DOCTORAL THESIS

A Membrane Remodeling System for

OXPHOS Activity in
Staphylococcus aureus

Iván Camilo Acosta García

Madrid, 2020
 UNIVERSIDAD AUTÓNOMA DE MADRID

FACULTAD DE CIENCIAS

DEPARTAMENTO DE BIOLOGÍA MOLECULAR

A Membrane Remodeling System for OXPHOS Activity in

Staphylococcus aureus

TESIS DOCTORAL
IVÁN CAMILO ACOSTA GARCÍA
MADRID, 2020
 UNIVERSIDAD AUTÓNOMA DE MADRID

FACULTAD DE CIENCIAS

DEPARTAMENTO DE BIOLOGÍA MOLECULAR

A Membrane Remodeling System for OXPHOS Activity in

Staphylococcus aureus

Memoria presentada por, Iván Camilo Acosta García, Microbiólogo Industrial

para optar por el grado de Doctor en Biociencias Moleculares por la
Universidad Autónoma de Madrid

Directores: Tutor:

Daniel López Serrano Ph.D Aurelio Hidalgo Ph.D

Marta Ukleja Ph.D

CENTRO NACIONAL DE BIOTECNOLOGÍA-CSIC

MADRID, 2020
This thesis was undertaken at the
National Center for Biotechnology
under the supervision of doctors Daniel
López Serrano and Marta Ukleja.

Iván Camilo Acosta García was recipient

of a FPI fellowship (BES-2015-071976)
from the Ministerio de Ciencia
Innovación y Universidades.
To my family
Acknowledgments
I would like to acknowledge the Ministerio de Ciencia, innovación y Universidades
of Spain for the FPI fellowship (BES-2015-071976), and the grant number
BFU2014-55601-P that supported and made possible this study. I want to
express my gratitude to Dr. Daniel Lopez Serrano for allowing me to do my
doctorate in his laboratory. As my mentor, I enjoyed every scientific discussion
we had during my training period and the freedom he gave me to explore my
research. I am also very grateful to all my fellow labmates, especially Dra. Maria
del Mar Cordero Alba and Dra. Marta Ukleja, who provided me extensive
personal and professional guidance and taught me an enormous understanding
of scientific research.

I had the privilege of working at the National Center for Biotechnology, where I
could interact and learn from colleagues with different scientific backgrounds that
helped me to skyrocket my research. I wanted to thank Cristina Patiño and
Beatriz Martín from the electron microscopy facility as well as Silvia Gutiérrez and
Ana Oña Blanco from the advanced light microscopy facility for guidance and
thorough education in microscopy. I am thankful to the CNB administration,
technical support, project management, and the human resources departments
for logistical assistance. Here I am immensely grateful to Marina Hernando
Bellido for encouraging me not to give up during hard times.

The completion of this project could not have been accomplished without the
support of Dr. Eric Skaar from the Pathology, Microbiology, and Immunology
department at Vanderbilt University Medical Center, who gave me the unique
opportunity to do an internship in his laboratory. Thank you for making me felt
part of your team and reminded me that science is fun. I am also deeply indebted
to the entire Skaar lab, especially to William Beavers, Andy Weiss, and Andrew
Monteith, for their friendship, feedback, and contribution to my work. Finally, with
warm affection, I express my appreciation to my loving family, Elvita, Eri, and
Andro, for their unconditional faith, continuous encouragement, and infinite
patience. I could not have done it without you at my side.
Index
 Table of Contents
Index ................................................................................................................ 11

Abstract .............................................................................................................. 8

Resumen .......................................................................................................... 10

List of abbreviations ......................................................................................... 13

Introduction....................................................................................................... 18

S. aureus as a pathogen ............................................................................. 19

An overall picture of S. aureus metabolism.............................................. 22

Regulation of OXPHOS under stress conditions ..................................... 25

Host adaptation in S. aureus ...................................................................... 28

Stomatin, prohibitin, flotillin and HflK/C domains (SPFH) ....................... 30

spfh operon in S. aureus ............................................................................ 33

Research aim ................................................................................................... 37

Objectives: ................................................................................................... 38

Methods ........................................................................................................... 40

Ethical Statement ........................................................................................ 41

Growth conditions and genetics ................................................................ 41

Bacterial strains and growth conditions ................................................ 41

Gene deletion ........................................................................................... 42

Complementation of sa1401 gene .......................................................... 46

Design and cloning of split GFP constructs .......................................... 46

RNA extraction and quantitative real-time PCR .................................... 47

In-silico predictions .................................................................................... 47

Sequence alignments .............................................................................. 47

Structural prediction analyses ................................................................ 48

Phenotypic assays ...................................................................................... 48

1
 Determination of the minimum inhibitory concentration (MIC)............ 48

Hemolysis Activity ................................................................................... 49

Whole blood and plasma killing assay ................................................... 49

Neutrophil killing assay ........................................................................... 49

Mouse infection studies .......................................................................... 50

Oxidant susceptibility assays ................................................................. 50

S. aureus kinetic growth curves ............................................................. 50

Susceptibility to thioridazine .................................................................. 51

Metabolic measurements ........................................................................... 51

Determination of acetate, lactate, and glucose ..................................... 51

Succinate and G3P measurements ........................................................ 51

Oxygen consumption .............................................................................. 52

Membrane potential ................................................................................. 52

Determination of intracellular ATP levels .............................................. 53

Intracellular ROS measurement .............................................................. 53

OH• (hydroxyl radical) measurements ................................................... 53

Disk diffusion assay for sodium azide ................................................... 54

Isolation of membrane extract from S. aureus cultures ....................... 54

DRM/DSM membrane fractionation ........................................................ 55

SDS-PAGE and immunoblot analysis .................................................... 55

Glycerol gradients.................................................................................... 56

Blue native gels ........................................................................................ 56

Second dimension SDS PAGE (2D SDS-PAGE) .................................... 56

Pull-down analysis ................................................................................... 57

Protein quantification by mass spectrometry ....................................... 57

SA1401 expression and purification ...................................................... 58

Protein-lipid assays .................................................................................... 59

2
 Protein-lipid interactions: co-sedimentation assay .............................. 59

Negative-staining electron microscopy (EM)......................................... 59

Microscopy of S. aureus cells .................................................................... 60

Fluorescence microscopy ....................................................................... 60

Nanogold immunolabeling of the S. aureus cells ................................. 60

Statistical analyses ..................................................................................... 61

Results ............................................................................................................. 63

Operon organization and bioinformatic analysis ..................................... 64

BmrS is important for S. aureus to cope with oxidative stress .............. 68

BmrS reduces oxidative metabolism under oxidative stress conditions

...................................................................................................................... 74

BmrS changes its oligomerization in the presence of ROS .................... 78

Lipid-protein interaction ............................................................................. 88

Discussion ........................................................................................................ 95

Bioinformatics predictions ......................................................................... 96

Switch from respiration to fermentation to overcome infectious stress

.................................................................................................................... 100

Membrane remodeling and protein-protein interaction ......................... 102

Stabilization of the respiratory chain by BmrS ....................................... 104

Conclusions .................................................................................................... 109

Conclusiones .................................................................................................. 111
References ..................................................................................................... 115

3
List of figures

Figure 1. S. aureus is a successful pathogen. ................................................. 20

Figure 2. Central carbon metabolism in S. aureus........................................... 24
Figure 3. Schematic representation of the ETC organization. ......................... 28
Figure 4. S. aureus has many strategies to thrive inside the host. .................. 29
Figure 5. FMMs organization in S. aureus. ...................................................... 35
Figure 6. Taxonomic classification of BmrS based on the amino acid sequence.
......................................................................................................................... 65
Figure 7. Structural prediction of BmrS. ........................................................... 68
Figure 8. Phenotypic characterization of bmrS. ............................................. 70
Figure 9. bmrS deletion affects the resistance to phagocytic-dependent killing.
......................................................................................................................... 71
Figure 10. bmrS deletion affects the tolerance to oxidizing agents.................. 72
Figure 11. bmrS is defective in organ colonization. ....................................... 73
Figure 12. BrmS influence the aerobic fermentation........................................ 75
Figure 13. BmrS modulates the ETC. .............................................................. 77
Figure 14. BmrS is a membrane protein part of the FMMs. ............................. 79
Figure 15. BmrS changes its complexity upon the presence of ROS .............. 81
Figure 16. Pull-down experiments showing that BmrS interacts with aerobic
metabolism-related proteins. ............................................................................ 83
Figure 17. bmrS deletion alters the quinol oxidoreductases activity in S. aureus.
......................................................................................................................... 84
Figure 18. GlpD oligomerization. ..................................................................... 86
Figure 19. Effect of thioridazine on cell viability and BmrS-FloA oligomerization.
......................................................................................................................... 88
Figure 20. BmrS interacts and deforms CL. .................................................... 90
Figure 21. The N-terminal region of BmrS mediates the CL-liposome deformation
and the resistance to H2O2 in S. aureus. .......................................................... 91
Figure 22. BmrS coincides closely with membrane deformations after H 2O2
treatment. ......................................................................................................... 93

4
Figure 23. Proposed mechanism of how BmrS mediates changes in the modify
S. aureus' metabolism to thrive the presence of free radicals from the immune
system. ........................................................................................................... 107

5
List of tables

Table 1. List of strains used in this study. ........................................................ 42

Table 2. List of primers used in this study. ....................................................... 46
Table 3. Minimum inhibitory concentration ....................................................... 69

6
Abstract

8
The biological processes of all organisms depend on the constant energy supply.
In Bacteria, respiratory chains use the electrons released from the metabolism of
inorganic and organic compounds to produce useable forms of energy such as
adenosine triphosphate (ATP). These series protein complexes are the principal
source of ATP in the cell, creating an electrochemical gradient across the
cytoplasmic membrane, which harnesses the proton flow to synthesize ATP.
During infections, the immune system targets the bacterial electron transport
chain by limiting the availability of essential metals like iron and producing free
radicals. One bacterial strategy to overcome the immune response is reducing
the respiratory rate and obtaining the energy via fermentation. Here we report a
novel membrane-bound protein, BmrS, which recognizes and remodels
cardiolipin enriched-regions in Staphylococcus aureus to stabilize the electron
transport chain under oxidative stress growth conditions. BmrS is part of
functional membrane microdomains, where a knockout (bmrS) strain decreases
the resistance to the oxidative burst from neutrophils. We observed that bmrS
is particularly prone to generate more intracellular Reactive Oxygen Species
(ROS) due to an imbalance in respiratory chain activity. Our data suggest a model
in which BmrS is induced by ROS, remodeling the membrane to improve the
quinol oxidoreductases activity and maintain the membrane potential when the
immune system is activated. We establish how this novel protein provides a real-
time mechanism to respond and control the staphylococcal metabolism during
infections, ameliorating oxidative stress.

9
Resumen

10
Los organismos vivos deben asegurar la conservación y el suministro constante
de energía para sobrevivir. Las bacterias metabolizan compuestos orgánicos e
inorgánicos transformándolos en formas de energías asimilables para la célula
como el trifosfato de adenosina (ATP). En este contexto, la cadena respiratoria
emplea la energía liberada de las reacciones de oxidoreducción para translocar
protones a través de la membrana, generando un gradiente electroquímico que
es utilizado para la síntesis de ATP. Durante las infecciones, el sistema inmune
limita la disponibilidad de hierro y produce radicales libres para afectar la cadena
respiratoria bacteriana. Para sobrellevar estas condiciones, los patógenos
reducen la tasa de respiración y utilizan preferencialmente la fermentación como
medio para preservar la conservación de la energía y crecer dentro del huésped.
En el presente estudio se describió la función de una novedosa proteína de
membrana (BmrS), la cual remodela las regiones ricas en cardiolipina en la
membrana de Staphylococcus aureus, estabilizando la cadena respiratoria
durante el estrés oxidativo. BmrS es parte de los microdominios funcionales de
membrana, cuya deleción génica reduce la resistencia a los neutrófilos. En este
trabajo se determinó que bmrS es particularmente propenso a acumular mayor
cantidad de especies reactivas de oxígeno (ROS) debido a un desequilibrio en
la respiración aerobia. Nuestros datos sugieren un modelo hipotético en el cual
BmrS se activa en la presencia de ROS, garantizando el buen desempeño de
algunos componentes de la cadena respiratoria como las enzimas quinol
oxidorreductasas. Este efecto previene la filtración de electrones, mantiene el
potencial de membrana, y mejora el crecimiento bacteriano al momento que el
sistema inmune se activa. Por lo tanto, el remodelamiento de la membrana por
BmrS proporciona una forma eficiente de responder y controlar el metabolismo,
ayudando a S. aureus a reducir el estrés oxidativo.

11
 List of
abbreviations

13
2D SDS- Second dimension SDS PAGE
PAGE
ADP Adenosine diphosphate
APF Aminophenyl fluorescein
Arg Accessory gene regulator
ATP Adenosine triphosphate
BmrS Bacterial Membrane Remodeling System
BN-PAGE Blue Native PAGE
CFU Colony-forming units
CidC Pyruvate oxidoreductase
CL Cardiolipin
DDM n-dodecyl β-D-maltoside
DETA (Z)-1-[N-(2-aminoethyl) -N-(2-ammonioethyl) amino] diazen-1-ium-1,2-diolate
NONOate
DHAP Dihydroxyacetone phosphate
DMEM Dulbecco’s modified Eagle’s medium
DMK Demethylmenaquinone
DRM Detergent resistant fraction
DSM Detergent sensitive fraction
EDTA Ethylenediaminetetraacetic acid
EM Negative-staining electron microscopy
ETC Electron transport chain
FAD Flavin adenine dinucleotide
FBS Fetal bovine serum
FMMs Functional Membrane microdomains
Fnbp Fibronectin-binding proteins
G3P Glycerol-3-phosphate
GlpD Glycerol-3-phosphate dehydrogenase
H2O2 Hydrogen peroxide
HOCl Hypochlorous acid
LB Luria Bertani
Ldh Lactate Dehydrogenase
LPG Lysylphosphatidylglycerol
LUVs Large unilamellar vesicles
MH Mueller-Hinton media
MIC Minimum inhibitory concentration
MICOS Mitochondrial contact site and cristae organizing system
MK Menaquinone

14
MOI Multiplicity of infection
MPO Myeloperoxidase
Mqo Malate quinone oxidoreductase
MRSA Methicillin-resistant S. aureus
MSCRAMMs Microbial surface components recognizing adhesive matrix molecules
NaClO Sodium hypochlorite
NAD Nicotinamide adenine dinucleotide
NDH-2 Type II NADH: quinone oxidoreductase
NETs Neutrophil extracellular traps
NO• Nitric oxide
OD Optical density
OH• Hydroxyl radical
OXPHOS Oxidative phosphorylation
PBP Penicillin Binding Protein
PBS Phosphate buffered saline
PCR Polymerase chain reaction
PE Phosphatidylethanolamines
PG Phosphatidylglycerol
PVL Panton-Valentine
ROS Reactive oxygen species
RPM Revolution per minute
RPMI Roswell Park Memorial Institute (culture medium)
RT Room temperature
SarA Staphylococcal Accessory Regulator
SCCmec Staphylococcal Cassette Chromosome
SCVs Small colony variants
SD Standard deviation
SDH Succinate dehydrogenase
SDS-PAGE Polyacrylamide gel electrophoresis
Sod Superoxide dismutase
SpA Protein A
SPFH Stomatin, prohibitin, flotillin and HflK/C domains
SQ Semiquinone
SXT Staphyloxanthin
TCA Tricarboxylic acid cycle
TEM Transmission electron microscopy
TOM The translocase of the outer membrane

15
TSA Tryptic soy agar
TSB Tryptic soy broth
UQ Ubiquinone
WHO The World Health Organization

16
Introduction

18
S. aureus as a pathogen

S. aureus is a Gram-positive, non-motile, cocci-shape, and facultative anaerobic

bacterium. Usually, it is a part of the human microbiota, colonizing up to 30% of
healthy individuals [1]. Moreover, its host spectrum can be extended to dogs, cats,
sheep, cattle, and poultry [2]. S. aureus in human carriers resides in the nose,
skin, and the gastrointestinal tract [1, 2]. However, the bacterium becomes a
significant risk when it trespasses the underlying epithelial barrier and internalizes
into the host, causing a wide range of healthcare-associated pathologies such as
skin and soft-tissue infections as the most common forms (Fig 1. a) [2]. If the
symptoms continue, the infection might progress to pneumonia, osteomyelitis,
endocarditis, bacteremia, and toxic shock syndrome (Fig. 1a) [3]. These broad
spectra of clinical manifestations have been linked to the expression of several
virulence factors that allow S. aureus to adhere to the host cells, colonize organs,
evade the immune system, and resist several antibiotics [4].

The main adherence factors of S. aureus are adhesins anchored covalently to

the cell wall [5]. They mediate the initial attachment of the bacteria to the
eukaryotic cell surface by identifying multiple ligands. These components are
classified based on structural and functional properties. The most studied group
is the microbial surface components recognizing adhesive matrix molecules
(MSCRAMMs) [5, 6], which are the largest family of adhesins in S. aureus (Fig.
1b). They are characterized by having an IgG-like domain and showing high-
affinity for several extracellular matrix components such as fibrinogen, fibronectin,
and collagens [6].

Some members of the MSCRAMMs family are the fibronectin-binding proteins A

and B (FnbpA and FnbpB), collagen-binding protein, clumping factor A and B,
and the staphylococcal protein A (SpA) [5]. MSCRAMMs are anchored to the cell
wall by sortase A with the subsequent secretion via the Sec system [5, 6]. These
proteins usually contain the secretory signal at the N-terminus, removed after
Sec-mediated secretion [7]. The deletion of genes encoding for adhesins impairs
the adhesion on the extracellular matrix, reducing the host colonization, bacterial
survival in the bloodstream, and the skin abscess formation [8, 9].

19
The SpA protein is a well-studied MSCRAMMs and virulence factor. This 42kDa
protein binds the Willebrand factor, which mediates platelet adhesion at the
endothelial damage [9]. SpA anchors to the cell wall via the C-terminal, and it is
actively released during infections [5]. The protein consists of two core domains,
the cell-wall anchor or X region and the immunoglobulin binding domain that
consists of five small sub-domains (E, D, A, B, and C). Each fragment recognizes
the Fc portion of the immunoglobulins G and the Fab region of the
immunoglobulins VH3 subclass. This interaction provides an effective strategy to
prevent the complement-dependent (opsono) phagocytosis by blocking the
antibodies binding on the bacterial surface [9]. Moreover, SpA acts as a
superantigen against B-cells, activating a rapid expansion followed by apoptotic
cell death, which significantly inhibits the immune response against the pathogen
(Fig. 1b) [10].

Figure 1. S. aureus is a successful pathogen. (a) Principal clinical manifestations caused by

S. aureus in humans. Graphic representation is adapted from [11]. (b) S. aureus expresses an
arsenal of the virulence factors to establish infections. The cartoon showed the primarily reported
virulence factors of this Gram-positive pathogen based on Vatansever et al., 2013, revision [12].

In addition to MSCRAMMs, S. aureus also secretes a wide variety of exoproteins

as virulence factors. They are divided into exotoxins and enzymes like nucleases,
protease lipases, and hyaluronidase, facilitating the tissue degradation into
nutrients [13]. Exotoxins are the principal weapons against the innate immune
cells like macrophages and neutrophils due to their cytolytic activity as pore-
forming proteins. When the toxin recognizes the target cell, it inserts into the

20
membrane accumulating several subunits that subsequently suffer
conformational leading to the pore formation and the consequent release of
cytoplasmatic content [13]. Some examples of these toxins include α-hemolysin,
β-hemolysin, γ-hemolysin, leukocidin, and Panton-Valentine leukocidin (PVL)
(Fig. 1b) [9].

Finally, antibiotic resistance is a notorious factor that contributes to bacterial

pathogenesis [14]. The World Health Organization (WHO) listed S. aureus as one
of the nine global concerns bacteria because of the extreme antibiotic resistance
[15]. Before the antibiotic era, the S. aureus mortality rate was over 80 %. The
implementation of the penicillin as a therapeutic option in 1940 decreased the
infection lethality. However, resistant strains appeared almost simultaneously
with the use of antimicrobials. Even though the development of the semisynthetic
β-lactam, methicillin, ameliorated the treatment, drug-resistant strains emerged
rapidly. Methicillin-resistant S. aureus (MRSA) strain was observed after a year
of clinical use of penicillin as an anti-staphylococcal agent. Since then, MRSA
strains have posed a considerable risk of infections due to their capacity to
survive on abiotic surfaces and the transmission from person to person [2, 4].

MRSA resistance is mediated by the mecA gene that is a part of a mobile genetic
element denominated Staphylococcal Cassette Chromosome (SCCmec),
acquired by horizontal gene transfer [4]. Gene mecA encodes an alternative
PBP2a, an enzyme implicated in the peptidoglycan cross-linking [4, 14]. This
protein shows a low affinity to β-lactams, resulting in resistance to a complete
antibiotic family. Since MRSA colonizes and adapts to various abiotic and biotic
niches, a rapid spread of the SCCmec among community strains has been
observed worldwide [4]. Over time MRSA strains have also acquired resistance
to other antibiotic families such as quinolones, tetracyclines, and
aminoglycosides, underlining the necessity to find alternative therapeutic options
to fight against this pathogen. The study of the host-pathogen interactions has
recently opened new possibilities in antivirulence approaches [4], precisely how
the host environment and the bacteria metabolic state influence the infection

21
progression. These key points highlight that the study of bacterial biology is the
correct approach to find alternative ways to control infectious diseases.

An overall picture of S. aureus metabolism

S. aureus can establish infections due to the expression of mechanisms to evade

the immune system and grow under nutrient-limited conditions like those present
inside the host [16]. This pathogen can synthesize all macromolecules from 13
intermediates, many of which are derived from three principal pathways: (i)
Embden-Meyerhof-Parnas, (ii) pentose phosphate, and (iii) tricarboxylic acid
cycle (TCA) lacking the glyoxylate shunt [17, 18]. Glycolysis (Embden-Meyerhof-
Parnas) and pentose phosphate are the pathways for carbohydrates catabolism,
whose activity produces two NADH molecules per glucose and generates
pyruvate as the end product. The fate of pyruvate depends on oxygen availability
[19], as it follows:

Under aerobic conditions, pyruvate is ultimately oxidized to CO2 and H2O via the
TCA cycle and the respiratory chain [20, 21]. In S. aureus and other Firmicutes
species, the TCA cycle is repressed by a rapidly catabolizing carbon source such
as glutamate or glucose (Fig. 2a) [22]. During the exponential phase and when
the glucose is available, the TCA cycle activity is downregulated, and the acetyl-
CoA is used to produce ATP through acetogenesis. In this pathway, acetyl-CoA
is the substrate for the acetate kinase to regenerate ATP from ADP, accumulating
extracellular acetate (Fig. 2) [20-22]. Once the glucose is depleted from the media,
S. aureus activates the TCA cycle (post-exponential phase) with the concomitant
acetate assimilation (Fig. 2). Mutations in this pathway (e.g., aconitase gene)
suppress the acetate catabolism and the post-exponential phase growth (Fig 2)
[19, 21, 22].

The series of reactions in the TCA cycle fuel the cell with reduced dinucleotides
(i.e., NADH, FADH, and NADPH) and play a critical function in the breakdown of

22
many organic molecules, such as amino acids and lipids. [19, 23-25]. The
transition to this pathway produces many molecules, including various metabolic
intermediates, secondary metabolites, virulence factors such as α- and β-toxins,
leading to a complete modification of the S. aureus metabolome [19, 24]. The
reduced equivalents (NADH, FADH, and NADPH) are subsequently oxidized in
the electron transport chain (ETC) to produce ATP via oxidative phosphorylation
(OXPHOS) [23]. As most Gram-positive bacteria, menaquinone (MK) is the only
electron carrier, which passes electrons to oxygen-depended terminal quinol
oxidases [16, 19]. S. aureus lacks a cytochrome C; however, it expresses three
cytochromes (aa3, bo3, and bd), encoded in two independent gene clusters.
qoxBACD encodes for the cyanine-sensitive aa3 and bo3 that is activated when
heme is restricted. Cyanine-resistant or bd cytochrome is the cydAB operon
product whose expression is induced upon respiratory stress [16, 19]. This
terminal oxidase is necessary for establishing infections on the skin and organ
colonization [16, 19, 26].

23
Figure 2. (a). Central carbon metabolism in S. aureus. Glycolysis (orange), lactic fermentation
(blue), acetic fermentation (purple), and the TCA (green) pathways are represented. In the
presence of oxygen, S. aureus degrades glucose, accumulating acetate. After glucose depletion,
S. aureus fully activates the TCA cycle, catabolizing the acetate from the media. The scheme was
modified based on the study of Ferreira and colleagues [27]. (b). Graphic representation of S.
aureus growth (rich media) showing the metabolism of glucose and acetate through the time.

Under anaerobic conditions, S. aureus undergoes fermentation or anaerobic

respiration [16, 27]. S. aureus respires anaerobically via the NarGHJI system
using nitrate as an electron acceptor [16, 19]. Nitrate reductase, a molybdenum-
dependent enzyme, forms a complex that transfers electrons from MK, reducing
nitrate to nitrite. Nitrate is commonly secreted, but during aerobic respiration, the
siroheme-dependent nitrate reductase (NirBD) converts it into ammonia [16, 19].
When S. aureus ferments, it produces L-lactate, D-lactate, 2.3-butanediol,
ethanol, and formate as the main fermentative products [27]. The Ldh enzymes
are only active during anaerobiosis, reducing the pyruvate to lactate with the
concomitant NADH regeneration (Fig. 2a) [28]. S. aureus can similarly maintain
the redox balance through AdhE and BudAB, generating ethanol and 2,3-
butanediol, respectively. Finally, formate is synthesized by the pyruvate formate
lyase (pflAB) system, which catalyzes the reversible conversion of pyruvate to
formate. This pathway ensures a steady supply of acetyl-CoA, NADH and

24
facilitates the formation of formylated peptides involved in several biosynthetic
processes [19].

What is the importance of fermentation in S. aureus? The single pathway deletion

shows no apparent phenotype in vitro due to their redundancy [16]. Nonetheless,
by evaluating those mutants in vivo, some studies prove that bacteria do not
always rely on respiration, and fermentation is strategically vital for surviving
inside the host [16, 19, 27-29]. For example, S. aureus selects lactic fermentation
to bypass the negative effect of nitric oxide (NO•), a free radical produced by
macrophages [13, 28, 30]. This molecule targets several enzymes involved in
respiration, thereby preventing ATP generation through the ETC [29]. Thus,
fermentation is required to maintain the redox state while supporting the growth
under the activation of the immune response, avoiding the use of catabolic
pathways affected by NO• [13, 28, 30]. Even though fermentation is four times
less efficient than respiration, bacteria require appropriate coordination between
respiration and fermentation to proliferate inside the host and reduce the harmful
effect of free radicals [28, 29].

Regulation of OXPHOS under stress conditions

OXPHOS is the culmination of aerobic metabolism [23, 31]. The reducing

equivalents obtained from the metabolic pathways are then transformed into a
proton motive force across the cytoplasmic membrane, which drives ATP
synthesis [32]. The electrochemical gradient or membrane potential is also crucial
for transporting numerous molecules, such as ions, proteins, and antibiotics.
Further, the membrane potential is necessary for the proper performance of many
membrane proteins implicated in cell wall synthesis, division, and motility [31]. In
bacteria, the regulation of OXPHOS contributes to the adaptation to changing
environments [32]. This idea is based on the ability of bacteria to use multiple
electron donors and acceptors often at the same time [31, 33]. For example,
quinol oxidoreductases connect many catabolic pathways with the respiratory
chain by transferring electrons to the quinone pool, contributing to keeping the

25
membrane potential [31, 33]. The expression of these enzymes depends
predominantly on the growth condition, providing metabolic flexibility to the
bacteria population [16, 29, 30, 34-36].

The quinol pool is a lipid component of the ETC that transfers electrons among
the respiratory complexes [35, 37, 38]. This electron carrier is a checkpoint in
controlling OXHPOS activity as the redox state, the expression levels, and the
affinity for the final acceptor modulate ATP synthesis [16, 31, 38]. For example,
E. coli expresses three respiratory quinones: (i) MK, (ii) demethylmenaquinone
(DMK), and (iii) ubiquinone (UQ) [32]. In addition to their structural differences,
the two-electron midpoint redox potential values are different, being low for MK,
middle for DMK, and high-potential for UQ, which contributes to selecting the
redox route toward the terminal acceptor. Indeed, E. coli prefers UQ for aerobic
respiration, whereas middle and low quinones for anaerobic respiration [32].
Other factors influencing the abundance of quinones in the cell are: (i) the
availability of electron acceptors, (ii) the growth phase, and (iii) the carbon source
[16, 34].

Contrary to E. coli, S. aureus only expresses MK as an electron carrier, which

donates electrons to the heme group of the cytochrome complexes bd and aa3
for either type of respiration [39]. MK has been isolated from most
Staphylococcus species, showing variations in the percentage of individual
isoprenoids [38, 39]. During aerobic respiration, the electron transference
imbalance from the MK pool to the terminal oxidases causes the superoxide
formation, which harms the ETC functionality (Fig. 3a) [40]. MK requires up to two
electrons to be reduced entirely, and the loss of one electron ends in the
formation of a semiquinone (SQ) that produces high superoxide ion by reacting
with the oxygen (Fig. 3a) [39].

Recently, a new regulation level has been postulated based on membrane

compartmentalization [32, 40, 41]. For instance, lipid composition and membrane
remodeling facilitate the cluster formation and the adjustment of OXPHOS

26
instantaneously [32]. Since gene expression represents a small part of the
regulatory system and is not a real-time mechanism, cells need a combination of
approaches to modify the OXPHOS outputs. Dynamic changes in the formation
of respiratory chain complexes enable bacteria to respond immediately and
protect the cell from environmental insults [31, 32, 38].

Although this subcellular organization has not been reported in prokaryotes yet,
recent studies revealed that bacterial membranes confine protein complexes into
functional membrane microdomains (FMMs), whose structure resembles the
eukaryotic lipid rafts [14, 42, 43]. In mitochondria, lipid rafts have been linked with
the ETC lateral segregation within micro-compartments called cristae (Fig. 3b)
[44, 45]. These membrane invaginations favor the molecular crowding, essential
for improving the interaction between the cytosolic and the ETC components [38,
46]. Thus, we propose that bacterial ETC may be organized in FMMs, providing
a real-time mechanism to regulate OXPHOS and reduce the intracellular ROS
(Fig. 3b) [38, 46].

27
Figure 3. Schematic representation of the ETC organization [47]. (a) The ETC is the principal
source of ROS in the cell. During aerobic respiration, unpair electrons react with molecular oxygen
producing ROS, which accumulates and might be detrimental to the cell. (b) Membrane
remodeling improves the electron transference and the protein oligomerization of the respiratory
complexes, minimizing the intracellular ROS generations. The compartmentalization of the ETC
into the MMs contributes to the dynamics and the stabilization of protein complexes, helping to
respond rapidly against an energetic demand.

Host adaptation in S. aureus

Bacterial respiratory chains are potential targets of the immune system to control
infectious spread [16, 48]. Usually, the host defenses withhold iron, manganese,
zinc, and copper from pathogens as a strategy to shut down respiration, restrict
the transport of solutes, and inactivate the enzymes involved in protecting against
oxidative stress [48]. The immune system also has specialized cells such as mast
cells, macrophages, and neutrophils to eradicate intruders [40]. Neutrophils are
the first line of defense against S. aureus [49] (Fig. 4). They are recruited at the
infection site in response to soluble factors like chemokines and cytokines, where
these leukocytes release a potent amount of ROS and enzymes stored in
cytosolic organelles known as azurophilic granules [50].

Neutrophils generate ROS in a process called the respiratory burst. NADPH-

dependent oxidase is the enzyme catalyzing the formation of superoxide that is
the precursor of hydrogen peroxide (H2O2), hydroxyl radical (OH•), hypochlorous

28
acid (HOCl), and peroxynitrite. Myeloperoxidase (MPO) is another enzyme
involved in the synthesis of HOCI from H2O2 and chloride [40]. Superoxide can
react with NO• to generate peroxynitrite, which might break down to OH• and
nitrogen dioxide. Together, these oxidants have been associated with
progressive pathogens damage or aging due to the oxidation of proteins, DNA,
and lipids, resulting in a robust clearance of microbes during infections. Curiously,
the ETC chain complexes are especially susceptible to those immune radicals
due to the iron content in their catalytic sites, which stimulates the formation of
the highly deleterious radical -OH•, through the Fenton reaction [40, 50].

Figure 4. S. aureus has many strategies to thrive inside the host. Nutrient acquisition in
nutrient-limited environments demands many cellular components, such as glucose transporters,
proteases, lipases that can help to acquire and catabolize essential nutrients from the host (32).
Expression of siderophores and metal transport are critical steps for growing and are required as
enzymatic cofactors of many enzymes such as superoxide dismutase and catalase. This scheme
was modified from the illustration of Thomsen and Liu [51].

For its part, S. aureus evades the immune system using a broad range of
antioxidant compounds [40]. For instance, staphyloxanthin imparts the golden
pigment to this bacterium and is the primary ROS scavenger [52]. Loss of
pigmentation causes a deficiency in the resistance to H2O2, neutrophils, and
attenuates the survival in the murine model [52]. Bacillithiol and coenzyme A are
small molecules with antioxidant properties that also contribute to the defense
against oxidants [40]. In addition to these molecules, staphylococci produce

29
several enzymes like superoxide dismutases (SodA and SodM), catalase,
glutathione peroxidase, and peroxiredoxins, all of which react with oxidants to
convert them in something less harmful. For instance, SodA and SodM transform
superoxide radical into H2O2 and O2 using manganese as a cofactor [40, 53].

The H2O2 from the superoxide dismutase activity is then broken down to water
and oxygen by catalase [54]. This heme dependent enzyme is encoded for the
katA gene whose activity is critical to face neutrophils and macrophages, grow in
biofilm [53, 55], and colonize the nares [56]. Interestingly the persister
subpopulation of S. aureus denominated small colony variants (SCVs) display
high tolerance to the immune cell-mediated clearance due to an increment in
catalase activity [57, 58]. Besides, the respiratory-defective phenotype of the
SCV makes fermentation the only pathway to produce ATP, a factor that reduces
the generation of internal ROS via the respiratory chain [59].

This plethora of mechanisms solves the oxidative stress in most cases. However,
upon a robust activation of the immune system, the antioxidant defenses are
overwhelmed, and if there is no control of internal ROS generation, bacteria will
die imminently. The downregulation of the components affected by free radicals
(e.g., ETC and TCA cycle) and the rerouting of the metabolism to fermentation
prevents S. aureus from exacerbating oxidative stress [60]. In general, this
process is denominated metabolic reprogramming and entails three cellular
outcomes: upregulation of the NAD kinases, drop in the NADH synthesis, and
ATP regeneration via substrate-level phosphorylation [61-64]. Pathogens have
deployed this strategy to limit ROS formation during infections, thereby
implementing an alternative antioxidant strategy based on respiration control.

Stomatin, prohibitin, flotillin and HflK/C domains (SPFH)

FMMs are a mechanism for the compartmentalization of cellular processes in the

membrane [65]. Proteins belonging to the SPFH domain are among the principal
components of FMMs [66]. Two principal characteristics are associated with
these proteins: the tendency to oligomerize and post-translational modifications

30
by acyl chains [66]. This protein domain is widespread from bacteria to animals,
indicating a common origin [67]. In bacteria, SPFH proteins are enriched in the
detergent resistance membrane (DRM) fraction, composed of proteins and lipids
that are not disaggregated with non-anionic detergent. Like eukaryotes, the
function of the domain is still unknown. However, the active interaction with lipids
and proteins suggests a function as a scaffold, participating in ion channel
regulation, membrane chaperoning, vesicles and protein trafficking, membrane-
cytoskeletal remodeling, and the formation of membrane domains [68].

Contrasting phenotypes of SPFH proteins in bacteria have been reported. For

example, a variant of YbbK, an SPFH protein in E. coli, confers viability in a lethal
background of ftsH and htpX proteases [69]. Another SPFH of E. coli, YqiK, has
shown no apparent phenotype even by applying stresses like oxidative, osmotic,
and alkaline shocks. However, protein overexpression affects cell morphology,
increases cell size, and accumulates membrane inclusions in the cytoplasm [69,
70]. A recent study identified that yqiK enhances swimming motility and
ampicillin resistance in E. coli [69, 70]. Besides, the authors proved that YqiK
localizes on discrete foci at the pole of the cells, acting as platforms for protein
complexes formation, whose stability depends on the interaction with lipids [43,
70, 71].

Bacillus subtilis is another well-studied model for FMMs [71]. This Gram-positive
bacterium contains two operons encoding for SPFH proteins whose GFP fusions
localize in discrete and highly mobile foci in the membrane [72]. Both SPFH
proteins (FloA and FloT) work as a scaffold and distribute differentially during the
growth phases. FloA acts in the cell wall, cytoskeleton, and primary metabolism,
while FloT tethers proteins involved in the adaptation to the stationary phase, like
those involved in the production of siderophores and antibiotics. The main
phenotypes linked with the deletion of the FMMs in B. subtilis are defects in
biofilm formation, sporulation, cell communication, kinase, and signaling
transduction [71, 72]. Comparable with eukaryotic lipid raft, FMMs differ in lipid
composition, being enriched in hopanoid, carotenoids, and cardiolipin lipids [42].

31
Disruption of these biosynthetic pathways gives a similar phenotype to an SPFH
mutant, supporting the role of lipid composition in FMMs [71].

So far, it is unclear if the ETC localizes into FMMs in bacteria. However, an early
study on an SPFH member (SO1377) from Shewanella oneidensis reported a
connection between this protein and the iron metabolism [73]. A mutant strain
displays less resistance to H2O2 and reduces growth in iron-depleted medium,
accumulating less iron due to alteration in the siderophore secretion [73].
Microarray and proteomic analyses indicated that SO1377 impact on aerobic
respiration. Several genes and proteins associated with aerobic respiration and
oxidative stress response were downregulated in the mutant strain [73]. Another
study in E. coli isolated several proteins of the ETC, TCA cycle, iron cluster
formation, and oxidative stress response from the DRM fraction [14, 74],
supporting the assumption that FMMs might regulate the respiratory chain.

A relationship between the SPFH domain and the ETC exists in mitochondria,
where some evidence showed how SPFH-proteins mediate OXPHOS
performance. Initially, the prohibitin function (SPFH member) was linked with cell
proliferation, where the 3′ untranslated region acts as a trans-acting regulatory
RNA molecule that inhibits the cell cycle progression [75]. It was then
demonstrated that two members of the prohibitins family, PHB1 and PHB2, form
a multimeric ring complex around the inner membrane (cristae), controlling
several membrane organization processes, such as morphogenesis,
phospholipids metabolism, and metabolic control [76]. The N-terminal parts of
PHB1 and PHB2 are anchoring the proteins to the membrane, while the carboxyl-
terminal domains (PHB domain) are exposed to the intermembrane space. Both
subunits are required (PHB1, PHB2) as mutations in either subunit abolish the
ring formation [77].

Experimental evidence using the malaria parasite indicates a loss of the

membrane potential in a PHB mutant when the parasite enters into the sexual
stage [78, 79]. This phenotype correlates with the increment in the intracellular

32
ROS and the impaired sequestration of the respiratory proteins [78]. Following
this hypothesis, the deletion of PHB1 in endothelial cells reduces complex I
activity and the membrane potential, indicating that PHB proteins might stabilize
the ETC by reducing electron leakage (Fig 3) [78-80]. Structural analysis of the
PHB1-PHB2 multimeric complex demonstrates that the ring structure maintains
the crista stalk, limiting the proton diffusion while improving the ATP synthesis
(Fig 3) [79, 80].

Finally, the SPFH domain is crucial for membrane integrity, governing the lipid
dynamics, particularly the cardiolipin (CL) content and distribution [79-81]. CL is
a non-bilayer lipid involved in the stabilization of the embedded ETC complexes
[82]. This phospholipid interacts with stomatin-like protein 2 (SLP-2), another
SPFH protein present in the mitochondria's inner membrane [81]. The deletion of
the slp-2 gene reduces the CL levels in detergent-insoluble membranes and
induces abnormal compartmentalization of this lipid, affecting the
supercomplexes formation. Thus, SLP provides stability to the inner membrane,
working as a platform for the ETC complexes assembly while improving the
electron transference (Fig. 3) [81]. Together this evidence emphasizes that the
SPFH domain is relevant for the proper functionality of the respiratory chain.

spfh operon in S. aureus

In contrast to E. coli and B. subtilis, which have various operons encoding for
SPFH proteins [67], S. aureus shows a single operon containing three genes: (i)
a nfeD-like gene annotated as sa1403 (N315 reference strain), (ii) the spfh gene
known as floA or sa1402, and (iii) a third gene, sa1401, which codes for an
unknown protein that exhibits no sequence homology to any other known protein
(Fig. 5) [65]. Previous studies of our laboratory established that SA1402 is a
flotillin-like protein that forms discrete foci around the cytoplasmic membrane and
is enriched in the DRM fraction [14]. Most of the phenotypes, coupled with
the spfh deletion, are defects in FMMs associated proteins' performance since
SA1402 works as a scaffold protein, enabling an efficient interaction between
protein interacting partners [14, 83, 84].

33
For example, García and Colleagues determined that disassembly of FMMs
affects the PBP2a oligomerization, resulting in susceptible MRSA to penicillin
treatment [14]. Usually, FloA mediates many protein partners' assembly, such as
the type VII secretion system, which reduces the secretion of related effectors
[84]. It is also described that FloA favors the oligomerization of RNase Rny
membrane complexes, a component of the RNA-degradation machinery
(degradosome) [83]. A mutant in floA reduces the Rny function, increasing the
targeted sRNA transcripts that negatively regulate the toxin expression [83].
Accordingly, our previous data highlights the importance of FMMs during
staphylococcal infection, mainly how FloA assists the assembly of protein
complexes involved in virulence. However, we little know about the molecular
mechanism (Fig. 5).

This work aimed to understand the biological function of the sa1401 gene
(henceforth renamed as bmrS), another FMMs-associated protein that is part of
the spfh operon in S. aureus. SA1401 is an unknown function protein with no
homology to any reported protein and highly conserved among the
Staphylococcus genus. To elucidate the sa1401 function, we analyzed how a
knockout mutant strain impacts the ability to establish infections using the murine
model. We hypothesized this protein is crucial to tolerate the innate immune
system activation as a strain lacking the sa1401 gene was significantly more
sensitive to H2O2 and NO•, two of the primary weapons used for the immune cells
to inactive pathogens. We explore the idea that FMMs organization modulates
the respiratory chain activity. This cellular component is the primary source of
ROS but is indispensable for niche colonization as it helps to maintain the
membrane potential, which is essential for the cell.

34
Figure 5. FMMs organization in S. aureus. The FMMs consist of three major components: (i)
cargo protein, e.g., PBP2a, type VII secretion system, and Rny RNase. (ii) The SPFH protein,
whose activity improves the functionality of the cargo proteins and (iii) the lipid constituent which
differs from the rest of the membrane, allowing the compartmentalization of the membrane. S.
aureus has a single spfh encoding gene (sa1402) that is arranged in an operon with two
additionals unknown function genes.

35
Research aim

37
 Research aim

1. To understand the physiological role of the bmrS gene in Staphylococcus

aureus and determine its relevance during infections.

Objectives:

1. Find a phenotype associated with the bmrS deletion in Staphylococcus aureus.

2. Perform a biochemical characterization of BmrS.

3. Conduct in-vivo experiments to establish the importance of BmrS during

staphylococcal infections.

4. Determine the molecular basis of BmrS in Staphylococcus aureus.

38
Methods

40
Ethical Statement

All animal studies were approved and conducted according to the Spanish
guidelines of animal care and experimentation with license number 17004-
641/2017. Mice were maintained in cages under standardized lighting conditions
and had ad libitum access to food and water.

Growth conditions and genetics

Bacterial strains and growth conditions

Bacteria, plasmids, and primers are listed in Tables 1 and 2. All strains were
stored at -80 °C in tryptic soy broth (TSB, BDTM) or Luria Bertani (LB, Oxoid) broth
supplemented with 20 % glycerol. Unless stipulated, strains were grown at 37° C,
200 rpm with a flask-to-medium ratio of 1:10 in TSB, TSB without glucose (TSB-
G BDTM), and RPMI 1640 (Gibco Life Technologies, pH 7.0) without glutamine
and supplemented with 0.5 % of casamino acids (BDTM). When appropriate,
antibiotics were added: erythromycin (150 µg ml-1), spectinomycin (150 µg ml-1),
ampicillin (100 µg ml-1) and kanamycin (50 µg ml-1). Bacterial growth was
monitored by measuring optical density at 600 nm (OD600), and colony-forming
units (CFU) were determined by the microdilution plating technique [85]. Unless
noted otherwise, all chemicals and molecular biology reagents were from Sigma-
Aldrich, St. Louis, MO, and New England Biolabs, respectively, used according
to manufacturer's instructions. Phusion Polymerase was used for all PCR
reactions for cloning. As necessary, plasmids were transformed by
electroporation into S. aureus cloning intermediate strain, RN4220, before
subsequent transduction into a final MRSA strain.

Strain Organism Genotype/plasmid Reference

IA 3 S. aureus USA300_TCH1516 WT [86]
IA 24 S. aureus RN4220 WT [87]
IA 58 S. aureus USA300_TCH1516 sa1401:specR This study

41
 IA 35 S. aureus USA300_TCH1516 sa1401+pJL74-sa1401 This study

IA 70 S. aureus USA300_TCH1516 WT+pJL74-sa1401-his This study

IA 127 S. aureus USA300_TCH1516 WT+pJL74-sa1401gfp This study
MU 38 S. aureus USA300_TCH1516 WT+pJL74-sa1401-V1 This study
MU 41 S. aureus USA300_TCH1516 WT+pJL74-sa1401-V2 This study

IA73 E. coli DH5α pJL74-sa1401-gfpCT This study

IA76 E. coli DH5α pJl74-gfpCT-sa1402-gfpNT-sa1402 This study

IA81 E. coli DH5α pJL74-gfpCT-sa1402 This study

IA82 E. coli DH5α pJL74-gfpCT-sa1402-gfpNT-sa1402 This study

IA74 E. coli DH5α pJl74-sa1401gfpCT-gfpNT-sa1402 This study

IA 78 S. aureus RN4220 pJl74-sa1402-gfpCT-gfpNT-sa1402 This study

IA 83 S. aureus RN4220 pJl74-gfpCT-sa1402-gfpNT-sa1402 This study

IA 80 S. aureus RN4220 pJl74-sa1401gfpCT-gfpNT-sa1402 This study

IA154 S. aureus USA300_TCH1516 WT-pJL74-glpD-gfp This study

IA156 S. aureus USA300_TCH1516 sa1401+pJL74-glpD-gfp This study

IA137 S. aureus USA300_TCH1516 WT-sdhA-gfp This study

IA138 S. aureus USA300_TCH1516 sa1401+sdhA-gfp This study

IA147 S. aureus USA300_TCH1516 WT-pJL74-menG-3xflag This study

IA148 S. aureus USA300_TCH1516 sa1401+pJL74- menG-3xflag This study

IA149 S. aureus USA300_TCH1516 WT-pJL74-qoxA-3xflag This study

MU10 E. coli DH5α pET28-sa1401-6xHis This study

MU11 E. coli DH5α pET28-ΔN30aa-sa1401-6xHis This study
MU12 E. coli DH5α pET28-ΔN20aa-sa1401-6xHis This study
MU13 E. coli BL21 pET28-ΔN30aa-sa1401-6xHis This study
MU14 E. coli BL21 pET28-ΔN20aa-sa1401-6xHis This study
MU15 E. coli BL21 pET28-sa1401-6xHis This study
Table 1. List of strains used in this study.

Gene deletion

Gene deletion was performed by the allelic exchange with some modifications
[88]. Briefly, 600 bp upstream and downstream of flanking sequences of the
sa1401 (N315 strain) gene were amplified from whole genomic DNA using the
primers sa1401-BamHI-1/ sa1401-2 and sa1401-5/ sa1401-SalI-6. Then

42
both PCR fragments were joined to the spectinomycin cassette by overlapping
PCR [89]. The PCR product was digested with BamHI and Sall restriction
enzymes and ligated into the pMAD vector. Ligation was transformed into E. coli
DH5α, and the insert was verified by sequencing before transferred and
integrated into S. aureus RN4220 (first recombination). The first recombination
was subsequently moved to S. aureus USA300 via ϕ11-phage transduction,
selecting the blue color and erythromycin-resistant colonies. Finally, a white/blue
screening was performed to eliminate the pMAD vector. The blue colonies were
grown in TSB without antibiotics for 6 h at 30 °C with shaking. After incubation,
the cultures were serially diluted and plated on TSB agar X-Gal supplemented
with spectinomycin. Plates were incubated at 42 °C for 24 h, and white colonies
were screened for loss of plasmid and presence of target construct (second
recombination), checking the antibiotic resistance by PCR, and sequencing the
upstream and downstream regions of the sa1401 gene.

Name Sequence (5'-3’)

Deletion of sa1401 gene

sa1401-BamHI-1 AAAGGATCCATAAACAATACCTGTATCCG

sa1401-2 GTTATTAGCGAGCCAGTCCAGATTTCATTAAGCGTGT

sa1401-3 ACACGCTTAATGAAATCTGGACTGGCTCGCTAATAAC

sa1401-4 CTTGGGAATTTTTAACGAGTCGTAGCGAGGGCAAGG

sa1401-5 CCTTGCCCTCGCTACGACTCGTTAAAAATTCCCAAG

sa1401-SalI-6 AAAGTCGAGGTACCGCGATAACGTT

Plasmid complementation and SA1401 His tag label

Fw-sa1401-SphI AAAGCATGCTAAGGAGGAACTACTATGAGTGTCGGTATTCTA
Rv-sa1401-HindIII TTTAAGCTTTTATAATTGTTTTGGTTTAGC
1401-His taq-1- SphI AAAGCATGCCCTCAACACGAATATTAATTATATAAAATAAACAT
1401-His taq-2 CAAAAATTAGAATACCGACACTCATAATTTCACCTCGCCCTC
1401-His taq-3 GAGGGCGAGGTGAAATTATGAGTGTCGGTATTCTAATTTTTG
1401-His taq-4 AscI AAAGGCGCGCCTTTCGGGCTTTGTTAGCAG
Translation fusion SA1401-GFP
P1-Carboxy-gfp- AAAGCATGCTCTCCTGAGTAGGACAAATCC
sa1401-SphI

43
P2-Carboxy-gfp-sa1401 TGAAAAGTTCTTCTCCTTTACTCATTCCTCCTAATTGTTTTGGTTT
AGCTAAAATTTCTG
P3-Carboxy-gfp-sa1401 CAGAAATTTTAGCTAAACCAAAACAATTAGGAGGAATGAGTAAA
GGAGAAGAACTTTTCA

P4-Carboxy-gfp- AAAGGCGCGCCTTATTTGTATAGTTCATCCATGCCAT
sa1401-AscI
qPCR primers
For qRT-PCR gyr297 TTAGTGTGGGAAATTGTCGATAAT
Rv qRT-PCR gyr574 AGTCTTGTGACAATGCGTTTACA
For qRT-PCR ackA GGGTATTCGTGCTTTCCGTA
Rv qRT-PCR ackA TCAGGCATTGTTTGATGGAA
For qRT-PCR citB CAAGATCATCAAGTGCCTATTCGT
Rv qRT-PCR citB CGTGATTACCACGTCTTGAACC
Split GPF
SplitGFPCt-14-1- Sph TTTGCATGCATCTGTTGTTTGTCGGTGAA
SplitGFPCt-14-2 CAAAAATTAGAATACCGACACTCATAATTGTTATCCGCTCACAAT
TAC
SplitGFPCt-14-3 GTAATTGTGAGCGGATAACAATTATGAGTGTCGGTATTCTAATTT
TTG
SplitGFPCt-14-4 TTTGAAGTTAACTTTGATTCCATTCTTTAATTGTTTTGGTTTAGCT
AAAATTTCTGA
SplitGFPCt-14-5 TCAGAAATTTTAGCTAAACCAAAACAATTAAAGAATGGAATCAAA
GTTAACTTCAAA
SplitGFPCt-14-6-AcsI TTTGGCGCGCCTTATTTGTATAGTTCATCCATGCCAT

SplitGFPCt-FloA-1- TTTGAATTCATCTGTTGTTTGTCGGTGA
EcoRI

SplitGFPCt-FloA-2 CTGCTATTACGATAAAACTTAAACTAAACATAATTGTTATCCGCT
CACAATTAC
SplitGFPCt-FloA-3 GTAATTGTGAGCGGATAACAATTATGTTTAGTTTAAGTTTTATCG
TAATAGCAG
SplitGFPCt-FloA-4 TAATTTTGAAGTTAACTTTGATTCCATTCTTATGTTCAGGTGACTC
ATCATC
SplitGFPCt-FloA-5 GATGATGAGTCACCTGAACATAAGAATGGAATCAAAGTTAACTT
CAAAATTA
SplitGFPCt-FloA-6-AcsI TTTGGCGCGCCTTATTTGTATAGTTCATCCATGCCAT
SplitGFPNt-FloA-1- TTTGGCGCGCCATCTGTTGTTTGTCGGTGAA
AcsI
SplitGFPNt-FloA-2 TGAAAAGTTCTTCTCCTTTACTCATAATTGTTATCCGCTCACAATT
AC

44
SplitGFPNt-FloA-3 GTAATTGTGAGCGGATAACAATTATGAGTAAAGGAGAAGAACTT
TTCA
SplitGFPNt-FloA-4 TGCTATTACGATAAAACTTAAACTAAACATTTGTTTGTCTGCCAT
GATGT
SplitGFPNt-FloA-5 ACATCATGGCAGACAAACAAATGTTTAGTTTAAGTTTTATCGTAA
TAGCA
SplitGFPNt-FloA-6- TTTGGCGCCTTAATGTTCAGGTGACTCATCATC
PluTI
SplitGFPCt-AntiP-1- TTTGAATTCATCTGTTGTTTGTCGGTGA
EcoRi

SplitGFPCt-AntiP-2 GAAGTTAACTTTGATTCCATTCTTCATAATTGTTATCCGCTCACA
ATTAC
SplitGFPCt-AntiP-3 GTAATTGTGAGCGGATAACAATTATGAAGAATGGAATCAAAGTTA
ACTTC
SplitGFPCt-AntiP-4 TGCTATTACGATAAAACTTAAACTAAACATTTTGTATAGTTCATCC
ATGCCAT
SplitGFPCt-AntiP-5 ATGGCATGGATGAACTATACAAAATGTTTAGTTTAAGTTTTATCG
TAATAGCA
SplitGFPCt-AntiP-6- TTTGGCGCGCCTTAATGTTCAGGTGACTCATCATC
PluTI
MenG-Flag
menG-Fw AAAAGAATTCATGGCTGACAATAAAGCAAATAAAG
menG-Rw AAAAGGCGCCTTATTTGTCGTCGTCGTCTTTGTAGTCTTTGTCGT
CGTCGTCTTTGTAGTCTTTGTCGTCGTCGTCTTTGTAGTCATCAC
CTTTGGTATTATCTTTTTCTTTATAG
QoxA-Flag
qoxA-Fw-EcoRI AAAAGAATTCGTGTCAAAATTTAAGTCTTTGCTTC
qoxA-Rw-Flag-PluTI AAAAGGCGCCTTATTTGTCGTCGTCGTCTTTGTAGTCTTTGTCGT
CGTCGTCTTTGTAGTCTTTGTCGTCGTCGTCTTTGTAGTCATGTC
CACCTCCATGATCA
GlpD-GFP
glpD-Fw-EcorRI AAAAGAATTCATGGCATTGTCTACTTTTAAGAGA

Primer 2-GlpD-GFP GAAAAGTTCTTCTCCTTTACTCATTTCTTTAACTGCTGGTTGATTA

TTT
Primer 3-GlpD-GFP AAATAATCAACCAGCAGTTAAAGAAATGAGTAAAGGAGAAGAAC
TTTTC
Rw-gfp-AscI AAAAGGCGCGCCTTATTTGTATAGTTCATCCATGCCA
Heterologous sa1401 expression in E. coli
sa1401-Fw-pET28a-C GGAGATATACATATGAGTGTCGGTATTCTAATTTTTGTCA
sa1401-Rw-pET28a-C CAGATGGTACCTAATTGTTTTGGTTTAGCTAAAATTTCTGA

45
 V1SA1401FNcoI CGGCCGCCATGGGGCAAAAGCCACCTCAAAAAACATCTACCGA
T
V2SA1401FNcoI CGGCCG CCATGGGG CGCGAAAATAGTCATAAAGATAGA
Table 2. List of primers used in this study. The underlying letters represent the restriction site of
each primer.

Complementation of sa1401 gene

The sa1401 gene and the native promoter of the floA operon were amplified from
MRSA strain chromosome using the primers 1401-Histaq-1-SphI, 1401-Histaq-2,
and 1401-Histaq-3, 1401-Histaq-4-AscI respectively. The PCR fragments were
joined by overlapping PCR and subsequently digested and cloned into SphI and
AscI restriction sites of the pJL74 plasmid. Plasmids were confirmed by PCR and
sequencing before transformed them into the intermediate strain, RN4220. All
plasmids were consequently transduced via ϕ-11 bacteriophage to its respective
S. aureus USA300 strain.

Design and cloning of split GFP constructs

The pJL74 plasmid encoding the full-length GFP was used as a template to
amplify the gfp gene. All primers used to generate the different genetic constructs
are listed in Table 2. GFP was dissected at a surface loop between glutamine 158
and lysine 159, generating two fragments, NtGFP and CtGFP, respectively. Briefly,
the floA (sa1402) and sa1401 genes were tagged with the ntgfp and ctgfp,
respectively. The CtGFP encoding DNA was joined in-frame to the end of the
sa1401 and sa1402 genes, resulting in sa1401-ctgfp and sa1402-ctgfp. The ntgfp
fragment was joined in-frame at the beginning of the sa1402 gene, generating
the ntgfp-sa1402 fragment.

All DNA fusions are under the control of the hyperspank promoter, and both ntgfp
and ctgfp constructs were cloned into the pJL74 vector using the SphI-AscI and
EcoRI-PluTI restriction sites in the following way: (i) ntgfp-sa1402 and sa1401-
ctgfp, (ii) positive control, ntgfp-sa1402 and sa1402-ctgfp, and (iii) parallel control,

46
sa1402-ntgfp and sa1402-ctgfp. The final plasmids were transformed into
RN4220 strain, and transformants were selected via erythromycin resistance. If
the fused proteins have an affinity for one another and antiparallel interaction
brings NtYFP and CtYFP into proximity, restoring the fluorescence. The individual
fragments and the parallel fusion (sa1402-ntgfp and sa1402-ctgfp) were
evaluated to establish the background fluorescence.

RNA extraction and quantitative real-time PCR

Primers are listed in Table 2, and the RNeasy Mini Kit (Qiagen) was used to
isolated RNA following the manufacturer’s instruction with some modification.
Briefly, cells were grown in TSB, harvested (a pellet of ~1X109 CFU),
resuspended in 90 µl of PBS, and immediately incubated with 100 µg ml-1 of
lysostaphin for 15 min at 37 °C. 600 µl of buffer RLT containing β-
mercaptoethanol were added and pipetted carefully until the suspension was
completely liquid before RNA isolation and purification. RNA samples were
treated with DNase I (New England Biolabs) to remove DNA traces, and the purity
was evaluated using Nanodrop (Thermo Scientific). Superscript III reverse
transcriptase and random hexamer primers (Applied Biosystems) were used to
synthesize cDNA. qPCR was set up and performed using the SYBR Green
Master Mix (Applied Biosystems), and relative quantification was employed to
analyze the change in gene expression using gyrB as a housekeeping gene.

In-silico predictions

Sequence alignments

The protein sequence of SA1401 (BmrS) was downloaded from UniProt [90] and
used to identify protein domains using Pfam [91] and InterPro [92]. HMMER [93]
was employed to identify orthologs, searching against a non-redundant Uniprot
database. The most representative species were selected to perform a multiple
sequence alignment using PRALINE [94]. The multiple sequence alignments

47
were then used to build a hidden Markov model to determine distant homologs
using hmmsearch. Those candidates that did not contain an spfh gene in the
same operon are considered non-homolog and were discarded.

Structural prediction analyses

Structural analysis prediction was performed applying the following bioinformatic

tools: (i) IUPred2A software for disordered and structured regions prediction [95];
(ii) Blast2ogo for the visualization of the conserved amino acid motifs [96]; (iii)
PSIPRED for the secondary structure predictions and hydrophobicity distribution
[97]; (iv) Heliquest software for calculating the physicochemical properties of the
alpha helixes [98], and (v) RaptorX was used to predict the in silico structural
model.

Phenotypic assays

Determination of the minimum inhibitory concentration (MIC)

The MIC was determined using the microdilution technique [99]. Briefly, bacterial
cultures grown overnight in Mueller-Hinton media (MH) were adjusted to an OD600
of 0.2 and diluted 1/10 in fresh medium to obtain a concentration of approximately
106 CFU ml-1. 75 µl of each standardized inoculum was mixed with 75 µl of MH
containing different antibiotic concentrations in a 96 well plate and incubated the
plate at 37° C for 16 h without agitation. All assays were in triplicate, and the
ranges and concentrations of antibiotics were established by applying the
EUCAST criteria [100]. The MIC was defined as the lowest antibiotic
concentration at which bacterial growth was inhibited.

48
Hemolysis Activity

Hemolysin was tested on TSB agar supplemented with 1 % of heparinized sheep

blood. Briefly, overnight cultures in TSB were adjusted an OD600 of 0.6, and 20 µl
of each suspension was spotted onto the TSB agar with 1 % of sheep blood.
Plates were incubated at 37 °C for 48 h, and the degree of hemolysis was
determined by measuring the transparent zone surrounding the colonies.

Whole blood and plasma killing assay

Blood was drawn from the submandibular vein of seven-week-old BALB/ mice
and collected in a 1.5 ml tube containing EDTA as an anticoagulant. Bacteria
were washed twice with PBS, diluted to an inoculum size of 10 4 in 50 µl, and
mixed with 150 µl of fresh blood or plasma in a 96 well-plate. Then, the plate was
incubated at 37 °C for two hours, at which aliquots were taken, diluted serially in
PBS, and plated onto TSA to CFU enumeration.

Neutrophil killing assay

Seven-week-old female BALB/cJ (n = 4) mice were sacrificed by CO2 inhalation,

and tibia and femurs were collected. Neutrophils were purified from bone marrow
by density centrifugation using the Ficoll-Hytopaque medium [101].
Approximately 2x104 neutrophils were transferred to a low-attached, round
bottom 96 well-plate to rest for 1 h at 37 °C and 5 % CO2 in D10 media
(Dulbecco's modified Eagle's medium [DMEM] plus 10 % FBS). In parallel,
overnight cultures in RPMI were washed twice in PBS, diluted 100-fold in non-
heat-inactivated fetal bovine serum, and placed on ice for 1 h to opsonize. Then
bacteria were transferred to the plates with (MOI = 2) or without neutrophils and
incubated at 37 °C and 5 % CO2. Bacteria viability was evaluated after 1 h of
incubation by plating the serial dilution on TSA. Survival percentage was
calculated by comparing the bacterial count from the plates with neutrophils to
the plates without neutrophils.

49
Mouse infection studies

S. aureus strains were streaked from -80 °C stock onto TSA and grown overnight
at 37 °C. A single colony was used to inoculated 10 ml of RPMI in a 100 ml flask
aeration culture and grown for 16 h at 37 °C with shaking. Bacteria were collected,
washed three times in ice-cold PBS, and resuspended to a final concentration of
4X109 CFU ml-1 in ice-cold PBS. For infection, cohorts of approximately seven-
weeks-old BALB/c mice (n = 10) were infected via intraperitoneal injection with
100 µl containing 4X108 CFU. For bacterial burden quantification, mice were
sacrificed after 48 h post-infection, and organs were sterilely collected in PBS,
homogenized, serially diluted in PBS, and plated on mannitol salt agar for
bacterial enumeration.

Oxidant susceptibility assays

All experiments were carried out using bacterial cultures grown in RPMI at 37 ⁰C
with shaking, keeping a medium to flask volume ratio of 1/10 for aeration. Cells
were collected by centrifugation, washed three times, and resuspended in PSB
to a final concentration of ~1x106 CFU ml-1 for H2O2 and diamide treatments and
~1x109 CFU ml-1 for sodium hypochlorite treatment. Subsequently, the respective
bacterial suspensions were exposed to H2O2 (5 mM), diamide (20 mM) for 45 min,
and sodium hypochlorite (10 mM) for 15 min. Surviving bacteria were counted by
serial dilution in PBS and plating onto TSA.

S. aureus kinetic growth curves

Growth curves were carried out on a 96-well plate using 200 µl of media. The
plate was incubated in an epoch 2 plate reader (BioTek, Winooski, VT) at 37 °C
with linear shaking at 567 cpm (3-mm excursion) for 24 h, taking the OD600 every
30 min or 60 min. Briefly, overnight cultures were grown in TSB or RPMI media,
washed twice with 1X PBS, and diluted to an OD600 of 0.01 for each growth curve.
Bacterial cultures were challenged with menadione (20 mM) and 10 mM of (Z)-1-

50
[N-(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA
NONOate), was used as NO• donor.

Susceptibility to thioridazine

Cells were grown overnight in RPMI, diluted to ~4X107 CFU ml-1 into fresh
medium, and challenged with 200 µg ml-1 of thioridazine hydrochloride. Treated
and untreated cultures were incubated for three hours with shaking. After the
incubation, cells were recovered by centrifugation at 5000 g for 15 min,
resuspended in the same volume of PBS, and CFUs were determined using the
microdilution technique.

Metabolic measurements

Determination of acetate, lactate, and glucose

Cells were grown in either TSB or RPMI. 100 µl of bacterial cultures were taken
and centrifugated for 10 min at 5000 g. The supernatant was removed and stored
at -20 °C until further sample processing. Glucose, acetate, and lactate were
determined using the commercial kits from R-Biopharm, Inc. (Marshall, Mich.),
according to the manufacturer's instructions.

Succinate and G3P measurements

Overnight cultures grown in RMPI media were washed twice with PBS and
adjusted to a final concentration of ~1x106 CFU ml-1. The bacterial suspensions
were then treated with 5 mM of H2O2 for 45 min and plated on TSB-agar. After
overnight incubation at 37 °C, bacteria growth was harvested by scraping the
biomass from the plates and resuspended in PBS. Cells were then washed three
times by rounds of centrifugation and resuspension in 1X PBS and adjusted to a
final OD600nm of 0.2 before the lysis with 25 μg ml-1 of lysostaphin. Unbroken cells

51
were removed by centrifugation, and supernatants were taken to measure the
intracellular concentrations of succinate and G3P, using the colorimetric/
fluorometric assay kits, Sigma-Aldrich, catalog MAK184-1KT and MAK20,
respectively, following the manufacturer's instructions.

Oxygen consumption

Extracellular oxygen consumption assay (Abcam, ab197243) was used

according to the manufacturer's instructions. Briefly, overnight cultures in RPMI
were harvested, washed two times in PBS, and resuspended at approximately
1x107 CFU/150 µml in fresh RMPI media. A 150 µl of cell suspension was
transferred into each well of a 96-well Costar 3603 plate (black plate with clear
bottom). Ten microliters of the Extracellular Oxygen Consumption Reagent (final
concentration 10 µg m-1) were added into the samples and mixed gently by
pipetting up and down. Immediately before measuring the fluorescence, 100 µl of
highly sensitive mineral oil was added to each well and, the signal was read
(EX/EM: 380/650 nm) every 90 sec for 90 min using a Tecan microplate reader.

Membrane potential

Membrane potential was measured using the BacLight Bacterial Membrane

Potential Kit (ThermoFisher). Strains were grown in RPMI, and cells were diluted
to approximately 1x108 CFU/ml. 200 μl bacterial suspensions were transferred to
a Costar 3603 plate (black plate with clear bottom), and 30 μM of DiOC2(3) dye
was added to each well, and red and green fluorescence was detected (EX 488,
EM 525, and 613 nm) every 5 min for 15 min using a Tecan plate reader. The
maximum red: green fluorescence ratio was taken as the value for relative
membrane potential.

52
Determination of intracellular ATP levels

ATP levels in H2O2-treated and untreated cells were measured using the
BacTiter-Glo reagent (Promega). S. aureus strains were grown in RPMI media
supplemented with 0.5 % of casamino acids (see growth conditions). Cells were
harvested, washed twice with PBS, and diluted at OD600 of 0.1 in PBS. Bacterial
suspensions were treated with 50 mM of H2O2 and incubated for 45 min at 37 °C
with shaking. Then equal amount (100 µl) of bacterial suspension and BacTiter-
Glo reagent were added into a black plate (Costar 3606), and luminescence was
recorded after 15 min of incubation in the dark.

Intracellular ROS measurement

The cell-permeable dye, MitoSOXTM Red (Life Technologies), was used to

measure the superoxide radical in cell culture. 10 ml of overnight cultures grown
in RPMI were harvested, washed twice, and diluted at OD600 of 0.1 in PBS to treat
with 50 mM of H2O2 and incubated for 45 min at 37 °C with shaking. Treated and
untreated suspensions were subsequently washed three times with PBS,
resuspended in fresh PBS containing 5 µM of MitoSOX TM, and incubated for 15
min at 37 °C with shaking. 200 µl of the stained solution (quadruplicates) were
transferred to a Costar 3603 plate (black plate with clear bottom), and the
fluorescence and OD600 of each well were immediately measured (EX/EM:
510/580 nm) using a Tecan plate reader. Fluorescence was normalized to the
OD600 of each well.

OH• (hydroxyl radical) measurements

Aminophenyl fluorescein (APF) (Thermo Fisher Scientific) probe was used to

detect the formation of •OH in bacterial cultures upon exposure to H 2O2.
Overnight cultures grown in RPMI were washed twice with PBS, diluted to an
OD600 of 0.1, and added into a black plate (Costar 3606) in quadruplicate. H 2O2
was added to a final concentration of 5 mM for the treated samples. APF was

53
added to all samples at 25 µM final concentration, and the plate was incubated
with shaking at 37 °C for 1 h. Fluorescence and the OD600 were measured
(EX/EM: 485/528 nm) on a Cytation 5 (Bio Tek). Fluorescence was normalized
to the CFU of each well.

Disk diffusion assay for sodium azide

Overnight cultures in RPMI were washed twice with PBS and adjusted at 106
CFU/ml, and 100 µl of the bacterial suspension was plated on TSA plate. A 2 M
stock solution of sodium azide was sterilized by filtration. 10 mm (diameter) disks
were impregnated with 100 µl of the sodium azide stock, and the disks were
placed onto the inoculated TSA plates. Disks containing RPMI media were used
as growth controls. Plates were incubated at 37 °C, and the zone of inhibition was
read at 24 h.

Protein analysis assays

Isolation of membrane extract from S. aureus cultures

For membranes isolation, strains were grown in 50 ml of RPMI with shaking. Cells
were collected by centrifugation at 5000 g for 15 min, washed twice with PBS,
and resuspended in 5 ml of lysis buffer (1 X PBS, 10 mM of MgCl2, 25 μg ml-1
lysostaphin, and 1 mM PMSF), and incubated at 37°C for 30 min. Then glass
beads were added, followed by mechanical disruption using a Geno/Grinder®
(three cycles of 90 s each at 1500 rpm); debris and unbroken cells were removed
by centrifugation (15,000 g, 15 min, 4°C). The supernatant was consequently
centrifuged at 150,000 g for 1 h, 4°C. The membrane pellet was resuspended in
PBS, 1% of n-dodecyl β-D-maltoside (DDM), and 10% (v/v) glycerol, and stored
at -80°C.

54
DRM/DSM membrane fractionation

CelLyticä MEM Protein Extraction Kit (Sigma-Aldrich) was used to isolate

hydrophobic and FMMs associated proteins from cellular membrane extracts.
Phase separation was performed according to the manufacturer's instructions
with some modifications. Briefly, approximately 1 µg of membrane extract was
mixed with 600 µl of lysis and separation buffer. Detergent solubilization was
carried out overnight at 4 °C with orbital shaking. The insoluble material was
removed by centrifugation (17000 g at 4 °C), and the supernatant was transferred
to a clean tube. For separation, membrane supernatants were consequently
incubated at 37 ºC for 15 min and centrifuged at 3.000 g for 3 min. The upper
hydrophilic phase (DSM) was transferred to a clean tube and store at 4 ºC before
processing. The lower hydrophobic phase (DRM) was washed three times with
PBS, repeating the previous incubation and centrifugation steps. The DRM was
resuspended in 200 μl Laemmli buffer, and 5 μl loaded on an SDS-PAGE gel.

SDS-PAGE and immunoblot analysis

Immunoblotting was carried out using standard protocols, as previously

described [102]. Approximately 80 ng of either protein extracts or purified protein
were loaded and separated on a 12% SDS-PAGE gel. Proteins were
subsequently transferred from the gel to nitrocellulose membrane using the wet
transfer system for 90 min [102]. After blotting, the membrane was blocked with
10 % (w/v) skim milk supplemented with 1 % of human serum for 1 h, and then
incubated with primary antibodies overnight, followed by 1 h incubation with
secondary antibodies. Antibodies were used as follows: anti-BmrS (1:10000;
Davis-Bio), -GFP (1:5000; Invitrogen), -FLAG (1:5000; Sigma-Aldrich), -GroEL
(1:5000, Sigma-Aldrich), -FloA (1:10000;), chicken IgY-HRP (1:500; Life
Technologies), -mouse IgG-HRP (1:10,000; Life Technologies) and -rabbit IgG-
HRP (1:20,000; Bio-Rad). Chemiluminescence was recorded with the ChemiDoc
touch system (BioRad).

55
Glycerol gradients

Solubilized membrane fraction (200 mg) was layered on a 10%–30% linear

glycerol gradient generated by a Biocomp gradient maker. Centrifugation was
performed in an SW55ti rotor (Beckman) at 150000 g for 16 h at 4 °C. Fractions
of 350 µl were collected from the top of the gradient, and proteins associated with
each fraction were precipitated by adding 10% trichloroacetic acid. Protein
fractions were dried and resuspended in sample buffer (10% SDS, 500mM DTT,
50% Glycerol, 250mM Tris-HCL, and 0.5% bromophenol blue dye, pH 6.8.)
before SDS-PAGE and immunoblotting analyses.

Blue native gels

Blue Native PAGE (BN-PAGE) was carried out using the Novex NativePAGE Bis-
Tris system (Life Technologies) according to the manufacturer's instruction with
some modification. Isolated membrane extracts were solubilized overnight at 4 °C
in 1X Native PAGE sample buffer containing 1 % DDM. Insoluble material was
separated by centrifugation (15,000 g, 20 min, 4 °C), and 100 μg solubilized
membranes were loaded onto 4 ± 16 % gradient gels and ran for 30 min at 150
V following of 60 min at 250 V. After electrophoresis, the gel was carefully
removed and soaked into a solution of PBS 1X, 1% SDS, rinsed with distilled
water and the lanes of interest were removed.

Second dimension SDS PAGE (2D SDS-PAGE)

Excised lanes from the Native-PAGE gel were immobilized horizontally on top of
a 12% SDS-PAGE gel. For PAGE separation, the gels were run using constant
voltage (140 V) for approximately 1-2 hours. After electrophoresis and blotting,
nitrocellulose membranes were blocked with 5 % skimmed milk containing 1% of
human serum for 1 hour, and the primary antibodies were incubated overnight at
4 °C. Chemiluminescence was recorded with the ChemiDoc touch system
(BioRad) using several exposure times.

56
Pull-down analysis

Pull-down experiments were done using Ni-NTA resin (QIAGEN). Membrane

extracts from S. aureus expressed a His6-tagged BmrS were resuspended in
binding buffer (50 mM Tris-HCl, 500 mM NaCl, 10% glycerol and, 10 mM
imidazole). Before protein biding, nickel resin was equilibrated by adding 50 µl of
resin into the Eppendorf tube and performed three centrifugation cycles and
washed with 20 volumes binding buffer. 1 ml of the dissolved membrane was
consequently mixed with equilibrated resin and incubated at 4 °C with end-over-
end agitation during 3 h. Then the resin was washed two times with wash buffer
1 (50 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 20 mM imidazole) and washed
two times with buffer 2 (50 mM Tris-HCl, 500 mM NaCl, 10% glycerol, 50 mM
imidazole). BmrS and its interacting protein partners were eluted by adding 80 µl
of 4X protein sample buffer and boiled for 10 min at 95 °C.

Protein quantification by mass spectrometry

To determine the proteins by LC-MS, samples were first digested with 0.5 mg
LysC (Wako) followed by treatment with 0.5 mg trypsin (Promega). Then sodium
deoxycholate was removed by ethyl acetate extraction, and samples were dried
using a vacuum concentrator. The excess of salt in the samples was removed
using C18 stage tips with five C18 Empore SPE disks (3M) and eluted with 60%
(v/v) acetonitrile/0.1% (v/v) formic acid. NanoLC-MS/MS analyses were carried
out on an Orbitrap Fusion instrument equipped with an EASY-Spray Ion Source
coupled to an EASY-nLC 1000 (Thermo Scientific). Digested samples were
loaded on a trapping column (2 cm x 75 mm ID, PepMap C18,3 mm particles,
100 A˚ pore size) and separated on an EASY-Spray column (25 cm x 75 mm ID,
PepMap C18, 2 mm particles, 100 A˚ pore size) with a 120-min linear gradient
from 3%–32% acetonitrile and 0.1% formic acid. MS scans were acquired in the
Orbitrap analyzer at a resolution of 120,000 at m/z 200. For data analysis, MS
raw data file processing, database searches, and quantification, we used
MaxQuant v1.5.3.30. The search was performed against an S. aureus database
in UniProt using N315 proteome as reference.

57
SA1401 expression and purification

The pET28a vector was used to express and purify SA1401 and the variant
lacking the N-terminal region. Primers SA1401FNcoI and SA1401RXhoI
amplified the full-length SA1401 to clone this gene in frame with the His-tag at
the C-terminal end (Table 2). For the soluble SA1401 variant, the forward primer
V1SA1401FNcoI was designed to remove the first 30 aa. All constructs are under
the control of the T7 promoter. The two recombinant proteins were overexpressed
in E. coli BL21-Gold (Novagen). The culture was inoculated with a single colony
from the freshly transformed plate, and the cells were grown at 30 °C for 24 h in
the autoinduction medium (2xTY supplemented with 1xNPS salts [100 mM
PO43−, 25 mM SO42−, 50 mM NH4+, 100 mM Na+, 50 mM K+], 1mM MgSO4, 0.5
% glycerol, 0.05 % glucose, 0.2 % a-lactose).

After incubation, cells were pelleted at 5000 g for 20 min and resuspended in lysis
buffer (lysozyme 1mg/ml [Sigma-Aldrich], 50 mM Tris-HCl pH 8, NaCl 500 mM,
10 % glycerol, protease inhibitor complete tablets [Sigma-Aldrich] and DNAse
0.1 µg/ml ) and incubated for 10 min at 37 °C. The suspensions were lysed
mechanically by sonication (8 cycles, 50% amplitude, 0.1 pulses), and lysates
were cleared by centrifugation (15.000 g, 15 min, 4°C). The extract for the full-
length SA1401 was ultracentrifuged at 150.000 g for 1 h to separate membrane,
and the membranes were solubilized with 0.5% DDM, followed by
ultracentrifugation (1 h, 100,000 g) to remove insoluble membranes.

Protein extracts were passed through a Ni-NTA agarose column (GE Healthcare)
1ml using AKTA Purifier System (GE Healthcare) and equilibrated with 50 mM
Tris-HCl pH 7.5, 500 mM NaCl, 10% glycerol, 10 mM imidazole buffer. Proteins
were eluted with 250 mM imidazole-containing buffer, and the purity was
analyzed by SDS-PAGE. Elution fractions were pulled and subjected to buffer
exchange using PD-10 desalting columns (GE Healthcare), equilibrated with
buffer: 50 mM Hepes pH=7.5, 100 mM NaCl, 0.05 % DDM. Protein was
concentrated using 500 Vivaspin concentrators (GE Healthcare) and further

58
purified by ion-exchange using 1ml HiTrap Q HP columns and AKTA Purifier
System (GE Healthcare). Elution was performed using 50 mM Hepes pH=7.5,
0.05 % DDM and salt gradient: 0.1 M NaCl. For soluble variants of SA1401, all
the buffers were the same except for the presence of the DDM detergent. For
storage, proteins were flash-frozen in liquid N2 and kept at -80 °C.

Protein-lipid assays

Protein-lipid interactions: co-sedimentation assay

The co-sedimentation assay was used to analyze protein-lipid interaction. Lipids

stocks were prepared by resuspending dried lipids (Sigma and Avanti Lipids) in
chloroform at 10 mg.ml-1. For the co-sedimentation assay, 0.2 mg.ml-1of each
lipid was taken and dried under the N2 stream followed by evaporation in a
vacuum for 1 h at room temperature (RT). The dried lipid film was resuspended
in the reaction buffer: 50 mM Hepes pH=7.5, 350 mM NaCl and hydrated in this
buffer for 30 min at RT. Large unilamellar vesicles (LUVs) were obtained by
extruding the lipids through 400 nm membrane using Mini Extruder System
(Avanti Lipids). Final vesicle suspensions were stored at 4 °C for not more than
a week. Proteins at 0.2 mg.ml-1 stored in the buffer: 50 mM Hepes pH=7.5, 350
mM NaCl, ± 0.02% DDM, were mixed at 1:1 ratio with lipids (20 µl of each) and
incubated with mild shaking at RT for 30 min. The lipid-protein mix was
centrifuged for 45 min at 20 000 x g in order to pellet lipids and potential lipid-
protein complexes. The supernatant was carefully collected to a separate tube,
and both supernatant and pellet content were analyzed by SDS-PAGE.

Negative-staining electron microscopy (EM)

Proteins, lipids, and protein-lipid complexes were visualized by negative staining

electron microscopy. 5 µl of the sample was deposited on carbon-coated copper
grids and incubated for 2 min at RT. The excess of the liquid was blotted off with
Whatman paper N° 1, and the grid was put over a drop of 2% solution of Uranyl

59
Acetate and incubated for 2 min. The stain excess was again blotted off, and the
grid was let for 30 min to dry at RT before analyzing at transmission electron
microscope JEOL JEM 1011 equipped with Gatan Erlangshen ES1000Ww
camera.

Microscopy of S. aureus cells

Fluorescence microscopy

S. aureus bearing a pJL74-sa1401-gfp was grown in TSB and TSB containing 5

mM of H2O2. After incubation, cells were harvested and immediately fixed with a
solution of 4 % (v/v) paraformaldehyde and incubated at room temperature for 15
min. After three washes with 1X PBS, cells were resuspended in 200 µl of 1X
PBS buffer, and 10 µl of fixed cells were mounted on a microscope slide, which
contains 1 % agarose pad. Microscopy images were taken on a Leica DMI6000B
microscope equipped with a Leica CRT6000 illumination system (Leica). The
GFP fluorescence signal was detected using an excitation filter 488 nm and an
emission filter 510 nm. STED microscopy was carried out using a Leica SP8 TCS
STED system (Leica Microsystems) with LAS X v 2.0.1. software (Leica
Microsystems) for acquisition control. Single optical slices were acquired with an
HC PL APO CS2 100x/1.40 N.A. oil objective (Leica Microsystems), a scanning
format of 1,024 × 1,024, 12-bit sampling, and 10x zoom, yielding a pixel
dimension of 11.3 nm and 11.3 nm in the x and y dimensions, respectively. Linear
image processing was done using Leica Application Suite Advanced
Fluorescence Software and Fiji software.

Nanogold immunolabeling of the S. aureus cells

Experiments were conducted using S. aureus strains grown in TSB, comparing

H2O2-treated cells versus untreated. A 1/500 dilution from the overnight culture
was inoculated in fresh TSB and TSB supplemented with 5 mM of H2O2. Bacterial
cultures were incubated at 37 °C for 24 h or until the H2O2-treated cultures started

60
growing. Cells were harvested and immediately fixed with a solution of 4 % (v/v)
paraformaldehyde and 0.1 % (v/v) glutaraldehyde in 1x PBS and incubated at
4 °C for 45 min. Fixed cells were rinsed with PBS and dehydrated in a graded
ethanol series and progressively cryo substituted in 40C methanol/0.5% uranyl
acetate before embedding in Lowicryl HM20 resin and thin-sectioning (100 nm)
with a Leica EM UC6 ultramicrotome. For immunogold labeling, grids were
incubated with rabbit anti-GFP antibody (1:50) and gold-conjugated anti-rabbit
antibody (BBI; gold particles 10 nm diameter, dilution 1:40). Samples were
negatively stained with 2% uranyl acetate, and images were acquired with a JEM
1011 transmission electron microscope (JEOL; 100 kV) and a Gatan Erlangshen
ES1000W camera.

Statistical analyses

Statistical analyses were conducted using SigmaPlot software Inc (version 14).
Graphs are the representation of four independent replicates, and each
experiment includes four technical repetitions. The error bars represent the
standard error of the mean (mean ± SD). Statistical significance between the two
groups was assessed using a parametric Student's t-test with Welch's correction
or nonparametric Mann-Whitney test. We applied a parametric one-way or two-
way ANOVA test or nonparametric Kruskal-Wallis or Bonferroni tests to compare
three or more groups. Post-analysis included multiple comparisons of Tukey's
test, Dunnett's test, Dunn's tests, or Wilconson text for the paired data set.
Significant differences were considered when the p-value was smaller than 0.05.
Statistical significance: nothing = not statistically significant, * p<0.05, ** p<0.01,
*** p<0.001.

61
Results

63
Operon organization and bioinformatic analysis

In this work, we studied a staphylococcal protein, BmrS (Bacterial Membrane

Remodeling System), that is co-transcribed with the spfh (floA) gene (Fig 5). In
the reference strain, N315, the bmrS gene is annotated as sa1401, encoding for
an unknown function protein [14, 65]. We initially searched for homologs to
determine the protein distribution using HMMER [93]. BmrS was mostly
conserved among Staphylococcus and other Firmicutes species (Fig. 6).
Consistent with the operon architecture in S. aureus, all predicted proteins shared
the same genomic location next to an spfh-encoding gene, validating the
predicted matches and suggesting the widespread distribution of BmrS in
Firmicutes (Fig. 6).

64
Figure 6. Taxonomic classification of BmrS based on the amino acid sequence. (a) Multiple
alignment sequences using the PRALINE server [94]. Protein homologs were obtained using
Hmmer software and manually validated by the presence of an SPFH protein in the operon. The
sequences showing different identities were then extracted and aligned. (b) Phylogenetic tree of
the multiple sequence alignment. (c) Pie chart showing the taxonomic distribution of BmrS in
bacteria.

Our previous analyses did not allow us to assess whether there are remote
orthologs outside of Firmicutes due to the amino acid sequence variability (Fig.
6a). Usually, remotely conserved proteins might be detected by increasing the
dataset and evaluating a diverse group of sequences to fill the gap with potential
linkers, facilitating the discovery of new candidates [103]. Thus, we selected
sequences of some BmrS orthologs considering those with different percentages
of identity to align them and generate a profile used as a query to find proteins in
curated databases (Fig. 6a, b).

The alignment showed that the N-terminal region shared a few residues while the
C-terminal was the most conserved region (Fig. 6a). We subsequently used this
alignment as the template to build an HMM profile and looked for remote
homologs using the hmmsearch tool of HMMER [93]. As shown in Fig 6c, many
proteins were still found in the Firmicutes phylum. Yet, we could detect new
protein with low similarity sequences in members of Proteobacteria,
Actinomycetes Spirochaetes, Verrucomicrobia, and Planctomycetes phyla,

65
indicating that BmrS could be present in other bacterial phyla (Fig. 6c); further
experimental validations are necessary to confirm these findings.

To get further in-silico insights into the functional and structural organization of
BmrS, we predicted protein domains and the secondary structure (Fig. 7). Our
search did not find any known functional-domain or any association with a protein
family. Secondary prediction revealed that BmrS predominantly has an α-helical
conformation (Fig. 7a), where the N-terminal (aa 3- aa 23) contains a hydrophobic
α-helix followed by a shorter polar fragment (Fig. 7a, b). Analysis of this region
by HELIQUEST [98] showed polar and nonpolar residues, suggesting the
amphipathic properties (Fig. 7b, c), which is known to mediate the binding of
many membrane proteins to anionic phospholipids [104, 105]. Besides, the
central part of the BmrS was predicted to have two disorder fragments (Fig. 7d)
(IUPred predictor) [95]. One from aa 22 to aa 46, and the second from aa 62 to
aa 139 (Fig. 7d), all of which coincides with a proline-rich region conserved
among the Staphylococcus species (Fig. 7e).

66
67
Figure 7. Structural prediction of BmrS. (a) Secondary structure predictions of BmrS using
PSIPRED [97]. Pink box: α-helix; yellow box: β-sheets; blue box: confidence prediction; black line:
random coil. (b) Hydrophobic and hydrophilic classification of the BmrS residues (PSIPRED) [97].
(c) Helical wheel projection of the N-region of BmrS using HELIQUEST. Positively charged
residues are shown as violet circles and hydrophobic residues as yellow circles. (d) Intrinsically
disorder residues were identified using IUPred2 and ANCHOR2 servers. Prediction assigns each
residue a score between 0 and 1, representing the probability of being disordered. (e) Blast2logo
visualization. The logo represents the consensus residues of BmrS among Staphylococcus
species. (f) Predicted BmrS 3D model using the Ab initio algorithm, RaptorX. (g) Cartoon showing
the principal predicted regions of BmrS.

Finally, the C-terminus consists of three consecutive short α-helices (aa 137- aa
227), which have a structured domain from the aa 196 to aa 232 (Fig. 7a and d).
In-silico 3D structure prediction (Fig. 7f) shows an overall fold with the dimensions
of 50 x 80 Å, with the extended vertically N-terminal α-helix. The disorder region
bridges to the long horizontal α-helix and the C-terminal short α-helixes. Together,
our bioinformatic predictions suggested that BmrS contains three relevant
regions: (i) the N-terminal anchored region, (ii) the disordered region, and (iii) the
highly conserved C-terminal end that shows the highest similarity to orthologs in
other bacterial species (Fig. 7g).

BmrS is important for S. aureus to cope with oxidative stress

We constructed a knockout mutant of bmrS and the complemented strain (C-

bmrS) to test phenotypic differences relative to the WT strain. TSB cultures at
37 C for 24 h showed no differences regarding growth rate, colony morphology,

68
hemolytic activity, and antibiotic resistance (Table 3 and Fig. 8), indicating no
defective phenotype of the mutant under standard laboratory conditions.

Antimicrobial agents W  C

Cecropin 0.2 0.2 0.2

Vancomycin 1.6 1.6 1.6
Oxacillin 6.25 6.25 6.25
Neomycin ≥200 ≥200 ≥200
Fosfomycin 64 64 64
Ciprofloxacin 2 2 2
Table 3. Minimum inhibitory concentration. Data correspond to the lowest concentration
(µg/ml) in which the growth was inhibited. WT strain is represented by W, bmrS by , and C-
bmrS by C.

69
Figure 8. Phenotypic characterization of bmrS. (a, b) Bacterial growth curves of the WT,
bmrS, and C-bmrS in TSB and RPMI media, respectively. WT strain is represented by W,
bmrS by , and C-bmrS by C. (c) Colony morphology after 48 h of incubation on TSB agar.
(d). Hemolytic activity. Bacterial suspensions were spotted on TSB-agar supplemented with 2 %
of sheep blood, and plates were incubated for 48 h. Bright halo denotes complete lysis of
erythrocytes (β-hemolysis), while partial lysis refers (greenish halo) to α-hemolysis. WT strain is
represented by W, bmrS by , and C-bmrS by C. (e, f) A bacterial killing assay using
isopropanol and ethanol, respectively. Approximately 109 CFU/ml of each strain was treated with
30 % of isopropanol and 70 % ethanol, respectively, for 15 min. Surviving bacteria were counted
by serial dilution in PBS and plating onto TSA. The blue bar corresponds to the WT strain, the
pink bar to bmrS, black bar to C-bmrS.

S. aureus is part of the human microbiota colonizing the skin and the soft tissue;
however, when this bacterium reaches the bloodstream causes severe clinical
manifestations, becoming a life-threatening risk [106]. To simulate a more
realistic staphylococcal infection condition, we incubated bacteria with the whole
blood components (Fig. 9). Ex vivo whole blood assay is a well-known model to
evaluate the effect of immune factors on pathogens, mainly the susceptibility to
oxidative burst due to the high number of leukocytes [58]. Accordingly, the

70
incubation of the strains with the murine blood returned a much lower CFU count
in bmrS than either wild type or C-bmrS (Fig. 9a).

These differences in killing can be explained by either the complement or the

phagocyte activity. To distinguish between both possibilities (complement- or
phagocytic-dependent killing), we isolated neutrophils from mice bone marrow
and plasma from mice blood and challenged bacteria to evaluate the survival rate
in the presence of these immune factors. Neutrophils were incubated with S.
aureus (4x106 CFU) at a multiplicity of infection (MOI) of 2 for 1h. The rate of
bacterial killing was calculated from the decrease in the CFU after incubation.
The WT strain showed a higher survival rate than bmrS, and phenotype was
rescued in the C-bmrS (Fig. 9b). No differences in bacterial counts were seen
between WT and the mutant using plasma (Fig. 9c), concluding that BmrS is
important for S. aureus to mediate the resistance to phagocytic-dependent killing
rather than opsonization.

Figure 9. bmrS deletion affects the resistance to phagocytic-dependent killing. Bacterial

survival of WT, bmrS, and C-bmrS in the presence of blood, plasma, and neutrophils isolated
from mice (a) Whole blood assay using 104 CFU/50µl of each strain and mixed with 150 µl of
mouse blood and incubated during 1 h. (b) Neutrophils were mixed with bacteria to an MOI of 2
and incubated during 1 h. (c) Plasma was isolated from total mouse blood and mixed with the
strains using the same ration as the whole blood assay. Data are the representation of four
independent replicates, where the blue bar-W corresponds to the WT strain, pink bar- to bmrS,
black bar-C to C-bmrS. Data were analyzed using the Mann-Whitney Rank Sum Test, *p < 0.05,
and the error bars represent the standard error.

One of the principal mechanisms of neutrophils to control infections is the release

of free radicals [107]. Thus, we assessed the resistance of the strains to five

71
oxidant agents: H2O2 (5 mM), sodium hypochlorite (10 mM), diamide (20 mM),
menadione (10 mM), and DETA nonoate (10 mM) as a donor NO•. In all cases,
bmrS showed a significant decrease in CFU number and growth delay
compared to the WT and C-bmrS strains (Fig. 10). No differences were
observed when used other antimicrobial agents such as ethanol, isopropanol, or
antibiotics (i.e., vancomycin, oxacillin, fosfomycin, and ciprofloxacin) (Table 3 and
Fig. 8e and f), suggesting the poor survival of the mutant in blood was due to an
increased sensibility to free radicals from immune cells.

Figure 10. bmrS deletion affects the tolerance to oxidizing agents. (a) H2O2 bacterial killing
assay. Approximately 106 CFU/ml of each strain was challenged with 5 mM H2O2 for 45 min and
then plated to determine the CFC/ml. (b) NaCIO bacterial killing assay. Approximately 109 CFU/ml
of each strain was treated with 10 mM of NaCIO for 15 min. (c) Diamide bacterial killing assay.
Bacterial strains (106 CFU/ml) were challenged with 20 mM of diamide for 45 min. Surviving
bacteria were counted by serial dilution in PBS and plating onto TSA. The blue bar corresponds
to the WT strain, pink to bmrS, black to C-bmrS. (d, e) Effect of NO• and menadione on
bacterial growth, respectively. An overnight culture of each strain was diluted (1:1000) in fresh
TSB supplemented with 10 mM of DETA NONOate and 20 mM of menadione, respectively, and
incubated for 24 h. WT strain is represented by W, bmrS by , and C-bmrS by C. Statistical
analysis, one-way ANOVA with Tukey's or Kruskal-Wallis for nonparametric statistics ***p < 0.001.

72
Finally, to demonstrate the potential role of bmrS in pathogenesis, we performed
in vivo studies, infecting mice intraperitoneally (4x108 CFU) and allowed the
infection to progress for 48 h before bacterial counting (Fig 11). The systemic
infection model has been employed to evaluate the colonization capacity, where
bacteria preferentially invade kidneys, liver, and heart [26]. Infected livers,
spleens, and kidneys exhibited significantly higher bacterial burdens
(approximately 2 logs) in the WT than respect to the bmrS strain, which
considerably diminished the colonization of these organs (Fig. 11a, b, and c). In
contrast, we did not detect any differences in hearts and lungs (Fig. 11d and e),
indicating that BmrS might be required to colonize murine liver, spleen, and
kidneys.

Figure 11. bmrS is defective in organ colonization. Bacterial load in the liver (a), spleen (b),
kidneys (c), heart (d), and lungs (e) of infected mice via intraperitoneal injection with 100 µl
containing 4x108 CFU (n=10), statistical analysis, Mann-Whitney Rank Sum Test, ***p < 0.001. W
represents the WT strain and  the mutant (bmrS) strain. Each figure is the average of ten
independent organs. Statistical analysis, one-way ANOVA with Tukey's comparison, ***p < 0.001,
*p < 0.05.

73
BmrS reduces oxidative metabolism under oxidative stress conditions

During infections, the ROS and NO• released from neutrophils and macrophages
target the respiratory chain of S. aureus, and the pathogen induces fermentation
to circumvent the negative effect of these radicals [29, 40]. We hypothesized that
the reduced growth of bmrS in the presence of H2O2 and NO• (Fig. 10a and d)
would result from deficiencies in fermentative metabolism [28, 29]. We measured
extracellular lactate and acetate as the most abundant fermentation products in
S. aureus (Fig. 12) [19, 28]. Lactate is mainly secreted during anaerobic growth
coming from the pyruvate reduction with the concomitant reoxidation of NADH
(anaerobic fermentation) [22] or when bacteria cannot undergo respiration due to
a deficiency in their ETC [39]. None of the strains had changes in lactate
concentration, even after H2O2 exposure (Fig. 12a, b), indicating that anaerobic
fermentation was not altered under these conditions, and the mutant can respire
aerobically at the same level as the WT does.

Acetate quantification showed no variations during fermentation at the early

stationary phase. However, once bacteria entered into post-exponential growth,
we observed that bmrS catabolized acetate more rapidly than WT (12 h) (Fig.
12c), while the C-bmrS strain restricted the acetate assimilation from the culture
medium for almost eight hours after the entry to the post-exponential growth
phase (Fig. 12c). Curiously, in the treatment with H2O2, the mutant produced less
acetate than the WT and C-bmrS, which accumulated significantly more acid
(Fig. 12d). In agreement with previous observations, transcriptomic analyses by
qPCR corroborated the upregulation of the ackA gene in the C-bmrS, whereas
the mutant showed a slight reduction in its expression (Fig. 12e). Consistently,
increased mRNA levels of citB (a TCA cycle gene) were observed in bmrS
relative to WT and C-bmrS, suggesting the BmrS activity reduces the carbon
flow through the TCA cycle (Fig. 12f).

74
Figure 12. BrmS influence the aerobic fermentation. (a) Lactate quantification was carried out
in TSB containing 0.25 % of glucose. At 3 h intervals, the samples were removed, and lactate
concentration was determined in the supernatant for 24 h of growth. (b) Lactate quantification in
the presence of H2O2. Lactate was quantified after overnight incubation in TSB glucose using

75
pretreated cells with 5 mM of H2O2. (c) Acetic acid quantification was carried out following the
previous growing conditions. At 3 h intervals, the samples were removed, and acetate
concentration was determined in the supernatant for 24 h. (d) Acetate quantification in the
presence of H2O2. Acetate was quantified after overnight incubation in TSB glucose using
pretreated cells with 5 mM of H2O2. The blue bar and W correspond to the WT strain, pink bar,
and  symbol to bmrS, black bar, and C to C-bmrS. The data represents at least four
independent experiments. Statistical significance (*p≤ 0.05, **p≤ 0.01***P≤ 0.001 ANOVA test)
relative to WT. (e, f) Quantification of ackA and citB RNA levels by RT-qPCR in cultures grown in
TSB glucose for 5 h. Bar charts show normalized expression relative to gyrB. P<0.05, Kruskal-
Wallis, and multiple comparisons versus the control using Dunn’s method.

The impaired aerobic fermentation combined with the sensitivity to H2O2 and NO•
points that bmrS deletion might be affecting the aerobic metabolism in S. aureus.
To determine whether there is an unbalance in respiration, we initially measured
the oxygen consumption using a fluorescent dye (Fig. 13). The bmrS had
significantly greater oxygen consumption rates relative to WT and C-bmrS (Fig.
13a). In line with this result, the levels of intracellular ATP were higher in bmrS
when compared with the WT and C-bmrS strains (Fig. 13b). Interestingly, upon
the exposure to H2O2, the mutant dropped the intracellular ATP considerably in
comparison to the WT and C-bmrS (Fig. 13b), demonstrating the imbalance in
the aerobic respiration, which might destabilize the membrane potential upon
oxidative stress.

The ATP synthesis relies on generating a proton motive force across the
membrane, whose disruption causes electron and proton leakage [108]. We
measured membrane potential and the susceptibility to sodium azide, an
ATPase-inhibitors, to test the role of bmrS in this process [29, 109]. As expected,
bmrS reduced the membrane potential after 45 min of H2O2 treatment compared
to the WT and C-bmrS (Fig. 13c). Likewise, enhanced susceptibility was
observed in the mutant in the presence of azide-mediated ATPase-inhibition
relative to the other strains (Fig. 13d), suggesting that BmrS might stabilize the
respiratory chain oxidative under stress.

76
Figure 13. BmrS modulates the ETC. (a) Measurement of oxygen uptake using the Extracellular
O2 Consumption Assay (Abcam, Cambridge, MA). The higher the fluoresce, the less the oxygen
content. The oxygenate RPMI medium was inoculated with approximately 107 CFU/ml, and the
signal was read every 90 sec for 90 min. (b) Comparison of intracellular ATP levels in the WT,
bmrS, and C-bmrS before and after the treatment with H2O2. (c) The membrane potential of
WT, bmrS, and C-bmrS before and after the treatment using the BacLight Bacterial Membrane
Potential Kit (ThermoFisher). (d) Sodium azide susceptibility using the disk diffusion method. 100

77
µl of a bacterial suspension adjusted at 106 CFU/ml was plated on TSA agar. A disk impregnated
with 2 M of sodium azide was placed on the agar plates and incubated for 24 h. The graph
represents the bacterial inhibition diameter after incubation. (e) Intracellular ROS quantification.
Overnight cultures in RPMI were normalized at 4x10 8 CFU/ml and treated with 50 mM of H2O2,
followed by MitoSOXTM Red (Life Technologies) for O2•–. (f) •OH determination using APF
(Thermo Fisher Scientific). All data represent the average of 4 independent experiments where
the blue bar and W correspond to the WT strain, pink bar, and  symbol to bmrS, black bar, and
C to C-bmrS. Statistical significance (*P≤ 0.05, **P≤ 0.01 ***P≤ 0.001 ANOVA test and two-way
ANOVA), and the error bars represent the error standard.

Intracellular ROS is a natural consequence of aerobic metabolism, which remains

elevated when uncoupling electrons are generated [110]. The free radicals from
neutrophils and macrophages are uncouplers of OXPHOS due to the oxidation
of the ETC complexes, increasing the proton permeability (loss of membrane
potential) and allowing the generation of O2•–. Moreover, the released iron from
the sulfur-iron clusters might react with H2O2, producing the deleterious •OH
(Fenton reaction) [40]. To verify if bmrS generates more ROS due to the loss of
the membrane potential upon oxidative stress, we focused on analyzing the
production of O2•– and OH•, comparing cells treated with H2O2 versus untreated
controls (Fig. 13e and f). We used MitoSOX and APF for O2•– and •OH
quantification, respectively. bmrS showed remarkably higher intracellular ROS
and •OH production than WT and C-bmrS after H2O2 treatment (Fig. 13e and f),
demonstrating the increasing electron permeability of the mutant under stress
and suggesting that BmrS might relieve the overproduction of intracellular ROS
by stabilizing the ETC.

BmrS changes its oligomerization in the presence of ROS

The bioinformatics analysis and the localization with floA in the same operon
predicted that BmrS is a membrane protein (Fig. 7g), part of the FMMs in S.
aureus (Fig. 5). In order to experimentally validate these predictions, we
investigated the subcellular localization (Fig. 14) by carrying out a cellular
fractionation followed by (i) immunoblotting detection and (ii) DRM/DSM
membrane phase separation [84]. BmrS was exclusively found in the membrane
and associated with the DRM fraction (Fig. 14a and b). In many cases, DRM/DSM
fractionation may result in misleading positive results for what is convenient to

78
confirm the possible candidates by performing additional tests. Thus, considering
that BmrS is part of spfh operon and SPFH proteins are an essential component
of the FMMs, we investigated if BmrS could interact with FloA (SA1402), the only
SPFH protein in S. aureus (Fig. 14c and d) [14].

Figure 14. BmrS is a membrane protein part of the FMMs (a) Cellular fractionation for BmrS
localization, using membrane extracts of the WT and bmrS strain (negative control). (b)

79
DSM/DRM fractionation of the WT membranes untreated and treated with H2O2. (c) Fluorescence
microscopy analyses of BmrS and FloA interaction using split GFP fragment complementation
assay in S. aureus. Dissection of GFP at the residues Q158 and K159 generated NtGFP and
CtGFP fragments, which require antiparallel complementation to restore the fluorescence. The
CtGFP fragment was fused to the C-terminal part of BmrS, while the complementary fragment
(NtGFP) was joined to the N-terminal end of FloA. Single dissected GFP fragments and parallel
FloA (FloA-NtGFP and FloA-CtGFP) were used as negative controls. (d) Pull-down assay
confirming the BmrS-FloA interaction. Coomasie staining and immunoblot (BmrS and FloA
antibodies) of the protein fractions coeluted with His tag.

To investigate the interaction between these two proteins, we initially used a split-
GFP assay in which N- and C-terminal GFP fragments (NtGFP, CtGFP) were
fused to BmrS and the FloA, respectively. If the proteins are close to each other,
bring the antiparallel interaction between NtGFP and CtGFP, rescuing the
fluorescence [83]. We transformed these genetic constructs into S. aureus and
evaluated the interaction, using treated and untreated cells. We selected H2O2 as
a stressor agent for the protein interaction and characterization assays as it
allowed better control of the experimental conditions. As shown in Fig. 14 c, the
GFP signal was restored after the exposure to H2O2 relative to the untreated cell
and the controls (Fig. 14c). This interaction was confirmed by pull-down assay
using an S. aureus strain bearing a His6-tagged BmrS (Fig. 14d). FloA
coprecipitated together BmrS (Fig. 14d), demonstrating the interaction between
FloA and BmrS and corroborating the presence of BmrS in the FMMs.

To continue characterizing BmrS, we assessed if ROS affect the protein

oligomerization (Fig. 15). We performed glycerol gradients and 2-BN-PAGE to
resolve membrane extracts from the H2O2-untreated versus H2O2-treated cells
and analyzed the samples by immunoblotting for the presence of BmrS (Fig. 15a
and b). In the H2O2-treated membranes, the protein migrated into the lower
glycerol density while in the untreated sample, BmrS was detected in the high-
density fractions (Fig. 15a). Similar patterns were seen when the isolated
membranes were subjected to 2D-BN-PAGE (Fig. 15b). The second dimension
showed the protein signal from < 66 kDa to ~480 kDa, which indicates that BmrS
forms oligomers in vivo. By contrast, in the H2O2-treated membranes, the protein
displayed lower molecular-weight oligomers with a more localized distribution

80
than the untreated membranes (Fig. 15b), suggesting BmrS complexity changes
in response to H2O2.

We then used fluorescence microscopy to analyze the effect of H2O2 on BmrS

subcellular distribution using a GFP-BmrS translational fusion (Fig. 15 c). In
untreated cells, the protein organized heterogeneously in the membrane,
displaying a punctate distribution mostly in the septum and some discrete foci
localized at the cell poles (Fig. 15c). In the presence of H2O2, the BmrS-GFP
signal tended to distribute more uniformly over large segments of the membrane,
showing higher-signal intensity (Fig. 15c). This increment in the protein
abundance was also evident by the immunodetection of BmrS using H2O2-treated
membrane extracts (Fig. 15c), indicating that BmrS increases its expression
during the oxidative stress.

Figure 15. BmrS changes its complexity upon the presence of ROS. BmrS oligomerization
was evaluated by (a) glycerol gradient and (b) 2D dimension BN/SDS-PAGE using membrane
fractions of WT untreated and treated with H2O2. Solubilized membranes were loaded at the top
of a glycerol gradient (10-30%), subjected to ultracentrifugation, and samples (300 µl each) were

81
collected from the top to button and analyzed by immunoblot with anti-BmrS. For 2D dimension
BN/SDS-PAGE, membrane extracts were loaded onto a BN-PAGE, and the corresponding lanes
were excised, horizontally immobilized on top of the 12 % SDS-PAGE gel resolved, and analyzed
by immunoblot with anti-BmrS (c) Localization patterns of BmrS-GFP using STED microscopy.
The bar chart represents the number of foci in 200 cells, comparing untreated versus H2O2-treated
cells. Student's t-test was applied to determine statistical differences. Scale bar 1 µm. (d)
Immunoblot evaluation of BmrS in the presence of H2O2 using membrane extracts from treated
and untreated cells.

Having determined that BmrS is part of the FMMs and changed its complexity in
the presence of ROS, we identified protein candidates that interact with this
FMMs-associated protein. Protein interaction partners were detected by pull-
down experiments using an MRSA strain expressing a His6-tagged BmrS.
Membranes crude extracts were solubilized and loaded onto a column of nickel-
charged resin that selectivity binds His6-tagged BmrS and proteins that are
associated directly or indirectly. The resin-bound proteins were eluted with an
imidazole-containing buffer (see material and methods), and BmrS-coeluted
proteins were identified by mass spectrometry and classified according to
functional groups (Fig. 16).

82
Figure 16. Pull-down experiments showing that BmrS interacts with aerobic metabolism-
related proteins. BmrS interactors were identified by a pull-down assay followed by mass
spectrometry analysis. (a) Treemap of coeluted proteins displaying the fold-change of the His-
tagged BmrS in comparison to control without the tag. Blue = greater abundance, light blue =
lesser abundance. (b) Pie chart showing the functional classification of BmrS protein-interacting
partners.

Consistent with the role of BmrS in the respiratory chain, a sizeable fraction of
the eluted proteins connected with aerobic metabolism (QoxB, AtpH, qoxB, GlpD,
Mqo, OdhA, B, and AcnA), iron metabolism, such as HemY, FtnA as well as
proteins involved in the defense against ROS and protein reparation (sodM, KatA,
DnaK, and DnaK) was enriched in the elution fraction in comparison to the
untagged control (Fig. 16a). Additionally, BmrS interacting partners were
clustered according to their functional classifications, showing well-defined
categories: aerobic metabolism (Arg, RsmG Mqo1 RocD2, SucD, PckA, OdhB),
stress response (ClpB, SodM, KatA, RadA, and SA0231), and regulation (SarA,
HrcA, SpxA, and HptR) (Fig. 16b), which provide additional insights into the
connection of this FMMs-associated protein with the respiratory chain of S.
aureus.

83
BmrS affects quinol oxidoreductases activity and stabilize the ETC

Among the BmrS protein-interacting partners, quinol-oxidoreductases enzymes

drew our attention since these respiratory complexes are essential in the electron
transference, and any imbalance in their activity enhances the electron leakage
[31, 39]. Previous proteome data from the DRM fraction of S. aureus [84] also
identified several members of these enzymes, which led us to speculate that
BmrS might stabilize the respiratory chain via oxidoreductases. To explore this,
we initially investigated levels of succinate dehydrogenase (SDH) and GlpD (two
examples of oxidoreductases found in the pull-down) in the bmrS (Fig. 16 and
17). We tagged the subunit A of SHD (SdhA) and GlpD with GPF at the C-terminal
end to perform cellular fractionation and evaluate the location and the expression
by immunoblotting (Fig. 17). As control of protein expression and subcellular
localization, we labeled the membrane protein, MenG, with 3xFlag (Fig. 17a).

Figure 17. bmrS deletion alters the quinol oxidoreductases activity in S. aureus. (a)
Evaluation of GlpD and SDH levels using cell lysate from bmrS and WT strains. MenG was used

84
as a negative control of protein abundance and subcellular localization. C represents the
cytoplasmic fraction and M the membrane fraction (b) Evaluation of substrates quantification.
Intracellular quantification G3P (glycerol-3-phosphate), succinate, and FAD. The bar charts
represent four independent replicates where the blue color corresponds to the WT strain, the pink
bar to bmrS, and the black to C-bmrS. Statistical analysis, one-way ANOVA with Tukey's
comparison or Kruskal-Wallis for nonparametric statistics * p < 0.05 ***p < 0.001.

Interestingly, the mutant in bmrS showed a particular increment in the abundance

of both enzymes, whereas no difference was seen in the MenG-3Flag expression
(Fig. 17a). Further tests quantifying the intracellular substrates of SDH and GlpD
showed the accumulation of succinate and glycerol-3-phosphate (G3P),
respectively (Fig. 17b). Because FAD is an essential coenzyme for the activity of
GlpD and SDH, we then hypothesized fluctuations in the level of this dinucleotide
as a consequence of the bmrS deletion. Consistently, we found that intracellular
FAD was higher in the mutant than the WT and C-brmS strains after the
treatment with H2O2 (Fig. 17b), pointing out the impairment of the GlpD and SDH
in the brmS strain.

The previous findings prompted us to probe whether the deletion of bmrS affects
the quinol oxidoreductase oligomerization. We selected GlpD as a case study
because it showed more consistent results than SdhA. We tested this hypothesis
by comparing the oligomerization in wild type and bmrS mutant strains using
crude membrane extracts and separating them by BN-PAGE and SDS-PAGE
(Fig. 18). No change in the GlpD oligomer was found in the WT versus the mutant
(Fig. 18a), showing that the lack of BmrS does not influence the GlpD dimer
formation [111]. However, when we detected the BmrS-FloA complex in the
solubilized WT membranes, it localized in the same zone of the BN-PAGE gel as
GlpD (Fig. 18b), suggesting that although there was no change in oligomerization,
GlpD require a membrane organization provided by the FMMs.

85
Figure 18. GlpD oligomerization. (a). Oligomerization of GlpD was evaluated using 2D
dimension BN/SDS-PAGE. Solubilized membrane fractions of WT and bmrS were load onto a
BN-PAGE, and the corresponding lanes were excised, horizontally immobilized on top of the 12 %
SDS-PAGE gel resolved, and analyzed by immunoblot with anti-GFP. (b) GlpD localizes in the
same region where the BmrS-FloA complex is. The solubilized WT membrane was separated
using 2D-BN/SDS-PAGE, as previously described. The red rectangle highlights the zone where
the three proteins converge.

To continue probing if BrmS is indeed an integral component for the quinol

oxidoreductase performance, we investigated the effects of thioridazine on S.
aureus viability (Fig. 19). This antimicrobial targets the II NADH: quinone
oxidoreductase (NDH-2) [112], whose reduced activity demands the activation of
different quinone oxidoreductase to feed electrons into the respiratory chain and
keep the membrane potential [31]. Following the addition of thioridazine, a
significant decrease in the number of CFU was observed in the mutant compared
to the WT and C-brmS, while no evident variations in the bacterial count were
detected when used vancomycin as control (Fig 19a). Overall, these results
confirmed the alteration of the quinol oxidoreductase activity in brmS.

86
Finally, to determine if FMMs respond to this antibiotic that specifically targets the
ETC, we assessed the oligomerization of BmrS and FloA in cells treated with
thioridazine. For this experiment, we employed an S. aureus strain, in which the
subunit A of the aa3 terminal oxidase (QoxA) is tagged with Flag to evaluate if
another ETC component forms an oligomer with BmrS-FloA. As shown in figure
19b, we detected higher molecular complexes of BmrS and FloA in treated cells
than the untreated control. However, we did not observe any effect of thioridazine
on QxoA-Flag oligomerization (Fig. 19b). Interestingly, in the treated membranes,
we detected an oligomer of BmrS, FloA, and QoxA at 480 kDa (Fig. 19b),
indicating a possible complex formation between the ETC and these two FMMs-
associated proteins under stress. The fact that GlpD and QxoA do not alter their
oligomerization patterns in the tested conditions, but BmrS does, strongly
suggest that the basis for respiratory chain unbalance in bmrS might be linked
with alterations in the physical properties of the membrane. Nevertheless, our
results pointing out that BmrS contribute heavily to maintaining the ETC stability.

87
Figure 19. Effect of thioridazine on cell viability and BmrS-FloA oligomerization (a) Bacterial
survival after the exposure to thioridazine. Strains were grown in RPMI and treated with 200 µg
ml-1 of thioridazine for three hours. CFU was determined by plating the treated and untreated
suspensions on TSA. Vancomycin was used as treatment control. Blue bar: WT, pink bar: bmrS,
and black bar: C-bmrS. Data are shown as mean ± SD of four independent experiments (n = 4).
Statistical analysis, one-way ANOVA with Tukey’s test for multiple comparisons, ** p < 0.01 ***p
< 0.001. (b) Oligomerization of BmrS, FloA, and QoxA-Flag in the presence of thioridazine. A WT
strain bearing a QxoA-Flag was grown in RPMI containing 200 µg ml-1 of thioridazine. Membrane
extracts were load onto a BN/SDS-PAGE, and the corresponding lanes were excised, horizontally
immobilized on top of the 12 % SDS-PAGE gel resolved, and analyzed by immunoblot with anti-
BmrS, anti-FloA, and anti-Flag. The red rectangle highlights the zone where the three proteins
converge.

Lipid-protein interaction

Bioinformatic analysis of the BmrS showed no evident protein domains or any

catalytic function. An implication of this is the possibility that BmrS might have a
structural role in the membrane. Supporting this idea, the N-terminal region of this
protein was predicted to have some amphipathic residues (Fig. 7b and c), which
are relevant for the membrane-binding and remodeling [105, 113]. Typically, the
hydrophobic amino acids insert into the lipid bilayer, while the hydrophilic

88
residues interact with the head groups of the negatively charged phospholipids
[113]. α-helical proteins regulate several cellular processes, including the ETC,
by inducing membrane remodeling [47]. Consequently, we hypothesized that
BmrS might recognize and remodel lipids associated with the respiratory chain,
such as phospholipids.

We first determined whether BmrS interacts and reshapes some of the most
abundant staphylococcal lipids by performing liposome co-sedimentation and
liposome deformation assays (Fig. 20). In the co-sedimentation assay, purified
BmrS showed preferential binding to the anionic phospholipids, CL and PG
(phosphatidylglycerol) over cationic or neutral lipids such as LPG (lysyl-
phosphatidylglycerol) or STX, (staphyloxanthin) (Fig. 20a). The liposomes
examination using negative-staining EM evidenced a strong distortion only in the
CL-liposome rather than PG-liposomes (Fig. 20b).

89
Figure 20. BmrS interacts and deforms CL. (a) Co-sedimentation assay to evaluate protein-
lipid interaction. Purified BmrS was mixed with cardiolipin (CL), phosphatidylglycerol (PG), lysyl-
phosphatidylglycerol (LPG), phosphatidylethanolamine (PE), and staphyloxanthin (STX). The
protein-lipid mixtures were centrifuged to separate supernatant (S) containing the unbound
protein and pellet (P), which includes the lipids and the lipid-bind protein. (b) Liposomes
deformation assay. Liposome morphology was observed by negative staining EM. Controls are
liposomes without purified BmrS. +BmrS, liposome mixed with purified protein. Scale bar = 100
nm. (c) Influence of protein concentration on liposome distortion using recombinant BrmS full-
length. (d) Liposome distortion assay evaluating different ratios of CL and PG. Recombinant full-
length BmrS (0.15 µM) was incubated with liposomes containing various ratios of CL and PG.
Liposomes without protein were used as a negative control.

Usually, stress response proteins containing an amphipathic helix motif can

regulate the membrane shape in a dose-related fashion, where they insert and
accumulate into one leaflet of the bilayer, forcing the membrane to bend [113-
115]. Hence, we sought to evaluate if various ratios of BmrS and CL-PG affects
the liposome deformation. As shown in Fig 20c and d, CL distortion was
dependent on the protein accumulation as a gradual increment in the amount of

90
BmrS leads to a large liposome deformation into buds, tubules, or small vesicles
(Fig. 20c). A comparable result was obtained with the increased ration of CL,
whose effect was inversely proportional to the PG concentration (Fig. 20d). These
findings reveal that BmrS interacts with anionic phospholipids (PG and CL), but
showed a tendency to deform CL instead of PG, an effect that is driven by the
protein concentration.

Figure 21. The N-terminal region of BmrS mediates the CL-liposome deformation and the
resistance to H2O2 in S. aureus. (a) Co-sedimentation to evaluate the interaction of BmrS-V with
CL, PG, LPG, PE, and STX. Lipid-protein mixtures were centrifugated, and supernatant (S) and
pellet (P) fractions were separated on a 12 % SDS-PAGE. (b) CL-liposome remodeling assay
using BmrS-V. CL-liposomes was mixed with purified BmrS-V and stained with 2 % uranyl acetate.
The images are the representation of a common tendency. (c) H2O2 complementation assay in S.
aureus. Genes encoding for the BmrS-V was transformed into bmrS, and an H2O2 killing assay
was performed comparing full-length BmrS complementation versus this variant without the N-
terminal region. All data represent the average of 4 independent experiments and the standard
error bars. Statistical significance was determined using the Kruskal–Wallis test following Dunn’s
analysis as a post hoc procedure ***p < 0.001.

To identify if the putative anchor region (N-terminal) of BmrS is responsible for

the interaction with anionic phospholipids and CL-remodeling, we then assessed
the lipid-binding and the liposome distortion, using a truncated version of BmrS

91
without containing the N-terminal (BmrS-V) (Fig. 21). The deletion of this area
reduced the co-sedimentation with PG and CL liposomes (Fig. 21a) as well as
abolished the distortion of CL containing liposomes (Fig. 21b). The N-terminal
utility has been probed in-vitro; however, to validate whether this region has any
implication in-vivo, we consequently transformed the gene encoding for BmrS-V
into bmrS (S. aureus) and performed an H2O2 killing assay to assess whether
this variant can rescue the WT phenotype to this oxidizing agent. As shown in Fig
21c, the trans-complementation with the bmrS-V could not restore the resistance
to H2O2 in bmrS compared to the WT strain and the full-length complementation
(Fig. 21c). Hence, it could conceivably be hypothesized that the amphipathic α-
helix at N-terminal is responsible for CL remodeling and plays an essential role
in oxidative stress tolerance.

Finally, to analyze whether BmrS remodels S. aureus membranes, we imaged

H2O2-treated cells expressing BmrS-GFP fusion using transmission electron
microscopy (TEM). Protein was detected by immunogold using a 10 nm gold
conjugated anti-GFP (Fig. 22). Upon the exposure to H2O2, the gold particles
were identified in the areas where deformations took place, whereas few signals
were observed in the untreated control (Fig. 22). Together, our results suggest
that BrmS recognizes CL-enriched areas and remodels the cytoplasmic
membrane to stabilize the quinol oxidoreductases under stress.

92
Figure 22. BmrS coincides closely with membrane deformations after H2O2 treatment.
Immunodetection of BmrS in the whole cell. Transmission electron micrographs of the WT
untreated versus treated bacteria. Cells were grown in TSB and challenged with 5 mM of H2O2.
Thin sections (100 nm) show more irregular bacterial membranes in H2O2-treated than the
untreated cells. Images are the representation of a trend; scale bar, 100 nm.

93
Discussion

95
In this work, we elucidated the function of the bacterial protein BmrS, a
fundamental part of the FMMs in S. aureus. By using forward genetics and
biochemical approaches, we determined that BmrS is crucial for pathogenesis,
helping to resist the oxidative stress caused by the immune system activation.
We proposed a model in which the protein specifically recognizes CL and induces
deformation of those regions by inserting into the bilayer using the N-terminal
amphipathic helix. During the oxidative stress, this membrane remodeling by
BmrS provides stability to the ETC since a bmrS shows a defective quinol
oxidoreductase activity, accumulating more intracellular ROS and reducing the
membrane potential upon stress. Our findings also underline the importance of
specialized membrane remodeling that controls the metabolism under
unfavorable conditions like those found inside the host, denoting that bacteria
have sophisticated cell organization programs comparable to their eukaryotic
counterparts.

Bioinformatics predictions

Our initial bioinformatics analysis demonstrates that BmrS is mostly present in

Firmicutes next to an SPFH gene-encoding (Fig. 5 and 6). Notably, it is already
known that only some bacteria have the third gene in their spfh operon [43]. SPFH
domain is widely distributed in the three domains of life [67, 116]. Usually, in
prokaryotes, the operon consists of two genes, nfeD-like and spfh genes [67].
This conserved association with nfeD homolog suggests these two gene clusters
shared a common ancestor, whose genomic organization has been maintained
by the selective pressure [67, 117]. Supporting this idea, Green and colleagues
proposed that stomatin arose from the last universal ancestor [117], as the
sequences from many organisms show a high percentage of identity and share
genomic organization [116].

In contrast to the well-preserved co-occurrence of nfeD and spfh, some bacterial

genomes contain a third gene with no clear phylogenetic relationship [43, 67].
This divergence produced incongruent results because it is not easy to define a

96
common origin (Fig. 6). Consequently, independent duplication or lateral
transference events are the most likely scenario for acquiring this gene into spfh
operons [67]. Hence, it is probable that the environmental signals drove the
selection and maintenance of bmrS in some bacterial genomes [118]. This idea
fits well with our sequence analysis, where most homologs were identified in the
Firmicutes phylum (Fig. 6), suggesting that respiratory chain control via BrmS
represents a competitive advantage to outweigh restricted environments
conditions. For instance, Firmicutes are among the predominant phylogenetic
groups in the human gut [119], which inevitably entails using mechanisms to cope
with the metabolic demand and thrive in this niche [43, 67, 116, 118].

Interestingly, by comparing the C-terminal region of several BmrS’ orthologs, we

could expand the number of matches to other bacterial species (Fig. 6, 7a, and
b), all of which include an operon organization with nfeD-like and spfh genes (Fig.
6). This result presumes a broader distribution of this protein in other bacterial
phyla, yet further studies will be required to corroborate this data. One
disadvantage of the sequence-based prediction approaches is the database
dependency, limiting the number of tested proteomes. Therefore, since many of
the newly orthologs are environmental bacteria (Fig. 6), we suggest studying
metaproteome data to validate whether BmrS is broadly disseminated in bacteria
and understand better why bmrS was integrated into the spfh operon in S. aureus.

Structural prediction found that BmrS is an α-helical protein, containing

hydrophobic and charged amino acids in the N-terminal region (Fig 7). This trait
and the disordered region (Fig. 7d and g) are also present in most of the Firmicute
homologs (Fig. 6). Amphipathic helices mediate membranes binding through
electrostatic interactions between the positive amino acids and the negatively
charged region of anionic phospholipids such as PG and CL (Fig. 19) [104]. Many
examples have been reported, for example, in energetic membranes
(mitochondria), proteins containing amphipathic α-helical include the translocase
of the outer membrane (TOM) and Mitochondrial Contact Site and Cristae
Organizing System (MICOS) systems, which are involved in the importation of
cytoplasmic proteins and the maintenance of the cristae architecture, respectively

97
[47, 120]. Most of these proteins can remodel the membrane by inserting the
amphipathic α-helix into the lipid bilayer, inducing membrane bending [113, 120].

If BmrS is necessary for stabilizing S. aureus’ respiratory chain, why is it only

present in some bacterial species, understanding that most of the prokaryotes
express CL and respiratory chain complexes? An answer to this question is the
variability in terms of ETC complexes throughout all prokaryote species [31]. For
instance, by comparing E. coli and S. aureus, we found many distinctions in terms
of the ETC complexes topology, the number of electron carriers, and the
phospholipid composition [32, 33, 38, 121-123]. Furthermore, E. coli has four
operons encoding for SPFH proteins, compared to S. aureus that only has one
[67], indicating that these differences would require independent regulatory
mechanisms.

It cannot be ruled out the existence of BmrS orthologs in E. coli, which evolved
separately from the spfh operons. However, our analysis did not allow us to
identify them due to the lack of known protein domains and the low sequence
conservation of BmrS among Gram-negative species (Fig. 6). Finally, even
though the major link between BmrS and CL is an amphipathic helix, we cannot
assume that all proteins that use an amphipathic helix to anchor to the membrane
are BmrS orthologs. Amphipathic helixes mediate the membrane binding of many
proteins, irrespective of whether they are related to the ETC [105]. Thus,
incorporating amphipathic helixes to membrane protein seems to arise
independently by convergent evolution, meaning that similar regulatory
mechanisms evolve independently [124, 125].

The physiological relevance of BmrS

Most of the investigations into FMMs have focused on studying how spfh deletion
impacts on the performance of cargo proteins. Here we show the role of an
FMMs-associated gene (bmrS) (Fig. 5) in the progress of staphylococcal
infections. Using the ex-vivo whole blood assay and the murine sepsis model, we

98
observed that the mutant decreased bacterial survival and showed low bacterial
burdens in several organs (Fig. 11a and c). Our analyses proved that bmrS had
low resistance to H2O2 and NO•, two of the redox molecules that serve as
arsenals to fight pathogens (Fig. 9 and 10). The failure to ameliorate the oxidative
damage from the neutrophils and macrophages can influence the host-adaptation
and the infective process [29, 40, 126]. Consequently, the presented evidence
confirmed the nexus between FMMs and pathogenesis using as a model the
human pathogen, S. aureus [127].

In vivo infections showed low bacterial burdens in kidneys, liver, and spleen in
the bmrS compared to the WT strain (Fig. 11). This result could indicate a
decline in the infection progression or a problem in organ colonization. In murine
sepsis, the organ colonization hypothesis is controversial as the liver and kidneys
accumulate more bacteria than other organs, working as bottlenecks in the
subsequent bacteria spread [128]. However, to survive and generate a systemic
infection, pathogens must colonize and clonally expand inside the bottleneck
organs. Thus, dissemination not only relies on the potential to resist macrophages
and neutrophils but also on the ability to grow at the site of infection, suggesting
that both scenarios (dissemination and colonization) are interconnected, and the
sepsis model can provide some insight into the colonization properties of our
strains [128, 129].

The notion that respiratory regulation is important for pathogenesis is supported

by the Hammer and colleagues’ study, who illustrated how S. aureus uses both
terminal oxidases, CydB, and QoxB, differentially to colonize organs [26, 130].
cydB had reduced bacterial burden in the heart, kidneys, and liver, while qoxB
only reduced the bacterial count in the liver [26]. The authors explain that each
organ has distinct metabolic requirements due to four principal reasons: (i)
oxygen concentration, (ii) presence of alternative electron acceptors, (iii)
accumulation of free radicals, and (iv) nutrient availability [26]. Thus, S. aureus
must accurately regulate both terminal oxidases to colonize the host successfully.

99
S. aureus has branched-chain respiratory pathways to ensure accurate energy
production in diverse aerobic environments [16, 26]. The two-terminal oxidases
support aerobic respiration and deal with rapid environmental changes by
adjusting the aerobic capacity [16, 26]. During a potent innate immune response,
like the presence of oxidative burst from neutrophils, bacteria must inhibit or favor
the use of specific terminal oxidase [16, 19, 29]. For instance, the cytochrome bd
(CydAB) facilitates respiration in low-oxygen niches full of free radicals. This
cytochrome has more affinity for oxygen and is less sensitive to ROS, working
efficiently, and bypassing the free radicals [26]. Thus, the establishment of
infections involves a fine-tune modulating of the bacterial metabolism to preserve
active the membrane potential.

Switch from respiration to fermentation to overcome infectious stress

S. aureus uses three main energy-generating pathways to support growth [19,

26]. In the presence of oxygen, bacteria can respire aerobically while in the
absence of oxygen and when an alternative electron acceptor is present, respire
anaerobically [19]. This bacterium can also use fermentation when there is no
available electron acceptor or when respiration components are damaged [26].
Bacteria usually decrease aerobic respiration to face the immune system
response, undergoing fermentation to renew ATP (subtract-level phosphorylation)
and maintain the redox balance [16, 28, 60, 107]. Interestingly our findings show
that bmrS degrades acetate prematurely, whereas the complemented strain has
a delay in the catabolism of this hydroxy acid, indicating a possible effect of the
BmrS on acetogenesis (Fig. 12). These results imply that the expression of BmrS
postpones the activation of the TCA cycle as a strategy to control the
overproduction of internal ROS via reduced carbon flux through TCA (Fig. 2 and
3) [19, 21, 22].

Inside the host, bacteria cannot rely entirely on OXPHOS to generate energy;
they must favor substrate-level phosphorylation pathways such as acetogenesis
[19]. In S. aureus, the aerobic fermentation (Fig. 2) is essential in the exponential
growth phase for ATP generation (Fig. 2b) [19], and the inactivation reduces

100
bacterial fitness [21, 22, 131, 132]. Gram-positive bacteria suppress the TCA
during acetogenesis, and once glucose is depleted from the media, acetate
catabolism begins with the full activation of the TCA cycle (Fig. 2) [21]. This
carbon catabolite repression works differently in Gram-negative bacteria. While
glucose suppresses the TCA in S. aureus, E. coli can consume acetate in the
presence of this carbohydrate [133, 134]. E. coli can assimilate acetate under
catabolic repression by activating a TCA shortcut called glyoxylate shunt [135].
In this variation of the TCA cycle, the carbon dioxide producing steps are
bypassed to prevent shuttle electrons to the ETC, reducing internal ROS [134,
135]. Therefore, it can be assumed that lowered carbon flow through the TCA
cycle and high aerobic fermentation improve bacterial survival upon oxidative
stress [21, 22, 131, 132].

The idea that respiration is detrimental for the cell under oxidative stress has been
primarily addressed in infection biology [19, 21, 136]. Lag in the TCA activation
is beneficial for the bacteria as the vast majority of the cellular respiration
enzymes have iron clusters or cysteine residues in their catalytic sites, which are
highly susceptible to oxidation [19, 21, 137]. As shown in Fig. 13, the intracellular
ROS levels and the loss in the membrane potential under stress are consistent
with the hypothesis that bmrS is more prone to damage than the WT due to the
electron leakage triggering intracellular ROS overproduction (Fig. 13). A similar
conclusion was reached indirectly in a previous transcriptomic study [138]. Upon
exposure to H2O2, S. aureus maximizes the transcription of genes involved in
DNA repair, virulence factors, and central metabolism [15, 138]. The gene
encoding for anaerobic metabolism, iron uptake- and storage are the ones with
the highest expression, indicating the cell undergoes an oxygen-limiting state with
the concomitant reduction of the aerobic respiration to prevent the cellular
damage by H2O2 [138, 139].

Besides the decrease in aerobic metabolism, S. aureus activates fermentation to

evade the ROS and NO• [16, 29, 60]. For example, mutants in glycolytic genes
reduce the survival rate upon NO• stress and affect the infective potential [28].
Glycolysis and fermentation allow bacteria to keep the redox balance and ensure

101
the synthesis of the thirteen metabolic intermediates for the conversion in
biomass while preventing the use of the aerobic pathways affected by free
radicals [28, 30]. When the growth media contains non-glycolytic carbon sources
(i.e., glycerol, pyruvate, casamino acids), the WT strain cannot overcome the
oxidative stress due to the lack of precursors to undergo lactic fermentation,
forcing the cell to use respiration [28]. Our results on NO• and H2O2 sensitivity
and the defects in organ colonization (Fig.11 and 13) are broadly consistent with
the inability of bmrS to regulate the switch from respiration to fermentation,
affecting the fitness during the immune system activation [16, 39].

Membrane remodeling and protein-protein interaction

Biochemical characterization found that BmrS is a membrane protein enriched in

the DRM fraction (Fig. 14), which organizes in discrete foci in the septum and the
cell poles (Fig. 15). Furthermore, the interaction with FloA demonstrates that
BmrS is part of the FMMs in S. aureus (Fig. 14). The change of BmrS complexity
upon the exposure to H2O2 presumes the protein responds to oxidative stress
(Fig. 15). Consistently, BmrS-GFP forms small and more disperse foci around the
membrane in the treated cells, denoting cellular localization changes during
stress (Fig. 15c). Membrane microdomains are a fundamental component of the
stress response as they continuously adjust many membrane components
depending on the environmental clues [140]. Some authors hypothesize the ETC
is organized into these domains, which improves the response to changes in the
energy demand [43, 81, 141, 142].

BmrS interacts with PG and CL, but preferentially deforms CL-containing

liposomes rather than PG-containing liposomes, indicating a possible CL-
remodeling role (Fig. 20). This fact can be attributed to the CL properties that
increase membrane fluidity and yield negative curvatures allowing a better
coupling of this phospholipid with the amphipathic residues [142, 143]. The
localization and interaction of BmrS and CL with several components of the ETC
(Fig. 16) suggest that the FMMs are zone enriched in CL [144]. This lipid is an
essential component of the bioenergetic processes [145]. It maintains the

102
structural integrity and the enzymatic activity of the ETC complexes while
improving the electron transference [77, 142, 145]. In bacteria, CL organizes in
microdomains in the septum and regions of negative curvatures [145, 146].

CL interaction was abolished when we removed the N-terminal (30 aa) of BmrS.
This result may be explained by the lack of the amphipathic helix and the adjacent
charged region, which mediates the interactions between CL and the BmrS (Fig.
21). Usually, the membrane-binding amphipathic region is between 10 to 30
amino acids long unfolded in solution but adopts a structural configuration upon
membrane contact [104, 105]. When folded, amphipathic helix exposed the
positive residues, resulting in the intercalation of the cationic amino acids into the
phospholipid hydrophobic face [105].

The localization of BrmS at regions of negative curvature, i.e., septum, where CL

is enriched (Fig. 15d), together with the deformation of CL-containing liposomes
(Fig. 20), indicate that BmrS could be involved in the generation of membrane
curvatures, which might appear spontaneously in a phenomenon called protein
crowding [147]. We support this hypothesis by the dose-dependent effect
observed in figure 20d, where high protein concentrations force the membrane to
bend [142, 145, 146]. If BmrS associates with CL-containing microdomains, it is
conceivable that under stress, FMMs affect CL dynamic to mitigate the
dissociation of the electron transference [76, 81, 145]. CL is particularly prone to
peroxidation [148, 149], in which case cells must prevent its damage from
conserving the energy. Hence, it could conceivably be hypothesized that
membrane remodeling by BmrS might reduce CL damage.

Moreover, we found a protein-protein interaction component based on our pull-

down experiments (Fig. 16) that detect several proteins involved in aerobic
metabolism, most of which require CL for the correct enzymatic performance [45].
We deduced the FMMs bring together many respiratory chain elements to
generate membrane platforms that improve the metabolic activity upon stress [32,
45]. Previous studies have identified in the DRM fraction various respiratory

103
proteins, such as cytochrome bo3, cytochrome bd terminal oxidases, quinol
oxidoreductases, and ATP subunits synthase, supporting our finding [14, 32, 74].
Here, FMMs must have mechanisms for the organization, maintenance, and
protection against externals insults to preserve the cell homeostasis [32, 42, 43,
71, 77, 83]. In conclusion, our results are consistent with previous studies and go
beyond demonstrating that BmrS (FMMs protein) remodels the membrane to
regulate the ETC activity [32, 42, 43].

Stabilization of the respiratory chain by BmrS

Bacteria use plenty of external sources such as organic or inorganic compounds

to supply energy regularly. Respiratory chains do most ATP synthesis using
membrane proteins that take the energy released from oxidoreduction reactions
to couple the electron transference with the proton translocation across the
membrane [31, 32]. This stepwise oxidation process uses two kinds of enzymes
to transfer electrons: (i) NAD dehydrogenases, delivering electrons from the
NADH, and (ii) quinol oxidoreductases that couple oxidation-reduction reactions
with the translocation of electrons via FADH2 equivalent [31, 32]. The latter
enzymes link the oxidation of many metabolic intermediates from carbohydrates,
lipids, and amino acids metabolism with the respiratory chain [31]. These FAD-
dependent enzymes are redundant in bacteria, raising the question about their
relevance in bacterial fitness. Several studies hypothesize that quinone
reductases maintain the membrane potential when bacteria face an unfavorable
situation [16, 29, 31, 39].

We see an impairment in the activity of two quinol oxidoreductases, SDH and

GlpD, when we delete bmrS (Fig. 17). The accumulation of G3P and succinate
(substrates of GlpD and SDH, respectively), the increment in protein abundance
(Fig. 17a, b), and the sensitivity to thioridazine in bmrS (Fig. 19a) indicate that
quinol oxidoreductases performance depends on FMMs integrity. A possible
explanation of this phenotype may be the lack of adequate membrane stability in
the mutant strain, leading the overexpression of quinol oxidoreductases to
compensate the cell for defective enzymatic activity (Fig. 17, 18, and 19) [105].

104
Since GlpD and QxoA did not change their oligomerization partners, but BmrS
and FloA did under the exposure of thioridazine (an ETC stressor) (Fig. 18 and
19), we speculate the FMMs are cellular structures involved in sensing and
modulate the membrane to improve the activity of the cargo proteins [14, 72]. The
physicochemical properties of the membrane, such as the fluidity and charges,
regulate the interactions with membrane-associated proteins [105]. Hence, it
seems possible that FMMs adjust those properties to provide the ideal lipid
environment for some ETC chain proteins.

In this sense, structural analyses of SDH and GlpD show that these proteins must
arrange correctly in the membrane [111, 150]. The quinol and FAD-binding
domains should be oriented toward the phospholipids’ interior face to enable a
correct coupling with the electron carrier [82, 111]. Analysis of GlpD from E. coli
gets more details and proves the hydrophobic region of GlpD mediates dimer
formation that requires to be embedded into the internal leaflet of the membrane
to a depth of 12–15 Å [111, 150]. This protein configuration holds the FAD-binding
pockets in the precise localization to interacts with the quinone pool, and any
variation seems to affect the electron transference [111]. Furthermore, CL is
critical to the integrity of both SDH and GlpD [82, 146].

Defective quinone oxidoreductase can also influence the intracellular ROS

generation. Mráček and colleagues have demonstrated that an incorrect FAD-
binding domain disposition causes access to the molecular oxygen, generating
unpair electrons that react with molecular oxygen and turn them into O2•– [150,
151]. Under oxidative stress, the iron release from the ETC complexes
exacerbates the cell damage due to the generation of the highly deleterious OH•,
providing a possible explanation of why bmrS dies in the presence of ROS (Fig.
10 and 13) [36, 39]. Thus, we propose a model where BmrS recognizes CL and
induces membrane remodeling that positively improves the quinol
oxidoreductases activity, decreasing the generation of intracellular ROS (Fig. 23).
This assumption is based on the idea that membrane remodeling is crucial for the
respiratory chain complexes where curvatures benefit the translocation reactions
[152], enlarge the surface areas where the redox reactions occur, and reduce the
electron leakage [47, 77, 81, 146, 153, 154].

105
Besides, compartmentalization of quinol oxidoreductases into FMMs contributes
significantly to stabilizing the respirasomes (Fig. 23) due to the formation of
condensed microdomains that are incredibly dynamic, assisting bacteria to adjust
their metabolism in real-time [31, 33, 38]. When quinol oxidoreductases reduce
MK on the internal part of the membrane, the acquired protons are later released
when MK is oxidized on the opposite side of the membrane (positive part) [108].
Here the membrane remodeling increases the MK mobility, thereby preserving
the membrane potential in situations where the ETC is not working.

Our model might also explain the virulence attenuation in bmrS (Fig 11). GlpD
catabolizes the oxidation of G3P to dihydroxyacetone phosphate (DHAP) with the
concurrent reduction of the FAD+, connecting glycolysis with lipid metabolism
[111, 155]. This enzyme yields DHAP, that can flow into either glycolysis for
energy conservation or biosynthesis pathways, like lipid and peptidoglycan
synthesis [155, 156]. The enzymatic defects in this enzyme cause an imbalance
of carbohydrate-lipid metabolism, affecting nutrient catabolism under situations
where glucose is the only available carbon source (Fig. 11) [16, 31, 156]. For
instance, the liver contains a large amount of glycogen [157, 158], which requires
glycolytic pathways to be metabolized, explaining to some extent the reduced
organ colonization of bmrS. This work has argued that BmrS is a real-time
mechanism that controls aerobic respiration to preserve the membrane potential
under oxidative stress. These results also offer insight into the molecular
mechanism of FMMs in pathogenesis. However, more research on this topic
needs to be undertaken before the association between FMMs and respiratory
supercomplex is more clearly understood.

106
Figure 23. Proposed mechanism of how BmrS mediates changes in the modify S. aureus'
metabolism to thrive the presence of free radicals from the immune system. Schematic
cartoon of the respiratory chain of S. aureus showing how BmrS recognizes CL regions, producing
membrane curvatures to modulate the aerobic metabolism. Membrane remodeling also helps to
stabilize the activity quinol-oxidoreductases to reduce the electron leakage and contribute to
maintaining the proton motive force under stress. This scheme was modified from the study of
Grosser et al., 2018 [108].

107
Conclusions

109
1. BmrS is mainly present in the Firmicutes, presuming a specific distribution
of this protein in some bacterial phyla.

2. FMMs are essential during staphylococcal pathogenesis, mediating the

tolerance to oxidative stress.

3. S. aureus requires bmrS under oxidative stress to preserve the membrane

potential and restrain ROS overproduction, which constitutes the primary
cause of cell damage in the bmrS mutant.

4. BmrS activity favors acetogenesis during infections to reduces the electron

flow through the respiratory chain, controlling the internal ROS generation
while ensuring the ATP synthesis via substrate-level phosphorylation.

5. The interaction of BmrS with several components of the ETC validates the
association between FMMs and the respiratory chain.

6. BmrS binds anionic phospholipids (PG and CL) and deforms CL-
containing membranes. The BrmS-CL interaction and membrane
deformation may stabilize the respiratory chain.

7. The increased protein levels upon stress indicate that BmrS is part of a
stress response mechanism. A high BmrS concentration causes the
accumulation in the enriched CL-region, inducing membrane remodeling.

8. BmrS assists the assembly of quinone reductases in the membrane,

improving the electron transference, and reducing the unpair electrons.

9. FMMs are involved in systemic infections and organ colonization by

modulating quinone reductase activity, required for nutrient metabolism
and proton motive force maintenance.

110
Conclusiones

111
1. BmrS está principalmente presente en firmicutes indicando una
distribución especifica en algunos filos bacterianos.

2. S. aureus requiere los FMMS para generar infecciones, ya que estas

estructuras de membrana ayudan a contrarrestar el estrés oxidativo.

3. bmrS es necesario para mitigar el efecto negativo provocado por el estrés

oxidativo, ayudando a preservar el potencial de membrana y a reducir la
sobreproducción de ROS intracelular, factor que causa el daño celular en
el bmrS.

4. La actividad de BmrS favorece la acetogénesis durante las infecciones,

reduciendo el flujo de electrones a través de la cadena respiratoria y
ayudando a controlar el ROS intracelular mientras se asegura la síntesis
de ATP usando la fosforilación a nivel de sustrato.

5. La interacción de BmrS con algunos componentes de la ETC apoya la

hipótesis de la relación entre los FMMS y la cadena respiratoria.

6. BmrS se une a fosfolípidos aniónicos (PG y CL), deformando membranas

ricas en CL preferentemente. Dicha interacción y deformación de la
membrana mejora y estabiliza la actividad de la cadena respiratoria.

7. El aumento en los niveles de BmrS en presencia de ROS, indica que esta

proteína es parte de un mecanismo de respuesta al estrés oxidativo.
Elevadas concentraciones de proteína generan la acumulación de ésta en
zonas ricas en CL, induciendo la remodelación de la membrana.

8. BmrS asiste a la correcta disposición de las quinol oxidorreductasas en la

membrana, mejorando la transferencia de electrones y reduciendo la
aparición de electrones desapareados.

112
9. BmrS, que es una parte fundamental de lo FMMs en S. aureus, ayuda a
favorecer las infecciones sistémicas y la colonización de órganos
mediante la modulación de la actividad de las enzimas quinol
oxidorreductasas, las cuales son necesarias para el metabolismo de
nutrientes y la conservación del potencial de membrana.

113
References

115
1. Krismer, B., et al., The commensal lifestyle of Staphylococcus aureus and
its interactions with the nasal microbiota. Nature Reviews Microbiology,
2017. 15(11): p. 675-687.
2. Tong, S.Y., et al., Staphylococcus aureus infections: epidemiology,
pathophysiology, clinical manifestations, and management. Clin Microbiol
Rev, 2015. 28(3): p. 603-61.
3. Kane, T.L., K.E. Carothers, and S.W. Lee, Virulence Factor Targeting of
the Bacterial Pathogen Staphylococcus aureus for Vaccine and
Therapeutics. Curr Drug Targets, 2018. 19(2): p. 111-127.
4. Turner, N.A., et al., Methicillin-resistant Staphylococcus aureus: an
overview of basic and clinical research. Nat Rev Microbiol, 2019. 17(4): p.
203-218.
5. Foster, T.J., The MSCRAMM Family of Cell-Wall-Anchored Surface
Proteins of Gram-Positive Cocci. Trends Microbiol, 2019. 27(11): p. 927-
941.
6. Foster, T.J., Surface Proteins of Staphylococcus aureus. Microbiol Spectr,
2019. 7(4).
7. Schneewind, O. and D. Missiakas, Sec-secretion and sortase-mediated
anchoring of proteins in Gram-positive bacteria. Biochim Biophys Acta,
2014. 1843(8): p. 1687-97.
8. Geoghegan, J.A., A.D. Irvine, and T.J. Foster, Staphylococcus aureus and
Atopic Dermatitis: A Complex and Evolving Relationship. Trends
Microbiol, 2018. 26(6): p. 484-497.
9. Lacey, K.A., et al., Clumping factor B is an important virulence factor
during Staphylococcus aureus skin infection and a promising vaccine
target. PLoS Pathog, 2019. 15(4): p. e1007713.
10. Falugi, F., et al., Role of protein A in the evasion of host adaptive immune
responses by Staphylococcus aureus. mBio, 2013. 4(5): p. e00575-13.
11. Salgado-Pabon, W. and P.M. Schlievert, Models matter: the search for an
effective Staphylococcus aureus vaccine. Nat Rev Microbiol, 2014. 12(8):
p. 585-91.
12. Vatansever, F., et al., Can biowarfare agents be defeated with light?
Virulence, 2013. 4(8): p. 796-825.

116
13. Tam, K. and V.J. Torres, Staphylococcus aureus Secreted Toxins and
Extracellular Enzymes. Microbiol Spectr, 2019. 7(2).
14. Garcia-Fernandez, E., et al., Membrane Microdomain Disassembly
Inhibits MRSA Antibiotic Resistance. Cell, 2017. 171(6): p. 1354-1367
e20.
15. Organization, W.H., Global antimicrobial resistance surveillance system
(GLASS) report Early implementation 2017-2018. 2019.
16. Richardson, A.R., Virulence and Metabolism. Microbiol Spectr, 2019. 7(2).
17. Collins, F.M. and J. Lascelles, The effect of growth conditions on oxidative
and dehydrogenase activity in Staphylococcus aureus. J Gen Microbiol,
1962. 29: p. 531-5.
18. Strasters, K.C. and K.C. Winkler, Carbohydrate Metabolism of
Staphylococcus Aureus. J Gen Microbiol, 1963. 33: p. 213-29.
19. Somerville, G.A. and R.A. Proctor, At the crossroads of bacterial
metabolism and virulence factor synthesis in Staphylococci. Microbiol Mol
Biol Rev, 2009. 73(2): p. 233-48.
20. Goldschmidt, M.C. and D.M. Powelson, Effect of the culture medium on
the oxidation of acetate by Micrococcus pyogenes var. aureus. Arch
Biochem Biophys, 1953. 46(1): p. 154-63.
21. Somerville, G.A., et al., Correlation of acetate catabolism and growth yield
in Staphylococcus aureus: implications for host-pathogen interactions.
Infect Immun, 2003. 71(8): p. 4724-32.
22. Somerville, G.A., et al., Staphylococcus aureus aconitase inactivation
unexpectedly inhibits post-exponential-phase growth and enhances
stationary-phase survival. Infect Immun, 2002. 70(11): p. 6373-82.
23. Nelson, D.L., A.L. Lehninger, and M.M. Cox, Lehninger Principles of
Biochemistry. 2008: W. H. Freeman.
24. Somerville, G.A., et al., Synthesis and Deformylation of
<em>Staphylococcus aureus</em> δ-Toxin Are Linked to Tricarboxylic
Acid Cycle Activity. Journal of Bacteriology, 2003. 185(22): p. 6686-6694.
25. Halsey, C.R., et al., Amino Acid Catabolism in Staphylococcus aureus and
the Function of Carbon Catabolite Repression. mBio, 2017. 8(1).

117
26. Hammer, N.D., et al., Two heme-dependent terminal oxidases power
Staphylococcus aureus organ-specific colonization of the vertebrate host.
mBio, 2013. 4(4).
27. Ferreira, M.T., et al., Effect of oxygen on glucose metabolism: utilization
of lactate in Staphylococcus aureus as revealed by in vivo NMR studies.
PLoS One, 2013. 8(3): p. e58277.
28. Vitko, N.P., N.A. Spahich, and A.R. Richardson, Glycolytic dependency of
high-level nitric oxide resistance and virulence in Staphylococcus aureus.
mBio, 2015. 6(2).
29. Spahich, N.A., et al., Staphylococcus aureus lactate- and malate-quinone
oxidoreductases contribute to nitric oxide resistance and virulence. Mol
Microbiol, 2016. 100(5): p. 759-73.
30. Fuller, J.R., et al., Identification of a lactate-quinone oxidoreductase in
Staphylococcus aureus that is essential for virulence. Front Cell Infect
Microbiol, 2011. 1: p. 19.
31. Refojo, P.N., et al., Chapter Six - The plethora of membrane respiratory
chains in the phyla of life, in Advances in Microbial Physiology, R.K. Poole,
Editor. 2019, Academic Press. p. 331-414.
32. Magalon, A. and F. Alberge, Distribution and dynamics of OXPHOS
complexes in the bacterial cytoplasmic membrane. Biochim Biophys Acta,
2016. 1857(3): p. 198-213.
33. Shepherd, M. and R.K. Poole, Bacterial Respiratory Chains, in
Encyclopedia of Biophysics, G.C.K. Roberts, Editor. 2013, Springer Berlin
Heidelberg: Berlin, Heidelberg. p. 172-177.
34. Unden, G. and P. Dunnwald, The Aerobic and Anaerobic Respiratory
Chain of Escherichia coli and Salmonella enterica: Enzymes and
Energetics. EcoSal Plus, 2008. 3(1).
35. Sena, F.V., et al., Type-II NADH:quinone oxidoreductase from
Staphylococcus aureus has two distinct binding sites and is rate limited by
quinone reduction. Mol Microbiol, 2015. 98(2): p. 272-88.
36. Gaupp, R., et al., Advantage of upregulation of succinate dehydrogenase
in Staphylococcus aureus biofilms. J Bacteriol, 2010. 192(9): p. 2385-94.
37. Hammer, N.D., et al., CtaM Is Required for Menaquinol Oxidase aa3
Function in Staphylococcus aureus. mBio, 2016. 7(4).

118
38. Jeffries, L., et al., Distribution of Menaquinones in Aerobic
Micrococcaceae. Nature, 1967. 215(5098): p. 257-259.
39. Wakeman, C.A., et al., Menaquinone biosynthesis potentiates haem
toxicity in Staphylococcus aureus. Mol Microbiol, 2012. 86(6): p. 1376-92.
40. Beavers, W.N. and E.P. Skaar, Neutrophil-generated oxidative stress and
protein damage in Staphylococcus aureus. Pathog Dis, 2016. 74(6).
41. Llorente-Garcia, I., et al., Single-molecule in vivo imaging of bacterial
respiratory complexes indicates delocalized oxidative phosphorylation.
Biochimica et Biophysica Acta (BBA) - Bioenergetics, 2014. 1837(6): p.
811-824.
42. Lopez, D., Molecular composition of functional microdomains in bacterial
membranes. Chem Phys Lipids, 2015. 192: p. 3-11.
43. Lopez, D. and G. Koch, Exploring functional membrane microdomains in
bacteria: an overview. Curr Opin Microbiol, 2017. 36: p. 76-84.
44. Poston, C.N., et al., Proteomic analysis of lipid raft-enriched membranes
isolated from internal organelles. Biochem Biophys Res Commun, 2011.
415(2): p. 355-60.
45. Paradies, G., et al., Functional role of cardiolipin in mitochondrial
bioenergetics. Biochim Biophys Acta, 2014. 1837(4): p. 408-17.
46. Kirchhoff, H., Diffusion of molecules and macromolecules in thylakoid
membranes. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 2014.
1837(4): p. 495-502.
47. Pfanner, N., B. Warscheid, and N. Wiedemann, Mitochondrial proteins:
from biogenesis to functional networks. Nat Rev Mol Cell Biol, 2019. 20(5):
p. 267-284.
48. Hood, M.I. and E.P. Skaar, Nutritional immunity: transition metals at the
pathogen-host interface. Nat Rev Microbiol, 2012. 10(8): p. 525-37.
49. Spaan, A.N., et al., Neutrophils versus Staphylococcus aureus: a
biological tug of war. Annu Rev Microbiol, 2013. 67: p. 629-50.
50. Guerra, F.E., et al., Epic Immune Battles of History: Neutrophils vs.
Staphylococcus aureus. Front Cell Infect Microbiol, 2017. 7: p. 286.
51. Thomsen, I.P. and G.Y. Liu, Targeting fundamental pathways to disrupt
Staphylococcus aureus survival: clinical implications of recent discoveries.
JCI Insight, 2018. 3(5).

119
52. Liu, G.Y., et al., Staphylococcus aureus golden pigment impairs neutrophil
killing and promotes virulence through its antioxidant activity. J Exp Med,
2005. 202(2): p. 209-15.
53. Gaupp, R., N. Ledala, and G.A. Somerville, Staphylococcal response to
oxidative stress. Front Cell Infect Microbiol, 2012. 2: p. 33.
54. Mandell, G.L., Catalase, superoxide dismutase, and virulence of
Staphylococcus aureus. In vitro and in vivo studies with emphasis on
staphylococcal--leukocyte interaction. The Journal of Clinical
Investigation, 1975. 55(3): p. 561-566.
55. Das, D. and B. Bishayi, Staphylococcal catalase protects intracellularly
survived bacteria by destroying H2O2 produced by the murine peritoneal
macrophages. Microb Pathog, 2009. 47(2): p. 57-67.
56. Cosgrove, K., et al., Catalase (KatA) and alkyl hydroperoxide reductase
(AhpC) have compensatory roles in peroxide stress resistance and are
required for survival, persistence, and nasal colonization in
Staphylococcus aureus. J Bacteriol, 2007. 189(3): p. 1025-35.
57. Painter, K.L., et al., Staphylococcus aureus adapts to oxidative stress by
producing H2O2-resistant small-colony variants via the SOS response.
Infect Immun, 2015. 83(5): p. 1830-44.
58. Painter, K.L., et al., The Electron Transport Chain Sensitizes
Staphylococcus aureus and Enterococcus faecalis to the Oxidative Burst.
Infect Immun, 2017. 85(12).
59. Proctor, R., Respiration and Small Colony Variants of Staphylococcus
aureus. Microbiol Spectr, 2019. 7(3).
60. Richardson, A.R., S.J. Libby, and F.C. Fang, A nitric oxide-inducible
lactate dehydrogenase enables Staphylococcus aureus to resist innate
immunity. Science, 2008. 319(5870): p. 1672-6.
61. Singh, R., et al., Oxidative Stress Evokes a Metabolic Adaptation That
Favors Increased NADPH Synthesis and Decreased NADH Production in
&lt;em&gt;Pseudomonas fluorescens&lt;/em&gt. Journal of Bacteriology,
2007. 189(18): p. 6665.
62. Singh, R., et al., A Novel Strategy Involved Anti-Oxidative Defense: The
Conversion of NADH into NADPH by a Metabolic Network. PLOS ONE,
2008. 3(7): p. e2682.

120
63. Mailloux, R.J., et al., The Tricarboxylic Acid Cycle, an Ancient Metabolic
Network with a Novel Twist. PLOS ONE, 2007. 2(8): p. e690.
64. Appanna, V.P., et al., Phospho-transfer networks and ATP homeostasis in
response to an ineffective electron transport chain in Pseudomonas
fluorescens. Archives of Biochemistry and Biophysics, 2016. 606: p. 26-
33.
65. Bramkamp, M. and D. Lopez, Exploring the Existence of Lipid Rafts in
Bacteria. Microbiology and Molecular Biology Reviews, 2015. 79(1): p. 81-
100.
66. Browman, D.T., M.B. Hoegg, and S.M. Robbins, The SPFH domain-
containing proteins: more than lipid raft markers. Trends Cell Biol, 2007.
17(8): p. 394-402.
67. Hinderhofer, M., et al., Evolution of prokaryotic SPFH proteins. BMC Evol
Biol, 2009. 9: p. 10.
68. Wagner, R.M., L. Kricks, and D. Lopez, Functional Membrane
Microdomains Organize Signaling Networks in Bacteria. J Membr Biol,
2017. 250(4): p. 367-378.
69. Chiba, S., K. Ito, and Y. Akiyama, The Escherichia coli plasma membrane
contains two PHB (prohibitin homology) domain protein complexes of
opposite orientations. Mol Microbiol, 2006. 60(2): p. 448-57.
70. Padilla-Vaca, F., et al., Flotillin homologue is involved in the swimming
behavior of Escherichia coli. Arch Microbiol, 2019. 201(7): p. 999-1008.
71. Lopez, D. and R. Kolter, Functional microdomains in bacterial membranes.
Genes Dev, 2010. 24(17): p. 1893-902.
72. Schneider, J., et al., Spatio-temporal remodeling of functional membrane
microdomains organizes the signaling networks of a bacterium. PLoS
Genet, 2015. 11(4): p. e1005140.
73. Gao, W., et al., Knock-out of SO1377 gene, which encodes the member
of a conserved hypothetical bacterial protein family COG2268, results in
alteration of iron metabolism, increased spontaneous mutation and
hydrogen peroxide sensitivity in Shewanella oneidensis MR-1. BMC
Genomics, 2006. 7: p. 76.

121
74. Guzman-Flores, J.E., et al., Proteomic analysis of Escherichia coli
detergent-resistant membranes (DRM). PLoS One, 2019. 14(10): p.
e0223794.
75. McClung, J.K., et al., Prohibitin: potential role in senescence,
development, and tumor suppression. Exp Gerontol, 1995. 30(2): p. 99-
124.
76. Van Aken, O., J. Whelan, and F. Van Breusegem, Prohibitins:
mitochondrial partners in development and stress response. Trends Plant
Sci, 2010. 15(5): p. 275-82.
77. Ikon, N. and R.O. Ryan, Cardiolipin and mitochondrial cristae organization.
Biochim Biophys Acta Biomembr, 2017. 1859(6): p. 1156-1163.
78. Matz, J.M., et al., An Unusual Prohibitin Regulates Malaria Parasite
Mitochondrial Membrane Potential. Cell Reports, 2018. 23(3): p. 756-767.
79. Merkwirth, C., et al., Loss of prohibitin membrane scaffolds impairs
mitochondrial architecture and leads to tau hyperphosphorylation and
neurodegeneration. PLoS Genet, 2012. 8(11): p. e1003021.
80. Merkwirth, C. and T. Langer, Prohibitin function within mitochondria:
essential roles for cell proliferation and cristae morphogenesis. Biochim
Biophys Acta, 2009. 1793(1): p. 27-32.
81. Mitsopoulos, P., et al., Stomatin-like protein 2 is required for in vivo
mitochondrial respiratory chain supercomplex formation and optimal cell
function. Mol Cell Biol, 2015. 35(10): p. 1838-47.
82. Arias-Cartin, R., et al., Cardiolipin binding in bacterial respiratory
complexes: Structural and functional implications. Biochimica et
Biophysica Acta (BBA) - Bioenergetics, 2012. 1817(10): p. 1937-1949.
83. Koch, G., et al., Attenuating Staphylococcus aureus Virulence by
Targeting Flotillin Protein Scaffold Activity. Cell Chem Biol, 2017. 24(7): p.
845-857 e6.
84. Mielich-Süss, B., et al., Flotillin scaffold activity contributes to type VII
secretion system assembly in Staphylococcus aureus. PLOS Pathogens,
2017. 13(11): p. e1006728.
85. Pfeltz, R.F., J.L. Schmidt, and B.J. Wilkinson, A microdilution plating
method for population analysis of antibiotic-resistant staphylococci. Microb
Drug Resist, 2001. 7(3): p. 289-95.

122
86. Gonzalez, B.E., et al., Severe Staphylococcal Sepsis in Adolescents in the
Era of Community-Acquired Methicillin-Resistant <em>Staphylococcus
aureus</em>. Pediatrics, 2005. 115(3): p. 642-648.
87. KREISWIRTH, B.N., et al., Nosocomial Transmission of a Strain of
Staphylococcus aureus Causing Toxic Shock Syndrome. Annals of
Internal Medicine, 1986. 105(5): p. 704-707.
88. Wach, A., PCR-synthesis of marker cassettes with long flanking homology
regions for gene disruptions in S. cerevisiae. Yeast, 1996. 12(3): p. 259-
265.
89. Pogulis, R.J., A.N. Vallejo, and L.R. Pease, Recombination and
Mutagenesis by Overlap Extension PCR, in The Nucleic Acid Protocols
Handbook, R. Rapley, Editor. 2000, Humana Press: Totowa, NJ. p. 857-
864.
90. Consortium, T.U., UniProt: a worldwide hub of protein knowledge. Nucleic
Acids Research, 2018. 47(D1): p. D506-D515.
91. El-Gebali, S., et al., The Pfam protein families database in 2019. Nucleic
Acids Research, 2018. 47(D1): p. D427-D432.
92. Mitchell, A.L., et al., InterPro in 2019: improving coverage, classification
and access to protein sequence annotations. Nucleic Acids Research,
2018. 47(D1): p. D351-D360.
93. Potter, S.C., et al., HMMER web server: 2018 update. Nucleic Acids
Research, 2018. 46(W1): p. W200-W204.
94. Bawono, P. and J. Heringa, PRALINE: A Versatile Multiple Sequence
Alignment Toolkit, in Multiple Sequence Alignment Methods, D.J. Russell,
Editor. 2014, Humana Press: Totowa, NJ. p. 245-262.
95. Dosztanyi, Z., Prediction of protein disorder based on IUPred. Protein Sci,
2018. 27(1): p. 331-340.
96. Thomsen, M.C.F. and M. Nielsen, Seq2Logo: a method for construction
and visualization of amino acid binding motifs and sequence profiles
including sequence weighting, pseudo counts and two-sided
representation of amino acid enrichment and depletion. Nucleic Acids
Research, 2012. 40(W1): p. W281-W287.
97. Jones, D.T., Protein secondary structure prediction based on position-
specific scoring matrices. J Mol Biol, 1999. 292(2): p. 195-202.

123
98. Gautier, R., et al., HELIQUEST: a web server to screen sequences with
specific alpha-helical properties. Bioinformatics, 2008. 24(18): p. 2101-2.
99. Andrews, J.M., Determination of minimum inhibitory concentrations.
Journal of Antimicrobial Chemotherapy, 2001. 48(suppl_1): p. 5-16.
100. EUCAST. Breakpoint Tables for Interpretation of MICs and Zone
Diameters. The European Committee on Antimicrobial Susceptibility
Testing. 2020; Available from: http://www.eucast.org/.
101. Ferrante, A. and Y.H. Thong, Optimal conditions for simultaneous
purification of mononuclear and polymorphonuclear leucocytes from
human blood by the hypaque-ficoll method. Journal of Immunological
Methods, 1980. 36(2): p. 109-117.
102. Green, M.R., Molecular cloning : a laboratory manual / Michael R. Green,
Joseph Sambrook, ed. J. Sambrook and L. Cold Spring Harbor. 2012, Cold
Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press.
103. Habermann, B.H., Oh Brother, Where Art Thou? Finding Orthologs in the
Twilight and Midnight Zones of Sequence Similarity, in Evolutionary
Biology: Convergent Evolution, Evolution of Complex Traits, Concepts and
Methods, P. Pontarotti, Editor. 2016, Springer International Publishing:
Cham. p. 393-419.
104. Mileykovskaya, E., et al., Effects of phospholipid composition on MinD-
membrane interactions in vitro and in vivo. J Biol Chem, 2003. 278(25): p.
22193-8.
105. Strahl, H. and J. Errington, Bacterial Membranes: Structure, Domains, and
Function. Annual Review of Microbiology, 2017. 71(1): p. 519-538.
106. van der Maten, E., et al., A versatile assay to determine bacterial and host
factors contributing to opsonophagocytotic killing in hirudin-anticoagulated
whole blood. Sci Rep, 2017. 7: p. 42137.
107. Winterbourn, C.C., A.J. Kettle, and M.B. Hampton, Reactive Oxygen
Species and Neutrophil Function. Annu Rev Biochem, 2016. 85: p. 765-
92.
108. Grosser, M.R., et al., Genetic requirements for Staphylococcus aureus
nitric oxide resistance and virulence. PLOS Pathogens, 2018. 14(3): p.
e1006907.

124
109. Noumi, T., M. Maeda, and M. Futai, Mode of inhibition of sodium azide on
H+-ATPase of Escherichia coli. FEBS Lett, 1987. 213(2): p. 381-4.
110. Messner, K.R. and J.A. Imlay, The identification of primary sites of
superoxide and hydrogen peroxide formation in the aerobic respiratory
chain and sulfite reductase complex of Escherichia coli. J Biol Chem,
1999. 274(15): p. 10119-28.
111. Yeh, J.I., U. Chinte, and S. Du, Structure of glycerol-3-phosphate
dehydrogenase, an essential monotopic membrane enzyme involved in
respiration and metabolism. Proc Natl Acad Sci U S A, 2008. 105(9): p.
3280-5.
112. Schurig-Briccio, L.A., et al., Characterization of the type 2
NADH:menaquinone oxidoreductases from Staphylococcus aureus and
the bactericidal action of phenothiazines. Biochimica et biophysica acta,
2014. 1837(7): p. 954-963.
113. Nepal, B., J. Leveritt, 3rd, and T. Lazaridis, Membrane Curvature Sensing
by Amphipathic Helices: Insights from Implicit Membrane Modeling.
Biophys J, 2018. 114(9): p. 2128-2141.
114. Welker, S., et al., Hsp12 is an intrinsically unstructured stress protein that
folds upon membrane association and modulates membrane function. Mol
Cell, 2010. 39(4): p. 507-20.
115. McDonald, C., et al., Membrane Stored Curvature Elastic Stress
Modulates Recruitment of Maintenance Proteins PspA and Vipp1. mBio,
2015. 6(5): p. e01188-15.
116. Green, J.B. and J.P. Young, Slipins: ancient origin, duplication and
diversification of the stomatin protein family. BMC Evol Biol, 2008. 8: p. 44.
117. Green, J.B., R.P. Lower, and J.P. Young, The NfeD protein family and its
conserved gene neighbours throughout prokaryotes: functional
implications for stomatin-like proteins. J Mol Evol, 2009. 69(6): p. 657-67.
118. Price, M.N., A.P. Arkin, and E.J. Alm, The Life-Cycle of Operons. PLOS
Genetics, 2006. 2(6): p. e96.
119. Ramakrishna, B.S., Role of the gut microbiota in human nutrition and
metabolism. Journal of Gastroenterology and Hepatology, 2013. 28(S4):
p. 9-17.

125
120. Drin, G. and B. Antonny, Amphipathic helices and membrane curvature.
FEBS Lett, 2010. 584(9): p. 1840-7.
121. Kuhn, S., C.J. Slavetinsky, and A. Peschel, Synthesis and function of
phospholipids in Staphylococcus aureus. Int J Med Microbiol, 2015.
305(2): p. 196-202.
122. Rossi, R.M., et al., Cardiolipin Synthesis and Outer Membrane
Localization Are Required for Shigella flexneri Virulence. mBio, 2017. 8(4).
123. Rowlett, V.W., et al., Impact of Membrane Phospholipid Alterations in
&lt;span class=&quot;named-content genus-species&quot;
id=&quot;named-content-1&quot;&gt;Escherichia coli&lt;/span&gt; on
Cellular Function and Bacterial Stress Adaptation. Journal of Bacteriology,
2017. 199(13): p. e00849-16.
124. Chadwick, G.L., et al., Convergent evolution of unusual complex I
homologs with increased proton pumping capacity: energetic and
ecological implications. The ISME Journal, 2018. 12(11): p. 2668-2680.
125. Perry, A.J., et al., Convergent evolution of receptors for protein import into
mitochondria. Curr Biol, 2006. 16(3): p. 221-9.
126. Thammavongsa, V., D.M. Missiakas, and O. Schneewind, Staphylococcus
aureus degrades neutrophil extracellular traps to promote immune cell
death. Science, 2013. 342(6160): p. 863-6.
127. Spooner, R. and O. Yilmaz, The role of reactive-oxygen-species in
microbial persistence and inflammation. Int J Mol Sci, 2011. 12(1): p. 334-
52.
128. Pollitt, E.J.G., et al., Staphylococcus aureus infection dynamics. PLOS
Pathogens, 2018. 14(6): p. e1007112.
129. Andrews, T. and K.E. Sullivan, Infections in Patients with Inherited Defects
in Phagocytic Function. Clinical Microbiology Reviews, 2003. 16(4): p.
597.
130. Mayer, S., et al., The Staphylococcus aureus NuoL-like protein MpsA
contributes to the generation of membrane potential. J Bacteriol, 2015.
197(5): p. 794-806.
131. Marshall, D.D., et al., Redox Imbalance Underlies the Fitness Defect
Associated with Inactivation of the Pta-AckA Pathway in Staphylococcus
aureus. J Proteome Res, 2016. 15(4): p. 1205-12.

126
132. Sadykov, M.R., et al., Inactivation of the Pta-AckA pathway causes cell
death in Staphylococcus aureus. J Bacteriol, 2013. 195(13): p. 3035-44.
133. Enjalbert, B., et al., Acetate fluxes in Escherichia coli are determined by
the thermodynamic control of the Pta-AckA pathway. Scientific Reports,
2017. 7(1): p. 42135.
134. Wolfe, A.J., The acetate switch. Microbiol Mol Biol Rev, 2005. 69(1): p. 12-
50.
135. Ahn, S., et al., Role of Glyoxylate Shunt in Oxidative Stress Response.
The Journal of biological chemistry, 2016. 291(22): p. 11928-11938.
136. Wang, Y., et al., Inactivation of TCA cycle enhances Staphylococcus
aureus persister cell formation in stationary phase. Sci Rep, 2018. 8(1): p.
10849.
137. Chatterjee, I., et al., Staphylococcus aureus ClpC is required for stress
resistance, aconitase activity, growth recovery, and death. J Bacteriol,
2005. 187(13): p. 4488-96.
138. Chang, W., et al., Global transcriptome analysis of Staphylococcus aureus
response to hydrogen peroxide. J Bacteriol, 2006. 188(4): p. 1648-59.
139. Nobre, L.S. and L.M. Saraiva, Effect of combined oxidative and nitrosative
stresses on Staphylococcus aureus transcriptome. Appl Microbiol
Biotechnol, 2013. 97(6): p. 2563-73.
140. Luna, E.J., et al., Lipid Raft Membrane Skeletons, in Membrane
Microdomain Signaling: Lipid Rafts in Biology and Medicine, M.P. Mattson,
Editor. 2005, Humana Press: Totowa, NJ. p. 47-69.
141. Pfeiffer, K., et al., Cardiolipin stabilizes respiratory chain supercomplexes.
J Biol Chem, 2003. 278(52): p. 52873-80.
142. Renner, L.D. and D.B. Weibel, Cardiolipin microdomains localize to
negatively curved regions of <em>Escherichia coli</em> membranes.
Proceedings of the National Academy of Sciences, 2011. 108(15): p.
6264-6269.
143. Zhukovsky, M.A., et al., Protein Amphipathic Helix Insertion: A Mechanism
to Induce Membrane Fission. Front Cell Dev Biol, 2019. 7: p. 291.
144. Pennington, E.R., et al., Proteolipid domains form in biomimetic and
cardiac mitochondrial vesicles and are regulated by cardiolipin

127
 concentration but not monolyso-cardiolipin. J Biol Chem, 2018. 293(41):
p. 15933-15946.
145. Romantsov, T., Z. Guan, and J.M. Wood, Cardiolipin and the osmotic
stress responses of bacteria. Biochim Biophys Acta, 2009. 1788(10): p.
2092-100.
146. Arias-Cartin, R., et al., Cardiolipin-based respiratory complex activation in
bacteria. Proc Natl Acad Sci U S A, 2011. 108(19): p. 7781-6.
147. Snead, W.T., et al., Membrane fission by protein crowding. Proceedings
of the National Academy of Sciences, 2017. 114(16): p. E3258-E3267.
148. Mulkidjanian, A.Y., et al., Does Oxidation of Mitochondrial Cardiolipin
Trigger a Chain of Antiapoptotic Reactions? Biochemistry (Mosc), 2018.
83(10): p. 1263-1278.
149. Shi, Y., Emerging roles of cardiolipin remodeling in mitochondrial
dysfunction associated with diabetes, obesity, and cardiovascular
diseases. J Biomed Res, 2010. 24(1): p. 6-15.
150. Mracek, T., et al., ROS generation and multiple forms of mammalian
mitochondrial glycerol-3-phosphate dehydrogenase. Biochim Biophys
Acta, 2014. 1837(1): p. 98-111.
151. Marreiros, B.C., et al., Exploring membrane respiratory chains. Biochimica
et Biophysica Acta (BBA) - Bioenergetics, 2016. 1857(8): p. 1039-1067.
152. Simon, J., R.J.M. van Spanning, and D.J. Richardson, The organisation of
proton motive and non-proton motive redox loops in prokaryotic respiratory
systems. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 2008.
1777(12): p. 1480-1490.
153. Meeusen, S., et al., Mitochondrial inner-membrane fusion and crista
maintenance requires the dynamin-related GTPase Mgm1. Cell, 2006.
127(2): p. 383-95.
154. Zhou, P., et al., Prohibitin reduces mitochondrial free radical production
and protects brain cells from different injury modalities. J Neurosci, 2012.
32(2): p. 583-92.
155. Rittmann, D., S.N. Lindner, and V.F. Wendisch, Engineering of a glycerol
utilization pathway for amino acid production by Corynebacterium
glutamicum. Appl Environ Microbiol, 2008. 74(20): p. 6216-22.

128
156. Choe, J., et al., Leishmania mexicana glycerol-3-phosphate
dehydrogenase showed conformational changes upon binding a bi-
substrate adduct. J Mol Biol, 2003. 329(2): p. 335-49.
157. Kannourakis, G., Glycogen storage disease. Semin Hematol, 2002. 39(2):
p. 103-6.
158. López-Soldado, I., et al., Liver Glycogen Reduces Food Intake and
Attenuates Obesity in a High-Fat Diet–Fed Mouse Model. Diabetes, 2015.
64(3): p. 796-807.

129