See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/364343942

Valine acts as a nutritional signal in brain to activate TORC1 and attenuate

postprandial ammonia-N excretion in Chinese perch (Siniperca chuatsi)

Article  in  Fish Physiology and Biochemistry · October 2022

CITATIONS READS

0 14

18 authors, including:

Jie Wang Shan He

Huazhong Agricultural University UNSW Sydney
7 PUBLICATIONS   1 CITATION    100 PUBLICATIONS   1,299 CITATIONS   

SEE PROFILE SEE PROFILE

All content following this page was uploaded by Jie Wang on 17 October 2022.

The user has requested enhancement of the downloaded file.

Fish Physiol Biochem
https://doi.org/10.1007/s10695-020-00767-y
Valine acts as a nutritional signal in brain to activate
TORC1 and attenuate postprandial ammonia-N excretion
in Chinese perch (Siniperca chuatsi)
Jie Wang & Xu-Fang Liang & Shan He &
Yan-Peng Zhang & Jiao Li & Kang Huang & Lin-Jie Shi &
Ping Ren
Received: 28 June 2019 / Accepted: 13 January 2020
# Springer Nature B.V. 2020
Abstract An emerging concept is that the hypothalam-
ic nutrient sensor can regulate peripheral energy metab-
olism via a brain-liver circuit. Valine is an essential
branched-chain amino acid (BCAA) that drives
J. Wang : X.<F. Liang : S. He : Y.<P. Zhang : J. Li :
K. Huang : L.<J. Shi : P. Ren
College of Fisheries, Chinese Perch Research Center, Huazhong
Agricultural University, No.1, Shizishan Street, Hongshan
District, Wuhan 430070 Hubei Province, China
J. Wang
e-mail: scofield_wj@163.com
S. He
e-mail: heshan@mail.hzau.edu.cn
Y.<P. Zhang
e-mail: 511306544@qq.com
J. Li
e-mail: lijiao0519@foxmail.com
K. Huang
e-mail: hk192@sina.com
L.<J. Shi
e-mail: 1451644883@qq.com
P. Ren
e-mail: 067706873@qq.com
J. Wang : X.<F. Liang (*) : S. He : Y.<P. Zhang : J. Li
K. Huang : L.<J. Shi : P. Ren
Innovation Base for Chinese Perch Breeding, Key Lab of
Freshwater Animal Breeding, Ministry of Agriculture,
Wuhan 430070, China
e-mail: xufang_liang@hotmail.com
intracellular signaling cascades by the activation of
target of rapamycin complex 1 (TORC1) which is
critical to protein metabolism in mammals. However,
in teleost fish, it remains scarce in this area especially
about how the intraventricular (ICV) injection of
valine can mediate the protein metabolism in periph-
eral organs. This study would tentatively explore the
effects of ICV injection of valine on protein metabo-
lism in peripheral organs through evaluating the post-
prandial ammonia-N excretion rate in Chinese perch.
The control group was injected with 5-μL PBS, and
the Val group was injected with 20-μg L valine
dissolved into 5-μL PBS. The ammonia-N excretion
rate of Val group was lower than control group at 4-,
12-, and 24-h postinjection, while the concertation of
plasma glucose was increased sharply at 0.5-, 4-, 12-,
and 24-h postinjection. We further checked both
mRNA level and the enzyme activity of glutamate
dehydrogenase (GDH) in the liver and adenosine
monophosphate deaminase (AMPD) in muscle, and
we found that they were obviously decreased in Val
group at 4-, 12-, and 24-h postinjection. The phos-
phorylation level of ribosomal protein S6, a down-
stream target protein of TORC1, was markedly en-
hanced in the liver of Val group at 4-, 12-, and 24-h
postinjection. Collectively, these results illustrated
that ICV injection of valine can attenuate protein
: degradation in peripheral organs by depressing the
GDH and AMPD enzyme activity; on the other hand,
the injected valine can trigger the activation of
TORC1 in the liver via a brain-liver circuit and then
interdict proteolysis.

Keywords Valine . ICV injection . Chinese perch .
Protein degradation . Ammonia-N excretion rate .
TORC1 . Brain-liver circuit
Introduction
Chinese perch (Siniperca chuatsi), a typical car-
nivorous fish in freshwater, is cultured widely in
China and some other Asian countries. It possesses
great meat quality and high nutritional value; thus,
it always has a high reputation and high demand
among the consumers all around the world (Liang
et al. 2001). Interestingly, this fish is also treated
as a suitable fish model for the fundament study
on physiology metabolism and feeding behavior
because of its high tolerance even when faced to
severe conditions (Strebkova and Shabalina 1984)
and peculiar feeding habit that only accepted live
prey fish (Liang et al. 2001). Over the past two
decades, the sharply expanding trade of Chinese
perch motivated the intensive and factory culture
model in China (Fang et al. 2017). However, when
the stocking density improved gradually, the fish
started suffering from the environmental stress fre-
quently within high concentration of ammonia and
nitrite, which has an adverse effect on its growth
and health (Guroy et al. 2012). On the other hand,
the higher ammonia elimination also implicated the
lower protein coefficient of utilization in fish.
Therefore, how to reduce the ammonia-N excretion
and protein catabolic rate is a mentionable issue in
the future cultivation of Chinese perch.
Ammonia-N is mainly the final product of amino
acid breakdown, which accounts for 80–99% of the total
nitrogen excretion in teleost fish (Brett and Zala 1975b).
Consequently, ammonia-N excretion rate is an impor-
tant indicator for evaluating the rate of protein degrada-
tion in fish (Brett and Zala 1975b; Kutty 1978). Gener-
ally, high production of postprandial ammonia is toxic
to fish and is also considered to be a major factor
limiting fish biomass and stocking density in intensive
culture systems (Cai and Summerfelt 1992; Forsberg
and Summerfelt 1992). Indeed, the accumulative
concertation of ammonia may result in localized eutro-
phication and stimulate algal blooms (Gowen 1994),
which can lead to high mortality in farmed fish
(Ballestrazzi et al. 1994; Wu 1995). It has been ap-
proved that the postprandial ammonia-N excretion rate
Fish Physiol Biochem
is associated with the water temperature (Cai and
Summerfelt 1992; Forsberg and Summerfelt 1992), the
sources and contents of dietary protein (Ballestrazzi
et al. 1994; Paulson 1980), and more even with the
availability of amino acids (Fournier et al. 2003; Peres
and Oliva-Teles 2007, 2008).
Notably, the branched-chain amino acids (BCAAs),
leucine (Leu), isoleucine (Ile), and valine (Val) differ
from most other essential amino acids in that they are
utilized and degraded primarily in the muscle but not in
the liver (Ahmed and Khan 2006; Lynch and Adams
2014); moreover, they can gain access to the central
nervous system (CNS) through a facilitative transport
system (Smith 2000) and participate directly and indi-
rectly in a variety of important regulatory mechanism
(Blouet et al. 2009; Cota et al. 2006; Fernstrom 2005;
Izumi et al. 2004; Lynch and Adams 2014; McCormack
et al. 2013; Newgard et al. 2009; Su et al. 2012).
Interestingly, more and more reports have confirmed
that the hypothalamus, as a central nutrient sensor in
CNS, plays an important role in the systemic metabolic
process (Pocai et al. 2005) that apperceives peripheral
nutritional signal (Swaab et al. 1993), especially sensing
of amino acids (Lazutkaite et al. 2017). On the other
hand, many research findings revealed that the hypotha-
lamic BCAAs can effectively mediate peripheral protein
metabolism mainly due to the activation of target of
rapamycin complex 1 (TORC1) pathway via a brain-
liver circuit (O'Hare and Zsombok 2016). The activation
of TORC1 advances protein synthesis and depresses
proteolysis primarily through the phosphorylation of
downstream substrates associated with ribosomes, e.g.,
ribosomal protein S6 (rpS6), which interacts directly
with the 40s ribosomal subunit (Dodd and Tee 2012;
Kimball and Jefferson 2006; Kimball et al. 1999; Vary
and Lynch 2007; Wang and Proud 2006; Yoshizawa
2004). During the last several years, many studies have
uncovered the correlative mechanism between central
sensing of BCAAs and peripheral protein metabolism
via the activation of TORC1 in mammals (Appuhamy
et al. 2012; Blouet and Schwartz 2010; Dodd and Tee
2012; Fernstrom 2005; Holecek 2002; Lang et al. 2010;
Meijer and Dubbelhuis 2004; Shimomura et al. 2006;
Vary and Lynch 2007; Wang and Proud 2006), but little
is known in teleost fish. This study is performed to
investigate the potential connection between ICV injec-
tion of valine and protein metabolism in peripheral
organs through evaluating the ammonia-N excretion in
Chinese perch.
Fish Physiol Biochem
Material and methods
Experimental animals
All the Chinese perch were purchased from Wuhan
Sihui Fish Farm (Wuhan, Hubei, China) and then cul-
tured in the aquarium (350 L) with a circulating system
of water filtration in Huazhong Agricultural University
(Wuhan, Hubei, China). The water temperature was
maintained at 24 ± 1 °C, and the photoperiod was 10 h
of dark and 14 h of light. Before the experiment, all fish
were acclimated for 2 weeks to adapt to the condition
and fed with juvenile live mrigal (Cirrhinus mrigala)
twice a day (8.30 am and 17.30 pm) to apparent satiation
(5% body weights) within 0.5-h feeding time. All ex-
perimental procedures were carried out by the ethical
guidance of laboratory animal protocols and were ap-
proved by the Committee of Huazhong Agricultural
University (Wuhan, Hubei, China).
Reagents
The chemical reagent of L-valine (V0513; Sigma-
Aldrich, USA) was dissolved in the phosphate buffer
solution (PBS) (C0221A, Beyotime-Biotechnology,
China) which was a vehicle with a total injection volume
of 5 μL. The dose of drug (20 μg for L-valine) was
primarily confirmed by the previous studies (Anthony
et al. 2000; Sánchez et al. 2001).
ICV injection
Before ICV injection, all the experimental fish were
fasted for 24 h, and then 150 healthy fish (14.50 ±
0.25 g fish−1) were picked out and arranged randomly
into 6 tanks (100 L) in hydrostatic condition (24 ± 1 °C).
The value of dissolved oxygen was 6.5–6.8 mg/L and
pH ranged 6.8–7.2. The stock density was 25 fish per
tank, and each group was arranged to triplicate tanks.
Fish were firstly anesthetized with MS-222 (200 mg/L;
Argent Chemical Laboratories, Redmond, WA, USA)
until into a deep coma and then conducted with ICV
injection from 8:30 to 9:00 am. Five fish were injected
by five trained experimenters at the same time in 1 min.
We recorded the start time and end time of injection of
each tank and also made a schedule of sample time
according to the end time of injection of each tank.
The ICV injection was performed with a 5-μL Hamilton
microsyringe (Hamilton, Reno, NV, USA) and located
directly over the cranium, post-orbitally, and to a deep-
ness of 3 mm into the 3rd ventricle, which was coinci-
dent with the method described previously (De Pedro
et al. 1998). The control group was injected with 5-μL
PBS, and the Val group was injected with 20-μg L
valine dissolved into 5-μL PBS. To further determine
the accurateness and deepness of the injection, we treat-
ed the methylene blue (Sigma-Aldrich, USA) as a dye
tracer (Ortega et al. 2013). When we finished the injec-
tion of the 25 fish in each tank, all the sober Chinese
perch of each tank were immediately fed with equiva-
lent live mrigal (5% of body weights) to apparent sati-
ation, and we made sure that there was no more residual
bait existing beyond 0.5-h feeding time according to the
rhythm of previous acclimation.
Sample and analytical methods
According to the preliminary experiment, it has been
approved that the accumulation of ammonia excretion in
hydrostatic condition within 24 h was in the safe range
and could negatively cause environment stress to Chi-
nese perch (Fang et al. 2017). The water samples of each
tank were collected after a full mixture at 0.5, 4, 12, and
24 h after injection, and the ammonia-N concentrations
(NH4+-N and NH3-N) were determined by the method
of Nessler’s reagent spectrophotometry (Thermo Elec-
tron Corporation BioMate 5, Cummings Center, Bever-
ly, MA, USA) (Chen and Hu 2011). The hourly
ammonia-N excretion rate was calculated by analyzing
the ammonia-N production between each time point
using the following formula (Yigit et al. 2003):
Ammonia-N excretion rate (mg kg−1 h−1) = [(Na–Nb) ×
V] × B−1 × (Ta-b)−1, where Na = Ammonia-N concentra-
tion at time a; Nb = Ammonia-N concentration at time b;
V = capacity of tank water (L); B = wet weight of the
fish (kg); and Ta-b = time interval between sampling a
and b (h). Indeed, at 0.5, 4, 12, and 24 h after injection,
five fish of each tank were randomly captured and
euthanized with MS-222, and then fresh blood was
taken from caudal vein, and the plasma glucose was
determined immediately by a quick and easy glucometer
(Accu-Chek Performa, Roche, Deutschland).Three fish
were randomly chosen from five sacrificed fish per tank
and then dissected for liver and muscle tissues for mo-
lecular experiments. All the dissected samples were
frozen immediately in liquid nitrogen and then stored
at − 80 °C for RNA isolation and protein extraction.

RNA extraction and reverse transcription
Before RNA extraction, the liver and muscle tissues
were taken out from the –80 °C fridge and unfrozen
on the ice. The RNA extraction and reverse transcription
were performed according to the methods described
previously (Wang et al. 2018).
Real-time quantitative PCR analysis
The quantification analysis of genes were performed by
the real-time qPCR method by following the protocols
described previously (Wang et al. 2018). The gene-
specific primers were exhibited in Table 1, and all the
sequences were obtained from our previous tran-
scriptome sequencing of Chinese perch (He et al.
2013). A set of six housekeeping genes (β-actin,
RPL13A, B2M, YWHA2, HMBS, and SDHA) were pick-
ed out based on the published article (Vandesompele
et al. 2002) in order to test their transcriptional stability.
Gene expression levels were quantified relative to the
expression of RPL13A using the optimized comparative
Ct (2–ΔΔCt) value method (Livak and Schmittgen 2001).
All data are presented with mean ± SEM (n = 6).
Enzyme activity assay
The GDH and AMPD enzyme activities were detected
according to the manufacturer’s instructions (A125–1-1
& A048–1-1; Nanjing Jiancheng Bioengineering Insti-
tute, China). The liver and muscle extracts were obtain-
ed by homogenization of frozen tissues in 10 vol of
extracting buffer on ice. After centrifugation (8000×g)
at 4 °C for 10 min, supernatants were transferred to
another new EP tube for determination. The glutamate
dehydrogenase (GDH) catalyzes the oxidation of NH4+,
a-ketoglutarate, and NADH to glutamate and NAD+,
Table 1 Primer sequences for the quantitative real-time PCR
Primers Sequence 5′-3′
RT-SC-GDH-F GACGACGACCCCAACTTCT
RT-SC-GDH-R GACCCGCTTCCTCTTCTGC
RT-SC-AMPD-F CATTTTCCTTCCCGTGTT
RT-SC-AMPD-R TCTGTCTGCGGAGTTGGT
RT-SC-RPL13A-F CACCCTATGACAAGAGGAAGC
RT-SC-RPL13A-F TGTGCCAGACGCCCAAG
Fish Physiol Biochem
which causes a decrease of absorbance at 340 nm. The
activity of GDH was calculated by measuring the rate of
decrease in absorbance at 37 °C. One unit of enzyme
activity of GDH was defined as 1-mg tissue protein that
catalyzed the hydrolysis of 1-nmol NADH per min
under 37 °C.Adenosine monophosphate deaminase
(AMPD) catalyzes the hydrolysis of adenosine nucleo-
sides to produce hypoxanthine nucleosides and ammo-
nia, and then ammonia can react with the color reagent
in the kit. The absorbance value of the chromogenic
reaction was determined at 640 nm at 37 °C. The en-
zyme activity of AMPD was calculated by a formula
that 1-mg tissue protein reacted with substrate for
60 min to produce 1 μg of ammonia at 37 °C. The
protein concentration of tissues were determined with
a BCA protein assay kit (P0010; Beyotime, PR China),
and bovine serum albumin was used as a standard.
Protein extraction and Western blot analysis
Frozen liver tissues were homogenized on ice with a
homogenizer in RIPA lysate (20 mmol/L Tris, pH 7.4,
140 mmol/L NaCl, 1% Triton X-100, 1% sodium
deoxycholate, 0.1% SDS, 1 mmol/L PMSF), which
was purchased from Beyotime (P0013B; Wuhan, Chi-
na). Homogenates were centrifuged for 20 mins at
10,000 g, and then the supernatants were collected and
stored at − 80 °C. The protein concentration was deter-
mined using the Beyotime protein assay kit (Catalog no.
P0010). Tissue lysates (20 μg of protein) were separated
on SDS-PAGE (Bio-Rad, USA) and transferred to
PVDF membranes (Catalog no. 88585; Thermo Pierce,
Shanghai, China) and then blocked for 4 h with 5%
evaporated milk. The primary antibody included in the
rabbit anti-Actin (Catalog no. 4970S) and phosphor-S6
ribosomal protein (Ser 235/236) (Catalog no. 4858S),
which were purchased from Cell Signaling Technology.
Tm (°C) Product size (bp) E-values (%)
57 126 94.3
58 242 103.6
59 100 102.9
Fish Physiol Biochem
The secondary antibody, IRDye 800CW goat anti-rabbit
(Catalog no. 926–32,211), was purchased from LICOR
(LI-COR Biosciences Corporate, Lincoln, NE). Bands
were visualized by infrared fluorescence and quantified
using the software in Odyssey imaging system (LI-COR
Biotechnology).
Statistical analysis
Statistical analyses were performed with SPSS 20.0
software. All values were presented with the mean ±
SEM. The error bars represented the standard error of
mean. The normality and homogeneity of variances of
all data were respectively assessed by Shapiro-Wilk’s
test and Levene’s test. The means of differences were
subjected to unpaired two-tailed Student’s t-tests. P
values less than 0.05 or even 0.01 indicate statistical
significance.
Results
Effects of ICV injection of valine on postprandial
ammonia-N excretion rates
To determine the effects of valine on postprandial
ammonia-N excretion rates, valine (20 μg) was admin-
istered into the third ventricle with using ICV injection.
The ammonia-N excretion rate of Val group decreased
markedly at 4-, 12-, and 24-h postinjection (p < 0.01). In
addition, the ammonia-N excretion rate at 0.5 h showed
no significant difference between Val group and control
group in Fig. 1.
Fig. 1 The ammonia-N excretion rates of Chinese perch at 0.5, 4,
12, and 24 h after ICV injection of valine. Data are means ± SEM
(n = 3). Mean values in Val group were significantly different from
those in control group: ** p < 0.01, which was tested by unpaired
two-tailed Student’s t-tests
Effects of ICV injection of valine on plasma glucose
As shown in Fig. 2, the plasma glucose exhibited ex-
tremely obvious variation between the Val group and
control group at four time point. The plasma glucose in
Val group was significantly higher than control group at
0.5-, 4-, and 12 h (p < 0.01) as well as at 24-h postin-
jection (p < 0.05).
Effects of ICV injection of valine on genes expression
As presented in Fig. 3, both genes expression of GDH
and AMPD were comparable between the Val group and
control group at 0.5 h after injection, otherwise, at 4- and
24-h postinjection, both the GDH and AMPD were
down-regulated significantly in Val group (p < 0.05).
Indeed, the AMPD mRNA level decreased markedly at
12-h postinjection in Val group (p < 0.05); on the other
hand, the mRNA level of GDH showed no significant
difference between Val group and control group.
Effects of ICV injection of valine on enzyme activity
To investigate the role of infected valine on the protein
degradation, we further checked the enzyme activities of
GDH and AMPD in the liver and muscle, respectively.
As presented in Fig. 4, we found that the enzymatic
activities of GDH and AMPD were almost consistent
with the mRNA level of them. The GDH and AMPD
attenuated markedly in Val group at 4, 12, and 24 h
(p < 0.05) but not at 0.5-h postinjection.
Fig. 2 The postprandial plasma glucose of Chinese perch at 0.5,
4, 12, and 24 h after ICV injection of valine. Data are means ±
SEM (n = 9). Mean values in Val group were significantly differ-
ent from those in control group: * p < 0.05, ** p < 0.01, which was
tested by unpaired two-tailed Student’s t-tests

Fig. 3 The gene expression of Chinese perch at 0.5, 4, 12, and
24 h after ICV injection of valine. (A) The relative mRNA level of
GDH in the liver. (B) The relative mRNA level of AMPD in
Effects of ICV injection of valine on signaling pathway
To further verify whether the TORC1 signaling pathway
participated in the protein metabolism mediated by
injected valine in the brain, we checked the phosphory-
lation level of a downstream effector protein, the
phosphor-S6 ribosomal protein (Ser 235/236) in the
liver. It was approved that the phosphor-S6 was signif-
icantly higher in Val group than in control group at 4,
12, and 24 h after injection (p < 0.01). However, at 0.5-h
postinjection, no significant difference was observed
between Val group and control group in the Fig. 5.
Discussion
ICV injection of valine (20 μg) can suppress postpran-
dial ammonia-N excretion significantly and promote the
level of plasma glucose obviously within 24 h in
Fig. 4 The enzyme activities of Chinese perch at 0.5, 4, 12, and
24 h after ICV injection of valine. (A) The enzymatic activity of
GDH in the liver. (B) The enzymatic activity of AMPD in muscle.
Fish Physiol Biochem
muscle. Data are means ± SEM (n = 6). Mean values in Val group
were significantly different from those in control group: * p < 0.05,
which was tested by unpaired two-tailed Student’s t-tests
Chinese perch. In general, the postprandial ammonia-
N excretion is usually associated with dietary protein
intake and water temperature (Leung et al. 1999; Yang
et al. 2002; Zheng et al. 2008). But in this study, a
hypothesis was emerged that ammonia-N excretion
could dramatically depend on valine-stimulated protein
metabolism. Given that the end nitrogenous metabolite
excreted by fish mainly was ammonia, which accounts
for more than 80% of total nitrogen excretion (Brett and
Zala 1975a; Fang et al. 2017), the measurement of
ammonia-N excretion rate is an important indicator to
evaluate the catabolic efficiency of protein in teleost fish
(Fang et al. 2017). The less protein was catabolized
which meant that more nitrogenous metabolite was used
for the body growth but not only for energy source in
fish (Yigit et al. 2002). Previous studies have reported
that the optimum level of dietary valine could benefit for
protein synthesis and growth performance in Indian
major carp (Cirrhinus mrigala) (Ahmed and Khan
Data are means ± SEM (n = 4). Mean values in Val group were
significantly different from those in control group: * p < 0.05,
which was tested by unpaired two-tailed Student’s t-tests
Fish Physiol Biochem
Fig. 5 Western blot analysis of
S6 protein phosphorylation in
Chinese perch at 0.5, 4, 12, and
24 h after ICV injection of valine.
Data are means ± SEM (n = 6).
Mean values in Val group were
significantly different from those
in control group: ** p < 0.01,
which was tested by unpaired
two-tailed Student’s t-tests
2006), the significantly lower postprandial ammonia
excretion was affirmed in red sea bream (Pagrus major)
when fed with dietary valine levels of 1.69 and 2.04%
compared to those fish offered 0.27% valine
(Rahimnejad and Lee 2013). These above research have
implied that the valine, when ingested as a supplement,
could play a critical role in enhancing protein synthesis
and suppressing protein degradation (Freund et al. 1981;
Holecek 2002; Shimomura et al. 2006). However, it was
noticed that the ammonia-N excretion rate was compa-
rable between Val group and control group only at 0.5-h
postinjection. It suggested that ICV injection of valine
could act on the metabolic process in peripheral organs
in a time-dependent manner, which was coincident with
previous studies in rodents (Blouet et al. 2009; Cota
et al. 2006). On the other hand, the higher concentration
of plasma glucose was observed in Val group, and
postinjection indicated that the extra injected valine
can play a role of substrate for gluconeogenesis (Shao
et al. 2018) especially when all the fish accepted enough
food. Fernstrom has reported that when the concentra-
tion of plasma glucose rises sharply, which can occur in
response to food ingestion or BCAA administration, or
with the onset of certain metabolic diseases (e.g., un-
controlled diabetes), brain BCAA concentrations rise,
and ArAA concentrations decline (Fernstrom 2005).
More studies have also shown that once the high con-
centration of valine got into circulatory system, it could
induce insulin resistance and then lead to hyperglycemia
(Lynch and Adams 2014; McCormack et al. 2013;
Newgard et al. 2009). This can further explain that the
injected valine not only acts as a nutritional signal to
stimulate the hypothalamus region where it regulates the
downstream protein metabolism, but also it acts on the
insulin directly in the blood circulation system in order
to raise the plasma glucose.
In fish, ammonia-N excretion is closely associated
with the deamination of amino acids in the both major
metabolic organs, the liver and muscle (Cowey 1995).
Glutamate dehydrogenase (GDH) plays a critical role in
glutamine deamination in the liver, and it converts glu-
tamate to alpha-ketoglutarate (αKG) and ammonia that
has been approved to fulfill vital functions on ammonia
excretion or ammoniogenesis in rainbow trout (Onco-
rhynchus mykiss) (Fournier et al. 2003), turbot (Psetta
maxima) (Peres and Oliva-Teles 2008), and grass carp
(Liu et al. 2012). Adenosine monophosphate deaminase
(AMPD) catalyzes the deamination of adenosine
monophosphate (AMP) to inosine monophosphate
(IMP) and ammonia (Morisaki et al. 1992) through the
purine nucleotide cycle (Vandenberghe et al. 1992), and
it is accountable for the production of most ammonia in
vertebrate skeletal muscle (Lushchak et al. 2009), espe-
cially in fish muscle (Walton and Cowey 1977). To
further explore the molecular mechanism and how the
injected valine in brain can mediate protein catabolism
in peripheral organs, we checked both the mRNA level
and enzymatic activities of GDH in the liver and AMPD
in muscle. We found that both the gene expression and
the enzyme activities showed no significance between
Control and Val group at 0.5-h postinjection, which was
coincident with the ammonia-N excretion rate in a time-
dependent manner. But at 4, 12, and 24 h after injection,
both the gene and enzyme level of AMPD descended

significantly in Val group. Notably, the gene expression
of GDH declined only at 4 and 24 h but not 12 h, but its
enzymatic activity decreased obviously at 4, 12, and
24 h. This indicated that the injected valine could bind
and interdict GDH directly to attenuate deamination of
glutamate but not act on the transcription factor of GDH,
and similar reports have been illustrated that leucine
could bind the GDH and affect its enzyme activity
directly (Duran et al. 2012; Frigerio et al. 2008; Li
et al. 2012). On the basis of above results we deduced
that the injected valine can attenuate postprandial
ammonia-N excretion by downregulating the gene level
and enzymatic activities of GDH and AMPD to depress
the protein breakdown.
To begin to explore the mechanism of signal trans-
duction of valine, we started looking for a middle regu-
lator element which not only was triggered by valine but
also acts on the downstream effector protein to partici-
pate in protein metabolism directly. There is a growing
evidence that ICV injection of BCAAs could effectively
activate TORC1 in rats (Blouet and Schwartz 2010;
Cota et al. 2006; Morrison et al. 2007) and neonatal
broilers (Everaert et al. 2010) and then trigger protein
synthesis as well as restrain protein breakdown (Dodd
and Tee 2012). Moreover, the relevant studies in teleost
fish have also proved that the activation of TORC1
could benefit for protein retention and growth perfor-
mance in turbot (Psetta maxima) (Wang et al. 2016a, b)
and rainbow trout (Oncorhynchus mykiss) (Belghit et al.
2014). To further to delineate whether the
encephalocoele sensing of valine could mediate protein
metabolism in peripheral organs via TORC1 pathway,
we checked the phosphorylation level of rpS6 in the
liver, a downstream target protein of TORC1, as well as
its effect in protein synthesis (Kimball and Jefferson
2002; Kimball et al. 1999). Our results illustrated that
the phosphorylation level of rpS6 increased markedly in
Val group at 4, 12, and 24 h after injection. This phe-
nomenon indicated that the injected valine in the brain,
which was regarded as a nutritional signal to stimulate
the hypothalamus region and then rearrange the periph-
eral energy metabolism through a brain-liver circuit
(Fernstrom 2005; Hutson and Harris 2001; Kimball
and Jefferson 2006; Yoshizawa 2004). More and more
studies have proved that the hypothalamus has been
developed as one of the main concentrations of
nutrient-sensing elements and also as a major center of
convergence and integration of multiple nutrient-related
signals (Blouet and Schwartz 2010; Lazutkaite et al.
Fish Physiol Biochem
2017; Morrison et al. 2007; O'Hare and Zsombok
2016; Pocai et al. 2005). Since a dose of valine has
administrated into the third ventricle hypothalamus, it
could act as a nutritional signal (Hutson and Harris
2001), which triggered the downstream signal transduc-
tion to activate the TORC1 in the liver through a brain-
liver circuit and then restrain protein catabolism (Choi
et al. 2001). Other similar studies have confirmed that
the sensor of energy sources in the hypothalamus could
regulate the glucose homeostasis in the liver through the
brain-liver circuit (Pocai et al. 2005; Su et al. 2012;
Wang et al. 2008).
In conclusion, ICV injection of valine can obviously
suppress postprandial ammonia-N excretion and pro-
mote plasma glucose within 24 h in Chinese perch.
The injected valine acts as a nutritional signal to stimu-
late the hypothalamus and then rearrange the protein
metabolism in the liver and muscle by the inhibition of
GDH and AMPD transcriptional level and the enzyme
activities; meanwhile, the circulating valine interacts
with insulin directly and induces insulin resistance to
raise plasma glucose. On the other hand, the hypotha-
lamic sensing of valine could activate the downstream
TORC1 signaling pathway effectively in the liver via a
brain-liver circuit, which would further depress the pro-
tein degradation and enhance protein retention in Chi-
nese perch. In this study, the potential circuit between
the brain and peripheral organs has been elucidated,
illuminating a new trace for further studies on the mech-
anisms on how the nutritional signal in the brain can
mediate peripheral metabolic process in teleost fish.
Authors’ contributions Conceived and designed the experi-
ments: JW, XFL, SH, and JL.
Carried out the experiments: JW, KH, YPZ, LJS, and PR.
Analyzed all the data: JW, KH, YPZ, LJS, and PR.
Wrote and revised the manuscript: JW.
All authors read and approved the final manuscript.
Funding information This work was financially supported by
the China Agriculture Research System (CARS-46), National Key
R&D Program of China (2018YFD0900400) and Da Bei Nong
Group Promoted Project for Young Scholar of HZAU (No.
2017DBN014).
Compliance with ethical standards
Conflict of interest The authors declare that they have no
comflict of interest.
Fish Physiol Biochem
Abbreviations BCAAs, Branched-chain amino acids; TORC1,
Target of rapamycin complex 1; ICV, Intraventricular; GDH, Glu-
tamate dehydrogenase; AMPD, Adenosine monophosphate deam-
inase; rpS6, Ribosomal protein S6; CNS, Central nervous system;
Leu, Leucine; Val, Valine; Ile, Isoleucine; PBS, Phosphate buffer
solution; αKG, Alpha-ketoglutarate; AMP, Adenosine
monophosphate; IMP, Inosine monophosphate
References
Ahmed I, Khan MA (2006) Dietary branched-chain amino acid
valine, isoleucine and leucine requirements of fingerling
Indian major carp, Cirrhinus mrigala (Hamilton). Br J Nutr
96:450–460
Anthony JC, Yoshizawa F, Anthony TG, Vary TC, Jefferson LS,
Kimball SR (2000) Leucine stimulates translation initiation
in skeletal muscle of postabsorptive rats via a rapamycin-
sensitive pathway. J Nutr 130:2413–2419
Appuhamy JA, Knoebel NA, Nayananjalie WA, Escobar J,
Hanigan MD (2012) Isoleucine and leucine independently
regulate mTOR signaling and protein synthesis in MAC-T
cells and bovine mammary tissue slices. J Nutr 142:484–491
Ballestrazzi R, Lanari D, Dagaro E, Mion A (1994) The effect of
dietary-protein level and source on growth, body-composi-
tion, total ammonia and reactive phosphate excretion of
growing sea bass (Dicentrarchus-Labrax). Aquaculture
127:197–206
Belghit I, Skiba-Cassy S, Geurden I, Dias K, Surget A, Kaushik S,
Panserat S, Seiliez I (2014) Dietary methionine availability
affects the main factors involved in muscle protein turnover
in rainbow trout (Oncorhynchus mykiss). Br J Nutr 112:493–
503
Blouet C, Schwartz GJ (2010) Hypothalamic nutrient sensing in
the control of energy homeostasis. Behav Brain Res 209:1–
12
Blouet C, Jo YH, Li X, Schwartz GJ (2009) Mediobasal hypotha-
lamic leucine sensing regulates food intake through activa-
tion of a hypothalamus-brainstem circuit. J Neurosci 29:
8302–8311
Brett JR, Zala CA (1975a) Daily pattern of nitrogen excretion and
oxygen-consumption of sockeye salmon (Oncorhynchus-
Nerka) under controlled conditions. J Fish Res Board Can
32:2479–2486
Brett JR, Zala CA (1975b) Daily pattern of nitrogen excretion and
oxygen consumption of sockeye Salmon (Oncorhynchus
nerka) under controlled conditions. J Fish Res Board Can
32:2479–2486
Cai YJ, Summerfelt RC (1992) Effects of temperature and size on
oxygen-consumption and ammonia excretion by walleye.
Aquaculture 104:127–138
Chen L-q, Hu Y (2011) Influencing factors on determination of
ammonia nitrogen in water by nessler's reagent spectropho-
tometry. 1173–1176
Choi YH, Fletcher PJ, Anderson GH (2001) Extracellular amino
acid profiles in the paraventricular nucleus of the rat hypo-
thalamus are influenced by diet composition. Brain Res 892:
320–328
Cota D, Proulx K, Smith KA, Kozma SC, Thomas G, Woods SC,
Seeley RJ (2006) Hypothalamic mTOR signaling regulates
food intake. Science 312:927–930
Cowey CB (1995) Intermediary metabolism in fish with reference
to output of end-products of nitrogen and phosphorus. Water
Sci Technol 31:21–28
De Pedro N, Pinillos ML, Valenciano AI, Alonso-Bedate M,
Delgado MJ (1998) Inhibitory effect of serotonin on feeding
behavior in goldfish: involvement of CRF. Peptides 19:505–
511
Dodd KM, Tee AR (2012) Leucine and mTORC1: a complex
relationship. Am J Physiol Endocrinol Metab 302:E1329–
E1342
Duran RV, Oppliger W, Robitaille AM, Heiserich L, Skendaj R,
Gottlieb E, Hall MN (2012) Glutaminolysis activates rag-
mTORC1 signaling. Mol Cell 47:349–358
Everaert N, Swennen Q, Coustard SM, Willemsen H, Careghi C,
Buyse J, Bruggeman V, Decuypere E, Tesseraud S (2010)
The effect of the protein level in a pre-starter diet on the post-
hatch performance and activation of ribosomal protein S6
kinase in muscle of neonatal broilers. Br J Nutr 103:206–211
Fang L, Bai X-L, Liang X-F, He S, Guo X-Z, Li L, Li B, Shen D,
Tao Y-X (2017) Ammonia nitrogen excretion in mandarin
fish (Siniperca chuatsi) and grass carp (Ctenopharyngodon
idellus) fed practical diets: the effects of water temperature.
Aquac Res 48:836–843
Fernstrom JD (2005) Branched-chain amino acids and brain func-
tion. J Nutr 135:1539S–1546S
Forsberg JA, Summerfelt RC (1992) Effect of temperature on diel
ammonia excretion of fingerling walleye. Aquaculture 102:
115–126
Fournier V, Gouillou-Coustans MF, Métailler R, Vachot C,
Moriceau J, Le Delliou H, Huelvan C, Desbruyeres E,
Kaushik SJ (2003) Excess dietary arginine affects urea ex-
cretion but does not improve N utilisation in rainbow trout
Oncorhynchus mykiss and turbot Psetta maxima.
Aquaculture 217:559–576
Freund HR, James JH, Fischer JE (1981) Nitrogen-sparing mech-
anisms of singly administered branched-chain amino acids in
the injured rat. Surgery 90:237–243
Frigerio F, Casimir M, Carobbio S, Maechler P (2008) Tissue
specificity of mitochondrial glutamate pathways and the con-
trol of metabolic homeostasis. Biochim Biophys Acta 1777:
965–972
Gowen RJ (1994) Managing eutrophication associated with aqua-
culture development. J Appl Ichthyol 10:242–257
Guroy D, Sahin I, Guroy B, Altin A, Merrifield DL (2012) Effect
of dietary protein level on growth performance and nitrogen
excretion of the yellow tail cichlid, Pseudotropheus acei. Isr J
Aquacult-Bamid 64
He S, Liang XF, Sun J, Li L, Yu Y, Huang W, Qu CM, Cao L, Bai
XL, Tao YX (2013) Insights into food preference in hybrid
F1 of Siniperca chuatsi (female symbol) x Siniperca
scherzeri (male symbol) mandarin fish through transcriptome
analysis. BMC Genomics 14:601
Holecek M (2002) Relation between glutamine, branched-chain
amino acids, and protein metabolism. Nutrition 18:130–133
Hutson SM, Harris RA (2001) Introduction. Symposium: leucine
as a nutritional signal. J Nutr 131:839S–840S
Izumi T, Kawamura K, Ueda H, Bungo T (2004) Central admin-
istration of leucine, but not isoleucine and valine, stimulates

feeding behavior in neonatal chicks. Neurosci Lett 354:166–
168
Kimball SR, Jefferson LS (2002) Control of protein synthesis by
amino acid availability. Curr Opin Clin Nutr 5:63–67
Kimball SR, Jefferson LS (2006) Signaling pathways and molec-
ular mechanisms through which branched-chain amino acids
mediate translational control of protein synthesis. J Nutr 136:
227S–231S
Kimball SR, Shantz LM, Horetsky RL, Jefferson LS (1999)
Leucine regulates translation of specific mRNAs in L6 myo-
blasts through mTOR-mediated changes in availability of
eIF4E and phosphorylation of ribosomal protein S6. J Biol
Chem 274:11647–11652
Kutty MN (1978) Ammonia quotient in sockeye salmon
(Oncorhynchus-Nerka). J Fish Res Board Can 35:1003–1005
Lang CH, Frost RA, Bronson SK, Lynch CJ, Vary TC (2010)
Skeletal muscle protein balance in mTOR heterozygous mice
in response to inflammation and leucine. Am J Physiol
Endocrinol Metab 298:E1283–E1294
Lazutkaite G, Solda A, Lossow K, Meyerhof W, Dale N (2017)
Amino acid sensing in hypothalamic tanycytes via umami
taste receptors. Mol Metab 6:1480–1492
Leung KMY, Chu JCW, Wu RSS (1999) Interacting effects of
water temperature and dietary protein levels on post-prandial
ammonia excretion by the areolated grouper Epinephelus
areolatus (Forskal). Aquac Res 30:793–798
Li M, Li C, Allen A, Stanley CA, Smith TJ (2012) The structure
and allosteric regulation of mammalian glutamate dehydro-
genase. Arch Biochem Biophys 519:69–80
Liang XF, Oku H, Ogata HY, Liu J, He X (2001) Weaning
Chinese perch Siniperca chuatsi (Basilewsky) onto artificial
diets based upon its specific sensory modality in feeding.
Aquac Res 32:76–82
Liu Z, Zhou Y, Liu S, Zhong H, Zhang C, Kang X, Liu Y (2012)
Characterization and dietary regulation of glutamate dehy-
drogenase in different ploidy fishes. Amino Acids 43:2339–
2348
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expres-
sion data using real-time quantitative PCR and the 2(−Delta
Delta C(T)) method. Methods 25:402–408
Lushchak VI, Husak VV, Storey JM, Storey KB (2009) AMP-
deaminase from goldfish white muscle: regulatory properties
and redistribution under exposure to high environmental
oxygen level. Fish Physiol Biochem 35:443–452
Lynch CJ, Adams SH (2014) Branched-chain amino acids in
metabolic signalling and insulin resistance. Nat Rev
Endocrinol 10:723–736
McCormack SE, Shaham O, McCarthy MA, Deik AA, Wang TJ,
Gerszten RE, Clish CB, Mootha VK, Grinspoon SK,
Fleischman A (2013) Circulating branched-chain amino acid
concentrations are associated with obesity and future insulin
resistance in children and adolescents. Pediatr Obes 8:52–61
Meijer AJ, Dubbelhuis PF (2004) Amino acid signalling and the
integration of metabolism. Biochem Biophys Res Commun
313:397–403
Morisaki T, Gross M, Morisaki H, Pongratz D, Zollner N, Holmes
EW (1992) Molecular basis of AMP deaminase deficiency in
skeletal muscle. Proc Natl Acad Sci U S A 89:6457–6461
Morrison CD, Xi X, White CL, Ye J, Martin RJ (2007) Amino
acids inhibit Agrp gene expression via an mTOR-dependent
Fish Physiol Biochem
mechanism. Am J Physiol Endocrinol Metab 293:E165–
E171
Newgard CB, An J, Bain JR, Muehlbauer MJ, Stevens RD, Lien
LF, Haqq AM, Shah SH, Arlotto M, Slentz CA, Rochon J,
Gallup D, Ilkayeva O, Wenner BR, Yancy WS Jr, Eisenson
H, Musante G, Surwit RS, Millington DS, Butler MD,
Svetkey LP (2009) A branched-chain amino acid-related
metabolic signature that differentiates obese and lean humans
and contributes to insulin resistance. Cell Metab 9:311–326
O'Hare JD, Zsombok A (2016) Brain-liver connections: role of the
preautonomic PVN neurons. Am J Physiol Endocrinol Metab
310:E183–E189
Ortega VA, Lovejoy DA, Bernier NJ (2013) Appetite-suppressing
effects and interactions of centrally administered
corticotropin-releasing factor, urotensin I and serotonin in
rainbow trout (Oncorhynchus mykiss). Front Neurosci 7:196
Paulson LJ (1980) Models of ammonia excretion for brook trout
(Salvelinus fontinalis) and rainbow trout (Salmo gairdneri).
Can J Fish Aquat Sci 37:1421–1425
Peres H, Oliva-Teles A (2007) Effect of the dietary essential amino
acid pattern on growth, feed utilization and nitrogen metab-
olism of European sea bass (Dicentrarchus labrax).
Aquaculture 267:119–128
Peres H, Oliva-Teles A (2008) Lysine requirement and efficiency
of lysine utilization in turbot (Scophthalmus maximus) juve-
niles. Aquaculture 275:283–290
Pocai A, Obici S, Schwartz GJ, Rossetti L (2005) A brain-liver
circuit regulates glucose homeostasis. Cell Metab 1:53–61
Rahimnejad S, Lee KJ (2013) Dietary valine requirement of
juvenile red sea bream Pagrus major. Aquaculture 416:
212–218
Sánchez MS, Barontini M, Armando I, Celis ME (2001)
Correlation of increased grooming behavior and motor activ-
ity with alterations in nigrostriatal and mesolimbic catechol-
amines after α-melanotropin and neuropeptide glutamine–
isoleucine injection in the rat ventral tegmental area. Cell Mol
Neurobiol 21:523–533
Shao D, Villet O, Zhang Z, Choi SW, Yan J, Ritterhoff J, Gu H,
Djukovic D, Christodoulou D, Kolwicz SC Jr et al (2018)
Glucose promotes cell growth by suppressing branched-
chain amino acid degradation. Nat Commun 9:2935
Shimomura Y, Yamamoto Y, Bajotto G, Sato J, Murakami T,
Shimomura N, Kobayashi H, Mawatari K (2006)
Nutraceutical effects of branched-chain amino acids on skel-
etal muscle. J Nutr 136:529S–532S
Smith QR (2000) Transport of glutamate and other amino acids at
the blood-brain barrier. J Nutr 130:1016S–1022S
Strebkova TP, Shabalina VN (1984) Farming of Chinese perch[J].
Mar Fish Cult:41–52
Su Y, Lam TK, He W, Pocai A, Bryan J, Aguilar-Bryan L,
Gutierrez-Juarez R (2012) Hypothalamic leucine metabolism
regulates liver glucose production. Diabetes 61:85–93
Swaab DF, Hofman MA, Lucassen PJ, Purba JS, Raadsheer FC,
Van de Nes JA (1993) Functional neuroanatomy and neuro-
pathology of the human hypothalamus. Anat Embryol (Berl)
187:317–330
Vandenberghe G, Bontemps F, Vincent MF, Vandenbergh F
(1992) The purine nucleotide cycle and its molecular defects.
Prog Neurobiol 39:547–561
Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De
Paepe A, Speleman F (2002) Accurate normalization of real-
Fish Physiol Biochem
time quantitative RT-PCR data by geometric averaging of
multiple internal control genes. Genome Biol 3:
RESEARCH0034
Vary TC, Lynch CJ (2007) Nutrient signaling components con-
trolling protein synthesis in striated muscle. J Nutr 137:1835–
1843
Walton MJ, Cowey CB (1977) Aspects of Ammoniogenesis in
rainbow-trout, Salmo-Gairdneri. Comp Biochem Physiol B
57:143–149
Wang X, Proud CG (2006) The mTOR pathway in the control of
protein synthesis. Physiology (Bethesda) 21:362–369
Wang PY, Caspi L, Lam CK, Chari M, Li X, Light PE, Gutierrez-
Juarez R, Ang M, Schwartz GJ, Lam TK (2008) Upper
intestinal lipids trigger a gut-brain-liver axis to regulate glu-
cose production. Nature 452:1012–1016
Wang Q, He G, Mai K, Xu W, Zhou H (2016a) Fishmeal replace-
ment by mixed plant proteins and maggot meal on growth
performance, target of rapamycin signalling and metabolism
in juvenile turbot (Scophthalmus maximus L.). Aquac Nutr
22:752–758
Wang Q, He G, Mai K, Xu W, Zhou H, Wang X, Mei L (2016b)
Chronic rapamycin treatment on the nutrient utilization and
metabolism of juvenile turbot (Psetta maxima). Sci Rep 6:
28068
Wang J, Liang XF, He S, Li J, Huang K, Zhang YP, Huang D
(2018) Lipid deposition pattern and adaptive strategy in
response to dietary fat in Chinese perch (Siniperca chuatsi).
Nutr Metab (Lond) 15:77
View publication stats
Wu RSS (1995) The environmental impact of marine fish culture:
towards a sustainable future. Mar Pollut Bull 31:159–166
Yang SD, Liou CH, Liu FG (2002) Effects of dietary protein level
on growth performance, carcass composition and ammonia
excretion in juvenile silver perch (Bidyanus bidyanus).
Aquaculture 213:363–372
Yigit M, Yardim O, Koshio S (2002) The protein sparing effects of
high lipid levels in diets for rainbow trout (Oncorhynchus
mykiss, W. 1792) with special reference to reduction of total
nitrogen excretion. Isr J Aquacult-Bamid 54:79–88
Yigit M, Koshio S, Aral O, Karaali B, Karayucel S (2003)
Ammonia nitrogen excretion rate - An index for evaluating
protein quality of three feed fishes for the black sea turbot. Isr
J Aquacult-Bamid 55:69–76
Yoshizawa F (2004) Regulation of protein synthesis by branched-
chain amino acids in vivo. Biochem Biophys Res Commun
313:417–422
Zheng ZM, Jin CH, Li MY, Bai PF, Dong SL (2008) Effects of
temperature and salinity on oxygen consumption and ammo-
nia excretion of juvenile miiuy croaker, Miichthys miiuy
(Basilewsky). Aquac Int 16:581–589
Publisher’s note Springer Nature remains neutral with regard to
jurisdictional claims in published maps and institutional
affiliations.