Molecular Phylogeny of the Magnoliaceae: The Biogeography of Tropical and Temperate

Disjunctions
Author(s): Hiroshi Azuma, José G. García-Franco, Victor Rico-Gray and Leonard B. Thien
Source: American Journal of Botany, Vol. 88, No. 12 (Dec., 2001), pp. 2275-2285
Published by: Botanical Society of America
Stable URL: http://www.jstor.org/stable/3558389 .
Accessed: 23/08/2013 21:28

Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at .
http://www.jstor.org/page/info/about/policies/terms.jsp

.
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of
content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms
of scholarship. For more information about JSTOR, please contact support@jstor.org.

Botanical Society of America is collaborating with JSTOR to digitize, preserve and extend access to American
Journal of Botany.

http://www.jstor.org

This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM

All use subject to JSTOR Terms and Conditions
American Journalof Botany 88(12): 2275-2285. 2001.

MOLECULAR PHYLOGENY OF THE MAGNOLIACEAE:

THE BIOGEOGRAPHY OF TROPICAL AND
TEMPERATE DISJUNCTIONS'

HIROSHI AZUMA,2'5JosE G. GARCIA-FRANCO,3VICTOR RICO-GRAY,3

AND LEONARD B. THIEN4

2Departmentof Botany, GraduateSchool of Science, Kyoto University, Kyoto 606-8502, Japan;

3Departamentode Ecologia Vegetal, Institutode Ecologia, Xalapa, Veracruz91000, Mexico; and
4Departmentof Cell and Molecular Biology, Tulane University, New Orleans, Louisiana 70118 USA

The boreotropical flora concept suggests that relictual tropical disjunctions between Asia and the Americas are a result of the
expansion of the circumborealtropical flora from the middle to the close of the Eocene. Subsequently,temperatespecies diverged at
high latitudes and migratedto other continents. To test this concept, we conducted a molecular phylogenetic analysis (using cpDNA)
of the Magnoliaceae, a former boreotropicalelement that currentlycontains both tropical and temperatedisjuncts. Divergence times
of the clades were estimated using sequences of matK and two intergenic regions consisting of psbA-trnH and atpB-rbcL.Results
indicate the tropical American section Talaumabranchedfirst, followed by the tropical Asian clade and the West Indies clade. Within
the remaining taxa, two temperatedisjunctions were formed. Assuming the temperatedisjunction of Magnolia acuminata and Asian
relatives occurred25 mya (late Oligocene; based on seed fossil records), section Talaumadiverged 42 mya (mid-Eocene), and tropical
Asian and the West Indies clades 36 mya (late Eocene). These events correlate with cooling temperaturesduring the middle to late
Eocene and probably caused the tropical disjunctions.

Key words: boreotropicalflora; disjunction;Dugandiodendron;Magnolia; Magnoliaceae; matK;Splendentes; Talauma.

For over a century, distributionsof morphologicallysimilar
plants between eastern Asia and eastern North America dis-
juncts have been studied by scientists (Gray, 1846; Li, 1952;
Graham, 1972; Boufford and Spongberg, 1983; Wu, 1983).
The "Arcto-TertiaryGeoflora" theory was initially proposed
to explain the origin and evolution of these patterns(Engler,
1879; Chaney, 1947; Axelrod, 1960). This theory suggests a
homogenous early Tertiaryflora evolved in arctic regions and
subsequently migrated during the mid-Tertiaryto middle lati-
tudes in response to climatic changes. Additional fossil dis-
coveries and new geological discoveries, however, suggested
a more complex chain of events was needed to fully under-
stand the evolution of floras in the Northern Hemisphere in
the Tertiary (Tralau, 1963; Wolfe, 1975, 1978, 1980, 1997;
Tiffney, 1985a, b; Taylor,1990; Tanai, 1992; Mai, 1995; Man-
chester, 1999). Tiffney (1985a) suggested five major periods
of migration existed between eastern Asia and eastern North
America: pre-Tertiary,Early Eocene, Late Eocene-Oligocene,
Miocene, and Late Tertiary-Quaternary.He also noted that
most evergreen disjunct taxa (e.g., Magnoliaceae, Lauraceae,
and Theaceae) migratedduringthe Early Eocene throughboth
the Bering and North Atlantic routes and that many deciduous
lineages migratedduring the Miocene.
To account for these new discoveries, Wolfe (1975) pro-
posed the "BoreotropicalFlora" theory to explain the circum-
boreal early Eocene mixed heterogeneous floristic units (de-
ciduous and evergreen vegetation). This theory suggests that
1 Manuscriptreceived 20 March 2001; revision accepted 3 July 2001.
The authors thank Richard B. Figlar for providing materials and encour-
agement throughoutthis study; Itsuro Arakawa, Gustavo Lozano-Contreras,
Yin-Long Qiu, Wei-Bang Sun, and Saula Vodonaivalufor providingmaterials;
Minoru Tsukagoshi and Kazuhiko Uemura for useful advice regardingfossil
records; and the Instituto de Ecologfa, Xalapa, Mexico for providing funds
and facilities to collect leaves of Magnoliaceae in Mexico. This study was
financially supportedby JSPS Research Fellowships for Young Scientists.
I Author for
reprintrequests (e-mail: j52116@sakura.kudpc.kyoto-u.ac.jp).
2275
tropical(megathermal)floristic units appearedat high latitudes
in the NorthernHemispherein the early Tertiaryand that taxa
were exchanged with other areas via the Bering and/orNorth
Atlantic land bridge, resulting in a circumborealheterogenous
flora. A markedtemperaturedeteriorationoccurredat the end
of the Eocene (the terminal Eocene event), which caused the
tropicalelements to move south and disappearat high latitudes
(Wolfe, 1978, 1980, 1997; Collinson, Fowler, and Boulter,
1981; Graham, 1999). It should be noted that the movement
of the boreotropical flora to lower latitudes resulted in the
origin of disjunct tropical plants, as the climate following the
mid- to late Eocene did not warm to levels prevalent in the
early Eocene (Miller, Fairbanks, and Mountain, 1987), i.e.,
most tropical plants could not reach high enough latitudes
again and thereforecould not migrateto othercontinents(Tiff-
ney, 1985a; Wolfe, 1997).
Only a few studies have used molecularphylogenetic tech-
niques to study evolutionary patterns or estimate divergence
times of disjuncts, e.g., Liriodendron (Parks and Wendel,
1990); Magnolia section Rytidospermum(Qiu, Chase, and
Parks, 1995; Qiu, Parks, and Chase, 1995); Leguminosaesub-
family Papilionoideae tribe Robinieae and allies (Lavin and
Luckow, 1993; Lavin, 1995); Caulophyllum,Menispermum,
Penthorum, and Phryma (Lee et al., 1996); Symplocarpus
(Wen, Jansen, and Kilgore, 1996); Aesculus (Xiang et al.,
1998); Cornus, Boykinia, Tiarella, Trautvetteria,and Caly-
canthus (Xiang, Soltis, and Soltis, 1998); Hamamelis (Wen
and Shi, 1999), and Aralia section Dimorphanthus (Wen,
1999, 2000). These molecular analyses mainly focused on
temperatedisjunctions (deciduous and herbaceous taxa). Ac-
cording to Tiffney (1985a) and Wolfe (1997), most temperate
disjuncttaxa probablymigratedbetween continentsduringthe
Miocene or later via the Bering land bridge. Indeed, diver-
gence times estimatedby molecular analyses roughly correlate
with this scenario, although the divergence times (from 2 to

This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM

All use subject to JSTOR Terms and Conditions
2276 AMERICAN JOURNAL OF BOTANY
25 million years ago [mya]) are scatteredthroughoutthe Mio-
cene to the Pliocene (see Wen, 1999). The wide range of di-
vergence times suggests multiple migrationsoccurredbetween
the continents.
Animal migrationsalso indicate multiple migrations.Wood-
burne and Swisher (1995) indicate that ten major migrations
of land mammals between North America and Eurasia took
place during the Cenozoic Era. In addition, >30 minor dis-
persals occurred,involving a few land mammal taxa.
Although only a relatively small number of disjunct taxa
have been analyzed using molecular techniques (Wen, 1999),
they are concordantwith the scenario in Tiffney (1985a) and
Wolfe (1997) regardingtemperatedisjuncttaxa. This scenario,
however, also predicted another importantevent that has not
been tested, i.e., the origin of tropical disjunctions. As de-
scribed above, if tropical taxa are not recently derived from
regionally adjacent temperate taxa, then tropical disjunctions
are relicts of the boreotropical flora and would have been
formed during the middle to late Eocene
(--50-34in mya).
Extant species of Magnoliaceae are distributed temperate
and tropical Asia (two-thirds of the species) from the Hima-
layas to Japan and southeastwardthrough the Malay Archi-
pelago to the New Guinea area. The remainderof the family
is found in the Americas with tropical elements extending to
Brazil and the West Indies (Takhtajan,1969; Heywood, 1978;
Law, 1984; Nooteboom, 1993; Frodin and Govaerts, 1996). In
the late Cretaceousand Tertiary,the family occurredthrough-
out the NorthernHemisphere(Greenland,Alaska, and Europe;
Mai, 1995; Graham, 1999). The disjunct distributionof the
family in temperateand tropical areas provides an opportunity
to test the boreotropicalfloral concept using molecular tech-
niques. We would expect that tropical disjunct pairs of Mag-
noliaceae diverged during the middle to late Eocene and that
the temperatedisjunct pairs diverged after the Eocene, that is,
in the Oligocene, Miocene, or more recently.
Phylogenetic and phytogeographicstudies of temperatedis-
junct pairs of Magnoliaceae (Liriodendronand Magnolia sec-
tion Rytidospermum)indicate the late Miocene to early Plio-
cene to be the formationtime for these temperatedisjunctions
(Parks et al., 1983, 1994; Parks and Wendel, 1990; Qiu and
Parks, 1994; Qiu, Chase, and Parks, 1995; Qiu, Parks, and
Chase, 1995; Sewell, Parks, and Chase, 1996; Azuma, Thien,
and Kawano, 1999; Kim et al., 2001). In this study, we con-
duct a molecular phylogenetic analysis of Magnoliaceaeusing
chloroplastDNA sequence data and estimate divergencetimes
(calibrated with fossil seeds) of tropical and temperate dis-
junctions.
MATERIALSAND METHODS
Taxonomic background-According to Frodin and Govaerts (1996), Mag-
noliaceae is composed of 223 species of trees or shrubs classified into the
following seven genera; Elmerrillia Dandy (4 spp.), Kmeria Dandy (2 spp.),
LiriodendronL. (2 spp.), Magnolia L. (128 spp.), Manglietia Blume (29 spp.),
Michelia L. (47 spp.), and Pachylarnax Dandy (2 spp.). Within the family,
two well-defined monophyletic subfamilies are recognized: Liriodendroideae
(only Liriodendron) and Magnolioideae. Delimitation of genera, subgenera,
and sections in the subfamily Magnolioideae have been extremely controver-
sial, hence different taxonomic systems have been proposed for the Magno-
lioideae (Dandy, 1927, 1950, 1978; Lozano-Contreras, 1975, 1983; Law,
1984; Nooteboom, 1985, 1987, 2000; Chen and Nooteboom, 1993; Vizquez-
Garcia, 1994; Frodin and Govaerts, 1996). In fact, recent molecular phylo-
genetic studies do not supportthe monophyly of Magnolia (Qiu, Chase, and
Parks, 1995; Azuma, Thien, and Kawano, 1999; Kim et al., 2001).
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
[Vol. 88
For example, Law (1984) recognized two tribes, four subtribes, and 14
genera in the subfamily Magnolioideae.On the otherhand, Nooteboom (1985)
merged most genera recognized by Law (1984) into Magnolia or Michelia,
creating two tribes and six genera in the Magnolioideae and three subgenera
and 16 sections in the genus Magnolia. In addition,Nooteboom (1985) placed
section Manglietiastrum Noot. in the genus Magnolia subgenus Talauma
(Juss.) Pierre, but later it was placed in the genus Manglietia (Chen and
Nooteboom, 1993).
In New WorldMagnoliaceae, Lozano-Contreras(1975, 1983) describedthe
genus DugandiodendronLozano (14 spp.), distributedin Colombia and ad-
jacent areas.Lozano-Contreras(1975, 1983) suggested thatDugandiodendron
differs from other members of Magnoliaceae in the position of the flower and
in the prefoliation(arrangementor form of leaves) in the vegetative buds, but
Nooteboom (1985) did not adopt this idea and retainedit in the genus Mag-
nolia. In turn, Vfizquez-Garcia(1994) separated section Splendentes Dandy
ex A. Vaizquez,which is composed entirely of Caribbeanspecies from sect.
TheorhodonSpach, creating a new section of genus Magnolia. Section Splen-
dentes differs from members of section Theorhodonin stamen morphology
in that the connective apex is extended into a long setiform appendage(How-
ard, 1948; Vfizquez-Garcia,1994). Interestingly,the same Splendentes-type
stamen character is found in Dugandiodendron (Lozano-Contreras,1975,
1983) and section Aromadendron(BI.) Noot. (Nooteboom, 1987).
In this paper, we follow the taxonomic classification of Magnoliaceae by
Frodin and Govaerts (1996) for generic circumscriptionand scientific names.
We use the subgeneric and sectional treatmentsof Nooteboom (1985, 1987)
except for the following genera and section that we use for our convenience
in discussing taxa in this paper: Dugandiodendron,ManglietiastrumY. W.
Law., and section Splendentes in Magnolia. This and other voucher infor-
mation is archived at the Botanical Society of America website (http://
ajbsupp.botany.org/).
Disjuncts-There are three temperatedisjunct taxonomic groups in Mag-
noliaceae, i.e., Liriodendron [L. tulipifera L. in North America and L. chi-
nense (Hemsl.) Sarg. in China], Magnolia subgenus Magnolia section Ryti-
dospermum Spach [M. dealbata Zucc., M. fraseri Walt., M. macrophylla
Michx., and M. tripetala (L.) L. in North America to Mexico and the West
Indies, and M. obovata Thunb., M. officinalis Rehder et E. H. Wilson, and
M. rostrata W. W. Sm. in eastern Asia], and Magnolia subgenus Yulania
(Spach) Reichenbach section Tulipastrum(Spach) Dandy [M. acuminata(L.)
L. in North America and M. liliiflora Desr. in China]. Tropical disjunctionof
Magnoliaceae is found in the genus Magnolia subgenus Talauma in which
there are four sections (Nooteboom, 1985), i.e., sections Blumiana Blume (7
spp.), Aromadendron(5 spp.), and ManglietiastrumNoot. (1 sp., which is
treated as a genus in this study) in eastern to southeasternAsia, and section
TalaumaBaill. (31 spp.) in the tropical to subtropicalarea in the New World
(numbers of species are cited from Nooteboom, 2000). SoutheasternAsian
section Blumiana and American section Talauma are morphologically very
similar to one another (Nooteboom, 1985, 1987).
Plant materials, DNA extraction, amplification, and sequencing-Leaf
materials of a total of 60 accessions from all genera (except Pachylarnax),
including Manglietiastrumand Dugandiodendron, in Magnoliaceae and all
sections (except Aromadendron)in genus Magnolia were used in this study
(http://ajbsupp.botany.org/). Approximatelyone-half of the samples were pre-
viously utilized in an earlier phylogenetic analysis of temperate Magnolia
species (Azuma, Thien, and Kawano, 1999). ExtractedDNA of Manglietias-
trumsinica Y. W. Law. and KmeriaseptentrionalisDandy were providedfrom
W.-B. Sun and Y.-L. Qiu (University of Zurich). Recent molecular phyloge-
netic analyses indicates that Degeneriaceae and Himantandraceaeare more
closely related to Magnoliaceae than to other members of the Magnoliales,
i.e., Annonaceae, Eupomatiaceae,and Myristicaceae (Qiu et al., 1999; Soltis
et al., 2000). In this study, Degeneriaceae (Degeneria roseiflora J. M. Miller
and D. vitiensis Bailey et Smith) and Himantandraceae[Galbulimimabelgra-
veana (E Muell.) Sprague]were used as outgroupsfor Magnoliaceae.
The coding region of matKlocated between the two exons of the trnKgene
and two intergenic spacer regions of chloroplast DNA (psbA-trnHand atpB-
December 2001] AZUMA ET AL.-MOLECULAR PHYLOGENYOF MAGNOLIACEAE
TABLE1. Sequences and positions of newly designed primers for matK
region in this study. Positions of primers correspond to tobacco
cpDNA (GenBank accession number GBAN-Z00044; Shinozaki et
al. 1986).
Primers Sequence(5'->3') Positions
HMF1 GGAGGAATTACAAGGATATT 3656-3637
HMR1 TAGGGAAGATACTAATCGCA 3311-3330
HMF2 GGGTTTTGCAGTCATTATGG 3365-3346
HMR2 GGAGTAATGAGACTATTCGA 3069-3088
HMF3 TTCTTTCTCCACGAGTATCG 3112-3093
HMR3 GCCAGAATGGATTTTCCTTG 2790-2809
HMF4 CCTTTCATGCATTATGTCAG 2833-2814
HMR4 GGACCGACTTACTAATGGGA 2470-2489
HMF5 ATTTTGTAACGTATCAGGGC 2510-2491
HMR5 CGGAAAATATCCAAATACCA 2157-2176
rbcL) were sequenced as described by Azuma, Thien, and Kawano (1999). It
was not possible, however, to sequence the degraded DNA of material ob-
tained from some herbariumspecimens. In these taxa, only the matK region
was sequenced using five newly designed overlappingprimers(Table 1). Two
intergenic spacer regions of Degeneriaceae and Himantandraceaealso could
not be sequenced because of degraded DNA or primer mismatching.Details
of DNA amplificationand sequencing strategy of fresh leaves were described
by Azuma, Thien, and Kawano (1999). The amplificationand sequencing of
matK region from degraded DNAs is described below.
Total DNA was isolated from the dried leaves (1-2 g) using the modified
CTAB (cetyltrimethylammoniumbromide) method of Doyle and Doyle
(1987). Double-strandedDNA was amplified via 43 cycles in the polymerase
chain reaction (PCR), with primer sets correspondingto each region as fol-
lows: HMF1-HMR1, HMF2-HMR2, HMF3-HMR3, HMF4-HMR4, and
HMF5-HMR5 (Table 1). The PCR mixture (25 tiL) contained 1 I L of tem-
plate DNA, 200 lpmol/L each deoxynucleotide, 1 pimol/L each primer, 2.5
mmol/L MgCl2, GeneAmp PCR Gold Buffer (Perkin-ElmerApplied Biosys-
tems, Foster City, California,USA), and 0.6 units of AmpliTaqGold (Perkin-
Elmer Applied Biosystems). The initial cycle of the PCR reaction consisted
of 0.5 min at 940C for denaturation,1 min at 500C for primerannealing, and
1.5 min at 720C for primer extension, with a pre-PCR heat step (9 min) to
activate the AmpliTaq Gold in the first cycle. The last PCR cycle extended
for 10 min. The PCR was performed by the GeneAmp PCR System 9700
(Perkin-ElmerApplied Biosystems). The PCR productswere separatedon 1%
agarose gels and purified using the QIAquick Gel ExtractionKit (QIAGEN,
Hilden, Germany). If a sharp band of amplified DNA did not appearon the
gel stained with ethidium bromide (EtBr), additionalPCR was conducted us-
ing 1 jiL of the post-PCR mixture under the same condition. For sequencing,
purified DNAs were reacted with BigDye TerminatorCycle Sequencing
Ready Reaction (Perkin-ElmerApplied Biosystems). Sequencing was per-
formed by an ABI PRISM 377 DNA Sequencer (Perkin-ElmerApplied Bio-
systems).
Phylogenetic analysis-Sequence data were manually aligned. Indels (in-
sertion and/ordeletion) were scored as binary characters(0 or 1) except length
mutationsof poly A, T, or G tracks. These polynucleotide trackswere ignored
in all analyses. In addition, three short sequence inversions of 6 base pairs
(bp), 3 bp, and 2 bp within the matK coding region and one inversion of 6
bp within the psbA-trnHspacer region were excluded from the data matrices
(see Azuma, Thien, and Kawano, 1999).
Maximum parsimony (MP) analysis was conducted with PAUP*, 4.0 beta
version (Swofford, 2000). In addition, the neighbor-joining(NJ) and the max-
imum likelihood (ML) analyses were also performedfor a combined data set
with the same program.For MP analysis, a heuristic search was employed,
using equal weighting of the TBR (tree bisection reconnection)branch-swap-
ping option with MULPARS. One thousand bootstrap replications (Felsen-
stein, 1985) and decay analyses (Bremer, 1988) were conducted to measure
confidence levels of each branch.We used AutoDecay, version 4.0 (Eriksson,
1998) for the decay analysis. For NJ analysis, distance matrices were calcu-
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
2277
lated using the Kimura two-parameter(Kimura, 1980) with the transition/
transversionratio set at 2.0. In the ML analysis, ten replications of random-
addition sequence searches with TBR branch-swappingwere carriedout. The
option to collapse branches at zero length was activated. One hundredboot-
strap replications were conducted under the same condition. In the analysis
of a matK data set, Degeneria species were used as outgroups, whereas in
the analyses of other data sets, Liriodendronspecies were used as outgroups.
Estimation of divergence times-The molecular clock or rate-constancy
hypothesis is controversial(Kimura, 1983), and in plants, nucleotide substi-
tution rates are consideredto be influenced by life history characters(includ-
ing generation time; Bousquet et al., 1992). To estimate divergence time in
Magnoliaceae, a substitutionrate for matK gene sequences was calculated.
The rate-constancyof nucleotide substitutionsof the matK gene in Magnolia
was assessed using the relative rate test of Wu and Li (1985). The numberof
synonymous and nonsynonymoussubstitutionswere calculated using method
2 of Ina (1995) and computerprograms(Ina, 1995). In this test, Liriodendron
tulipifera was used as a reference taxon.
We surveyed the literaturefor fossil seed records of Magnolioideaeto cor-
relate divergence times of some lineages within the Magnolioideae with mo-
lecular data. Although fossil records of Magnolia-like leaves are abundant
throughoutthe NorthernHemisphere in the Tertiary(e.g., Tralau, 1963; Do-
rofeev et al., 1974; Hably, 1985; Uemura, 1988; Rember, 1991; Mai, 1995;
Liu, Guo, and Ferguson, 1996; Walther,1999), we only used seed characters
because foliar charactersof the Magnolioideae are shared with several other
families (Peigler, 1989; Collinson, Boulter, and Holmes, 1993; Mai, 1995).
Fossil seeds of Magnolia are common throughout the Tertiary in Europe.
However, fossils of modern Magnolia species become numerousin the late
Miocene (Nooteboom, 1993; Mai, 1995).
RESULTS
Molecular phylogenetic analysis-The aligned sequence
data matrix of the matK region of 60 accessions comprises
1460 charactersincludingthree indels (insertion/deletion).One
deletion was found in Dugandiodendron mahechae Lozano
and D. lenticellatum Lozano, and two indels were located in
Himantandraceaeand Degeneriaceae. This matrix lacks the
first 22 bp and 48 bp of the end region of the matK gene in
comparisonto the sequence in tobacco (Shinozakiet al., 1986;
GenBank accession number GBAN-Z00044). There are 113
(7.7%) variable sites among 1460 total characterswithin Mag-
noliaceae, of which 73 (5.0%) are informative.The most par-
simonious (MP) analysis of the matK data produced 174
equally most parsimonioustrees with 218 steps, a consistency
index (CI) (excluding uninformativecharacters)of 0.83, a re-
tention index (RI) of 0.92, and a rescaled consistency index
(RC) of 0.82. The 50% majority-ruleconsensus tree is shown
in Fig. 1-I. The MP tree indicates tropical American section
Talauma is monophyletic and ancestralwithin Magnolioideae
(Fig. 1-I). The clade, however, is supportedby relatively small
bootstrap and decay values. There are several clades within
the remaining clade, but phylogenetic affinities among them
are not conclusive (Fig. 1-I).
We also sequenced the trnK intron (-2500 bp in which
matKgene is located) andpsbA-trnHand atpB-rbcLintergenic
regions of 47 accessions to obtain more informativecharacters
(http://ajbsupp.botany.org/).The data matrix of the trnK in-
tron, including the matK region, consists of 2496 characters
with four indels. Among the 2496 characters,181 (7.3%) are
variable within Magnoliaceae, of which 112 (4.5%) are infor-
mative. The MP analysis of trnK intron generated99 equally
most parsimonious trees with 210 steps, CI excluding unin-
formative characters = 0.85, RI = 0.92, and RC = 0.83. A
2278 AMERICAN JOURNAL OF BOTANY [Vol. 88
level(X=19)
Ploidy
96 Man.decidua (?)
58 d=3 Man. insignis (2X)
s 62 6 Man. conifera (2X) Section 7 M. S. sieboldii
M. officinalis (2X) 100 M.s. sinensis
59M. obovata Rytidospermum 7.
d=1 64 (2)
M wilsonii
M. s. sieboldii (2X) 68 M.japonica
97 =1 M.s. sinensis (2X) M.tripetala
61 d-3 Ms japonica Oyama Man. decidua
Md=1 (2X) s 100 71
M.wilsonii (2X) Man.insignis
afK) d=1 M.virginiana-N (2X) Man.conifera
d=i M.virginiana-S
M.pacifica
(2X) Magnolia NJ tree M.obovata
97 (?) com ne M officinalis
SM. iltisiana () (combined)62 M.pacifica
d=1 M. yoroconte () 97 tiiana
93 M.guatemalensis (7)
SM.
d=4 sharpi Theorhodon 91 M. yoroconte
60 M. grandiflora (ex)
(7) 52 M. guatemalensis
d=1 M. tamaulipana (7) 52 M. sharpii
M.schiedeana (6X) 100 M.virginiana-N
7 M.kobus (2x) M. virginiana-S
d=2 M.stellata (2x) Buergeria M.grandiflora
59 M.
M. salicifolia
sargentiana (2X)
(6X) 60 M.tamaulipana
85 M.schiedeana
M.campbelii (6x) Yulania lOO l M.f. fraseri
. (53 52 M. denudata (4X,6X)i M. f. pyramidata
d=I M. liliiflora Tulipastrum
(2X,4X)
Tulipastrum M kobus
M.acuminata
M. nitida
(4x) 5 95 M.stellata
....................... E (2x) D Gynopodium
Kme.septentrionalis(?)
5
71 M.salicifolia
62 (66) sinicum(2X)
Manglietiastrum 75 M. denudata
54
d="1 M. carsonii (?) [ Maingola M. liliiflora
- M.cathcartii (2X) ] Alcimandra M.sargentiana
57 Mic.compressa (2X) M.acuminata
d=l -- Mic. figo (2X)M.suit
Mic.macclurei (2X) 1 IIyl99 100 Mic.Mic. mpressa
o compressa
Elm.ovalis (?) 1 fig
fgo
63 M. m. macrophylla
Mic.
Mic.
100 M.m. ashei
(2X)
(2X)
d=l M.nitida
d=6 M.dealbata (?) Rytidospermum 95 M.m. macrophylla
99 M.f. fraseri (2X) 100 M.m. ashei
d=4 d=4 M. f. pyramidata (2X) macclurer
LM. dealbata
64 M.portoricensis (?) Splendenes portorisensis
66 d=1
66ld= M.p
M. s ds plendens ) tes M.M. o isensis
d=l 62 s
Dug. mahechae (7) M.splendens
9
d=l lenticellatum (?) M Coco
85
d=2
Dug.
M.liliifera
M pterocarpa
(2X)
(2X)
I0 Blumiana
Lirianthe
-(X110) 99
delav iifera
M.M
100 95 coco 98 , M.delavayi
3M. (2X) dodecapetala
d>15d= M.delavayi (2x) Gwillimia 96 M . ovata
68 M. caricifragrans (?) I . M. mexicana
M. dodecapetala (7) M. minor
Aoo 92 Sd= M.ovata (2X) Talauma L.chinense
d 0d=3 M. mexicana (?) tulipifera 0.001
M.minor (?) L.
L tulipifer
100 r---L. chinense (2X)
. Magnolia
E subg.
d=10 L. tulipifera (2X,4X) N subg. Yulania
Gal.beleraveana (n=12) = subg. Talauma
Deg. vitiensis (2n =24) Man. decidua
Deg. roseiflora (1) Man.insignis
Man.conifera
P 65 M obovata
M.officinalis
63 62-- M. s. sieboldii
100 M.s. sinensis
M s. japonica
AIv nM.wilsonii
MwlM.s
M. tripetala
- 28 mya (late Oligocene) 98 M.pacifica
I M. iltisiana
(61 = M.guatemalensis
5 M M. M.sharpii

I
IlI
o
100
L •
M.M.
virginiana-N
virginiana-S
M.grandiflora
M.tamaulipana
ML tree 25 mya (late Oligocene) M.schiedeana
sple
(83DAl s kobus
M. M
(combined) stellata
M.saicifolia SubtroSrical Temperate
)69W
colbd 6 M.denudata
SM. sargentiana
- 36 mya (late Eocene) M. acuminata
I Mic. compressa
~J -- 10_i. __ Mic. macclurei
Mnitida

42 42 mya (mid
Eocene)00
(mid
mya
Eocene) M. m. macrophylla
M.m. ashei
GL M. dealbata
M.
*M. f. fraseri
AF f. pyramidata
- M. =100.FA is
r*(x10) splendens

' M. delavayi Tropical-

SM. dodecapetala Subtropical

L. tulipife ra
L-c h- -en- -

Fig. 1. Molecular phylogenetic trees based on matK coding region (tree I) and the combined data set of trnK intron, including matK coding region, psbA-
trnH, and atpB-rbcLintergenic regions (trees II and III). Numbers above branches are bootstrapvalues in 1000 (trees I and II) or 100 (tree III) replications.
Thick branchesindicate the New World taxa, and normal branches are the Old World taxa. Tree I: the 50% majority-ruleconsensus of 174 most parsimonious
(MP) trees based on matKsequence data of 60 accessions of Magnoliaceaeand outgroups(1460 characters,218 steps, consistency index excluding uninformative
characters= 0.83, retentionindex = 0.92). Numbers below the branches are the decay (d) indices. Dashed branches are not presented in the strict consensus
tree. Numbers within parenthesesbelow the dashed branchesindicate frequency of the branch.Ploidy level (Chen et al., 2000) and taxonomic treatmentwithin
subgeneric and sectional levels in the genus Magnolia are shown to the right of the taxon name. Tree II: the neighbor-joiningtree based on the combined data

This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM

All use subject to JSTOR Terms and Conditions
December 2001] AZUMA ET AL.-MOLECULAR PHYLOGENYOF MAGNOLIACEAE
strict consensus tree showed almost the same topology as gen-
erated by the matK data (tree not shown). The psbA-trnHdata
matrix consists of 455 charactersincluding four indels. There
are 62 (13.6%) variable characters within Magnoliaceae, of
which 32 (7.0%) charactersare informative. The MP analysis
of the psbA-trnHdata matrix generatedfour equally most par-
simonious trees (70 steps, CI excluding uninformativechar-
acters = 0.87, RI = 0.96, and RC = 0.89, tree not shown).
The data matrix of atpB-rbcL consists of 826 charactersin-
cluding five indels. There are 42 (5.1%) variable characters,
of which 20 (2.4%) charactersare informative.The MP anal-
ysis produced a single most parsimonious tree (44 steps, CI
excluding uninformativecharacters = 0.95, RI = 0.97, and
RC = 0.95, tree not shown). Phylogenetic resolutionsfor both
trees were low. To obtain a better-resolvedphylogenetic tree,
the sequences from these differentgene and noncodingregions
were directly combined because they are all from the chloro-
plast genome and thus there is no recombination.
The combined data matrix is composed of 3781 characters
including 13 indels. There are 284 (7.5%) variablecharacters,
of which 163 (4.3%) charactersare informative.The MP anal-
ysis generated 26 equally most parsimonioustrees (326 steps,
CI excluding uninformativecharacters= 0.85, RI = 0.93, and
RC = 0.84, tree not shown). The neighbor-joining(NJ) anal-
ysis generated a cladogrambasically concordantwith the MP
tree (Fig. 1-II). The most likelihood analysis (ML) produced
the tree with the best log-likelihood (-7610.11) obtainedfrom
examination of 19577 different trees, largely concordantwith
both MP and NJ trees (Fig. 1-III). In the ML tree, tropical
American section Talauma (clade A) branches first within
Magnolioideae, only weakly supportedby bootstrapanalysis.
The next clade (B) comprises three subclades, the tropical
Asian group [clade C with M. liliifera (L.) Baill. (section Blu-
miana), M. coco (Lour.)DC., and M. delavayi Franch.(section
Gwillimia DC.)], the West Indies section Splendentes (clade
D), and the temperate-subtropicalclade E, including two tem-
perate disjuncts (clades K and M). Phylogenetic relationships
among clades C, D, and E are not clearly resolved (Fig. 1-
III).
Estimation of divergence times-We conductedthe relative
rate test (Wu and Li, 1985) to check the rate-constancyof
nucleotide substitution of matK region among 57 accessions
of Magnoliaceae. Absolute numbers of synonymous sites in
matKregion were very low (2.95 sites on averagewithin Mag-
nolioideae), and there were no large differences between rates
of synonymous and nonsynonymous substitutions(0.0085 vs.
0.0067) within Magnolioideae.Therefore,we used the Kimura
two-parameterdistance across the whole matK region for the
test and detected no acceleratedor deceleratedlineages.
Fossil seed records (Tertiary)of subfamily Magnolioideae
are abundantthroughout the Northern Hemisphere (Fig. 2).
The morphological characteristicsof these fossils as well as
those of extant taxa are well documented (e.g., Mai, 1971,
1975; Dorofeev et al., 1974; Tiffney, 1977). Most extant taxa
of Magnolioideae produce ovate to asymmetrical seeds with
smooth (most Magnolia taxa) or rough coats (Manglietia and
set of 47 accessions of Magnoliaceae constructed by Kimura two-parameterdistances. Tree III: the maximum likelihood tree with the best log-likelihood
(-7610.11) generated from ten replications of random addition sequence searches. Estimated divergence times calculated from pairwise distances of matK
sequences are shown (solid arrows), assuming the disjunctionof subgenus Yulania (clade K) occurredat 25 mya (late Oligocene; a dashed arrow).
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
2279
Michelia and most taxa of section Talauma; Tiffney, 1977;
nos. 36-38, 41, 42 in Fig. 2). Othertaxa, i.e., sections Theor-
hodon, Magnolia, Tulipastrum,Buergeria (Siebold et Zucc.)
Baillon, and Yulania (Spach) Dandy, produce seeds with flat,
symmetrical, and cordiform to bean-like shapes (nos. 33-35,
39, 40), which are easily distinguishablefrom the ovate and
asymmetrical seeds (Tiffney, 1977; Fig. 2). Based on these
characters,we classified the fossil seeds into two categories in
North America and Eurasia (Fig. 2). Among extant taxa pro-
ducing flat and symmetricalseeds, those of sects. Theorhodon
(e.g., M. grandifloraL., no. 39) and Magnolia taxa are longer
than wide, while those of section Buergeria [e.g., M. kobus
DC. and M. stellata (Siebold et Zucc.) Maxim., nos. 33, 34]
are usually wider than long, and those of sections Tulipastrum
(e.g., M. acuminata, no. 40) and Yulania (e.g., M. denudata
Desr., no. 35) are slightly longer than wide or vice versa (Fig.
2; Tiffney, 1977).
Fossil seeds with flat and symmetricalshapes are abundant
from the middle Oligocene in Eurasia(Fig. 2). One fossil seed
taxon (Magnolia tiffneyi, no. 30) is known from Eocene de-
posits of western North America (Manchester,1994). The seed
fossils found in Eurasia(nos. 9b, 16-26) bear a greaterresem-
blance to those of subgenus Yulania (sects. Buergeria, Tuli-
pastrum, and Yulania) than those in sects. Theorhodon and
Magnolia. In addition, Tiffney (1977) described a fossil seed
taxon, Magnolia waltonii (no. 32), from the BrandonLignite
of North America (Fig. 2), considered to be early Miocene
(Tiffney, 1994). Magnolia waltonii is not directly comparable
to the seeds of any living taxa of Magnolia, but in some re-
spects there are similarities between M. waltonii and sections
Theorhodon and Tulipastrum(Tiffney, 1977). Figlar (1993)
examined a leaf fossil (the slope Magnolia) from the Miocene
Clarkia flora in North America (Idaho) that is comparableto
the leaves of extant Magnolia acuminata (section Tulipas-
trum).
Based on these fossil records, we consider the ancestrallin-
eage of subgenus Yulania (especially sect. Tulipastrum)to
have divergedin Eurasiaand North America duringthe middle
Oligocene to early Miocene (-30-20 mya). Molecular phy-
logenetic analysis indicates subgenus Yulaniais monophyletic
(clade K in Fig. 1-III) and that M. acuminata (sect. Tulipas-
trum) is the basal lineage. Therefore, we assume the disjunc-
tion of subgenus Yulania taxa (i.e., M. acuminata vs. Asian
relatives) occurredat 25 mya (late Oligocene; Fig. 1-III).
Average nucleotide substitutionrate of matK gene in sub-
genus Yulaniais estimated to be 9.95 X 10-11" 1.85 X 10-11
(M. acuminata vs. other taxa). Based on this rate, the diver-
gence time between tropicalAmerican section Talauma(clade
A) and other taxa (clade B) is estimated to be -42.0 _6.6
mya on average (Fig. 1-III). Divergence time between the oth-
er tropical groups (tropical Asian clade C and the West Indies
clade D) and temperate-subtropicalclade E is estimatedto be
35.6 ? 5.6 mya (Fig. 1-III). The divergence time between
anothertemperatedisjunct (M. tripetala vs. other taxa in clade
M) is estimated to be 27.9 4.4 mya (Fig. 1-III).
_
2280 AMERICAN JOURNAL OF BOTANY [Vol. 88

180 150 12090 30 0 30' 60' 120 150 180

75'
75"
I 5 r
,

6001 160' '

26 020-25
19
18
%19 )
31,32 917 8c,27
45 * 28-30 45'
1a8ba
18 sect. Lirianthe

- - --- -------- - ----- - sect. Splendentes

so

15I
30"
-.---,--.....
.. sect. Talauma sect. Gwillimia
sect. Blumiana
Blumiana
Dugandiodendron -sect.
o 0 0*

15 acMagnoliaceae
Magnoliaceae - (33- 38) .5' s

-_------30'
30'

North America Eurasia

ovate, asymmetrical flat, symmetrical ovate, asymmetrical flat, cordiform to bean-like
Extant taxa (subgenus-section)

LU
ctc M.acuminata(40) M.kobus (33)
bMan. garrettii(37) (Yulania-
macrophylla(42) (Yulania- (Yulania- M. stellata(34)
SM. (Magnolia- M.grandiflora(39) Tulipastrum) M. sieboldii(38) Buergeria) (Yulania-Buergeria)M.denudata (35)
M.mexicana (41 Rytidospermum) (Magnoia-Theorhodon) M. liliifera(36) (Magnolia-Oyama) (34)
(Yulania-Yulania)
(Talauma-Talauma)Rytidospermum) (Magnolia-Theorhodon) (Talaumalumiana)nia-Yulania)
Talauma-Blumiana)
MY
PLEISTOCENE
PLIOCENE
5- M kobus(I8a, 18c)
obovata (27): )M. cor (16)
10 M. "
,,"3

M. kireevskiana (23)
15- MIOCENE lilistellata(22) M. lusatica (17)
M. burseracea (9b)
20
M. obensis (21)

Man.germanica(14) M. denudatiformis(24) M. uralensis (26)

25- M.waltonii
(32) M burseracea
M.parthensis(15) burseracea(9a)
(9a)
M.septentrionalis(31)
LGOCENE
30 M.parvisperma(25)
M. baltica(19)
M burseracea (11)
cf.
35- Man.zinkeisenii(13)

Man.hercynica
(10Oa)
EOCENE

45 E45 ENE M.lobata(2)

M. subquadrangularis(3) M. subcircularis(7)
M. muldoonae (28) Mcrassa (4)
50- M.paroblonga(29)
(30)
Sffneyi M.angusta
(6)
M. subtriangularis (5) •M. o
longissima (1) T. wilkinsoni (8)
K9..1Crn
55-
seed surface
60 PALEOCENE Man. (12) O smooth
multicostata
Man.hercynica(10c) i O roughor striate
65
CRETACEOUS Man.hercynica(10b)

Fig. 2. Outline of fossil seeds assigned to Magnoliaceaewith ages and localities. The localities (NorthAmericanor Eurasian),forms (ovate and asymmetrical
or flat and symmetricalwith cordate to bean-like), and seed surface (smooth, rough, or striate) are noted. Seed shapes of some extant taxa are also presented.
Distributionsof extant Magnoliaceae and tropical taxonomic groups are also illustratedon the world map. References for fossil taxa: 1-7, Reid and Chandler
(1933); 8, Chandler(1964); 9a, Mai and Walther(1991); 9b, 16, 17, Mai (1975); 10a, Mai and Walther(1985); 10b, Knobloch and Mai (1986); 10c, 13, 14,
Mai (1971); 11, Mai and Walther(1978); 12, Mai (1987b); 15, Mai (1987a); 18a, 18b, Tralau(1963); 18c, Tsukagoshi, Ono, and Hashimoto (1997); 19, 26,
Dorofeev et al. (1974); 20, Dorofeev (1959) or Dorofeev et al. (1974); 21-24, Dorofeev (1960b) or Dorofeev et al. (1974); 25, Dorofeev (1960a) or Dorofeev
et al. (1974); 27, Tsukagoshi and Todo CollaborativeResearch Group (1995); 28-30, Manchester(1994); 31, 32, Tiffney (1977). References for extant taxa:
33, 35, 38, Dorofeev et al. (1974); 34, 40, 42, Mai (1975); 36, 37, Kyoto University Herbarium(KYO); 39, Tiffney (1977); 41, authors' collection (from
Xalapa, Mexico).

This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM

All use subject to JSTOR Terms and Conditions
December 2001] AZUMAET AL.-MOLECULARPHYLOGENY
OF MAGNOLIACEAE 2281

DISCUSSION indicate section Rytidospermumrepresentsa para-or polyphy-

Circumscription of tropical disjunct groups-Molecular
phylogenetic analyses in this study show that there are three
phylogenetic clades of tropical-subtropicaltaxa in Magnoli-
aceae. The first is the tropical American section Talauma
(clade A in Fig. 1-III), which is widely distributedin the trop- glietia clade (clade P). The genus Manglietia (29 spp., all
ical-subtropicalarea of the Americas (Fig. 2) and is the an-
cestral lineage within the Magnolioideae. The second is the
tropical Asian group (clade C), composed of three sections,
Blumiana, Gwillimia, and Lirianthe (Spach) Dandy (Fig. 1-I
and III), which is distributed from the Himalayas to south-
eastern Asia (Fig. 2). The third is the West Indies taxon (sec- false whorls on the ends of shoots. The feature is found only
tion Splendentes,clade D) which is closely relatedto the Col-
ombian taxon, Dugandiodendron(Fig. 1-I).
Although section Blumiana is placed in the subgenus Ta-
lauma and separatedfrom the two other sections in subgenus
Magnolia (sections Gwillimia and Lirianthe),it is morpholog-
ically indistinguishablefrom the other taxa except in the de-
hiscence of fruits (Nooteboom, 1985). Section Gwillimia and
monotypic section Lirianthe are also morphologicallyclosely
related and can also be distinguished only by fruiting char-
acters (short beaks vs. long beaks; Nooteboom, 1985). Thus,
the close affinity among these Asian sections is supportedby
morphologicalcharactersas well as by molecularphylogenetic
analysis.
Section Aromadendron,not included in this study, is taxo-
nomically placed in the subgenus Talauma and is morpholog-
ically closely related to sect. Blumiana (Nooteboom, 1985,
1987). A recent molecular study, however, indicates that sect. analysis, however, does not support this monophyly, but in-
Aromadendrondoes not show a close affinity to other sections
of subg. Talauma. Instead, it is the sister group to sect. Alci- M. liliiflora) of subgenus Yulania(clade K in Fig. 1-III). The
mandra (Dandy) Noot. [M. cathcartii (Hook. f. et Thomson)
Noot.] of subg. Magnolia, hence this Aromadendron/Alciman-
dra clade is sister to the genus Michelia-section Maingola
clade (Kim et al., 2001).
Although Dugandiodendron and section Splendentes are
separatelyrecognized and assigned to differentsections or sub-
genera, the close affinity between them is also suggested by
their stamen morphology, with the connective apex extended
into a long setiform appendage (see Howard, 1948; Lozano-
Contreras, 1975, 1983; Vaizquez-Garcia,1994). The tip em-
beds in the gynoecium, and then the stamens abscise at the
base in section Splendentes (Howard, 1948; Vaizquez-Garcia,
1994). The long setiform appendage,however, is not unique,
as most Aromadendrontaxa have a similarsetiformappendage
atop the stamens (Nooteboom, 1987).
Morphological studies supporta sister relationshipbetween
tropical American section Talauma and tropicalAsian section
Blumiana (Nooteboom, 1985, 1987). The molecular phyloge-
netic analysis, however, does not supportthis conclusion but
ratherindicates the tropical Asian clade (including Blumiana,
clade C in Fig 1-III) might form a sister relationship with
another tropical American lineage, the West Indies group
(clade D, and perhaps with Dugandiodendron;see Fig. 1-I).
Although a direct sister relationshipbetween the tropicalAsian
group and the West Indies is not shown, we can conclude that
a tropical disjunction of Magnoliaceae occurs between the
tropical Asian and the West Indies taxa (and Dugandioden-
dron).
Circumscription of temperate disjunct groups-Present
and previous molecular phylogenetic studies of Magnoliaceae mya (middle Eocene), in which the tropical Americansection
letic lineage (Qiu, Chase, and Parks, 1995; Azuma, Thien, and
Kawano, 1999; Kim et al., 2001; see Fig. 1). The disjunction
is found in clade M (in Fig. 1-III), which is composed of
Magnolia tripetala (North American taxon), Asian section
Oyama Nakai taxa (clade 0), and Asian Rytidospermum-Man-
Asian taxa) is taxonomically separated from Magnolia by
numberof ovules (four or more) per carpel and leaf anatomical
characters (Nooteboom, 1985, 1993). However, other taxo-
nomic features are comparableto those found in genus Mag-
nolia, especially in the way the leaves are often arrangedin
in section Rytidospermumand genus Manglietia. The close
affinity between Asian Rytidospermumand Manglietia may be
reliable, althoughthe affinity is weakly supportedby bootstrap
analysis (Fig. 1).
The relationshipbetween section Oyama clade and M. tri-
petala or Asian Rytidospermum-Manglietiaclade is not sup-
ported by morphologicalcharacters.Morphologicalcharacters
need to be reevaluatedto supportthis relationship.Close af-
finity between M. tripetala and Asian membersof section Ry-
tidospermum(but not with other American members of that
section) is found in seed and fruit morphologies (Qiu, Chase,
and Parks, 1995). However, this study does not supporta direct
sister relationshipbetween the taxa (Fig. 1).
Section Tulipastrum(subgenus Yulania)with only two spe-
cies (M. acuminata in North America and M. liliiflora in Chi-
na) has been traditionallyrecognized as a disjunct.Molecular
dicates M. acuminatais sister to all Asian members(including
section Tulipastrumis taxonomicallyseparatedby the sepaloid
tepals, the flowering after leaf emergence, and the color of
tepals (Nooteboom, 1985). However, these charactersare not
important because they appearin other members of subgenus
Yulania [e.g., petaloid sepals in M. salicifolia (Siebold et
Zucc.) Maxim., and flowering at the time of leaf emergence
in M. kobus]. Although floral charactersof M. acuminata are
relatively distinct among subgenus Yulaniataxa, i.e., relatively
small flower and yellow-greenish and narrow tepals, Asian
members of subgenus Yulania possess no commonly recog-
nized morphologicalcharacter.
Biogeographical implications-The origin of the family
Magnoliaceae and divergence of the subfamilies Liriodendro-
ideae and Magnolioideae extends back - 100 mya (Late Cre-
taceous). For example, multifollicularfruits (Archaeanthuslin-
nenbergeri) and associated leaves, tepals, and stipular bud
scales are known from the Late Cretaceous (-95 mya) in the
Dakota Formationof centralKansas,USA (Dilcher and Crane,
1984). The floral structureof the Archaeanthusis comparable
to that of extant Magnoliaceae and is considered to be an an-
cestor or a lineage closely related to Magnoliaceae (Peigler,
1989; Friis, Crane, and Pedersen, 1997; Crane, 1998).
Despite the long history of Magnoliaceae, diversificationof
extant taxa within the subfamily Magnolioideae seems to have
occurred recently, as indicated by the long branch between
Liriodendroideae(only Liriodendron)and Magnolioideae(Fig.
1). The phylogenetic tree of the combined sequence data in-
dicate that divergence within Magnolioideae occurredat -42

This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM

All use subject to JSTOR Terms and Conditions
2282 AMERICAN JOURNAL OF BOTANY
Talauma branchedoff first, and then both tropical Asian and
the West Indies groups diverged (Fig. 1-II and III).
According to paleobotanical and geological evidence, the
early Eocene (50-54 mya) was the warmestperiod in the Ter-
tiary, and the boreotropicalflora (including an ancestralline-
age of Magnolioideae) circumboreallyspreadat high latitudes
in the NorthernHemisphere (Reid and Chandler,1933; Chan-
dler, 1964; Wolfe, 1978, 1997; Collinson, Fowler, and Boulter,
1981; Miller, Fairbanks,and Mountain, 1987; Graham, 1999;
see Fig. 2). The paleobotanicalevidence indicates that in the
late early and early middle Eocene (50-48 mya) a significant
cooling occurred,followed by two warm intervals (46-43 and
37-34 mya) separatedby a cool interval (42-38 mya) in the
middle to late Eocene (Wolfe, 1978, 1997). Oxygen isotope
records also suggest very warm temperaturesin the early Eo-
cene, but cooling temperaturesduring the middle to late Eo-
cene proceeded with small fluctuations(Miller,Fairbanks,and
Mountain, 1987). The cooling events might have caused
movement of the boreotropical floral elements to the lower
latitudes, leading to disjunction of ancestral lineages of mod-
ern tropical plants between North America and Eurasia.
The molecular phylogenetic analysis indicates tropical
American section Talauma (clade A in Fig. 1-III) diverged at
--42 mya (middle Eocene). In addition, the tropical Asian
group (clade C) may be the most ancestrallineage within the
remaining clade B because the sequence distance between
tropical Asian clade C and clade E (0.0076) is greater than
between the West Indies clade D and clade E (0.0063; see Fig.
1-II). Therefore, the cool interval (42-38 mya) at the middle
to late Eocene seems to have led to the diversificationor dis-
junction between North America (tropical American section
Talauma)and Eurasia(or clade B). In thatperiod, southeastern
Alaska's vegetation supporteda temperate(mesothermal)flora
(Wolfe, 1972), suggesting difficulty of interchangesfor tropi-
cal elements between the continents. However, temperature
fluctuationduring the middle to late Eocene (46-34 mya) may
have enabled northernparts of the divided tropical floras to
interchangebetween the continentsvia the North Atlanticand/
or the Bering land bridge during the warm intervals. Indeed,
fossil records of land mammals indicate that intercontinental
migrations occurred twice during the Eocene (at 43 and 36
mya; Woodburneand Swisher, 1995), which are concordantin
time with the two warm intervals inferredfrom the paleobo-
tanical records (Wolfe, 1978).
The molecular phylogenetic analysis indicates that diver-
gence and disjunction of tropical Asian and the West Indies
groups (clades C and D) occurred at -36 mya (late Eocene).
The warm interval (37-34 mya) in the late Eocene therefore
might have promptedintercontinentalmigrationof the divided
lineage of Magnolioideae (clade B), and subsequent cooling
by 33 mya may be responsible for the disjunction between
clades C and D.
Paleobotanical evidence suggests major climate deteriora-
tion occurredat 33 mya (the TerminalEocene Events) leading
to a high rate of extinction in lineages and eliminationof trop-
ical elements from most areas of North America and Europe
(Wolfe, 1978, 1997). The molecular phylogenetic analysis
could not resolve phylogenetic affinities among most temper-
ate-subtropicalclades (within clade E in Fig. 1-III). Diversi-
fication of temperate-subtropicalclades (clade E) seems to
have occurred near the time of major climate deteriorationat
33 mya (Fig. 1-III), and perhapsthe extinction of tropicaltaxa
obscured relationshipsamong temperatelineages and/orrapid
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
[Vol. 88
speciation of temperatetaxa took place. After the 33-mya cli-
matic deterioration,temperaturebegan to fluctuate and five
warm-cool intervals took place between early Oligocene and
middle Miocene (--34-15 mya). The temperature,however,
did not reach the level of the early Eocene (Miller,Fairbanks,
and Mountain, 1987; Wolfe, 1997). The fluctuation of tem-
peraturemay have allowed temperateelements to migratebe-
tween continents during warm intervals. Indeed, estimated
times of disjunctions of temperatelineages of Magnolioideae
(at 28 and 25 mya) correlatewith this scenario.
Comparison withprevious studies of temperatedisjunction
in Magnoliaceae-Parks and Wendel (1990) show the diver-
gence time of Liriodendrontulipifera and L. chinense to be
10-16 mya (middle to late Miocene) based on molecularanal-
ysis (allozyme and RFLP [restriction fragment length poly-
morphism] analysis of cpDNA) and paleobotanicalevidence.
However, if a substitutionrate calculated in this study is em-
ployed to estimate the time of disjunction (relative rate tests
for these taxa were not conducted because they were used as
reference taxa in the test), L. tulipifera and L. chinense di-
verged at 27.9 t 4.4 mya. Similarly, Qiu, Parks, and Chase
(1995) suggested the divergence time of M. tripetala and M.
hypoleuca Siebold et Zucc. (M. obovata in this study; both
deciduous taxa in section Rytidospermum)to be 4.1-5.5 or 1.9
mya using allozyme data and 1.7 + 0.8 mya using RFLP data
of cpDNA. This suggests the disjunction occurred in the late
Miocene to early Pliocene (6-5 mya). The divergence time
between M. tripetala and Asian relatives in our study (clade
M in Fig. 1-III)was estimatedto be 27.9 + 4.4 mya. However,
if only the two taxa (M. tripetala and M. obovata) are com-
pared as in Qiu, Parks, and Chase (1995), the divergence time
is estimated to be 20.9 ? 3.3 mya.
The estimation of divergence times conducted in this study
strictly relies on fossil records adopted as an independentes-
timate. Therefore, the accuracy of assignment and incidental
occurrenceof the fossil records as well as variationof molec-
ular evolutionaryrate and patternof extinction in a clade will
affect the estimation and may be responsible for different es-
timations between previous and present studies.
The molecular phylogenetic tree constructedfrom cpDNA
sequence data shows mostly maternal phylogeny and would
miss tracingthe tangled phylogeny that would occur in a clade
composed of polyploid taxa. Polyploidy is known in several
lineages of Magnoliaceae (Chen et al., 2000), especially in
subgenus Yulania and section Theorhodonin genus Magnolia
(Fig. 1-I). If reticulate evolution took place in the polyploid
clade, the cpDNA phylogeny may obscureevents thatoccurred
in lineages and would then affect the estimated divergence
time.
Recently, Kim et al. (2001) conducted a molecular phylo-
genetic analysis of Magnoliaceaecovering all genera and sec-
tions (total 99 taxa of 223 species) using ndhF sequence data.
Generally, the topology of the ndhF tree is concordantwith
that of the tree constructedin this study. However, the ndhF
tree indicated the clade of M. macrophylla and M. dealbata
(North Americantaxa of section Rytidospermum)was basal in
the subfamily Magnolioideae, but supportedby a very low
bootstrap value (39%). Qiu, Parks, and Chase (1995) also
showed the same relationship. On the other hand, our study
shows that the tropical American group (section Talauma)is
at the base, and then the tropical Asian group and the West
Indies group diverged in the subfamily but with relatively low
December 2001] AZUMA ET AL.-MOLECULAR PHYLOGENYOF MAGNOLIACEAE
bootstrapvalues (Fig. 1). To clarify this discordanceand phy-
logenetic relationshipin unresolved clades, a sequence matrix
combined with multiple genes and noncoding regions should
be analyzed.
Other examples of tropical disjunction of Laurasian
taxa-The Illiciaceae, with -42 species, are distributed in
southeastern Asia, southeastern United States plus eastern
Mexico, and the West Indies (Smith, 1947). Molecular phy-
logenetic analysis of ITS sequence data of 15 species (not
including Caribbean species) indicated the North American
species (2 spp.) and the remainingeast Asian species separated
first, suggesting the age of disjunction is relatively old (Hao,
Saunders,and Chye, 2000). Fossil records of seeds and fruits
of Illiciaceae are found in Europe and North America from
the Paleocene to the Miocene (Mai, 1970; Tiffney and Bar-
ghoorn, 1979; Friis, Crane, and Pedersen, 1997). Therefore,
the disjunction of the Illiciaceae suggests it also representsa
relict of the boreotropicalflora like Magnoliaceae.
Both Illiciaceae and Magnoliaceae are ancient Laurasian
taxa extending to the early Cretaceous. However, membersof
Illiciaceae are not present in South America unlike taxa of
Magnoliaceae (Dugandiodendronand Talauma). For most of
the Tertiaryand much of the Cretaceous, South America was
essentially an island continent (Gentry, 1982). Magnoliaceae
is one of the few Laurasianelements thatinvaded South Amer-
ica via the PanamanianIsthmusafter Pliocene or via the proto-
Antillean chain (GAARlandia) during the Tertiary (Gentry,
1982; Iturralde-Vinentand MacPhee, 1999), which probably
resulted in rapid speciation in American Talaumaand Dugan-
diodendron.
In regard to the southward distribution of Magnoliaceae
(New Guinea and Brazil), we could not eliminate a possibility
of migrationvia the SouthernHemisphere (Cox, 1990). How-
ever, the present and past (fossil) distributionpatternsof Mag-
noliaceae do not supportthis hypothesis.
Conclusion-The boreotropicalflora concept suggests that
tropical disjuncts have occurredduring the middle to late Eo-
cene prior to the disjunctions of temperate taxa (Tiffney,
1985a; Wolfe, 1997). Molecularphylogenetic analysis and fos-
sil evidence of Magnoliaceae clearly show the tropical dis-
junction occurred during the middle to late Eocene and that
the temperatedisjunction occurredin the Oligocene, which is
concordantwith the boreotropicalfloraconcept. Thereare only
two examples of molecular analyses on the intragenericlevel
of tropicaldisjunction(Magnoliaceae and Illiciaceae) and both
indicate the tropical disjunctions are ancient.
LITERATURECITED
AXELROD, D. I. 1960. The evolution of flowering plants. In S. Tax [ed.],
Evolution after Darwin, vol. 1, The evolution of life, 227-305. The Uni-
versity of Chicago Press, Chicago, Illinois, USA.
AZUMA, H., L. B. THIEN, AND S. KAWANO. 1999. Molecular phylogeny of
Magnolia (Magnoliaceae) inferred from cpDNA sequences and evolu-
tionary divergence of the floral scents. Journal of Plant Research 112:
291-306.
BOUFFORD, D. E., ANDS. A. SPONGBERG. 1983. EasternAsian-easternNorth
American phytogeographicalrelationships: a history from the time of
Linnaeusto the twentiethcentury.Annals of the Missouri Botanical Gar-
den 70: 423-439.
BOUSQUET, J., S. H. STRAUSS, A. H. DOERKSEN, ANDR. A. PRICE.1992.
Extensive variation in evolutionary rate of rbcL gene sequences among
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
2283
seed plants. Proceedings of the National Academy of Sciences, USA 89:
7844-7848.
BREMER,K. 1988. The limits of amino acid sequence data in angiosperm
phylogenetic reconstruction.Evolution 42: 795-803.
CHANDLER, M. E. J. 1964. The lower Tertiary floras of southern England.
IV. A summary and survey of findings in the light of recent botanical
observations. British Museum (NaturalHistory), London, UK.
CHANEY, R. W 1947. Tertiary centers and migration routes. Ecological
Monographs 17: 139-148.
CHEN, B. L., AND H. P. NOOTEBOOM. 1993. Notes on Magnoliaceae III: the
Magnoliaceae of China. Annals of the Missouri Botanical Garden 80:
999-1104.
CHEN,Z., X. HUANG, R. WANG, ANDS. CHEN.2000. Chromosome data of
Magnoliaceae. In Y. Liu et al. [eds.], Proceedings of the International
Symposium on the Family Magnoliaceae, 192-201. Science Press, Bei-
jing, China.
COLLINSON, M. E., M. C. BOULTER, ANDP. L. HOLMES. 1993. Magnoliophyta
(Angiospermae). In M. J. Benton [ed.], The fossil record 2, 809-840.
Chapmanand Hall, London, UK.
COLLINSON, M. E., K. FOWLER, ANDM. C. BOULTER. 1981. Floristicchanges
indicate a cooling climate in the Eocene of southern England. Nature
291: 315-317.
Cox, C. B. 1990. New geological theories and old biogeographycalproblems.
Journal of Biogeography 17: 117-130.
CRANE,P. R. 1998. The phylogenetic position and fossil history of the Mag-
noliaceae. In D. Hunt [ed.], Magnolias and their allies, 21-36. David
Hunt, Milborne Port, UK.
DANDY,J. E. 1927. The genera of Magnolieae. Bulletin of Miscellaneous
Information(Royal Botanic Gardens,Kew) 7: 257-264.
DANDY,J. E. 1950. A survey of the genus Magnolia togetherwith Manglietia
and Michelia. In P M. Synge [ed.], Camellias and Magnolias: reportof
the conference held by the Royal HorticulturalSociety, 64-81. Royal
HorticulturalSociety, London, UK.
DANDY,J. E. 1978. A revised survey of the genus Magnolia together with
Manglietia and Michelia. In N. G. Treseder [ed.], Magnolias, 29-37.
Faber and Faber,London, UK.
DILCHER, D. L., ANDP R. CRANE.1984. Archaeanthus:an early angiosperm
from the Cenomanianof the western interior of North America. Annals
of the Missouri Botanical Garden 71: 351-383.
DOROFEEV, P. I. 1959. Ob oligotsenovoi flore s. kozyulino v ustye r. tomi.
Doklady Akademii nauk SSSR 127: 1103-1105 (in Russian).
DOROFEEV, P. I. 1960a. Ob oligotsenovoi flore dunaevskogo yara na r. tym
v zapadnoi sibiri. Doklady Akademiinauk SSSR 132: 659-661 (in Rus-
sian).
DOROFEEV, P. I. 1960b. Novye dannyeo tretichnykhflorakhkireevskogoyara
na obi. Doklady Akademii nauk SSSR 133: 211-213 (in Russian).
DOROFEEV, P. I., S. ILJINSKAJA, N. IMCHANITZKAJA, T. KOLESNIKOVA, E.
KUTUZKINA, I. SHILKINA, N. SNIGIREVSKAYA, I. SVESHNIKOVA, AND S.
ZHILIN.1974. Magnoliaceae-Eucommiaceae.In A. Takhtajan[ed.], Fos-
sil flowering plants of the USSR, vol. 1. Nauka, Leningrad,Russia (in
Russian).
DOYLE, J. J., AND J. L. DOYLE.1987. A rapid DNA isolation procedurefor
small quantitiesof fresh leaf tissue. PhytochemistryBulletin 19: 11-15.
ENGLER, A. 1879. Versuch einer Entwicklungsgeschichteder Pflanzenwelt,
inbesondere der Florengebiete seit der Tertidirperiode.1. Die extratro-
pischen Gebiete der Ntirdlichen Hemisphiire.Verlag von Wilhelm En-
gelmann, Leipzig, Germany.
ERIKSSON, T. 1998. AutoDecay, version 4.0 (programdistributedby the au-
thor). Bergius Foundation,Royal Swedish Academy of Sciences, Stock-
holm, Sweden.
FELSENSTEIN,J. 1985. Confidence limits on phylogenies: an approachusing
the bootstrap.Evolution 39: 783-791.
FIGLAR,R. B. 1993. Stone Magnolias. Arnoldia 53: 2-9.
FRIIS, E. M., P. R. CRANE, AND K. R. PEDERSEN. 1997. Fossil history of
magnoliid angiosperms.In K. Iwatsukiand P H. Raven [eds.], Evolution
and diversificationof land plants, 121-156. Springer-VerlagTokyo, To-
kyo, Japan.
FRODIN, D. G., AND R. GOVAERTS. 1996. World checklist and bibliography
of Magnoliaceae. Royal Botanic Gardens, Kew, UK.
GENTRY, A. H. 1982. Neotropical floristic diversity: phytogeographicalcon-
nections between Central and South America, Pleistocene climatic fluc-
tuations, or an accident of the Andean orogeny? Annals of the Missouri
Botanical Garden 69: 557-593.
2284 AMERICAN JOURNAL OF BOTANY
GRAHAM, A. 1972. Outline of the origin and historicalrecognition of floristic
affinities between Asia and eastern North America. In A. Graham[ed.],
Floristics and paleofloristics of Asia and eastern North America, 1-18.
Elsevier, Amsterdam,The Netherlands.
GRAHAM, A. 1999. Late Cretaceousand Cenozoic history of North American
vegetation, north of Mexico. Oxford University Press, New York, New
York, USA.
GRAY,A. 1846. Analogy between the Flora of Japan and that of the United
States. American Journal of Science and Arts Second Series 2: 135-136.
HABLY,L. 1985. Catalogue of the HungarianCenozoic leaf-flora.Studia Bo-
tanica Hungarica 18: 5-58.
HAO,G., R. M. K. SAUNDERS, ANDM.-L. CHYE.2000. A phylogenetic anal-
ysis of the Illiciaceae based on sequences of internaltranscribedspacers
(ITS) of nuclear ribosomal DNA. Plant Systematics and Evolution 223:
81-90.
HEYWOOD, V. H. 1978. Flowering plants of the world. Oxford University
Press, London, UK.
HOWARD, R. A. 1948. The morphology and systematics of the West Indian
Magnoliaceae. Bulletin of the Torrey Botanical Club 75: 335-357.
INA, Y. 1995. New methods for estimating the numbersof synonymous and
nonsynonymous substitutions.Journal of Molecular Evolution 40: 190-
226.
ITURRALDE-VINENT, M. A., ANDR. D. E. MACPHEE. 1999. Paleogeography
of the Caribbeanregion: implications for Cenozoic biogeography. Bul-
letin of the American Museum of Natural History Number 238. Ameri-
can Museum of NaturalHistory, New York, New York, USA.
KIM,S., C.-W. PARK,Y.-D. KIM,ANDY. SUH.2001. Phylogenetic relation-
ships in family Magnoliaceae inferred from ndhF sequences. American
Journal of Botany 88: 717-728.
M. 1980. A simple method for estimatingevolutionaryrates of base
KIMURA,
substitutionsthrough comparablestudies of nucleotide sequences. Jour-
nal of Molecular Evolution 16: 111-120.
KIMURA,M. 1983. The natural theory of molecular evolution. Cambridge
University Press, London, UK.
KNOBLOCH, E., ANDD. H. MAI. 1986. Monographieder Friichteund Samen
in der Kreide von Mitteleuropa.Rozpravytistrednihotistavugeologicke-
ho 47: 1-219.
LAVIN,M. 1995. TribeRobinieae and allies; model groups for assessing early
Tertiarynorthernlatitudediversificationof tropicallegumes. In M. Crisp
and J. J. Doyle [eds.], Advances in legume systematics 7. Phylogeny,
141-160. Royal Botanical Gardens, Kew, UK.
LAVIN,M., AND M. LUCKOW.1993. Origins and relationships of tropical
North America in the context of boreotropical hypothesis. American
Journal of Botany 80: 1-14.
LAW,Y.-W.( LIU,Y.-H.). 1984. A preliminarystudy on the taxonomy of the
family Magnoliaceae.Acta PhytotaxonomicaSinica 22: 89-109 (in Chi-
nese).
LEE,N. S., T. SANG,D. J. CRAWFORD, S. H. YEAU,ANDS.-C. KIM. 1996.
Molecular divergence between disjunct taxa in eastern Asia and eastern
North America. American Journal of Botany 83: 1373-1378.
LI, H.-L. 1952. Floristic relationshipsbetween easternAsia and easternNorth
America. Transactionsof the American Philosophical Society, New Se-
ries 42: 371-429.
LIu, Y. S., S. Guo, AND D. K. FERGUSON. 1996. Catalogue of Cenozoic
megafossil plants in China. Palaeontographica Abteilung B Paldiophy-
tologie 238: 141-179.
LOZANO-CONTRERAS, G. 1975. Contribuciona las Magnoliaceae de Colom-
bia, III. Caldasia 11: 27-50.
LOZANO-CONTRERAS, G. 1983. Flora de Colombia, vol. 1, Magnoliaceae.
Universidad Nacional de Colombia, Colciencias, Bogota, Colombia.
MAI, D. H. 1970. Neue Arten aus tertiiren Lorbeerwildernin Mitteleuropa.
Feddes Repertorium81: 347-370.
MAI,D. H. 1971. Fossile Funde von Manglietia Blume (Magnoliaceae).Fed-
des Repertorium82: 441-448.
MAI, D. H. 1975. Beitrige zur Bestimmung und Nomenklaturfossiler Mag-
nolien. Feddes Repertorium86: 559-578.
MAI, D. H. 1987a. Neue Arten nach Frtichtenund Samen aus dem Tertiiar
von Nordwestsachsenund der Lausitz. Feddes Repertorium98: 105-126.
MAI, D. H. 1987b. Neue Frtichteund Samen aus paliozinen Ablagerungen
Mitteleuropas.Feddes Repertorium98: 197-229.
MAI, D. H. 1995. Tertiire Vegetationsgeschichte Europas. Gustav Fischer
Verlag, Jena, Germany.
MAI, D. H., ANDH. WALTHER. 1978. Die Floren der HaselbacherSerie im
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
[Vol. 88
Wei8elster-Becken(Bezirk Leipzig, DDR). Abhandlungendes Staatlich-
en Museumsfiir Mineralogie und Geologie zu Dresden 28: 1-200.
MAI,D. H., ANDH. WALTHER.1985. Die obereozinen Floren des WeiBelster-
Beckens und seiner Randgebiete.Abhandlungendes Staatlichen Muse-
umsfir Mineralogie und Geologie zu Dresden 33: 1-260.
MAI, D. H., AND H. WALTHER. 1991. Die oligozinen und untermiozdinen
Floren Nordwest-Sachsens und des Bitterfelder Raumes. Abhandlungen
des Staatlichen Museumsfiir Mineralogie und Geologie zu Dresden 38:
1-230.
MANCHESTER, S. R. 1994. Fruits and seeds of the Middle Eocene Nut Beds
flora, Clarno Formation, Oregon. Palaeontographica Americana 58: 1-
205.
MANCHESTER, S. R. 1999. Biogeographicalrelationshipsof North American
Tertiaryfloras. Annals of the Missouri Botanical Garden 86: 472-522.
MILLER,K. G., R. G. FAIRBANKS, AND G. S. MOUNTAIN. 1987. Tertiary
oxygen isotope synthesis, sea level history, and continental margin ero-
sion. Paleoceanography 2: 1-19.
NOOTEBOOM, H. P. 1985. Notes on Magnoliaceae, with a revision of Pachy-
larnax and Elmerrillia and the Malesian species of Manglietia and Mich-
elia. Blumea 31: 65-121.
NOOTEBOOM, H. P 1987. Notes on Magnoliaceae II, revision of Magnolia
sections Maingola (Malesian species), Aromadendron, and Blumiana.
Blumea 32: 343-382.
H. P 1993. Magnoliaceae. In K. Kubitzki [ed.], The families
NOOTEBOOM,
and genera of vascular plants, Flowering plants, vol. II, Dicotyledons,
391-401. Springer-Verlag,Berlin, Germany.
H. P. 2000. Different looks at the classification of the Mag-
NOOTEBOOM,
noliaceae. In Y. Liu et al. [eds.], Proceedings of the InternationalSym-
posium on the Family Magnoliaceae,26-37. Science Press, Beijing, Chi-
na.
PARKS,C. R., N. G. MILLER, J. E WENDEL,ANDK. M. McDOUGAL.1983.
Genetic divergence within the genus Liriodendron(Magnoliaceae).An-
nals of the Missouri Botanical Garden 70: 658-666.
PARKS,C. R., ANDJ. E WENDEL.1990. Molecular divergence between Asian
and North American species of Liriodendron(Magnoliaceae) with im-
plications for interpretationof fossil floras. AmericanJournal of Botany
77: 1243-1256.
PARKS,C. R., J. E WENDEL,M. M. SEWELL,ANDY.-L. QIU. 1994. The
significance of allozyme variationand introgressionin the Liriodendron
tulipifera complex (Magnoliaceae). American Journal of Botany 81:
878-889.
PEIGLER, R. S. 1989. Fossil Magnoliaceae: a review of literature.Magnolia
(Journal of the Magnolia Society) 25: 1-11.
QIu, Y.-L., M. W. CHASE,ANDC. R. PARKS.1995. A chloroplastDNA phy-
logenetic study of the eastern Asia: eastern North America disjunctsec-
tion Rytidospermumof Magnolia (Magnoliaceae).American Journal of
Botany 82: 1582-1588.
QIU,Y.-L., J. LEE, E BERNASCONI-QUADRONI, D. E. SOLTIS,P S. SOLTIS,M.
ZANIS, E. A. ZIMMER,Z. CHEN, V. SAVOLAINEN,AND M. W. CHASE.
1999. The earliest angiosperms: evidence from mitochondrial,plastid
and nuclear genomes. Nature 402: 404-407.
Qiu, Y.-L., AND C. R. PARKS. 1994. Disparity of allozyme variation levels
in three Magnolia (Magnoliaceae) species from the southeasternUnited
States. AmericanJournal of Botany 81: 1300-1308.
QIu, Y.-L., C. R. PARKS, AND M. W. CHASE. 1995. Molecular divergence in
the eastern Asia-eastern North America disjunct section Rytidospermum
of Magnolia (Magnoliaceae). American Journal of Botany 82: 1589-
1598.
REID, E. M., AND M. E. J. CHANDLER.1933. The London Clay flora. British
Museum (NaturalHistory), London, UK.
REMBER,W. C. 1991. Stratigraphyand paleobotany of Miocene Lake sedi-
ments near Clarkia,Idaho. Ph.D. dissertation,University of Idaho, Mos-
cow, Idaho, USA.
SEWELL,M. M., C. R. PARKS, AND M. W. CHASE. 1996. Intraspecific chlo-
roplast DNA variation and biogeography of North American Lirioden-
dron L. (Magnoliaceae). Evolution 50: 1147-1154.
SHINOZAKI,K., ET AL. 1986. The complete nucleotide sequence of the to-
bacco chloroplast genome: its gene organizationand expression. EMBO
Journal 5: 2043-2049.
SMITH, A. C. 1947. The families Illiciaceae and Schisandraceae.Sargentia7:
1-224.
SOLTIS,D. E., ETAL, 2000. Angiospermphylogeny inferredfrom 18S rDNA,
December 2001] AZUMA ET AL.-MOLECULAR
rbcL, and atpB sequences. Botanical Journal of the Linnean Society 133:
381-461.
SWOFFORD, D. L. 2000. PAUP*:phylogenetic analysis using parsimony(*and
other methods), version 4. Sinauer,Sunderland,Massachusetts,USA.
TAKHTAJAN, A. 1969. Flowering plants: origin and dispersal. Oliver and
Boyd, Edinburgh,UK.
TANAI,T. 1992. Tertiary vegetational history of East Asia. Bulletin of the
MizunamiFossil Museum 19: 125-163 (in Japanese).
TAYLOR, D. W. 1990. Paleobiogeographicrelationshipsof angiospermsfrom
the Cretaceousand early Tertiaryof the North American area.Botanical
Review 56: 279-417.
TIFFNEY, B. H. 1977. Fruitsand seeds of the BrandonLignite:Magnoliaceae.
Botanical Journal of the Linnean Society 75: 299-323.
TIFFNEY, B. H. 1985a. Perspectives on the origin of the floristic similarity
between eastern Asia and eastern North America. Journal of the Arnold
Arboretum66: 73-94.
TIFFNEY, B. H. 1985b. The Eocene North Atlantic land bridge:its importance
in Tertiary and modern phytogeography of the Northern Hemisphere.
Journal of the Arnold Arboretum66: 243-273.
TIFFNEY, B. H. 1994. Re-evaluationof the age of the BrandonLignite (Ver-
mont, USA) based on plant megafossils. Review of Palaeobotany and
Palynology 82: 299-315.
TIFFNEY, B. H., ANDE. S. BARGHOORN.1979. Flora of the BrandonLignite.
IV. Illiciaceae. American Journal of Botany 66: 321-329.
TRALAU,H. 1963. Asiatic dicotyledonous affinities in the Cainozoic flora of
Europe. Kungliga Svenska VetenskapsakademiensHandlingar 9: 1-87.
TSUKAGOSHI, M., Y. ONO, AND T. HASHIMOTO. 1997. Fossil endocarp of
Davidia from the Early Pleistocene sediments of the Tokai Groupin Gifu
Prefecture,central Japan.Bulletin of the Osaka Museumof Natural His-
tory 51: 13-23.
TSUKAGOSHI, M., AND TODOCOLLABORATIVE RESEARCH GROUP. 1995.
Plant megafossils from the Pliocene Toki Sand and Gravel Formationin
and aroundEna City, Gifu Prefecture,central Japan.Bulletin of the Osa-
ka Museum of Natural History 49: 23-46.
UEMURA, K. 1988. Late Miocene floras in northeastHonshu,Japan.National
Science Museum, Tokyo, Japan.
VAZQUEZ-GARCIA, J. A. 1994. Magnolia (Magnoliaceae)in Mexico and Cen-
tral America: a synopsis. Brittonia 46: 1-23.
WALTHER, H. 1999. Die Tertidrfloravon Kleinsaubernitzbei Bautzen. Pa-
laeontographicaAbteilung B Palliophytologie 249: 63-174.
WEN, J. 1999. Evolution of easternAsia and eastern North Americandisjunct
distributionsin flowering plants. Annual Review of Ecology and System-
atics 30: 421-455.
This content downloaded from 168.176.5.118 on Fri, 23 Aug 2013 21:28:16 PM
All use subject to JSTOR Terms and Conditions
PHYLOGENY OF MAGNOLIACEAE 2285
WEN, J. 2000. Internaltranscribedspacerphylogeny of the Asian and eastern
North American disjunct Aralia sect. Dimorphanthus(Araliaceae) and
its biogeographic implications. International Journal of Plant Sciences
161: 959-966.
WEN, J., R. K. JANSEN,AND K. KILGORE. 1996. Evolution of the eastern
Asia and eastern North American disjunct genus Symplocarpus (Ara-
ceae): insights from chloroplast DNA restriction site data. Biochemical
Systematicsand Ecology 24: 735-747.
WEN,J., ANDS. SHI. 1999. A phylogenetic and biogeographicstudy of Ham-
amelis (Hamamelidaceae),an easternAsian and easternNorth American
disjunct genus. Biochemical Systematicsand Ecology 27: 55-66.
WOLFE,J. A. 1972. An interpretationof Alaskan Tertiaryfloras. In A. Gra-
ham [ed.], Floristics and paleofloristicsof Asia and easternNorth Amer-
ica, 201-233. Elsevier, Amsterdam,The Netherlands.
WOLFE,J. A. 1975. Some aspects of plant geography of the northernhemi-
sphere during the late Cretaceous and Tertiary.Annals of the Missouri
Botanical Garden 62: 264-279.
WOLFE,J. A. 1978. A paleobotanical interpretationof Tertiaryclimates in
the NorthernHemisphere.American Scientist 66: 694-703.
WOLFE, J. A. 1980. Tertiaryclimates and floristic relationshipsat high lati-
tudes in the NorthernHemisphere.Palaeogeography, Palaeoclimatology,
Palaeoecology 30: 313-323.
WOLFE,J. A. 1997. Relations of environmentalchange to angiosperm evo-
lution during the late Cretaceous and Tertiary.In K. Iwatsuki and P. H.
Raven [eds.], Evolution and diversification of land plants, 269-290.
SpringerVerlag Tokyo, Tokyo, Japan.
WOODBURNE, M. O., ANDC. C. SWISHER, III. 1995. Land mammal high-
resolution geochronology, intercontinentaloverlanddispersals,sea level,
climate, and vicariance. In W. A. Berggren, D. V. Kent, M.-P Aubry,
and J. Hardenbol [eds.], Geochronology time scales and global strati-
graphic correlation. SEPM Special Publication Number 54, 335-364.
SEPM (Society for SedimentaryGeology), Tulsa, Oklahoma,USA.
WU, C.-I, ANDW.-H. LI. 1985. Evidence for higher rates of nucleotide sub-
stitution in rodents than in man. Proceedings of the National Academy
of Sciences, USA 82: 1741-1745.
Wu, Z. 1983. On the significance of pacific intercontinentaldiscontinuity.
Annals of the Missouri Botanical Garden 70: 577-590.
XIANG, Q.-Y., D. J. CRAWFORD,A. D. WOLFE, Y.-C. TANG, AND C. W. DE-
PAMPHILIS. 1998. Origin and biogeography of Aesculus L. (Hippocas-
tanaceae):a molecular phylogenetic perspective. Evolution52: 988-997.
XIANG, Q.-Y., D. E. SOLTIS, AND P. S. SOLTIS. 1998. The eastern Asian and
eastern and western North Americanfloristic disjunction:congruentphy-
logenetic patternsin seven diverse genera. Molecular Phylogenetics and
Evolution 10: 178-190.