Received: 28 June 2019 | Revised: 1 October 2019 | Accepted: 3 October 2019

DOI: 10.1111/anu.13010

ORIGINAL ARTICLE

Atlantic salmon fed a nutrient package of surplus methionine,

vitamin B12, folic acid and vitamin B6 improved growth and
reduced the relative liver size, but when in excess growth
reduced

Marit Espe1 | Vibeke Vikeså2 | Tårn Helgøy Thomsen2 | Anne‐Catrin Adam1 |

Takaya Saito1 | Kaja H. Skjærven1

1
Institute of Marine Research (IMR), Bergen,
Norway Abstract
2
Skretting ARC, Stavanger, Norway Feeding plant‐based diet through smoltification of Atlantic salmon requires verifica‐
tion of the optimal level of 1C nutrients. Here, we fed Atlantic salmon plant‐based
Correspondence
Marit Espe, Institute of Marine Research diets containing three different surplus amounts of the 1C nutrients; methionine, co‐
(IMR), Po Box 1870, N‐5817, Bergen,
balamin (vitamin B12), pyridoxine (vitamin B6) and folic acid during 6 weeks in fresh
Norway.
Email: Marit.Espe@hi.no water, through smoltification, followed by 3 months on‐growing period in salt water.
The three diets were fed to fish dispersed in triplicate tanks throughout the experi‐
Funding information
Norwegian Research Council, Grant/Award ment. Mean start body weight was 32 g. Dietary methionine levels in the diets were
Number: 267787
6.7, 9.2 and 11.7 g/kg. Dietary B6 was 6.75, 8.45 and 11 mg/kg. Cobalamin was 0.16,
0.18 and 0.20 mg/kg. While dietary folic acid was 2.9, 4.8 and 6.3 mg/kg, diets are re‐
ferred to as low, medium and high 1C diet. All other amino acids were similar between
diets. The results showed no differences in growth or feed utilization in the fresh
water period, but following the on‐growing salt water period, differences between
diets occurred. The fish fed the medium 1C diet showed better growth, as compared
to fish fed the low or high 1C diet (p = .009). The medium 1C fed fish showed a relative
lower liver weight compared with fish fed low or high 1C diet (p = .025). Condition
factor was better in fish fed the medium and high 1C diet as compared to those fed
the low 1C diet (p = .0006). As expected, free methionine in liver, plasma and muscle
increased by dietary methionine inclusion. Surplus vitamins only had minor effect on
tissue concentrations. Based on these findings, we conclude that the micronutrient
and methionine level presented in the medium 1C diet improved the growth, liver
size and condition factor; however, more research is needed to evaluate the optimal
requirement level for each of the 1C nutrients.

KEYWORDS
amino acid retention, B12, B6, folate, folic acid, methionine, one‐carbon metabolism

Aquaculture Nutrition. 2019;00:1–13. wileyonlinelibrary.com/journal/anu

© 2019 John Wiley & Sons Ltd | 1
2 |
1 | I NTRO D U C TI O N
The substrates and cofactors involved in the one‐carbon metabolism
are highly important for healthy growth, to reduce deformities and for
overall energy metabolism for all vertebrates (Ducker & Rabinowitz,
2017). The 1C nutrients, folate and methionine and the cofactors B12
and B6 are important regulators for availability of the methyl donor
S‐adenosylmethionine (SAM), which is utilized for cellular methylation
reactions. For aquaculture, the dietary requirement levels of 1C nu‐
trients depend highly on the macronutrient composition in the feed.
When changing the raw materials from marine to plant based, the
overall performance improves if a higher level of 1C nutrients is added
to the feed (Hemre et al., 2016). Recently, Taylor et al. showed a better
growth performance for Atlantic salmon (Salmo salar) if fed a plant‐
based diet was enriched among others with a high folate, B12 and
B6 diet (Taylor et al., 2019). In a similar feeding trial, where we used
zebrafish as a nutritional model fish, we enriched the diet with folate,
B12, B6, choline and methionine and observed several improvements
for growth and health (Skjaerven et al., 2016). We have earlier shown
that early on‐growing stages of Atlantic salmon improve growth with
additional methionine in the diet (Espe et al., 2014).
Methionine is an indispensable amino acid, and in addition to
being incorporated into protein, methionine is involved in several
metabolic pathways due to being one of the main methyl donors in
metabolism (Finkelstein, 1990; Mato, Corrales, Lu, & Avila, 2002).
Before methionine is able to function as a methyl donor, methi‐
onine needs to be converted to S‐adenosylmethionine (SAM). Upon
donating the methyl group, SAM is converted to S‐adenosylho‐
mocysteine (SAH) which is unstable and easily converted to homo‐
cysteine. Homocysteine is cytotoxic to the cells and needs either to
be re‐methylated either via methionine synthase or betaine homo‐
cysteine methyltransferase, or eliminated via the trans‐sulfuration
pathway (Obeid, 2013). Therefore, the SAM to SAH ratio has been
used as a marker for the methylation capacity of cells (Cantoni &
Chiang, 1980; Kerr, 1972). The liver is a key target organ for meth‐
ylation reaction where SAM is the methyl donor and participates in
post‐translational protein modifications, DNA methylation, as well
as many metabolic pathways such as creatine synthesis (Brosnan,
Jacobs, Stead, & Brosnan, 2004), carnitine synthesis (Arslan, 2006)
and endogenous choline synthesis (Noga & Vance, 2003; da Silva,
Kelly, Al Rajabi, & Jacobs, 2014). SAM also is decarboxylated, and
the resulting propyl group is used in polyamine synthesis (Pegg,
2009; Cecero & Pegg, 2009). Opposite to adult salmon (Espe,
Hevrøy, Liaset, Lemme, & El‐Mowafi, 2008), juvenile salmon fed diet
containing 7.9 g methionine per kilo diet had reduced growth, due
to reduced protein gain, compared to fish fed a similar diet contain‐
ing 11.4 g methionine per kilo diet (Espe et al., 2014). Further, adult
salmon fed deficient methionine increased triacyl glycerol (TAG) in
liver (Espe, Rathore, Du, Liaset, & El‐Mowafi, 2010), while juvenile
salmon did not increase liver TAG, but had an increased relative liver
weight when fed the lower methionine diet (Espe et al., 2014).
Liver lipid accumulation is associated with increased metabolic
stress, energy depletion, cytokine activation and inflammation in
ESPE et al.
mammals (Koek, Liedorp, & Bast, 2011; Rolo, Teodoro, Palmeira,
& Carlos, 2012; Vanni et al., 2010; Vernon, Baranova, & Younossi,
2011). Choline is part of the phospholipid phosphatidylcholine (PC)
of which is abundant in liver. PC is synthesized by two metabolic
pathways within the liver either through the Kennedy pathway or
through the phosphatidylethanolamine methyl transferase (PEMT)
pathway (Vance, Walkey, & Cui, 1997; Watkins, Zhu, & Zeisel,
2003). It has been reported that mammalian species have the ca‐
pacity to synthesize almost 40% of the required choline endoge‐
nously by a three‐step methylation of phosphatidylethanolamine
(PEA) through the enzyme PEMT. The endogenous choline syn‐
thesis requires three molecules of SAM as methyl donors for each
choline molecule synthesized (Mato et al., 2002; Noga & Vance,
2003; Stead, Brosnan, Brosnan, Vance, & Jacobs, 2006; Vance
& Ridgeway, 1988). The SAM concentration in Atlantic salmon
is known to depend on adequate methionine intake (Espe et al.,
2008), which also is true for rodents (Sugiyama, Kumazawa, Zhou,
& Saeki, 1998). It has been proposed that liver TAG accumula‐
tion is due to reduced availability of PC and apolipoprotein B100
(ApoB100) of which is needed to assembly the very low density li‐
poproteins (VLDL) and transport of TAG from the liver to peripheral
organs important for growth, like the muscle (Vance et al., 1997;
Watkins et al., 2003). Hemre et al. (2016) showed that the addition
of nutrient package of B‐vitamins, folate, B12 and B6 to salmon fed
plant protein‐based diets, reported that salmon benefits from diets
having higher vitamin inclusion than suggested by NRC (2011). The
usage and activity of the 1C nutrients are highly tissue specific and
are tightly regulated within the different compartments in the cell
(Ducker & Rabinowitz, 2017). Vitamin B6 serves as cofactor for
several enzymes including important enzymes in the trans‐sulfura‐
tion pathway to reduce the homocysteine level if re‐methylation to
methionine is limited. One way compromising methionine synthase
activity to re‐methylate homocysteine to methionine is either by
low levels of the substrate folate or by low levels of the cofactor
vitamin B12 (cobalamin; da Silva et al., 2014). Atlantic salmon, es‐
pecially presmolt, had reduced relative liver size and viscera indices
and better protein retention when fed the B‐vitamin‐supplemented
diets above NRC recommendation, but without surplus methionine
(Hemre et al., 2016).
The current feeding trial, testing three different levels of 1‐C
nutrients, was designed to improve the dietary recommendations
for salmon by testing a combined surplus methionine as well as
added vitamin B6, folate and vitamin B12, here referred to as 1C
nutrients, in presmolt salmon through the smoltification and in the
following on‐growing phase in sea water. Results aim to address
whether additional 1C nutrients would be beneficial for growth and
tissue deposition. Here, we used the latest literature in the field
and made diets with three different inclusion levels of methionine,
folate, vitamin B12 and B6. The levels chosen for the low 1C diet
will include B‐vitamins to the requirement level as recommended
by Hemre et al. (2016) and methionine given in NRC (2011). The
medium and high 1C group contained higher levels above the pre‐
vious dietary recommendations published for salmon. The three
ESPE et al. | 3

TA B L E 1 Composition of the experimental diets used and analysed values (g/kg)

3 mm 4 mm

Base† Low 1C Medium 1C High 1C Low 1C Medium 1C High 1C

Diet composition
Wheat 54.22 50.64 47.05 54.22 50.64 47.05
Wheat gluten 132.03 — — — — — —
Sun flower meal 10.0 — — — — — —
Dehulled faba beans 30.0 — — — — — —
Pea concentrate 150.0 — — — — — —
Soy protein 240.0 — — — — — —
concentrate
Krill meal 20.0 — — — — — —
Fish meal 120.0 — — — — — —
Rapeseed oil 81.24 — — — — — —
Fish oil 126.9 — — — — — —
Water 11.43 11.84 12.26 11.43 11.84 12.26
dl‐methionine 0.05 3.12 6.19 0.05 3.12 6.19
Choline 0.92 — — — — — —
NRC mineral mix 2.0 — — — — — —
NRC Vitamin mix 1.0 — — — — — —
Vitamin B12 0.156 0.179 0.203 0.156 0.179 0.203
Folate 0.023 0.053 0.083 0.023 0.053 0.083
Vitamin B6 0.077 0.107 0.137 0.077 0.107 0.137
Taurine 2.8 — — — — — —
Micronutrients 17.2a — — — — — —
Analysed composition (g/kg)
Crude protein 436.7b — — — — — —
c
Crude lipid 235 — — — — — —
Dry matter 920 — — — — — —
Energy (MJ/kg) 22.8d — — — — — —
Vitamin B12 (mg/kg) 0.16 0.18 0.20 0.15 0.16 0.20
Folate (mg/kg) 2.90 4.80 6.30 2.60 4.60 7.80
Vitamin B6 (mg/kg) 6.75 8.45 11.00 7.01 9.31 11.25
abcd
Note: Values are not equivalent but similar as determined by their relatively small SDs: ±0.01, ±5.2, ±5.5 and ±0.18, respectively.
†
Base value indicates that all values in the same row are equivalent/similar across the diets and the pellet sizes.

experimental diets were fed to Atlantic salmon during 6 weeks in

the fresh water presmolt period, through sea water transfer and
3 months in the salt water to address effects of surplus 1C diets on
growth and metabolism.
2 | M ATE R I A L A N D M E TH O DS
2.1 | Ethics statement
The experiments complied with the guidelines of the Norwegian
Regulation on Animal Experimentation and European Community
Directive 86/609/EEC.
2.2 | Feed production
Skretting ARC (Stavanger, Norway) provided the experimental diets,
which were prepared at 3 and 4 mm pellet size as fish grew from
presmolt to postsmolt throughout the feeding trial. Three experi‐
mental diets were prepared. The diets, low 1C, medium 1C and high
1C diets, contained increasing concentrations of the one‐carbon (1C)
nutrients; methionine, folate, vitamin B12 and B6. The levels chosen
for the low 1C diet will include B‐vitamins to the requirement level as
recommended by Hemre et al. (2016) and methionine given in NRC
(2011). The medium and high 1C group contained slightly higher in‐
clusion of 1C metabolites. The protein source was mainly pea and
4 | ESPE et al.

soy protein concentrates, but diets also contained wheat gluten and
dehulled faba beans. To ensure good palatability and thus feed in‐
take (Espe, Lemme, Petri, & El‐Mowafi, 2006, 2007), smaller amount
of fishmeal and krill meal was included. A mixture of fish oil and
rapeseed oil was used as the lipid source. Taurine was added to all
diets at the same concentration. Tables 1 and 2 show diet composi‐
tion and analysed values of the experimental diets. Dietary methio‐
nine levels in the diets were 6.7, 9.2 and 11.7 g/kg. Dietary B6 was
6.75, 8.45 and 11 mg/kg. Cobalamin was 0.16, 0.18 and 0.20 mg/kg.
While dietary folic acid was 2.9, 4.8 and 6.3 mg/kg, diets are referred
to as low, medium and high 1C diets.
2.3 | Fresh water fish trial
The fish trial was run at Skretting ARC Lerang Research Station,
Norway. Presmolt Atlantic salmon (SalmoBreed strain) with mean
body weight of 23 ± 3 g were acclimatized to the experimental tanks
for 2 weeks prior to the start of the experiment. At the start of the
experiment, 20 fish were sampled for chemical analysis represent‐
ing the crude chemical composition of the fish. Randomized tripli‐
cate tanks (diameter 0.6 m, volume: 70 L, water flow: 300–450 L/hr;
rearing temperature 11.9 ± 0.4°C) contained 90 fish per tank with
mean body weight 32.1 g (bulk weight). Fish were fed with each of
the three diets for a period of 71 days using Hølland belt feeders
(Hølland Teknologi AS, Norway http://geirr​asmus​sen.wixsi​te.com/
holla​nd-tekno​loginew). Fish were fed continuously until day 94. After
this, the fish were provided three daily meals (2 hr per meal, 08:00,
12:00 and 20:00). The fish received 12 hr light and 12 hr darkness
during the first 6 weeks of the experiment followed by continuous
light for the rest of the experiment. All fish were vaccinated (0.05 ml
ALPHA JECT micro® 6, https​://www.pharm​aq.no/produ​c ts/injec​
table/​norwa​y/) at day 38. Fish were starved for five days during vac‐
cination. The outline of the experiment is shown in Figure 1a.
2.4 | Fresh water sampling
At day 95, fish blood were collected from the caudal vain into hep‐
arinized syringes from 5 fish per tank, centrifuged and plasma was
pooled for each tank. Pooled samples of liver and muscle from 5 fish
per tank were collected and frozen in liquid nitrogen to be used for
chemical analysis, and in addition, from the same fish, individual
samples (n = 5 per tank) of liver and muscle tissues were dissected
and snap frozen on liquid nitrogen for gene expression studies. All
fish were weighed for growth calculation. In addition, length and
liver weight were measured from the sampled fish to allow calcula‐
tion of relative liver size and condition factor. Five fish per tank were
analysed and pooled to calculate retention of nutrients. All samples
were collected from fish 24‐hr postfeeding to address metabolism
in fish fed the three diets rather than to reflect the diet itself (Espe
et al., 2006; Espe, Lied, & Torrissen, 1993). Fish were anaesthetized
with Tricaine (Pharmaq) before all handling.
2.5 | Smoltification, salt water fish
trial and sampling
Following the sampling at the end of the fresh water period, fish
were transferred to salt water and went through smoltification.

TA B L E 2 Dietary amino acid composition plus taurine (g/kg) During the salt water transfer, fish were moved to larger tanks (tank
diameter 0.6 m, tank volume: 450 L, water flow: 450–900 L/hr;
3 mm 4 mm
rearing temperature 12.0 ± 0.1°C). Following smoltification, 20 fish
Diets A B C A B C were sampled for chemical composition at start of the salt water
period. Transferred fish had mean body weight of 95.0 ± 3.9 g. Fish
OH‐pro 0.99 1.00 1.00 0.99 1.00 1.00
were fed the same diets as fed in the presmolt period for 98 days
His 9.3 9.2 9.2 9.2 9.4 9.2
before sampling at the end of the postsmolt period. Sampling
Taurine 2.4 2.3 2.4 2.3 2.4 2.4
procedures were performed as described above for the presmolt
Ser 20.5 20.7 20.6 20.6 21.2 21.1
period.
Arg 25.1 25.1 25.0 25.0 25.4 25.2
Gly 18.4 18.4 18.6 18.5 19.0 18.6
Asp 38.8 39.6 37.8 38.8 38.6 38.9
2.6 | Chemical analysis
Glu 90.4 93.0 87.8 90.1 90.2 90.8 Energy, fat and protein content of the feeds were determined as de‐
Thr 15.4 15.5 15.3 15.5 15.8 15.7 scribed by Espe et al. (2006). Amino acid composition in the diets
Ala 17.9 18.2 17.8 18.0 18.3 18.2 and whole fish was determined after hydrolysis for 22 hr at 110°C
Pro 27.6 27.6 27.6 27.5 28.2 27.7 in 6N HCl (chemically equivalent to 6M HCl) containing 3.125 mM
Lys 26.1 26.5 26.1 26.2 26.6 26.3 Norvalin (internal standard) and 3 mM DTT (to protect the sulphur

Tyr 13.4 13.5 13.3 13.5 13.9 13.6 amino acids against oxidation), and precolumn derivatisation with
AccQTag™ at 55°C as described by Waters. Amino acids were sep‐
Met 6.7 9.2 11.7 6.7 9.5 12.1
arated on a UPLC system (Waters Aquity UPLC BEH C18 column
Val 20.1 19.9 19.7 20.1 20.3 19.7
internal diameter of 1.7 µM at a flow rate of 0.7 ml/min using the
Ile 17.1 16.8 16.7 17.1 17.2 16.6
gradient offered by the supplier). The concentration of each amino
Leu 31.4 31.5 31.4 31.3 32.1 31.6
acid was calculated using external standards supplied by Sigma. Free
Phe 20.5 20.3 20.4 20.3 20.9 20.4
amino acids and N‐metabolites were determined in plasma, liver and
ESPE et al. | 5

F I G U R E 1 The outline and sampling points of the experiment growing Atlantic salmon in fresh water, during smoltification and in the on‐
growing sea water period are outlined in (a), while the mean body weight at the different sampling points is given in (b). The only difference
in mean body weight between the low, medium and high 1C diets occurred at the end of the salt water period. Values are tank means ± SEM
(ANOVA followed by Tukey)

muscle of pooled samples on Biochrom 20 plus amino acid bioana‐
lyzer (Amersham Pharmacia Biotech) using postcolumn derivatiza‐
tion with ninhydrin as described (Espe et al., 2006). The lipid classes
(TAG, PE, PC, PL and total cholesterol) in liver were analysed after
lipid extraction with 2:1 chloroform: methanol as described (Bell,
Dick, McVicar, Sargent, & Thompson, 1993; Liaset, Julshamn, &
Espe, 2003). Folate and cobalamin (B12) were determined by micro‐
biological methods (Hemre et al., 2016). Pyridoxine (vitamin B6) was
determined by HPLC (CEN, 2002).
2.7 | Gene expression in liver and muscle
RNA was extracted from liver and muscle (n = 5 individual fish
per tank) using the BioRobot EZ1 and EZ1 RNA Universal Tissue
kit (Qiagen) according to the manufacture's descriptions. Quality
and quantity of RNA were analysed as described elsewhere
(Espe et al., 2014). Reverse transcription followed by quatita‐
tive real‐time PCR (RT‐qPCR) as earlier described (Skjaerven,
Olsvik, Finn, Holen, & Hamre, 2011). In liver, MGAT2 and DGAT1
(for primer sequence see: Liland et al., 2018) and ApoB100 and
CD36 (for primer sequence see: Espe, Xie, Chen, Araujo, & Holen,
2019), and MAT (forward primer: GCTGCTGTGTGGAGAGATCA,
reverse primer: TGGTCTCCAGCTCCCATATC) and CBS (for‐
ward primer: AAACCCTCAGACCCAGTCAA, reverse primer:
CTCTTCTCCCTGGCTGTGAC) were addressed, while in muscle
growth hormone receptor (GHr), insulin‐like growth factor 1 (IGF‐1)
and IGF‐1 receptor (IGF‐1r) were analysed (for primer sequence
see: Hevrøy et al., 2013). The obtained c t values were normalized
against two reference genes, b‐actin and EF1a (for primer sequence
see: Espe et al., 2019). Normalization and calculation of relative gene
expression were done using the GE‐Norm tool as described (Olsvik,
Lie, Jordal, Nilsen, & Hordvik, 2005).
2.8 | Calculations
Calculations of growth and deposition were done at the end of the
fresh water period, during the salt water period as well as during
the whole period including the vaccination and smoltification period
(i.e., from the start of fresh water until the end of the salt water pe‐
riod) when fish did not consume any feed or very little feed.
6 | ESPE et al.

TA B L E 3 Growth performance and

Diets Diet A Diet B Diet C p‐Values
body indexes during the fresh water, salt
Fresh water period water and the whole grow out period
SGR (%/day) 1.39 ± 0.03 1.44 ± 0.03 1.37 ± 0.07 .55
FCR 1.25 ± 0.03 1.17 ± 0.04 1.32 ± 0.04 .07
PPV (%) 33.5 ± 1.8 34.8 ± 1.2 31.6 ± 1.0 .33
PER 1.82 ± 0.04 1.95 ± 0.07 1.76 ± 0.06 .13
HSI 1.09 ± 0.04 0.99 ± 0.00 1.02 ± 0.01 .06
CF 1.29 ± 0.02 1.32 ± 0.00 1.31 ± 0.03 .51
Salt water period
SGR (%/day) 1.50 ± 0.07 1.61 ± 0.04 1.43 ± 0.03 .11
FCR 0.78 ± 0.02 0.73 ± 0.01 0.78 ± 0.01 .08
PPV (%) 46.4 ± 1.2 51.1 ± 0.1 52.2 ± 2.6 .10
PER 2.90 ± 0.07 3.05 ± 0.02 2.94 ± 0.06 .25
HSI 1.64 ± 0.08b 1.32 ± 0.04a 1.42 ± 0.05ab .025
CF 1.46 ± 0.01b 1.55 ± 0.01a 1.53 ± 0.02a .006
The whole period
SGR (%/day) 1.37 ± 0.01b 1.44 ± 0.02a 1.36 ± 0.01b .01
FCR 0.85 ± 0.01 0.80 ± 0.02 0.86 ± 0.00 .16
PPV (%) 43.4 ± 1.1 47.9 ± 1.0 48.1 ± 1.5 .056
PER 2.65 ± 0.05 2.81 ± 0.04 2.69 ± 0.02 .07

Note: Values are mean of three tanks ± SEM, means followed by different letters differ significantly
(p < .05, ANOVA followed by Tukey's).

Growth was calculated as specific growth rate (SGR): ( )

liver weight
HSI = 100 ∗
(
ln (final mean body weight) − ln (initial mean body weight)
) body weight
SGR = 100 ∗
days of feeding
( )
body weight
Feed utilization was calculated as feed conversion ratio (FCR): CF =
fork length3
( )
final biomass live fish + biomass dead fish
FCR = Consumed feed ∗
body mass increase

Calculation of nutrient deposition of protein productive value 2.9 | Statistical analysis

(PPV):
All values are presented as the tank mean ± SE. ANOVA followed
( ) by post hoc Tukey's HSD test was used to test differences be‐
final protein content − initial protein content
PPV = 100 ∗
consumed protein tween treatment means and accepted as different p < .05. Data
were tested for homogeneity and normal distribution prior to
Calculation of nutrient deposition of protein efficiency ratio (PER): Tukey. The nonparametric Kruskall–Wallis test was used when
( ) data did not fulfil the ANOVA assumptions. The statistical pro‐
final body weight − initial body weight
PER = gram Statistica (Stat. Inc. Version 15.0) was applied for statistical
protein consumed
analysis.

Calculation of nutrient deposition of retention of indispensable

amino acids (AA): 3 | R E S U LT S
( )
AA deposition
AA retention = 100 ∗ 3.1 | Growth performance and protein accretion
AA consumed
The body mean weight at each sampling point is shown in
To address any changes in lipid deposition pattern, relative liver Figure 1b. Growth performance during the fresh water period, the
size as hepatosomatic index (HSI) and condition factor were calcu‐ salt water period (post smoltification) and the whole period includ‐
lated (fork length is equivalent to standard length): ing the salt water transfer is listed in Table 3. Fish grew from mean
ESPE et al. | 7

body weight of 31–90 g during the fresh water period, and there TA B L E 4 Retention of indispensable amino acids (% deposited
were no differences in growth performance between fish fed the of consumed) during the presmolt period, the postsmolt period and
the whole experiment (from presmolt through sea water transfer
different diets. FCR was between 1.17 and 1.32 in fish fed the
and postsmolt growth)
three diets, and no differences in FCR were present in the fresh
water period. PPV and PER ratio were in the range of 31%–33% Diets Diet A Diet B Diet C p‐Values
and 1.76–1.95, respectively. There were no differences in protein Fresh water period
utilization between the experimental diets during the fresh water His 39.0 ± 1.8 40.5 ± 2.3 36.2 ± 1.2 .31
period. Although HSI was numerically higher in fish fed the low 1C
Arg 32.3 ± 1.7 35.6 ± 2.6 32.6 ± 1.0 .45
diet, it was not significantly different from fish fed the diets added
Thr 40.4 ± 2.2 43.7 ± 1.8 40.0 ± 1.1 .33
surplus B‐vitamins and methionine (p = .06). CF did not differ in
Lys 44.4 ± 2.5 46.5 ± 1.2 41.3 ± 1.3 .19
the fresh water period between fish fed any of the diets.
Met 61.9 ± 3.5a 49.6 ± 2.7b 35.5 ± 1.1c .001
During the salt water period, fish fed the medium 1C diet had higher
Val 36.7 ± 1.9 40.6 ± 1.8 35.5 ± 1.4 .17
postsmolt body weight (p = .009) compared with fish fed diets contain‐
ing both higher and lower methionine and B‐vitamin inclusions. Even Ile 32.6 ± 1.7 36.5 ± 1.7 31.5 ± 1.4 .14

though SGR was numerically higher for fish fed the medium 1C diet, it Leu 32.3 ± 1.7 34.9 ± 1.3 31.0 ± 1.0 .19
did not reach a statistical difference. However, when SGR was calcu‐ Phe 28.1 ± 1.4 31.5 ± 1.8 28.2 ± 1.1 .24
lated for the whole period, including the sea water transfer period, fish Salt water period
fed the medium 1C diet had significantly better growth (p = .01) than His 52.1 ± 2.5 59.5 ± 0.9 57.1 ± 3.3 .17
fish fed the lower or higher methionine and B‐vitamin diets. Neither Arg 32.9 ± 1.2 36.4 ± 0.4 34.7 ± 1.2 .12
did PPV, PER or FCR differ between treatments. HSI was higher in fish Thr 55.8 ± 2.4a 65.2 ± 0.5b 62.4 ± 2.3b .036
fed the low 1C diet (p = .025) compared with those fed the medium 1 C
Lys 62.0 ± 3.0 71.1 ± 0.9 68.9 ± 2.3 .06
and high 1C diet during the salt water period. Also, CF was lower in fish
Met 85.2 ± 3.8a 69.9 ± 0.4b 52.5 ± 2.8c .0004
fed the low 1C diet as compared to fish fed the diets where methionine
Val 44.4 ± 2.5 52.2 ± 0.9 50.5 ± 2.7 .09
and vitamins were added in surplus (p = .006).
Ile 45.2 ± 2.7 54.2 ± 0.8 52.3 ± 2.8 .07
Generally, FCR and protein utilization (PPV and PER) were better
Leu 44.2 ± 2.1 51.0 ± 0.6 48.9 ± 2.4 .09
during the salt water period as compared with the fresh water period
(Table 3). Retention of indispensable amino acids during the fresh Phe 38.6 ± 1.9 43.9 ± 0.4 42.1 ± 2.6 .21

water, salt water and the whole period including the smoltification The whole period

period is shown in Table 4. Methionine retention decreased (p = .001) His 47.7 ± 2.0 54.5 ± 1.6 61.6 ± 2.7 .16
when dietary methionine increased, while none of the other indispens‐ Arg 29.2 ± 1.0 32.7 ± 0.5 30.6 ± 0.9 .059
able amino acids differed between diets in fresh water period. This re‐ Thr 51.5 ± 1.8a 60.0 ± 1.2b 57.0 ± 1.8ab .026
duced methionine retention persisted throughout the salt water period Lys 57.7 ± 2.3 66.1 ± 1.5 63.3 ± 1.7 .053
(p = .0004). Additionally, threonine retention was lower in fish fed the Met 78.2 ± 3.0a 64.7 ± 1.2b 48.1 ± 2.0c .0002
low 1C diet during the salt water period (p = .036). Generally, the re‐ Val 41.1 ± 1.8 48.6 ± 1.4 46.4 ± 1.9 .055
tention of amino acids was higher during the salt water period as com‐
Ile 41.9 ± 2.0a 50.3 ± 1.3b 48.0 ± 2.0ab .040
pared with the fresh water period. The retention of the branched chain
Leu 40.8 ± 1.5 47.2 ± 1.1 44.8 ± 1.8 .06
amino acids was numerically less in fish fed the low 1C diet, but only
Phe 35.4 ± 1.5 40.5 ± 1.0 38.4 ± 2.0 .15
isoleucine reached a statistical difference (p = .04) when the whole pe‐
riod including the salt water transfer was included. Note: Values are mean of three tanks ± SEM, means followed by differ‐
ent letters differ significantly (p < .05, ANOVA followed by Tukey's).

3.2 | Free amino acids and N‐metabolites in liver,

plasma and muscle
Free methionine, serine and glycine plus taurine, cystathionine,
ammonia and urea in muscle, plasma and liver are given in Figure 2
for the fresh water period and at the end of the salt water pe‐
riod. Increasing the dietary methionine increased free methionine
in muscle (p < .0001) and plasma but not in liver (p = .14) during
the fresh water period. This also was the case at the end of the
salt water period. Taurine did not differ between treatments in
the fresh water period, while taurine increased with increasing di‐
etary methionine in plasma and liver during the salt water period.
Cystathionine was not detected in plasma of the fresh water fish,
but increased with increasing dietary methionine in muscle and
liver. These changes in cystathionine also persisted throughout the
salt water period. Urea was less in fish fed the un‐supplemented
diet (low 1C diet) in liver and muscle during the fresh water period,
but these differences were not present at the end of the salt water
period. Increasing dietary methionine in general increased urea,
and especially so in the presmolt salmon indicating a higher deg‐
radation of amino acids when dietary methionine and B‐vitamin
supplementation was low. The other N‐metabolites analysed are
given as Tables S1–S3.
8 | ESPE et al.

F I G U R E 2 Muscle, plasma and liver

b b a a b b a b a b b cystathionine, glycine, methionine, serine
and urea levels (µmol/100 g tissues or
µmol/100 ml plasma)in the pre‐ and
ND postsmolt Atlantic salmon fed either a
low 1C, a medium 1C or a high 1C diet.
Bars show the mean of three tanks ± SEM
a b b b c a b c a a b b
and different letters indicate means that
differs significantly between the diet
groups of either pre‐ or postsmolt salmon
(ANOVA, followed by Tukey). Plasma
cystathionine was not detected (ND)
b a a a b b c b a a b b

a b b

b ab a a ab b

b a a c b a

Table 5. There were no differences in any of these between fish fed

3.3 | Vitamin B6, B12 and folate in liver and
muscle tissue
Vitamin B6, folate and B12 at the end of the fresh and at the
end of the salt water period are shown in Figure 3. Muscle from
fresh water period fish, fed the medium 1C diet, contained less
(p = .002) total vitamin B6 as compared to fish fed both the low
and high 1C diets, but this difference in vitamin B6 disappeared
(p = .94) at the end of the sea water period. Total vitamin B6 in
liver from fish during the fresh water and salt water period was
not different between dietary groups. No difference was present
in either folate or cobalamin in the fresh water period in either
liver or muscle. However, at the end of the salt water period, fish
fed the low and medium 1C diet contained more folate in muscle
as compared to fish fed the high 1C diet (p = .012). Liver folate did
not differ among treatments neither did total vitamin B6 at the
end of the trial.
3.4 | Lipid classes in liver
Phospholipids, total cholesterol and TAG in liver of fish fed the re‐
spective diets throughout the whole feeding period are given in
the three diets. At the end of the fresh water period, lipid classes
could not be analysed due to the small size of the livers.
3.5 | Gene expression in liver
Gene expression in fresh water and salt water liver samples is shown
in Figure 4a,b, respectively. Gene expression of ApoB100 was not
different in fish fed any of the diets (p = .85) in the fresh water pe‐
riod. Neither was the gene expression of Apo100 affected by diets
at the final sampling of the salt water period (p = .58). Gene expres‐
sion of the cluster of differentiation 36 (CD36) was higher in fish
fed the medium and high 1C diet as compared to fish fed the low 1C
diet in the fresh water period (p = .011). By the end sampling in the
salt water period, CD36 did not differ between fish fed the experi‐
mental diets (p = .24). By the end of the fresh water period, there
were no differences between dietary treatment and the expression
of MGAT2 (p = .98). The expression was not affected following the
sea water feeding period either (p = .12). However, the expression
of DGAT1 was higher in fish fed diets low and high 1C diets as com‐
pared to fish fed the medium 1C diet during the fresh water period
(p = .0006). Following the salt water period, DGAT expression was
ESPE et al. | 9

4 | D I S CU S S I O N
Diet Low 1C Medium 1C High 1C
Vitamin B6 is required as cofactor for several enzymes includ‐
Cobalamin, Liver Cobalamin, Muscle ing the trans‐sulfuration of methionine through the enzyme
0.125 a b b cystathionine beta‐synthase, while folate is a methyl donor in
0.75 0.100
re‐methylation of homocysteine to methionine by the enzyme
0.50 0.075
methionine synthase of which requires vitamin B12 (Finkelstein,
0.050
0.25 0.025 1990; Obeid, 2013). Thus, all three vitamins are essential for the
0.00 0.000 metabolism of methionine in fish (Skjaerven et al., 2016), as in
Folate, Liver Folate, Muscle mammals (Ducker & Rabinowitz, 2017). There is limited research
0.3 on the requirement levels for several micronutrients for Atlantic
mg/kg wet tissue

a a
15
0.2
10
5 0.1
0 0.0
Total vitamin B6, Liver Total vitamin B6, Muscle
8 8 a b a so in the fresh water period. Recently, Taylor et al. (2019) showed
6 6
4 4
2 2
0 0
pre−smolt post−smolt pre−smolt post−smolt
F I G U R E 3 Muscle and liver cobalamin, folate and total vitamin
B6 in the end of the presmolt and postsmolt growth periods (mg/
kg wet tissues) Values are mean ± SEM of three tanks. Means
that differ significantly are indicated by different letters (ANOVA
followed by Tukey)
higher in fish fed the high 1C diet compared with those fed the low
and medium 1C diets (p = .001).
3.6 | Gene expression in muscle at the end of the
salt water period
In white muscle tissue, the expression of growth hormone receptor
(ghr) was higher in fish fed the low 1 C diet (p < .0001) compared
with fish fed the medium or high 1C diet, while neither insulin‐like
growth factor (igf‐1) nor its receptor (igf1r) was affected by dietary
treatment (Figure 5).
b
salmon, and these same nutrients are especially important during
periods of extensive growth and development the 1C nutrients is
of high importance. Hemre et al. (2016) postulated that Atlantic
salmon required higher dietary B‐vitamins than reported in NRC
(2011) to improve nutrient accretion and growth, and especially
that when changing the macronutrient composition from marine
to plant‐based diets, the overall performance improved if these B‐
vitamins were added in double amounts compared with the NRC
(2011) recommendations.
The current trial aimed to test whether fish required higher
amounts of pyridoxine (B6), cobalamin (B12) and folate to effi‐
ciently metabolize methionine and to improve deposition pattern
at requirement level and at surplus methionine and vitamin lev‐
els. In the current trial, the vitamin levels at the low 1C diet were
similar to the levels suggested by Hemre et al. (2016), while me‐
thionine is according to required levels (Espe et al., 2008; NRC,
2011) then added at two surplus levels. We previously reported
that juvenile Atlantic salmon showed better protein accretion and
growth when fed 11.4 g methionine per kilo diet as compared to
salmon fed 7.9 g methionine per kilo diet (Espe et al., 2014). Espe
et al. (2010) reported increased TAG accumulation in liver of adult
salmon fed low methionine diets (6.7 g methionine per kilo diet)
of which disappeared when salmon were fed diets containing
9 g methionine per kg diet. On the other hand, juvenile Atlantic
salmon fed diets containing low methionine or a methionine‐sup‐
plemented diet did not accumulate liver TAG (Espe et al., 2014),
though having a higher relative liver weight and reduced growth

TA B L E 5 Lipid classes (mg/g tissue) in

C Diet A Diet B Diet C p‐Values
liver at the end of the sea water period
Phosphatidylcholine 21.57 ± 3.19 27.57 ± 2.36 26.63 ± 0.60 .22
Phosphatidylserine 2.07 ± 0.45 2.33 ± 0.12 2.43 ± 0.14 .65
Phosphatidylinositol 2.37 ± 0.49 2.90 ± 0.11 2.97 ± 0.12 .36
Phosphatidyletanolamine 2.33 ± 1.17 3.53 ± 0.58 4.50 ± 0.15 .21
Total cholesterol 2.67 ± 0.28 3.00 ± 0.11 3.47 ± 0.18 .087
TAG 5.40 ± 0.66 10.17 ± 2.76 8.17 ± 0.73 .22
Total PL 30.73 ± 5.68 38.87 ± 2.71 39.40 ± 0.45 .25

Note: Values are mean of three tanks ± SEM, means followed by different letters differ significantly
(p < .05, ANOVA followed by Tukey's).
10 | ESPE et al.

b a a F I G U R E 4 Normalized gene
0.5 0.6
(a) expression in liver at the end of the
0.4 fresh water period (a) while the gene
NGE ApoB100

0.4 expression the liver at the end of the

NGE CD36
0.3
salt water period is shown in (b). At the
0.2
0.2 end of the fresh water period, ApoB100
0.1
was unaffected by diets (p = .85), while
fish fed the medium 1C diet and high 1C
0.0 0.0
diet showed higher expression of CD36
1C

1C

1C

1C

1C

1C
(p = .011). MGAT1 was not affected by
w

h
ig

ig
Lo

Lo
iu

iu
diets (p = .98), while DGAT2 was less
H

H
ed

ed
M

M
expressed in fish fed medium 1C diet
as compared to low and high 1C diet
a b a
0.8 0.6 (p = .0006). MAT1a1 was not significantly
affected (p = .36). At the end of the salt
water period, ApoB was not affected by
NGE MGAT2

0.6
NGE DGAT1 0.4
diets (p = .58). Neither was CD36 (p = .24)
0.4
or MGAT (p = .12). DGAT however was
0.2 higher expressed in fish fed the high‐1C
0.2
diet as compared to those fed the low and
0.0 0.0 medium 1C diets (p = .001). MAT1a1 was
less expressed in fish fed the low 1C diet
1C

1C

1C

1C

1C

1C
as compared to those fed the high 1C diet
w

h
ig

ig
Lo

Lo
iu

iu
H

H
ed

ed

with the medium in between (p = .002). All

M

values are the means of three tanks ± SEM

0.8 0.25 (ANOVA followed by Tukey)
0.20
0.6
NGE ApoB100
NGE MAT1a1

0.15
0.4
0.10
0.2
0.05

0.0 0.00
1C

1C

1C

1C

1C

1C
w

h
ig
Lo

ig
iu

Lo

iu
H

H
ed

ed
M

(b) 0.8 0.8

0.6
NGE MGAT2

0.6
NGE CD36

0.4 0.4

0.2 0.2

0.0 0.0
1C

1C

1C

1C

1C

1C
w

h
ig

ig
Lo

Lo
iu

iu
H

H
ed

ed
M

b ab a
b b a
0.20 0.8

0.15 0.6
NGE MAT1a1
NGE DGAT1

0.10 0.4

0.05 0.2

0.00 0.0
1C

1C

1C

1C

1C

1C
w

h
ig
Lo

ig
iu

Lo

iu
H

H
ed

ed
M

M
ESPE et al. | 11

(a) (b) (c)

a b b

0.8 0.8 0.4

0.6 0.6 0.3

NGE IGF-1r
NGE IGF-1
NGE ghr

0.4 0.4 0.2

0.2 0.2 0.1

0.0 0.0 0.0

C

1C

1C

1C

1C
1C

1C

1C
1C

h
ig

m
w

um
w

h
ig

ig
Lo
Lo

Lo
iu
iu

H
ed
ed

ed
M
M

M
F I G U R E 5 Normalized expression of growth hormone receptor (ghr, 3a p < .0001), insulin‐like growth factor 1 (igf‐1, 3b, p = .057) and
igf1‐receptor (igf1r, 3c, p = .16) at the end of the trial (after the salt water period). No differences occurred by the end of the fresh water
period (not shown). Only growth hormone receptor was higher expressed in fish fed the low 1C diet as compared to the medium and high 1C
fed fish

are in line with the current trial. The lower protein growth, the
elevated FCR and lower retention of indispensable amino acids in
the presmolts as compared to postsmolts indicate that presmolt
salmon used more of the dietary amino acids for energy purposes
than on deposition of muscle protein. This is supported by the
lower retention of indispensable amino acids as well as PPV and
PER in the presmolt period as compared to the postsmolt period
in the current trial. This needs to be followed up analysing the
anabolic signalling, as to the best of our knowledge, there exist no
paper following the salmon fed different methionine diets from
presmolt through smoltification and further through the sea water
grow out phase.
There were no differences in phospholipids or cholesterol be‐
tween fish fed the three diets in the current trial. No differences
in phospholipids are in line with Espe et al. (2010) in adult salmon,
but not in juvenile salmon where phospholipids increased following
increased dietary methionine (Espe et al., 2014). We were unable
to detect any changes in the current trial, this might be due to the
relative high variation present between tanks in the current study or
simply due to having enough of the vitamins and methionine in the
diets to prevent the development of fatty liver.
The increased cystathionine and the stable methionine in liver
from fish fed the higher methionine diets are in line with our previ‐
ous reports feeding adult or juvenile salmon increasing methionine
(Espe et al., 2014, 2008, 2010). Espe and co‐workers sampled tis‐
sues 6 hr postfeeding while the current trial sampled 24 hr post‐
feeding. Despite that the sampling was done 24 hr postfeeding,
the increased free methionine following increased dietary methi‐
onine in muscle and plasma and the stable free methionine in liver
were similar to the 6 hr postfeeding results reported by Espe et al.
(2014). The increased concentration of N‐metabolites in muscle
and plasma in fish fed the low 1C diet especially muscle free lysine
(290 vs. below 50 µmol/100 g tissues in fish fed the low vs. the
medium and high 1C diets, see supplementary files) indicated a
higher degradation of protein in muscle or a reduced synthesis of
protein. Although PPV was numerically lower in fish fed the low
1C diet, it was not significantly different from fish fed the diets
containing higher levels of methionine and B‐vitamins (medium
and high 1C diet). ApoB100 or CD36 expression was not signifi‐
cantly affected by the end of the fresh water period implying that
transport of lipids from liver was unaffected, while the increased
expression of CD36 after the sea water period in fish fed the high
1C diet might indicate a difference in lipid assembly and transport
in liver tissue of these fish.
The improved retention of methionine when dietary inclusion is
low and the decline in accretion following increased dietary methi‐
onine inclusion are in line with our previous results feeding salmon
lower methionine (Espe et al., 2014). An increased muscle free ly‐
sine and reduced protein growth and reduced IGF‐1 are in line with
juvenile salmon fed low or surplus methionine diets (Espe et al.,
2008; Espe, Veiseth‐Kent, Zerrahn, Ronnestad, & Aksnes, 2016).
The increased urea in fish fed the supplemented diets is in line with
our previous studies feeding juvenile salmon low versus surplus me‐
thionine diets support a lower utilization or deposition of dietary
protein when the low methionine diets are fed (Espe et al., 2014)
and indicate an increased degradation of AA following surplus me‐
thionine diets. The increased growth hormone receptor (ghr) also
was reported in Hevrøy et al. (2013) when Atlantic salmon was
reared at elevated water temperature and might be a marker for
increased stress. Thus, fish fed the low 1C diet might be more met‐
abolically stressed, but this need to be tested in new studies. Espe
et al. (2016) reported lower expression of IGF‐1 in juvenile Atlantic
salmon fed 8 g methionine/kg diet as compared to those fed 11 g/
kg, while adult salmon only downregulated IGF‐1r expression fed a
methionine deficient diet, while IGF‐1 expression was unaffected
(Espe et al., 2008).
In conclusion, methionine had a higher impact on growth and depo‐
sition than the B‐vitamins did. To maximize growth and deposition,
diets containing the medium methionine and B‐vitamin levels are rec‐
ommended as resulting in the best performance during smoltification
and the on‐growing sea water period. To optimize 1C levels, new trials
testing 1C levels between the low and medium 1C diets are necessary.
12 | ESPE et al.
AC K N OW L E D G E M E N T
The authors would thank Eva Mykkeltvedt at IMR for technical as‐
sistance in sampling and analysis. The trial was financially supported
by the Norwegian Research Council, project no: 267787 (NutrEpi).
C O N FL I C T O F I N T E R E S T
The authors declare no conflict of interest.
ORCID
Marit Espe https://orcid.org/0000-0002-6593-2824
DATA AVA I L A B I L I T Y S TAT E M E N T
The data obtained and not presented within the manuscript are
available as Tables S1–S3.
REFERENCES
Arslan, C. (2006). l‐carnitine and its use as a feed additive in poultry
feeding a review. Revue de Medicine Veterinaire, 157, 134–142.
Bell, J. G., Dick, J. R., McVicar, A. H., Sargent, J. R., & Thompson, K. D.
(1993). Dietary sunflower, linseed and fish oils affect phospholipid
fatty acid composition, development of cardiac lesions, phospholi‐
pase activity and eicosanoid production in Atlantic salmon (Salmo
salar). Prostaglandins Leukotrienes and Essential Fatty Acids, 49, 665–
673. https​://doi.org/10.1016/0952-3278(93)90075-8
Brosnan, J. T., Jacobs, R. L., Stead, L. M., & Brosnan, M. E. (2004).
Methylation demand: A key determinant of homocysteine metabo‐
lism. Acta Biochemica Polonica, 51, 405–413.
Cantoni, G. L., & Chiang, P. K. (1980). The role of S‐adenosylhomocyste‐
ine hydrolase in the control of biological methylation. In D. Cavallini,
G. E. Gaull, & V. Zappia (Eds.), Natural sulphur compounds (pp. 67–80).
New York, NY: Plenum Press.
Cecero, R. A., & Pegg, A. (2009). Polyamine catabolism and disease. The
Biochemical Journal, 421, 323–338. https​://doi.org/10.1042/BJ200​
90598​
CEN (Comitè Europè de Normalisation) (2002). NS‐EN (2006) Foodstuffs
– Determination of vitamin B6 (including its glycosylated forms) by HPLC.
da Silva, R. P., Kelly, K. B., Al Rajabi, A., & Jacobs, R. L. (2014). Novel
insights on interactions between folate and lipid metabolism.
BioFactors, 40, 277–283. https​://doi.org/10.1002/biof.1154
Ducker, G. S., & Rabinowitz, J. D. (2017). One‐carbon metabolism
in health and disease. Cell Metabolism, 25, 27–42. https​://doi.
org/10.1016/j.cmet.2016.08.009
Espe, M., Andersen, S. M., Holen, E., Rønnestad, I., Veiseth‐Kent, E.,
Zerrahn, J.‐E., & Aksnes, A. (2014). Methionine deficiency does not
increase polyamine turnover through depletion of liver S‐adeno‐
sylmethionine (SAM) in juvenile Atlantic salmon. British Journal of
Nutrition, 112, 1274–1283.
Espe, M., Hevrøy, E. M., Liaset, B., Lemme, A., & El‐Mowafi, A. (2008).
Methionine intake affect hepatic sulphur metabolism in Atlantic
salmon, Salmo salar. Aquaculture, 274, 132–141. https​://doi.
org/10.1016/j.aquac​ulture.2007.10.051
Espe, M., Lemme, A., Petri, A., & El‐Mowafi, A. (2006). Can Atlantic
salmon (Salmo salar) grow on diets devoid of fish meal? Aquaculture,
255, 255–262. https​://doi.org/10.1016/j.aquac​ulture.2005.12.030
Espe, M., Lemme, A., Petri, A., & El‐Mowafi, A. (2007). Assessment of
lysine requirement for maximal protein accretion in Atlantic salmon
using plant protein diets. Aquaculture, 263, 168–178.
Espe, M., Lied, E., & Torrissen, K. R. (1993). Changes in plasma and muscle
free amino‐acids in Atlantic salmon (Salmo salar) during absorption of
diets containing different amounts of hydrolyzed cod muscle protein.
Comparative Biochemistry and Physiology, 105A, 555–562.
Espe, M., Rathore, R. M., Du, Z.‐Y., Liaset, B., & El‐Mowafi, A. (2010).
Methionine limitation results in increased hepatic FAS activity,
higher liver 18:1 to 18:0 fatty acid ratio and hepatic TAG accumula‐
tion in Atlantic salmon, Salmo salar. Amino Acids, 39, 449–460. https​
://doi.org/10.1007/s00726-009-0461-2
Espe, M., Veiseth‐Kent, E., Zerrahn, J.‐E., Ronnestad, I., & Aksnes, A.
(2016). Juvenile Alantic salmon decrease white trunk muscle IGF‐1‐
expression and reduce muscle and plasma free sulphur amino acids
when methionine availability is low while liver sulphur metabo‐
lites mostly is unaffected by treatment. Aquaculture Nutrition, 22,
801–812.
Espe, M., Xie, S., Chen, S., Araujo, P., & Holen, E. (2019). Development of
a fatty liver model using oleic acid in primary liver cells isolated from
Atlantic salmon and the prevention of lipid accumulation using met‐
formin. Aquaculture Nutrition, 25, 737–746. https​://doi.org/10.1111/
anu.12905​
Finkelstein, J. D. (1990). Methionine metabolism in mammals.
Journal of Nutritional Biochemistry, 1, 228–237. https​://doi.
org/10.1016/0955-2863(90)90070-2
Hemre, G.‐I., Lock, E.‐J., Olsvik, P. A., Hamre, K., Espe, M., Torstensen,
B. E., … Sissener, N. H. (2016). Atlantic salmon (Salmo salar) require
increased dietary levels of B‐vitamins when fed diets with high in‐
clusion of plant based ingredients. Peer J, 4, e2493. https​://doi.
org/10.7717/peerj.2493
Hevrøy, E. M., Hunskår, C. D., de Gelder, S., Shimizu, M., Waagbø, R.,
Breck, O., … Hansen, T. (2013). GH‐IGF system regulation of at‐
tenuated muscle growth and lipolysis in Atlantic salmon reared at
elevated sea temperatures. Journal of Comparative Physiology, 183,
243–259.
Kerr, S. J. (1972). Competing methyltransferase systems. Journal of
Biological Chemistry, 247, 4248–4252.
Koek, G. H., Liedorp, P. R., & Bast, A. (2011). The role of oxidative stress in
non‐alcoholic steatohepatitis. Clinica Chimica Acta, 412, 1297–1305.
https​://doi.org/10.1016/j.cca.2011.04.013
Liaset, B., Julshamn, K., & Espe, M. (2003). Chemical composition and
theoretical nutritional evaluation of the produced fractions from
enzymatic hydrolysis of salmon frames with Protamex™. Process
Biochemistry, 38, 1747–1759.
Liland, N., Johnsen, E. N., Hellberg, H., Waagbø, R., Sissener, N. H.,
Torstensen, B., & Sæle, Ø. (2018). Effects of dietary vegetable oils
and varying dietary EPA and DHA levels on intestinal lipid accumula‐
tions in Atlantic salmon. Aquaculture Nutrition, 24, 1599–1610.
Mato, J. M., Corrales, F. J., Lu, S. C., & Avila, M. A. (2002). S‐adenosyl‐
methionine: A control switch that regulates liver function. The FASEB
Journal, 16, 15–26. https​://doi.org/10.1096/fj.01-0401rev
Noga, A. A., & Vance, D. E. (2003). Insights into the requirement of phos‐
phatidylcholine synthesis for liver function in mice. Journal of Lipid
Research, 44, 1998–2005.
NRC (National Research Council), & Committee on the Nutrient
Requirements of Fish and Shrimp (2011). Nutrient requirements of fish
and shrimp. Washington, DC: The National Academies Press.
Obeid, R. (2013). The metabolic burden of methyl donor deficiency with
focus on the betaine homocysteine methyltransferase pathway.
Nutrients, 5, 3481–3495. https​://doi.org/10.3390/nu509​3 481
Olsvik, P., Lie, K., Jordal, A.‐E., Nilsen, T. O., & Hordvik, I. (2005).
Evaluation of potential reference genes in real‐time RT‐PCR studies
of Atlantic salmon. BMC Molecular Biology, 6, 21–29.
ESPE et al.
Pegg, A. E. (2009). Critical review. Mammalian polyamine metabolism
and function. IUBMB Life, 61, 880–894. https​://doi.org/10.1002/
iub.230
Rolo, A. P., Teodoro, J. S., Palmeira, C. M., & Carlos, M. (2012). Role of
oxidative stress in the pathogenesis of nonalcoholic steatohepa‐
titis. Free Radical Biology and Medicine, 52, 599–669. https​://doi.
org/10.1016/j.freer​adbio​med.2011.10.003
Skjaerven, K., Jakt, L. M., Dahl, J. A., Espe, M., Aanes, H., Hamre, K., &
Fernandes, J. (2016). Parental vitamin deficiency affects the embry‐
onic gene expression of immune ‐, lipid transport ‐ and apolipopro‐
tein genes. Nature Scientific Report, https​://doi.org/10.1038/srep3​
4535
Skjaerven, K. H., Olsvik, P. A., Finn, R. N., Holen, E., & Hamre, K.
(2011). Ontogenetic expression of maternal and zygotic genes in
Atlantic cod embryos under ambient and thermally stressed con‐
ditions. Comparative Biochemistry and Physiology Part A Molecular
Integrative Physiology, 159, 196–205. https​://doi.org/10.1016/j.
cbpa.2011.02.026
Stead, L. M., Brosnan, J. T., Brosnan, M. E., Vance, D. E., & Jacobs, R. L.
(2006). Is it time to reevaluate methyl balance in humans? American
Journal of Clinical Nutrition, 83, 5–10.
Sugiyama, K., Kumazawa, A., Zhou, H., & Saeki, S. (1998). Dietary me‐
thionine level affects linoleic acid metabolism through phosphatidy‐
lethanolamine N‐methylation in rats. Lipids, 33, 235–242. https​://doi.
org/10.1007/s11745-998-0201-2
Taylor, J. F., Vera, L. M., De Santis, C., Lock, E.‐J., Espe, M., Skjærven,
K. H., … Tocher, D. R. (2019). The effect of micronutrient supple‐
mentation on growth and hepatic metabolism in diploid and trip‐
loid Atlantic salmon (Salmo salar) parr fed a low marine ingredient
diet. Comparative Biochemistry and Physiology Part B: Biochemistry
and Molecular Biology, 227, 106–121. https​://doi.org/10.1016/j.
cbpb.2018.10.004
Vance, D. E., & Ridgeway, N. D. (1988). The methylation of phosphatidy‐
lethanolamine. Progress in Lipid Research, 27, 61–79.
Vance, D. E., Walkey, C. J., & Cui, Z. (1997). Phosphatidyletanolamine
N‐methyltransferase from liver. Biochimica et Biophysica Acta, 1348,
142–150.
| 13
Vanni, E., Bugianesi, E., Kortonen, A., de Minicis, S., Yki‐Jarvinen, H., &
Svegliati‐Baroni, G. (2010). From the metabolic syndrome to NAFLD
or vice versa? Digestive and Liver Disease, 42, 320–330. https​://doi.
org/10.1016/j.dld.2010.01.016
Vernon, G., Baranova, A., & Younossi, Z. M. (2011). Systematic re‐
view: The epidemiology and natural history of non‐alcoholic
fatty liver disease and non‐alcoholic steatohepatitis in adults.
Alimentary Pharmacology & Therapeutics, 34, 274–285. https​://doi.
org/10.1111/j.1365-2036.2011.04724.x
Watkins, S. M., Zhu, X., & Zeisel, S. H. (2003).
Phosphatidylethanolamine‐N methyltransferase activity and di‐
etary choline regulate liver‐plasma lipid flux and essential fatty
acid metabolism in mice. Journal of Nutrition, 133, 3386–3391.
https​://doi.org/10.1093/jn/133.11.3386
S U P P O R T I N G I N FO R M AT I O N
Additional supporting information may be found online in the
Supporting Information section.
How to cite this article: Espe M, Vikeså V, Helgøy Thomsen
T, Adam A‐C, Saito T, Skjærven KH. Atlantic salmon fed a
nutrient package of surplus methionine, vitamin B12, folic
acid and vitamin B6 improved growth and reduced the
relative liver size, but when in excess growth reduced.
Aquacult Nutr. 2019;00:1–13. https​://doi.org/10.1111/
anu.13010​