Aquaculture Reports 23 (2022) 101075

Contents lists available at ScienceDirect

Aquaculture Reports
journal homepage: www.elsevier.com/locate/aqrep

Effects of three feed attractants on the growth, biochemical indicators, lipid

metabolism and appetite of Chinese perch (Siniperca chuatsi)
Di Peng a, b, Binbin Peng a, b, Jiao Li a, b, Yanpeng Zhang a, b, Haocan Luo a, b, Qianqian Xiao a, b,
Shulin Tang a, b, Xu-Fang Liang a, b, *
a
College of Fisheries, Chinese Perch Research Center, Huazhong Agricultural University, Wuhan 430070, China
b
Engineering Research Center of Green development for Conventional Aquatic Biological Industry in the Yangtze River Economic Belt, Ministry of Education, Wuhan
430070, China

A R T I C L E I N F O A B S T R A C T

Keywords: This study aims to investigate the effects of three feed attractants on the growth performance, body composition,
Chinese perch (Siniperca chuatsi) biochemical indicators, liver histology, lipid metabolism and appetite of Chinese perch (Siniperca chuatsi). An
Stickwater eight-week feeding trial was conducted using four diets, including a basal diet of 51% fish meal without
Squid paste
attractant (control), with 5% stickwater (SW), 5% squid paste (SP) and a 5% mixture of SW and SP a ratio of 1:2
Growth
(Mix), respectively. The results demonstrated that SW diet significantly increased the weight gain rate and feed
Lipid metabolism
Appetite intake (P < 0.05), while resulted in the lowest crude lipid content of whole fish and liver in Chinese perch.
Dietary attractants also significantly affected the contents of serum albumin (ALB), glucose (GLU), total
cholesterol (CHO), triglyceride (TG) and low-density lipoprotein (LDLC), as well as the activities of aspartate
transaminase (AST) and alanine transaminase (ALT). Compared with the control diet, the SW diet significantly
increased the serum superoxide dismutase (SOD) and catalase (CAT) activities (P < 0.05), while obviously
decreased the activity of malondialdehyde (MDA) (P < 0.05). In addition, dietary SW significantly increased the
expression of neuropeptide Y (npy) and agouti-related protein (agrp) while significantly decreased that of
cocaine- and amphetamine-regulated gene (cart) and pro-opiomelanocortin (pomc) gene in the brain. As for the
peripheral appetite, dietary SW reduced the expression of leptin A, while significantly increased that of ghrelin.
Gene expression analysis revealed that dietary SW reduced liver lipid accumulation probably by inhibiting the
lipid synthesis related gene (fas) and inducing the lipid oxidation-related gene (cpt-1).) In general, our results
indicated that the supplementation of 5% SW can improve the growth performance, increase the expression of
appetite-promoting genes and antioxidant capacity, and reduce liver lipid accumulation in Chinese perch.

1. Introduction
Feeding is the main way for fish to obtain nutrition and energy in
aquaculture, providing a material and energy basis for the life activities
such as survival, growth and reproduction of fish (Flores-Sierra et al.,
2016; Murashita et al., 2009; Volkoff and Peter, 2006). In recent years,
to improve the efficiency of aquaculture, different types of attractants
are often added to the feed to improve the bait palatability, feed intake
(FI) and fish growth and reduce the waste of feed, so as to save the cost of
aquaculture. Improvement of the feed palatability is a crucial way to
increase the FI of fish. It has been demonstrated that many substances,
such as betaine, nucleosides, nucleotides, L-amino acids and marine
extracts, can stimulate the appetite of fish (Dias et al., 1997; Min and
Cui, 2001; Papatryphon and Soares, 2000). Stickwater (SW) and squid
paste (SP) are commonly used natural animal extracts. SW is a
by-product of fish meal processing, which is rich in proteins, small
peptides, free amino acids, taurine and some other active substances. It
has been found to improve the growth (Tang et al., 2008), activity of
digestive enzymes (Srichanun et al., 2014), nutrient absorption (Wu
et al., 2018), specific immunity and the appetite of fish (Khosravi et al.,
2015). SP is a natural substance containing abundant free amino acids,
nucleotides, nucleosides and quaternary ammonium bases. It has been
found to promote the FI of many fish such as Atlantic halibut (Hippo­
glossus hippoglossus) (Yacoob and Browman, 2007), juvenile gibel carp
(Carassius auratus gibelio) (Min and Cui, 2001), and Sablefish (Anoplo­
poma fimbria) (Davis et al., 2006). Adams et al. (Adams et al., 1988)

* Corresponding author at: College of Fisheries, Chinese Perch Research Center, Huazhong Agricultural University, Wuhan 430070, China.
E-mail address: xufang_liang@hotmail.com (X.-F. Liang).

https://doi.org/10.1016/j.aqrep.2022.101075
Received 28 December 2021; Received in revised form 1 March 2022; Accepted 1 March 2022
Available online 10 March 2022
2352-5134/© 2022 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Di Peng et al. Aquaculture Reports 23 (2022) 101075

found that a mixture of attractants is generally more effective than single Table 1
attractants in promoting fish FI, which has been confirmed in rainbow Compositions of diets added with different feed attractants (% dry weight).
trout (Oncorhynchus mykiss) (Mackie and Mitchell, 2006), European eel Ingredients Groups
(Anguilla anguilla) (Mackie and Mitchell, 1985), and striped bass
Control SW SP Mix
(Morone saxatilis) (Papatryphon et al., 2000).
The feeding behavior of fish is a result of regulation of multiple tis­ White fish meal 51 51 51 51
Casein 20 20 20 20
sues and organs. The fish first accepts information of both the inside and Corn starch 8 8 8 8
outside environment by sensory organs, which is then transformed into Fish oil 8 8 8 8
neural signals and transferred to the brain. After the analysis by the Vitamin premixa 1 1 1 1
central nervous system, the signals will be integrated and then sent to Mineral premixb 2 2 2 2
c
Stickwater 0 5 0 1.67
the effector, finally resulting in corresponding physical activities of the c
Squid paste 0 0 5 3.33
body (Ishimaru et al., 2005; Margolskee et al., 2007; Oike et al., 2007). Microcrystalline cellulose 7 2 2 2
Fish FI is closely associated with the appetite, which is regulated by Carboxymethyl cellulose 2 2 2 2
related hormones (Aldegunde and Mancebo, 2006; Kamijo et al., 2011). CaHPO4 1 1 1 1
Most research on the effect of attractants on appetite has been focused Total 100 100 100 100
Proximate chemical composition (dry matter basis, %)
on mammals, particularly rodents, while little is known about the effect Crude protein 51.61 51.97 51.80 51.86
in fish so far. Crude lipid 11.65 11.71 11.96 11.88
Chinese perch (Siniperca chuatsi), which belongs to the orders of Ash 8.69 8.93 8.79 8.84
Perciformes, Sinipercinae and Siniperca, is widely distributed in China and a
Vitamin premix (per kg of diet): vitamin A, 40 mg; vitamin B1 (thiamin), 15
the border areas of Russia along the Heilong Jiang River, the Korean mg; vitamin B2 (riboflavin), 25 mg; vitamin B6, 20 mg; vitamin B12, 0.1 mg;
Peninsula, Vietnam and Japan. In recent years, the cultivation scale of vitamin D3, 60 μg; vitamin E 200 mg; vitamin K3 10 mg; folic acid, 10 mg;
Chinese perch in China has been continuously expanded. In 2019, its biotin, 3.2 mg; pantothenic acid calcium, 50 mg; inositol, 600 mg; ascorbic acid
annual production reached about 330,000 tons, with an annual output (35%), 210 mg; niacinamide, 200 mg; choline, 1000 mg.
b
value exceeding 200 billion yuan (Fishery, 2019). Chinese perch is a Mineral premix (per kg of diet): CaHPO4, 15 g; MnSO4, 13 mg; MgSO4, 0.8
typical carnivorous fish, and live bait and chilled fish are the main g; KCl, 3 g; NaCl, 1.5 g; ZnSO4, 80 mg; KI, 1.1 mg; CuSO4, 10 mg; FeSO4, 150
sources of feed in the culture. However, with the rapid development, the mg; Na2SeO3, 0.7 mg; CoSO4, 0.02 mg. Na2MoO4, 0.14 mg; KF, 0.26 mg.
c
industry is faced with the problems of declining traditional natural bait Bought from XiangShanChaoXing aquatic feed co. LTD.
resources, imbalanced nutritional composition, threats of bacteria in
chilled fish and high cost of cultivation. Therefore, the present study each tank, and the feeding trial was lasted for eight weeks. The dissolved
aims to investigate the effects of SW and SP on the growth, serum oxygen (DO) value was 7.56 ± 0.17 mg/L; the temperature was 23.00 ±
biochemistry, immunity and genes related to the appetite and lipid 0.58 ◦ C; the ammonia content was 0.28 ± 0.03 mg/L and the pH was
metabolism in Chinese perch. The findings may provide an effective 7.35 ± 0.14 during the trial.
measure to promote the cultivation and domestication of Chinese perch.
2.3. Sampling procedure
2. Materials and methods
After 56 days of feeding trial, all fish were starved for 24 h, and then
2.1. Experimental diets anaesthetized by MS-222 (50 mg/L water) and weighed. Three fish were
randomly selected from each replicate. Then, the whole brains
The formulation and proximate composition of the experimental (including the pituitary) of three fish from each tank were dissected and
diets are presented in Table 1. Four isonitrogenous (518 g kg− 1 crude quickly frozen in liquid nitrogen and stored at − 80 ◦ C for gene
protein) and isolipidic (118 g kg− 1 total lipid) diets were formulated. expression analysis. Another three fish from each tank were randomly
The basal diet was prepared with fish meal and casein as the main collected for serum biochemical analysis. Blood was collected from the
protein source, fish oil as the main lipid source, and corn starch as the caudal vein and kept to precipitate at 4 ◦ C for 24 h. After centrifugation
carbohydrate source. The three test diets were prepared by the addition at 3,500g for 10 min, the serum was extracted and stored at − 80 ◦ C for
of 50 g kg− 1 SW, 50 g kg− 1 SP and 50 g kg− 1 mixture of 16.7 g kg− 1 SW subsequent analysis. After collection of the blood samples, the fish from
and 33.3 g kg− 1 SP (named as the Mix group) to the basal diet, each tank were dissected on ice to obtain the liver, muscle and intestine.
respectively. The tissue samples were first weighed and then cryopreserved at − 80 ◦ C
All dry ingredients were thoroughly mixed before the addition of oil for subsequent analysis. Another two fish were randomly chosen for
and 30% water. The diets were pelleted to soft granules using a small analysis of whole body composition. Histological analysis samples were
twin-screw extruder (1-cm diameter template; Model F26; South China immediately fixed in phosphate-buffered formalin (4%; pH 7.4) for 24 h
University of Technology Science and Technology Industrial Plant, and subsequently transferred to ethanol (70%) until further processing.
Guangzhou, China).

2.2. Fish rearing and experimental design 2.4. Growth performance and biological parameters

The experiment was conducted in an indoor aquarium system at
Huazhong Agricultural University, Wuhan, China. Chinese perch was
trained to accept the artificial feed according to the method of Liang
et al. (Liang et al., 2015). After two weeks of acclimatization, 144 Chi­
nese perch with similar size that could well accept the artificial feed (the
control diet) were selected for experimental trial. The Chinese perch
samples with an initial average weight of 235 ± 2 g were randomly
distributed into 12 tanks, with each tank containing 12 Chinese perch,
and three tanks (169 L/tank) of fish were randomly assigned to each
experimental diet. The fish were fed to apparent visual satiation twice a
day at 07:00 and 17:00. The daily feed consumption was recorded for
Data were analyzed for weight gain rate (WGR), specific growth rate
(SGR), feed intake (FI), protein efficiency ratio (PER), survival ratio
(SR), condition factor (CF), intraperitoneal fat index (IFI), feed conver­
sion ratio (FCR), hepatosomatic index (HSI) and viscera index (VSI)
using the following formulas:
Weight gain rate (WGR; %) =100 × [(final weight – initial weight)/initial
weight]
Specific growth rate (SGR; %/d) = 100 × (ln final weight – ln initial weight)/
days

2
Di Peng et al. Aquaculture Reports 23 (2022) 101075
1
Feed intake (FI; g fish− days− 1) = total amount of the feed consumed (g)/
number of fish/days Table 2
Genes and primers used for qPCR.
Protein efficiency ratio (PER; %) = 100 × weight gain (g)/protein intake (g)
Gene Primer Sequence 5′ − 3′ Annealing temp
Survival rate (SR; %) = final number of fish × 100/initial number of fish name (℃)

fas fas-F ATGGAAATCACCCCTGTAATCTT 57

Condition factor (CF) = body weight (g) × 100/body length3 (cm) fas-R CTTATCTGACTACGGAATGAATCG
acc1 acc1-F TATGCCCACTTACCCAAATGC 58
Intraperitoneal fat index (IFI; %) = intraperitoneal fat weight × 100/body acc1-R TGCCACCATACCAATCTCGTT
weight cpt-1 cpt-1-F ATGGTGTATTGGCTGGAGTCT 57.5
cpt-1-R CTGTGTGGTAGGTTTTCCTTGAT
Feed conversion ratio (FCR) = amount of feed given (g)/weight gain (g) pparα pparα-F GGGTGTGCTCAGACAAGGCT 58
pparα-R GTTGCGGTTCTTCTTTTGGAT
Hepatosomatic index (HSI; %) = hepatopancreas weight × 100/body weight npy npy-F GGAAGGATACCCGGTGAAA 52
npy-R TCTTGACTGTGGAATCGTG
Viscera index (VSI; %) = viscera weight × 100/body weight cart cart-F CGAACCTAACCAGTGAGAAG 56
cart-R GGGACAGTCGCACATCTT
agrp agrp-F GAGCCAAGCGAAGACCAGA 60
agrp-R GCAGCACGGCAAATGAGAG
2.5. Proximate composition analysis ghrelin ghrelin-F TTGCTGGTCTTCCTGTTGTGT 56.7
ghrelin-R TTCCCCTTGTTCTGAGGTTTT
leptin-A leptin-A- CCTCTGCCAGTGGAAGTA 58
Proximate analysis of the experimental diets and whole fish, muscle F
and liver samples was conducted according to standard Association of leptin-A- GTGTCAGAGATCAGGCTGT
Official Agricultural Chemists methods (Hirwitz, 1995). Crude protein R
content was determined by measuring the nitrogen (N × 6.25) levels pomc pomc-F CTTACAAGAAGCCCAGTG 55.2
pomc-R TCAGTCCACCCTCAGTTT
with the Kjeldahl method following acid digestion with an auto Kjeldahl rpl13a rpl13a-F TATCCCCCCACCCTATGACA 58
System (Kjelflex K-360; BUCHI Labortechnik AG, Flawil, Switzerland). rpl13a-R ACGCCCAAGGAGAGCGAACT
The moisture content was measured with freeze-drying samples for 48 h
in a vacuum freeze dryer (Christ Beta 2–4 LD plus LT, Marin Christ
Corporation, Osterode, Germany). The ash level was determined Color Real-Time PCR Detection System, Bio-Rad) with a 20 μl reaction
through incineration at 550 ◦ C for 24 h in a muffle furnace. volume containing 10 μl SYBR qPCR Green Master Mix (Code no.
Q311–02; Vazyme, China), 0.4 μl PCR forward/re-verse primers (10
2.6. Analysis of serum biochemical and immune indices μM), 1 μl cDNA template and 8.2 μl RNase-free H2O. The qRT-PCR pa­
rameters were as follows: 95 ◦ C for 1 min, followed by 40 cycles at 95 ◦ C
The contents of total protein (TP), serum albumin (ALB), aspartate for 10 s, 57 ◦ C for 30 s and a melt curve step (from 95 ◦ C, gradually
transaminase (AST), alanine aminotransferase (ALT), glucose (GLU), decreasing at 0.5 ◦ C/s to 57 ◦ C, with data acquisition at every 6 s). The
total cholesterol (TCHO), triglyceride (TG), high-density lipoprotein amplification efficiencies of the control and target genes were approxi­
(HDLC) and low-density lipoprotein (LDLC) were determined using an mately equal and ranged from 96.3% to 104.9%. The gene expression
automatic biochemical analyzer (CHEMIX-800, Sysmex Corporation, levels were quantified relative to the expression of rpl13a using the
Kobe, Japan) with commercial diagnostic reagent kits (Sysmex Wuxi Co. optimized comparative Ct (2-ΔΔCt) value method. All amplifications
Ltd., Wuxi, China). The serum globulin (GLB) level was calculated by were performed in triplicate for each RNA sample.
subtracting the albumin content from total protein content.
The total values of superoxide dismutase (SOD), catalase (CAT), 2.9. Statistical analysis
malondialdehyde (MDA) and glutathione peroxidase (GSH-Px) in the
serum were determined using commercial kits (Jiancheng Bioengi­ The normality of the data was tested by a single sample T test. The
neering Institute, Nanjing, China). homogeneity of all data was tested before one-way analysis of variance
(ANOVA). The data were expressed as mean ± SEM (standard error of
2.7. Histological analysis of the liver section the mean) and analyzed by ANOVA. A multiple comparison test (Dun­
can’s new multiple range test) was conducted to compare the significant
The fixed liver samples were dehydrated in graded ethanol concen­ differences among groups. Differences were considered as significant at
trations (50–99.9%), cleared in xylene and then embedded in paraffin. P ≤ 0.05. Statistical analysis was conducted by using the SPSS 26.0
Sections were cut at a thickness of 5 µm using a microtome and stained (SPSS, Chicago, IL, USA).
with haematoxylin and eosin (H&E). The slides were observed on a light
microscope (Olympus, CX41, Tokyo, Japan) equipped with a digital 3. Results
camera (Olympus, DP73, Tokyo, Japan). Electronic images were further
captured using the image analysis software Image-Pro Plus 6.0 (Media 3.1. Growth performance, feed utilization and biometric indices
Cybernetics, Inc., Bethesda, MD, USA).
The growth performance, feed utilization and biometric indices are
2.8. Gene expression analysis presented in Table 3. The SW diet resulted in significantly higher FBW,
WGR, SGR, FI and PER than the control (P < 0.05), and significantly
Total RNA was extracted with the RNAiso Plus reagent (Takara, lower FCR than other diets. In addition, the SP diet led to the highest HSI
Dalian, China) manually, and the purity and quantity were determined and CF of the fish, which were significantly different from those of the
by agarose gel electrophoresis, protein and nucleic acid analyzer. Then, control group (P < 0.05). No significant difference was observed in SR,
the cDNA was obtained by using the HiScript® II Reverse Transcriptase VSI and IPF among all treatments (P > 0.05).
(Code no. R301–01/02; Vazyme, China) reverse transcriptase.
Real-time PCR was performed to measure the expression levels of 3.2. Proximate composition analysis
genes with specific primers (Table 2). The rpl13a gene was used as an
endogenous reference to normalize the template amount. Real-time PCR The results of whole body, muscle and liver composition analysis are
assays were carried out in a quantitative thermal cycler (MyiQ2™ Two- presented in Table 4. Four dietary treatments showed no significant

3
Di Peng et al. Aquaculture Reports 23 (2022) 101075

Table 3 Table 5
Growth performance and feed utilization of Chinese perch fed with different Serum biochemical and antioxidant indices of Chinese perch fed with different
feed attractants. Values are presented as the means ± SEM (n = 3). Values within feed attractants. Values are presented as the means ± SEM (n = 3). Values within
a column followed by different superscript letters differ significantly (P < 0.05). a column followed by different superscript letters differ significantly (P < 0.05).
Items Control SW SP Mix Item Control SW SP MIX

IBW (g) 232.57 ± 236.33 ± 239.29 ± 232.56 ± TP (g/L) 39.88 ± 1.45 44.90 ± 43.25 ± 2.92 45.30 ± 0.51
3.90 2.86 6.32 2.38 0.75
a
FBW (g) 295.87 ± 376.15 ± 280.62 ± 302.56 ± ALB (g/L) 8.03 ± 0.49 11.03 ± 12.67 ± 13.40 ±
4.42a 28.65b 17.79a 3.42a 1.07b 1.01b 0.37b
WGR (%) 27.24 ± 53.58 ± 20.99 ± 30.11 ± GLB (g/L) 33.38 ± 1.35 33.15 ± 33.18 ± 1.27 33.03 ± 0.15
1.30a 6.80b 1.41a 1.41a 1.43
SGR (%/d) 0.43 ± 0.02a 0.76 ± 0.08b 0.34 ± 0.02a 0.47 ± 0.02a ALB/GLB (%) 0.26 ± 0.35 ± 0.21 ± 0.01a 0.41 ± 0.01c
FI (g fish− 1 1.38 ± 0.02a 1.62 ± 0.05b 1.30 ± 0.06a 1.43 ± 0.03a 0.05ab 0.04bc
days− 1) AST (U/L) 69.00 ± 46.33 ± 65.50 ± 48.33 ±
FCR (%) 2.86 ± 0.16b 1.75 ± 0.23a 3.75 ± 0.24c 2.94 ± 3.51b 1.76a 5.33b 3.93a
0.37bc ALT (U/L) 73.00 ± 47.33 ± 82.67 ± 73.67 ±
PER (%) 0.60 ± 0.04a 1.01 ± 0.12b 0.46 ± 0.03a 0.61 ± 0.07a 1.53b 1.53a 0.88c 1.76b
SR (%) 100 ± 0.00 100 ± 0.00 100 ± 0.00 100 ± 0.00 GLU (mmol/L) 8.07 ± 0.71b 4.91 ± 0.60a 8.11 ± 0.65b 7.84 ± 0.77b
VSI (%) 20.85 ± 19.63 ± 0.75 21.95 ± 0.23 19.92 ± CHO (mmol/L) 6.46 ± 0.28a 6.75 ± 0.68a 7.65 ± 0.51ab 8.69 ± 0.24b
1.18 0.99 TG (mmol/L) 5.96 ± 0.59a 3.65 ± 1.39a 4.96 ± 0.38ab 8.05 ± 0.81b
HSI (%) 1.38 ± 0.02a 1.30 ± 0.06a 1.62 ± 0.05b 1.43 ± HDLC (mmol/ 0.92 ± 0.06 0.92 ± 0.08 0.91 ± 0.08 0.81 ± 0.05
0.03ab L)
CF (%) 1.78 ± 1.67 ± 0.04a 2.10 ± 0.05c 1.89 ± 0.08b LDLC (mmol/ 0.79 ± 0.01c 0.85 ± 0.02c 0.61 ± 0.03a 0.72 ± 0.03b
0.04ab L)
IPF (%) 1.08 ± 0.13 1.09 ± 0.17 1.12 ± 0.18 1.19 ± 0.28 MDA (nmol/ 4.69 ± 0.12b 4.17 ± 0.14a 4.71 ± 0.18b 4.44 ± 0.18ab
mL)
IBW, initial body weight; FBW, final body weight; WGR, weight gain rate; SGR, SOD (U/mL) 31.34 ± 41.59 ± 33.70 ± 37.34 ±
specific growth rate; FI, feed intake; FCR, feed conversion ratio; PER, protein 0.94a 2.91c 0.96ab 1.43bc
efficiency ratio; SR, survival rate; VSI, viscera index; HSI, hepatosomatic index; CAT (U/mL) 16.03 ± 20.24 ± 16.24 ± 19.45 ±
CF, condition factor; IPF, intraperitoneal fat ratio. 0.43a 1.20b 0.31ab 2.10ab
GSH-Px (U/ 42.17 ± 4.31 47.30 ± 48.87 ± 59.93 ± 6.90
mL) 3.48 10.24
Table 4 TP, total protein; ALB, albumin; AST, aspartate transaminase; GLB, Globulin;
The whole body, muscle and liver composition of Chinese perch fed with ALT, alanine aminotransferase; GLU, glucose; TCHO, total cholesterol; TG, tri­
different feed attractants(%). Values are presented as the means ± SEM (n = 3). glyceride; HDLC, high-density lipoprotein; LDLC, low-density lipoprotein; SOD,
Values within a column followed by different superscript letters differ signifi­ The total superoxide dismutase; CAT, catalase; MDA, malondialdehyde; GSH-Px,
cantly (P < 0.05). glutathione peroxidase.
Item Control SW SP MIX

Whole body No significant difference was found in serum GSH-Px activity among
Moisture 73.79 ± 1.03 74.43 ± 0.85 75.73 ± 0.22 75.03 ± 0.42 the treatment groups (P > 0.05). In addition, the SW group had signif­
Crude 16.31 ± 18.05 ± 16.61 ± 17.56 ± icantly higher MDA content and serum CAT and SOD activities than the
protein 0.44a 0.59b 0.28a 0.19ab
control group (P < 0.05).
Crude lipid 4.71 ± 0.87ab 3.33 ± 0.59a 5.07 ± 0.36b 4.59 ± 0.17ab
Crude ash 4.66 ± 0.87b 4.27 ± 0.10a 4.81 ± 0.14ab 4.61 ± 0.18a
Muscle 3.4. Expression of appetite-related genes
Moisture 78.38 ± 76.79 ± 78.45 ± 78.19 ± 0.05b
0.02b 0.15a 0.08b
The SW diet resulted in significantly higher mRNA expression of npy
Crude 19.86 ± 21.46 ± 19.78 ± 20.09 ± 0.16a
protein 0.11a 0.09b 0.19a than the control diet (P < 0.05) (Fig. 1). Morever, the mRNA expression
Crude lipid 0.63 ± 0.04 0.57 ± 0.12 0.60 ± 0.08 0.58 ± 0.15 of agrp in the SW and Mix group was significantly higher than that in
Crude ash 1.16 ± 0.03 1.12 ± 0.04 1.19 ± 0.04 1.15 ± 0.05 other groups (P < 0.05). The control group had significantly higher
Liver mRNA expression levels of pomc and cart in the brain than all treatment
Moisture 75.86 ± 0.23 75.62 ± 0.10 75.84 ± 0.69 75.43 ± 0.22
Crude 13.52 ± 14.63 ± 12.96 ± 14.79 ± 0.15b
groups (P < 0.05), and there was no significant difference among the
protein 0.10a 0.07b 0.59a three treatment groups (P > 0.05). The control group had the highest
Crude lipid 2.49 ± 0.09ab 2.29 ± 0.02a 2.90 ± 0.12c 2.69 ± 0.01bc mRNA expression level of leptin A in the liver (P < 0.05), and the SW
Crude ash 8.13 ± 0.11 7.66 ± 0.16 8.11 ± 0.12 7.82 ± 0.33 group had a higher mRNA expression level of ghrelin in the gut than all
other groups (P < 0.05).
difference in their influence on the moisture content of the whole body
and liver (P > 0.05). The SW diet resulted in significantly higher crude 3.5. Expression of genes related to lipid metabolism
protein content in whole body, muscle and liver than the control group
(P < 0.05). Different diets led to significantly different crude lipid The SW group had the highest mRNA expression level of acc1 and
contents in whole body and liver (P < 0.05), but resulted in no difference pparα in the liver, but the difference from other groups did not reach the
in the crude lipid content of muscle (P > 0.05). significant level (P > 0.05) (Fig. 2). Morever, SW treatment significantly
down-regulated the fas gene compared with other treatments
(P < 0.05), and dramatically increased the mRNA level of cpt1
3.3. Serum biochemical parameters and antioxidant indices compared with the control (P < 0.05).

As shown in Table 5, the TP and GLB content in the serum was in­
dependent of the dietary treatments (P > 0.05). The SW group showed
significantly lower enzyme activities of AST and ALT in the serum than
the control group (P < 0.05). Besides, the supplementation of dietary
attractants increased the ALB content (P < 0.05).
3.6. Histological observation of liver
Fig. 3 and Fig. 4 show the effects of attractants on the liver
morphology of Chinese perch. Observation of the liver oil red O staining
sections under a 40 × microscope revealed that the SW group had a

4
Di Peng et al. Aquaculture Reports 23 (2022) 101075

Fig. 1. The relative mRNA level changes in appetite-related genes in brain of Chinese perch fed with different feed attractants. Values are presented as the means
± SEM (n = 3). Different lowercase letters above the bars indicate significant difference (P < 0.05).

significant accumulation of lipid droplets, while there were no signifi­
cant differences among the control, SP and Mix groups. The H&E
staining of the liver sections revealed that all groups had liver cells with
normal morphology and structure in a regular arrangement, and there
was no infiltration of inflammatory cells associated with liver damage.
4. Discussion
SW is a by-product of industrialized fish meal production (Shi et al.,
2019). SP is a black paste made from fresh squid viscera by steaming and
boiling at high temperature. They are often used as nonnutritive addi­
tives to improve the palatability of artificial compound feed. FI is
generally an important index to evaluate the palatability of artificial
feed. The present study demonstrated that 5% SW diet could improve
the growth performance of Chinese perch. SW could significantly in­
crease the FI and decrease FCR, indicating that it can improve the feed
palatability for Chinese perch as an attractant. SW contains various
water soluble molecules and particles, such as free amino acids, pep­
tides, small proteins, minerals, water soluble vitamins, and low molec­
ular weight components such as taurine, creatinine and carnosine
(Kousoulaki et al., 2009). The taurine contained in SW can promote
intestinal development and growth (Kim et al., 2005), while free amino
acids (Ala, Gly, Glu, Pro, Leu and Tau) are usually related to the taste
response, and play certain roles in regulating the appetite (Shamushaki
et al., 2007). Previous studies have demonstrated that SW has an irre­
placeable effect on the nutritional value of carnivorous fish (Mahdad

5
Di Peng et al. Aquaculture Reports 23 (2022) 101075

Fig. 2. The relative mRNA level changes in lipid metabolism-related genes in brain of Chinese perch fed with different feed attractants. Values are presented as the
means ± SEM (n = 3). Different lowercase letters above the bars indicate significant difference (P < 0.05).

Fig. 3. Hepatic section for Oil-red O staining at 40 × magnification.

and Pezhman, 2018). Yun et al. (Yun et al., 2014) confirmed that SW significantly different FI and WGR of Chinese perch compared with the
supplementation in the diet could significantly improve the growth control diet. Xue et al. (Xue et al., 2004) also found that although the
performance and feed utilization rate of juvenile Snakehead (Ophioce­ addition of 0.1% SP to the diet could improve the feeding speed of the
phalus argus). In this study, the SP and Mix diets resulted in no gibel carp (Carassius auratus gibelio) in the short term, it resulted in no

6
Di Peng et al.
Fig. 4. Hepatic section for HE staining at 40 × magnification.
significant difference from the control diet in the long-term experiment.
Toften et al. (Toften and Jobling, 1997) also reported that the addition of
SP to the feed failed to improve the FI and growth performance of
Atlantic salmon (Salmo salar L.). The mixture of attractants is generally
more effective than single attractants in promoting the feeding of fish
(Adams et al., 1988). However, in this study, the feeding effect of the
Mix diet was not as good as that of the SW diet. For the same species of
fish, the mixture of attractants may show different feeding effects from
individual attractants, which may be ascribed to the mutual promoting
or inhibiting effects between the components in the mixture. The
interaction mechanism between the various components needs to be
further studied. This study confirmed that SW supplementation could
increase the WGR, FI and PER of Chinese perch, indicating that SW can
improve the feed palatability for Chinese perch.
Furthermore, our results showed that dietary SW supplementation
decreased the whole-body crude lipid content and significantly reduced
the content of hepatopancreas lipid (P < 0.05), but the SP and Mix
supplementation exhibited no significant effect on the crude lipid con­
tent of the whole fish relative to the control. It has been demonstrated
that the supplementation of attractants can affect the fat deposition in
many fish species, such as Atlantic salmon (Burrells et al., 2001),
freshwater spadefish (Colossoma brachypomum) (Lu et al., 2003), Chi­
nese soft-shelled turtle (Pelodiscus sinensis) (Sun et al., 2017), and
freshwater crayfish (Procambarus clarkia) (Hua et al., 2015). However,
the effects are dependent on the type of attractant and the effective
concentration. In this study, the SW group showed decreases in crude
lipid content in the liver, as well as changes in CHO and TG related to
lipid metabolism in the serum compared with other groups. The liver Oil
red O section showed that the SW group had decreases in lipid droplets.
fas is a key rate-limiting enzyme regulating lipid synthesis (Davis and M,
2000), and cpt1 is a rate-limiting enzyme of the β-oxidation of fatty acids
(Guo et al., 2020). We further analyzed the expression levels of genes
related to lipid metabolism, and found that SW diet significantly
decreased the expression of the fas gene, but significantly increased that
of the cpt1 gene in the liver, indicating that SW may inhibit lipid syn­
thesis, increase lipid decomposition, enhance lipid metabolism and
reduce lipid accumulation in the liver of Chinese perch.
Blood biochemical indices can indicate the physiological and meta­
bolic status of animals, and are closely related to nutritional changes,
health and environmental conditions (Lermen et al., 2004). TG and CHO
are important products of lipid metabolism, and an increase in serum
CHO is usually accompanied by an increase in TG. Adipose tissue is the
7
Aquaculture Reports 23 (2022) 101075
largest storage pool for CHO in the body, and the serum CHO level can
reflect the status of lipid absorption and metabolism. LDLC and HDLC
are involved in the transport of cholesterol, with the former transporting
cholesterol from the liver to other tissues and the latter transporting
cholesterol from other tissues to the liver. In this study, the SW group
had lower contents of serum TG and CHO than other groups, indicating
that lipid metabolism is relatively inactive under this nutritional state.
Moreover, the SW group had a significantly higher serum LDLC level
than the SP and Mix groups (P < 0.05), while showed no significant
difference in the HDLC level, implying that SW could increase the
transport of cholesterol from the liver to other tissues. Another previous
study (Ming et al., 2016) also showed that taurine can effectively reduce
the serum CHO and TG level. Similar results were obtained in yellow
catfish (Pelteobagrus fulvidraco) (Wu et al., 2018): the addition of SW
reduced the lipid content of whole fish and the liver. These results may
be attributed to the high content of taurine in SW. Many studies have
demonstrated the effect of taurine on bile acid synthesis and lipid
metabolism. It can promote lipid emulsification and the digestion and
absorption of some lipid materials such as fat-soluble vitamin (Hoseini
et al., 2018; Yun et al., 2011).
ALT and AST are important and sensitive indices to reflect liver cell
damage (Jiang et al., 2015). Normally, the levels of AST and ALT are low
in the blood, but they can enter the bloodstream in large quantities upon
the damage of the liver (Casamassima et al., 2017). SOD, CAT and GSH
are important components in the antioxidant system of animals. SOD
and CAT can effectively remove reactive oxygen species such as O2-, -OH
and H2O2 in the body, and GSH can react with lipid peroxide and H2O2
to remove excess free radicals (Yang, Du et al., 2019; Yang et al., 2018).
MDA, which reflects the level of lipid peroxidation on the membrane, is
a good indicator of oxidative stress (Yang, Liang et al., 2019). Our results
showed that the SW diet enhanced the activity of SOD and CAT in the
serum of Chinese perch, while decreased the serum contents of AST, ALT
and MDA, indicating that SW can enhance the antioxidant ability of
Chinese perch. For other carnivorous fish, such as rice field eel
(Monopterus albus) (Shi et al., 2019) and juvenile Snakehead (Ophioce­
phalus argus) (Yun et al., 2014), the addition of an moderate amount of
SW can also significantly improve their antioxidant capacity.
npy has been recognized as the most effective appetite stimulating
factor with a significant effect on the appetite of mammals and fish
(Volkoff and Peter, 2006; Volkoff et al., 2009). agrp can coordinate with
npy to promote fish FI (Murashita et al., 2009). cart was identified as an
important appetite-suppressing neuropeptide in the hypothalamus
Di Peng et al.
(Murashita et al., 2009; Zhong et al., 2013), and has been previously
described to play an anorexigenic role in several species, such as Atlantic
salmon (Valen et al., 2011), gilthead seabream (Sparus aurata) (Catarina
et al., 2021), channel catfish (Ictalurus punctatus) (Peterson et al., 2012),
and dourado (Salminus brasiliensis) (Hélène et al., 2016). pomc has also
been proved as a kind of appetite-suppressing hormone in mammals and
fish (Volkoff et al., 2005). ghrelin, a brain-gut peptide mainly produced
by gastric secreting adenosine cells, is widely distributed in the central
nerve system and peripheral tissues of animals, and is the first discov­
ered endogenous ligand of the growth hormone secretion receptor
(Kojima et al., 1999). ghrelin has different effects on the appetite of fish.
Exogenous injection of ghrelin could increase the FI in tilapia (Oreo­
chromis niloticus) (Riley et al., 2005) and goldfish (Carassius auratus)
(Matsuda et al., 2006), but inhibited the appetite of rainbow trout
(Elisabeth et al., 2010). Leptin is a satiety signal mainly acting on the
feeding and satiety centers of the brain (Zhang et al., 1997). Most studies
of aquatic animals have demonstrated that leptin can reduce the appe­
tite (Zhang et al., 2013). In this study, all three attractants down­
regulated the expression of cart and pomc, and the expression of npy and
agrp in the SP group was not significantly different from that in the
control group. SW up-regulated the mRNA expression of the central
appetite-stimulating factor npy and agrp, and downregulated that of the
central appetite-suppressing factor cart and pomc. As for the genes
related to peripheral appetite, SW supplementation decreased the
expression of the appetite-suppressing gene leptin A, while significantly
increased that of ghrelin, confirming that SW supplementation can
significantly promote the appetite and increase the FI of Chinese perch.
In conclusion, the supplementation of SW at an appropriate level can
improve the appetite and feed acceptability, decrease the FCR, as well as
improve the antioxidant capacity and reduce liver lipid accumulation of
Chinese perch. Therefore, SW may be recommended as a promising
attractant in the compound feed of Chinese perch.
Funding information
National Key R&D Program of China (2019YFD0900500). China
Agriculture Research System (CARS-46); The National Natural Science
Foundation of China (31972809).
Ethics declarations
All experiments and animalhandling procedures were approved by
the Ethics Committee of the Institute of Laboratory Animal Centre,
Huazhong Agricultural University (Ethical code: HZAUFI-2019–027).
Authors’ contributions
XFL designed the research. DP wrote the paper and analyzed the
data. BBP, JL, YPZ, HCL, QQX and SLT carried out the experiments and
analyzed the data.
Declaration of Competing Interest
All authors have approved the final version of the manuscript.
Competing interests, the authors declare no competing interests..
References
Adams, M.A., Johnsen, P.B., Zhou, H.Q., 1988. Chemical enhancement of feeding for the
herbivorous fish Tilapia zillii. Aquaculture 72, 95–107.
Aldegunde, M., Mancebo, M., 2006. Effects of neuropeptide Y on food intake and brain
biogenic amines in the rainbow trout (Oncorhynchus mykiss). Peptides 27, 719–727.
Burrells, Williams, P.D., Southgate, P.J., S.L, 2001. Dietary nucleotides: a novel
supplement in fish feeds: 2. Effects on vaccination, salt water transfer, growth rates
and physiology of Atlantic salmon (Salmo salar L.). Aquaculture 199, 171–184.
Casamassima, D., Palazzo, M., Vizzarri, F., Costagliola, C., Corino, C., Costanzo, A.D.,
2017. Dietary effects of plant extracts, based on verbascoside, lycopene and
8
Aquaculture Reports 23 (2022) 101075
horseradish on several blood variables and plasma oxidative status in growing
rabbits. Livest. Sci. 206, 148–153.
Catarina, B.-S., Paula, E., Aires, O.-T., Sara, B.-P., Isabel, N., Encarnación, C., Inês, G.,
2021. Dietary protein source and protein/carbohydrate ratio affects appetite
regulation-related genes expression in gilthead seabream (Sparus aurata).
Aquaculture 533, 736142.
Davis, M. S, 2000. Overproduction of Acetyl-CoA Carboxylase Activity Increases the Rate
of Fatty Acid Biosynthesis in Escherichia coli. J. Biol. Chem. 275, 28593–28598.
Davis, M.W., Spencer, M.L., Ottmar, M.L., 2006. Behavioral responses to food odor in
juvenile marine fish: Acuity varies with species and fish length. J. Exp. Mar. Biol.
328, 1–9.
Dias, J., Gomes, E.F., Kaushik, S.J., 1997. Improvement of feed intake through
supplementation with an attractant mix in European seabass fed plant-protein rich
diets. Aquat. Living Resour. 10, 385–389.
Elisabeth, J., Hiroyuki, K., Thrandur, B.B., 2010. Ghrelin decreases food intake in
juvenile rainbow trout (Oncorhynchus mykiss) through the central anorexigenic
corticotropin-releasing factor system. Gen. Comp. Endocrinol. 166, 39–46.
Flores-Sierra, J., Arredondo-Guerrero, M., Cervantes-Paz, B., Rodríguez-Ríos, D.,
Alvarado-Caudillo, Y., Nielsen, F.C., Wrobel, K., Wrobel, K., Zaina, S., Lund, G.,
2016. The trans fatty acid elaidate affects the global DNA methylation profile of
cultured cells and in vivo. Lipids Health Dis. 15, 1–7.
Guo, C., Han, L., Li, M., Yu, L., 2020. Seabuckthorn (Hippopha rhamnoides) Freeze-Dried
Powder Protects against High-Fat Diet-Induced Obesity, Lipid Metabolism Disorders
by Modulating the Gut Microbiota of Mice. Nutrients 12, 265.
Hélène, Volkoff, Rafael, Estevan, Sabioni, José, Eurico, Possebon, Cyrino, 2016. Appetite
regulating factors in dourado, Salminus brasiliensis: cDNA cloning and effects of
fasting and feeding on gene expression. Gen. Comp. Endocrinol. 237, 34–42.
Hirwitz, W.A.L.G., 1995. Official methods of analysis of AOAC International, 16th edn
Trends Food Sci. Tech. 382-382.
Hoseini, S.M., Hosseini, S.A., Eskandari, S., Amirahmadi, M., 2018. Effect of dietary
taurine and methionine supplementation on growth performance, body composition,
taurine retention and lipid status of Persian sturgeon, Acipenser persicus (Borodin,
1897), fed with plant-based diet. Aquac. Nutr. 24, 324–331.
Hua, X.M., Shui, C., He, Y.D., Xing, S.H., Yu, N., Zhu, Z.Y., Zhao, C.Y., 2015. Effects of
different feed stimulants on freshwater crayfish (Procambarus clarkii), fed diets with
or without partial replacement of fish meal by biofeed. Aquac. Nutr. 21, 113–120.
Ishimaru, Y., Okada, S., Naito, H., Nagai, T., Yasuoka, A., Matsumoto, I., Abe, K., 2005.
Two families of candidate taste receptors in fishes. Mech. Dev. 122, 1310–1321.
Jiang, S., Wu, X., Li, W., Wu, M., Luo, Y., Lu, S., Lin, H., 2015. Effects of dietary protein
and lipid levels on growth, feed utilization, body and plasma biochemical
compositions of hybrid grouper (Epinephelus lanceolatus ♂×Epinephelus fuscoguttatus
♀) juveniles. Aquaculture 446, 148–155.
Kamijo, M., Kojima, K., Maruyama, K., Konno, N., Motohashi, E., Ikegami, T.,
Uchiyama, M., Shioda, S., Ando, H., Matsuda, K., 2011. Neuropeptide Y in tiger
puffer (Takifugu rubripes): distribution, cloning, characterization, and mRNA
expression responses to prandial condition. Zool. Sci. 28, 882.
Khosravi, S., Bui, H., Rahimnejad, S., Herault, M., Fournier, V., Kim, S.S., Jeong, J.B.,
Lee, K.J., 2015. Dietary supplementation of marine protein hydrolysates in fish-meal
based diets for red sea bream (Pagrus major) and olive flounder (Paralichthys
olivaceus). Aquaculture 435, 371–376.
Kim, S.K., Takeuchi, T., Yokoyama, M., Murata, Y., Kaneniwa, M., Sakakura, Y., 2005.
Effect of dietary taurine levels on growth and feeding behavior of juvenile Japanese
flounder Paralichthys olivaceus. Aquaculture 250, 765–774.
Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Kangawa, K., 1999. Ghrelin is a growth-
hormone-releasing acylated peptide from stomach. Nature 402, 656.
Kousoulaki, K., Albrektsen, S., Langmyhr, E., Olsen, H.J., Campbell, P., Aksnes, A., 2009.
The water soluble fraction in fish meal (stickwater) stimulates growth in Atlantic
salmon (Salmo salar L.) given high plant protein diets. Aquaculture 289, 74–83.
Lermen, C.L., Lappe, R., Crestani, M., Vieira, V.P., Gioda, C.R., Schetinger, M.,
Baldisserotto, B., Moraes, G., Morsch, V.M., 2004. Effect of different temperature
regimes on metabolic and blood parameters of silver catfish Rhamdia quelen.
Aquaculture 239, 497–507.
Liang, X.F., Oku, H., Ogata, H.Y., Liu, J., He, X., 2015. Weaning Chinese perch Siniperca
chuatsi (Basilewsky) onto artificial diets based upon its specific sensory modality in
feeding. Aquac. Res. 32, 76–82.
Lu, Q.E., Li, Z.Q., Li, X.X., 2003. Effects of betaine hydrochloride on lipid metabolism of
colossoma brachypomum. Oceanol. Et. Limnol. Sin. 176, 231–239.
Mackie, A.M., Mitchell, A.I., 1985. Identification of gustatory feeding stimulants for fish-
application in aquaculture. Nutr. Feed. fishes 177–189.
Mackie, A.M., Mitchell, A.I., 2006. Studies on the chemical nature of feeding stimulants
for the juvenile European eel, Anguilla anguilla (L.). J. Fish. Biol. 22, 425–430.
Mahdad, M., Pezhman, H., 2018. A Comparative Study on Some Functional and
Antioxidant Properties of Kilka Meat, Fishmeal, and Stickwater Protein
Hydrolysates. J. Aquat. Food Prod. Technol. 27, 1–15.
Margolskee, R.F., Dyer, J., Kokrashvili, Z., Salmon, K., Shirazi-Beechey, S.P., 2007. T1R3
and gustducin in gut sense sugars to regulate expression of Na+-glucose
cotransporter 1. Proc. Natl. Acad. Sci. 104, 15075–15080.
Matsuda, K., Miura, T., Kaiya, H., Maruyama, K., Shimakura, S.I., Uchiyama, M.,
Kangawa, K., Shioda, S., 2006. Regulation of food intake by acyl and des-acyl
ghrelins in the goldfish. Peptides 27, 2321–2325.
Min, X., Cui, Y., 2001. Effect of several feeding stimulants on diet preference by juvenile
gibel carp (Carassius auratus gibelio), fed diets with or without partial replacement of
fish meal by meat and bone meal. Aquaculture 198, 281–292.
Ming, L., Hang, L., Li, Q., Gong, S., Wang, R., 2016. Effects of dietary taurine on growth,
immunity and hyperammonemia in juvenile yellow catfish Pelteobagrus fulvidraco
fed all-plant protein diets. Aquaculture 450, 349–355.
Di Peng et al.
Murashita, K., Kurokawa, T., Ebbesson, L., Stefansson, S.O., R?Nnestad, I., 2009.
Characterization, tissue distribution, and regulation of agouti-related protein
(AgRP), cocaine- and amphetamine-regulated transcript (CART) and neuropeptide Y
(NPY) in Atlantic salmon (Salmo salar). Gen. Comp. Endocrinol. 162, 160–171.
Oike, H., Nagai, T., Furuyama, A., Okada, S., Aihara, Y., Ishimaru, Y., Marui, T.,
Matsumoto, I., Misaka, T., Abe, K., 2007. Characterization of ligands for fish taste
receptors. J. Neurosci. Off. J. Soc. Neurosci. 27, 5584–5592.
Papatryphon, Soares, Jh, 2000. The effect of dietary feeding stimulants on growth
performance of striped bass, Morone saxatilis, fed-a-plant feedstuff-based diet.
Aquaculture 185, 329–338.
Papatryphon, E., Soares, J.H., 2000. Identification of feeding stimulants for striped bass,
Morone saxatilis. Aquaculture 185, 339–352.
Peterson, B.C., Waldbieser, G.C., Riley, L.G., Upton, K.R., Kobayashi, Y., Small, B.C.,
2012. Pre- and postprandial changes in orexigenic and anorexigenic factors in
channel catfish (Ictalurus punctatus). Gen. Comp. Endocrinol. 176, 231–239.
Riley, L.G., Fox, B.K., Kaiya, H., Hirano, T., Grau, E.G., 2005. Long-term treatment of
ghrelin stimulates feeding, fat deposition, and alters the GH/IGF-I axis in the tilapia,
Oreochromis mossambicus. Gen. Comp. Endocrinol. 142, 234–240.
Shamushaki, Vaj, Kasumyan, Ao, Abedian, Abtahi, B, 2007. Behavioural responses of the
Persian sturgeon (Acipenser persicus) juveniles to free amino acid solutions. Mar.
Freshw. Behav. Physiol. 40, 219–224.
Shi, Y., Zhong, L., Ma, X., Liu, Y., Tang, T., Hu, Y., 2019. Effect of replacing fishmeal with
stickwater hydrolysate on the growth, serum biochemical indexes, immune indexes,
intestinal histology and microbiota of rice field eel (Monopterus albus). Aquac. Rep.
15, 100223.
Srichanun, M., Tantikitti, C., Kortner, T.M., Krogdahl, Chotikachinda, R., 2014. Effects of
different protein hydrolysate products and levels on growth, survival rate and
digestive capacity in Asian seabass (Lates calcarifer Bloch) larvae. Aquaculture
428–429, 195–202.
Sun, C.X., Xu, W.N., Zhang, D.D., Li, X.F., Li, P.F., Jiang, G.Z., Liu, W.B., 2017. Different
preference is modulated by the feeding stimulants supplementation in different
Chinese soft-shelled turtle (Pelodiscus sinensis) basic diets. Aquac. Nutr. 24, 195–203.
Tang, H.G., Tian-Xing, W.U., Zhao, Z.Y., Pan, X.D., 2008. Effects of fish protein
hydrolysate on growth performance and humoral immune response in large yellow
croaker (Pseudosciaena crocea R.). J. Zhejiang Univ. 9, 684–690.
Toften, H., Jobling, M., 1997. Feed intake and growth of Atlantic salmon, Salmo salar L.,
fed diets supplemented with oxytetracycline and squid extract. Aquac. Nutr. 3,
145–151.
Valen, R., Jordal, A., Murashita, K., Rnnestad, I., 2011. Postprandial effects on appetite-
related neuropeptide expression in the brain of Atlantic salmon. Salmo salar. Gen.
Comp. Endocrinol. 171, 359–366.
Volkoff, H., Canosa, L.F., Unniappan, S., Cerdá-Reverter, J., Bernier, N.J., Kelly, S.P.,
Peter, R.E., 2005. Neuropeptides and the control of food intake in fish. Gen. Comp.
Endocrinol. 142, 3–19.
Aquaculture Reports 23 (2022) 101075
Volkoff, H., Peter, R.E., 2006. Feeding behavior of fish and its control. Zebrafish 3,
131–140.
Volkoff, H., Unniappan, S., Kelly, S.P., 2009. Chapter 9 The Endocrine Regulation of
Food Intake. Fish. Physiol. Biochem. 28, 421–465.
Wu, D., Zhou, L., Gao, M., Wang, M., Wang, B., He, J., Luo, Q., Ye, Y., Ca, I.C., Wu, P.,
2018. Effects of stickwater hydrolysates on growth performance for yellow catfish
(Pelteobagrus fulvidraco). Aquaculture 488, 167–173.
Xue, M., Xie, S., Cui, Y., 2004. Effect of a feeding stimulant on feeding adaptation of gibel
carp Carassius auratus gibelio (Bloch), fed diets with replacement of fish meal by meat
and bone meal. Aquac. Res. 35, 473–482.
Yacoob, S.Y., Browman, H.I., 2007. Olfactory and gustatory sensitivity to some feed-
related chemicals in the Atlantic halibut (Hippoglossus hippoglossus). Aquaculture
263, 303–309.
Yang, C., Hao, R., Du, X., Wang, Q., Deng, Y., Sun, R., 2018. Response to different dietary
carbohydrate and protein levels of pearl oysters (Pinctada fucata martensii) as
revealed by GC-TOF/MS-based metabolomics. The. Sci. Total Environ. 2614–2623.
Yang, C., Du, X., Hao, R., Wang, Q., Deng, Y., 2019. Effect of vitamin D3 on immunity
and antioxidant capacity of pearl oyster Pinctada fucata martensii after
transplantation: Insights from LC–MS-based metabolomics analysis. Fish. Shellfish
Immunol. 94, 271–279.
Yang, Q., Liang, H., Mokrani, A., Ji, K., Yu, H., Ge, X., Ren, M., Xie, J., Pan, L., Sun, A.,
2019. Dietary histidine affects intestinal antioxidant enzyme activities, antioxidant
gene expressions and inflammatory factors in juvenile blunt snout bream
(Megalobrama amblycephala). Aquac. Nutr. 25, 249–259.
Yun, B., Ai, Q., Mai, K., Xu, W., Qi, G., Luo, Y., 2011. Synergistic effects of dietary
cholesterol and taurine on growth performance and cholesterol metabolism in
juvenile turbot (Scophthalmus maximus L.) fed high plant protein diets. Aquaculture
324, 85–91.
Yun, B., Ai, Q., Hua, X., Qian, X., 2014. Effects of dietary squid soluble fractions on
growth performance and feed utilization in juvenile snakehead(Ophiocephalus argus)
fed practical diets. Isr. J. Aquac. 66.
Zhang, Faming, Basinski, Margret, B, 1997. Crystal structure of the obese protein leptin-E
100. Nature 387, 206–209.
Zhang, K., Ai, Q., Mai, K., Xu, W., Liufu, Z., Zhang, Y., Peng, M., 2013. Effects of dietary
hydroxyproline on growth performance, body composition, hydroxyproline and
collagen concentrations in tissues in relation to prolyl 4-hydroxylase α(I) gene
expression of juvenile turbot, Scophthalmus maximus L. fed high plant protein diets.
Aquaculture 404, 77–84.
Zhong, C., Song, Y., Wang, Y., Zhang, T., Duan, M., Li, Y., Liao, L., Zhu, Z., Hu, W.,
Zhong, C., 2013. Increased food intake in growth hormone-transgenic common carp
(Cyprinus carpio L.) may be mediated by upregulating Agouti-related protein (AgRP).
Gen. Comp. Endocrinol. 192, 81–88.