Article

Fasting-Refeeding Impacts Immune Cell Dynamics

and Mucosal Immune Responses
Graphical Abstract Authors
Motoyoshi Nagai, Ryotaro Noguchi,
Daisuke Takahashi, ..., Keiyo Takubo,
Taeko Dohi, Koji Hase

Correspondence
hase-kj@pha.keio.ac.jp

In Brief
Temporary fasting drastically reduces the
levels of B cells in Peyer’s patches, with
germinal center B cells undergoing
apoptosis and naive cells migrating to the
bone marrow and only egressing upon
refeeding.

Highlights
d Fasting drastically reduces lymphocyte levels in Payer’s
patches

d Naive B cells migrate to bone marrow during fasting and then

back upon refeeding

d Nutritional signals are essential to maintain CXCL13

expression by stromal cells

d Fasting causes GC B cell death and attenuates antigen-

specific IgA response

Nagai et al., 2019, Cell 178, 1072–1087

August 22, 2019 ª 2019 Elsevier Inc.
https://doi.org/10.1016/j.cell.2019.07.047
 Article

Fasting-Refeeding Impacts Immune Cell Dynamics

and Mucosal Immune Responses
Motoyoshi Nagai,1,2 Ryotaro Noguchi,1,2 Daisuke Takahashi,1 Takayuki Morikawa,3 Kouhei Koshida,1 Seiga Komiyama,1
Narumi Ishihara,1 Takahiro Yamada,1 Yuki I. Kawamura,2 Kisara Muroi,1 Kouya Hattori,1 Nobuhide Kobayashi,1
Yumiko Fujimura,1 Masato Hirota,1 Ryohtaroh Matsumoto,1 Ryo Aoki,4,5 Miwa Tamura-Nakano,6 Machiko Sugiyama,2,7
Tomoya Katakai,8 Shintaro Sato,9,10 Keiyo Takubo,3 Taeko Dohi,1,2 and Koji Hase1,10,11,*
1Division of Biochemistry, Faculty of Pharmacy and Graduate School of Pharmaceutical Science, Keio University, Tokyo 105-8512, Japan
2Department of Gastroenterology, Research Center for Hepatitis and Immunology, Research Institute, National Center for Global Health and
Medicine, Chiba 272-8516, Japan
3Department of Stem Cell Biology, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan
4Division of Gastroenterology and Hepatology, Department of Internal Medicine, Keio University School of Medicine, Tokyo 160-8582, Japan
5Institute of Health Sciences, Ezaki Glico Co., Ltd., Osaka 555-8502, Japan
6Communal Laboratory, Research Institute, National Center for Global Health and Medicine, Tokyo 162-8655, Japan
7Laboratory for Immunobiology, Graduate School of Medical Life Science, Yokohama City University, Kanagawa 230-045, Japan
8Department of Immunology, Graduate School of Medical and Dental Sciences, Niigata University, Niigata 951-8510, Japan
9Mucosal Vaccine Project, BIKEN Innovative Vaccine Research Alliance Laboratories, Research Institute for Microbial Diseases, Osaka

University, Osaka 565-0871, Japan

10International Research and Development Center for Mucosal Vaccines, the Institute of Medical Science, the University of Tokyo (IMSUT),

Tokyo 108-8639, Japan

11Lead Contact

*Correspondence: hase-kj@pha.keio.ac.jp
https://doi.org/10.1016/j.cell.2019.07.047

SUMMARY SanGiovanni, 1997). Furthermore, childhood malnutrition is a

Nutritional status potentially influences immune re-
sponses; however, how nutritional signals regulate
cellular dynamics and functionality remains obscure.
Herein, we report that temporary fasting drastically
reduces the number of lymphocytes by
50% in
Peyer’s patches (PPs), the inductive site of the gut
immune response. Subsequent refeeding seemingly
restored the number of lymphocytes, but whose
cellular composition was conspicuously altered. A
large portion of germinal center and IgA+ B cells
were lost via apoptosis during fasting. Meanwhile,
naive B cells migrated from PPs to the bone marrow
during fasting and then back to PPs during refeeding
when stromal cells sensed nutritional signals and
upregulated CXCL13 expression to recruit naive
B cells. Furthermore, temporal fasting before oral
immunization with ovalbumin abolished the induc-
tion of antigen-specific IgA, failed to induce oral
tolerance, and eventually exacerbated food anti-
gen-induced diarrhea. Thus, nutritional signals are
critical in maintaining gut immune homeostasis.
INTRODUCTION
Inappropriate calorie intake is a global health problem. In devel-
oping countries, the nutritional deficiency often compromises
vaccination efficacy and increases the risk of infectious dis-
eases (Kaufman et al., 2011; Savy et al., 2009; Scrimshaw and
predisposing factor for environmental enteropathy characterized
by intestinal dysfunction, increased intestinal permeability, and
microbial dysbiosis (Brown et al., 2015; Humphrey, 2009). In
industrialized countries, on the other hand, excessive food intake
accompanied by a lack of exercise has augmented the incidence
of obesity (World Health Organization, 2016), which is a signifi-
cant risk factor for cardiovascular disease, metabolic syn-
dromes, and cancer (Basen-Engquist and Chang, 2011; Grundy,
2004; Poirier et al., 2006). Low-grade inflammation due to
obesity is significantly implicated in the development of these
diseases (Visscher and Seidell, 2001). These observations
indicate that nutritional status has a significant impact on the
immune system.
The gastrointestinal mucosa is directly exposed to exogenous
food ingredients and thus inevitably faces drastic changes in the
nutritional status of the lumen during food uptake and fasting.
We previously demonstrated that intestinal tissue is highly sus-
ceptible to deprivation of luminal nutrients, as temporal fasting
arrested epithelial cell proliferation while refeeding induced hy-
perproliferation in the intestinal epithelium (Okada et al., 2013).
Given that epithelial cell turnover constitutes a robust first-line
barrier to external antigens, mucosal barrier function may be
more vulnerable during fasting than during feeding. Considering
that fasting relieves the burden of food-borne antigens and
microorganisms on the gut mucosa, it is thus reasonable to
decelerate epithelial cell turnover temporarily to minimize energy
expenditure under nutrient deprivation.
The gut mucosal barrier consists of not only intestinal epithe-
lium but also an underlying immune system that establishes the
second-line barrier. The gut mucosal immune response is charac-
terized by the production of dimeric or polymeric immunoglobulin

1072 Cell 178, 1072–1087, August 22, 2019 ª 2019 Elsevier Inc.
 A

E
D

Figure 1. Characterization of PPs during Fasting and Refeeding

(A) Serial sections of PP were stained with H&E. PPs were obtained from mice fed ad libitum (left), fasted for 36 h (middle), or refed with CE2 for 48 h (right). Scale
bar, 200 mm.
(B) Immunostaining of PPs from mice fed ad libitum (left), mice fasted for 36 h (middle), and mice refed with CE2 for 48 h (right). Scale bar, 200 mm.

(legend continued on next page)

Cell 178, 1072–1087, August 22, 2019 1073

A (IgA) to the mucosal surface (Lycke and Bemark, 2017).
Secretory IgA (S-IgA) plays vital roles in host defense against
pathogens, inhibition of microbial metabolite penetration, and
regulation of the gut microbial community (Mantis et al., 2011;
Uchimura et al., 2018; Wei et al., 2011). To efficiently induce
S-IgA response, luminal antigens are actively taken to gut-associ-
ated lymphoid tissue, such as Peyer’s patches (PPs), that serve
as an inductive site of mucosal immunity. In PPs, germinal center
(GC) reactions, namely, class switch recombination to IgA as well
as affinity maturation, occur continuously with the aid of follicular
helper T (Tfh) cells. IgA class-switched B cells subsequently
egress PPs and then home to the intestinal lamina propria via
mesenteric lymph nodes (MLNs), the thoracic duct, and blood
circulation, during which IgA+ B cells terminally differentiate into
IgA-producing plasma cells.
Multiple lines of research have uncovered a link between im-
mune cell function and metabolic status (Kau et al., 2011; Man
and Kallies, 2015). For example, upon T cell receptor (TCR) stim-
ulation, effector T (Teff) cells enhance the uptake and utilization
of glucose to promote aerobic glycolysis. Activated Teff cells
also upregulate glutaminolysis. Such metabolic reprogramming
is essential for Teff cells to meet the energy demand of clonal
expansion and effector functions, such as the production of
inflammatory cytokines (Carr et al., 2010). Furthermore, IgA+
plasma cells in the intestine preferentially utilize glycolysis for en-
ergy metabolism, whereas naive B cells in PPs usually gain ATP
through aerobic metabolism in mitochondria (Kunisawa et al.,
2015). Stimulation with lipopolysaccharides (LPS) or B cell re-
ceptor (BCR) ligation upregulates glucose transporter 1 (Glut1)
expression in B cell activating factor (BAFF)-pretreated B cells,
which eventually undergo metabolic reprogramming to glycol-
ysis (Caro-Maldonado et al., 2014). Because B cell-specific
Glut1 depletion leads to decreased B cell number and antibody
production, glycolytic rewiring is critical for B cell activation.
Upregulation of Glut1 expression in activated B cells is primarily
mediated by activation of the phosphatidylinositol 3-kinase
(PI3K)-Akt pathway, which in turn enhances the mechanistic
target of rapamycin (mTOR) signaling. Excessive activation
of the PI3K-Akt-mTOR pathway increases the frequencies of
Tfh cells and GC B cells in PPs, while the opposite is true, as
disruption of mTORC1 or mTORC2 diminishes GC reactions
and production of S-IgA (Zeng et al., 2016). Given that mTOR
serves as a nutrient sensor, the whole-body nutritional status
in response to energy intake and starvation may considerably
affect the immune response. Indeed, fasting or fasting-mimic
diet exerts a protective effect on bacterial sepsis and colitis by
alleviating expression of proinflammatory cytokines (Okada
et al., 2017; Rangan et al., 2019), whereas glucose supplemen-
tation protects against influenza viral infection (Wang et al.,
2016). However, the impact of nutritional signals on mucosal bar-
riers, lymphocyte dynamics, and effector functions in the context
of fasting and feeding remains unknown. Furthermore, most an-
(C and D) PPs were stained with TUNEL (C) or for cleaved caspase-3, counterstained with hematoxylin (D). PPs were obtained from mice fed ad libitum (left),
fasted for 36 h (middle), or refed with CE2 for 48 h (right). Scale bar, 200 mm (upper panel), 50 mm (lower panel). In quantification of TUNEL assay, PPs were
obtained from the ad libitum (n = 7), fasting (n = 6), or refeeding group (n = 8).
(E) Sections of PPs were observed by TEM. Scale bar, 10 mm (upper left and lower), 2.0 mm (upper right).
Data represent the means ± SEM. ANOVA followed by Tukey’s test (C). *p < 0.05; **p < 0.01.
1074 Cell 178, 1072–1087, August 22, 2019
imal studies on calorie restriction and intermittent fasting have
employed older mice, which may not adequately reflect biolog-
ical responses during childhood and children susceptible to
nutritional deficiency.
In the present study, we analyzed the influence of fasting-
refeeding on cellular dynamics and functionality of the gut im-
mune system mainly in juvenile mice. We observed that PP lym-
phocytes, particularly naive B cells, exhibit dynamic movement to
the bone marrow (BM) during temporal fasting and then swiftly
migrate back to PP in response to food intake. A similar oscillation
of naive B cells based on the circadian rhythm was observed to a
lesser extent in ad libitum-fed mice. Stromal CXCL13 expression
for recruiting and retaining B cell subsets was regulated by meta-
bolic status depending on aerobic glycolysis. The frequency of
memory-like B cell subsets markedly decreased after fasting-
refeeding treatment, leading to attenuation of antigen-specific
IgA production and oral tolerance to a food antigen, which even-
tually increased susceptibility to antigen-induced diarrhea.
RESULTS
Fasting Has a Profound Effect on the Morphology of PPs
To explore the impact of nutrient deficiency on the gut immune
system, we maintained juvenile mice (around 6 weeks old) under
fasting conditions for 36 h. The numbers of total cells, B cells, and
T cells in PPs decreased by half after fasting compared with those
of ad libitum-fed mice (Figure S1A). Such a drastic change was
evident in PPs throughout the small intestine (Figure S1B). Immu-
nofluorescent analysis demonstrated that the size of PPs was
markedly reduced during fasting and was restored in response
to refeeding. Despite this macroscopic alteration, the underlying
microstructure composed of B cell follicles and T cell regions was
not disturbed during fasting and refeeding (Figures 1A and 1B).
To explore the cause of decrease in the number of lympho-
cytes in PPs of fasted mice, we analyzed apoptotic cells and
observed that fasting induced apoptosis in considerable number
of B cell follicles, which were rescued by refeeding (Figure 1C).
Apoptotic cells were mainly detected in the GC region as a
light-blue zone by hematoxylin counterstaining (Figure 1D).
Furthermore, transmission electron microscopy (TEM) showed
a higher frequency of apoptotic cells characterized by nuclear
chromatin condensation and fragmentation (Figure 1E, upper
right) as well as phagocytes engulfing apoptotic bodies in the
GC region during fasting (Figure 1E, lower right). Thus, a large
portion of GC B cells, which include proliferating B cells and
IgA class-switched B cells, were eliminated in PPs by cell death
followed by phagocytosis in fasted mice.
Naive B Cells Circulate between PPs and BM in
Response to Nutritional Status
Total cell number steeply declined with nutrient deprivation from
24 to 36 h and then gradually recovered by refeeding for an
 A 2.5 2.0 4
Total cells (x107)

2.0
1.5 *

B cells (x107)
3

T cells (x106)
** **
1.5 ** ** *
** ** **
1.0 ** 2
1.0
0.5 1
0.5

0.0 0.0 0
0 24 48 72 96 0 24 48 72 96 0 24 48 72 96 (h)

B 1.5 2.5 2.5

Naive B cells (x107)

IgA+ B cells (x106)

GC B cells (x106)
2.0 2.0
CD95+ GL7+

** *
IgM+ IgD+

1.0
** 1.5 1.5
** **
** **
1.0 ** 1.0 **
0.5 ** **
0.5 0.5

0.0 0.0 0.0 (h)

0 24 48 72 96 0 24 48 72 96 0 24 48 72 96

C 5 ** 2.0 E
B220+ cells (x107)
Total cells (x107)

4
1.5 Fasting Refeeding
3
1.0 **
Total cell
2 B220+ cell
0.5 naive B cell 4
1

0.0
immature B cell
0
0 24 48 72 0 24 48 72 (h) CD4+ T cell
D CD8+ T cell
10
6 Granulocyte 3
Immature B cells (x106)

**
Naive B cells (x106)

**
8 Macrophage
GMP
IgM- IgD-
IgM+ IgD+

4 6 ** **
**
MEP
4
CMP
2
2 CLP 2
0 0
MPP(CD34Flt3)
0 24 48 72 0 24 48 72 ST-HSC(CD34Flt3)
LT-HSC(CD34Flt3)
1.5
MPP2(SLAM) 1
Ki67+ B cells (x107)

MPP3(SLAM)
1.0
MPP4(SLAM)
**
ST-HSC(SLAM)
0.5
** LT-HSC(SLAM)
0
0.0
0 24 48 72 (h)
F G
Naive B cells /PP # (x106)

1.6
ZT0 ZT8 ZT16
0.69 0.045 0.71 0.072 1.56 0.061 1.4
CD3ε

1.2
PP

1.0
n.s.
56.5 42.7 0.8
55.2 44.0 57.4 41.0 0 4 8 12 16 20 24
(ZT)
B220
B220+CD3ε- gated 2.0
Naive B cells (x106)

** **
0.94 6.06 1.18 8.88 1.81 14.0
1.5
IgD

BM

1.0

0.5

70.7 22.3 65.8 24.1 58.2 26.0

0.0
0 4 8 12 16 20 24
IgM (ZT)

Figure 2. Lymphocyte Dynamics in PPs and BM in Response to Fasting and Refeeding

(A–D) Numbers of the indicated cell subsets were measured in PPs (A and B) and the right tibia and femur BM (C and D) of mice fasted for 36 h (blue background)
and refed with CE2 (red background). 24, 36, and 60 h in (A) and (B), n = 12; the other datasets, n = 9.
(E) The mean numbers of the indicated cells from mice fasted for 36 h or refed for 48 h were normalized by the value for mice fed ad libitum (each group, n = 9).

(legend continued on next page)

Cell 178, 1072–1087, August 22, 2019 1075

additional 72 h reflecting the histological observations (Figures
1A, 1B, and 2A). A similar tendency was observed for total B cells
(Figure 2A); however, cell behavior was different among the
B cell subpopulations. IgM+IgD+ naive B cells were restored to
pre-fasting (healthy) levels within 72 h after refeeding, whereas
CD95+GL7+ GC and IgA+ B cells failed to recover (Figure 2B).
Consequently, PPs were predominantly filled with naive B cells
after the mice experienced fasting and refeeding. Of note, total
CD4+ and CD8+ T cells also decreased after 36 h of fasting
and slowly increased with refeeding (Figure S1C), but because
B cell subsets are deemed highly susceptible to food deprivation
and intake, we focused on analyzing B cell dynamics.
GC B cells were eliminated by apoptosis and would be newly
induced in response to food intake, which explains the delayed
recovery during the refeeding period. On the other hand, the
rapid recovery of naive B cells during the refeeding stage raises
the possibility that this cell subset may migrate to effector sites
(i.e., intestinal lamina propria) and/or extraintestinal lymphoid tis-
sue during fasting and then gain re-entry to PPs during refeeding.
To examine this possibility, we carefully analyzed cell dynamics
in multiple tissues during fasting and refeeding. Fasting did not
affect cell numbers of cecal patches (CPs), the MLNs, or the
small intestine lamina propria (SILP) (Figure S1A). The number
of splenic B cells, which mainly consisted of naive B cells, signif-
icantly decreased during fasting and then recovered after 48 h of
refeeding (Figure S1D). In sharp contrast, total BM cell number
increased during fasting and decreased after refeeding (Fig-
ure 2C). In particular, the naive B cell number expanded more
than 4-fold during fasting and then steeply declined to basal
levels by refeeding (Figures 2D and 2E). These dynamics of
BM naive B cells were complementary to that of PP and splenic
B cells (Figures 2B and S1D). The accumulation of BM naive
B cells did not result from enhanced B cell generation because
immature B (B220+IgMIgD) cells, as well as Ki67+ B cells,
decreased during fasting. Hematopoietic stem/progenitor cells
(HS/PCs) also decreased significantly during fasting and rapidly
recovered in response to refeeding (Figures 2D, 2E, and S2A;
Table S1). Moreover, the immunofluorescent analysis revealed
that naive B cells were localized not only in the vascular region
but also the BM cavity during fasting (Figures S2B and S2C).
These data suggest that naive B cells most likely translocate to
the BM during nutrient deprivation.
To rigorously confirm the bias of lymphocyte trafficking under
fasting conditions, we adoptively transferred fluorescent dye-
labeled PP cells from ad libitum-fed donors to either fasting or
ad libitum-fed recipients (Figure 3A). After 18 h, the transferred lym-
phocytes preferentially migrated to the BM only when the recipient
mice were fasted (Figure 3B). These BM-migrating cells were
mainly naive B cells (Figure 3C). We also assessed lymphocyte
(F) Representative flow cytometry dot-plots of B220/CD3ε gated (upper panels) and IgM/IgD gated on B220+CD3ε B cells (lower panels) in the BM of mice fed ad
libitum.
(G) The circadian fluctuation in the number of naive B cells in PPs (upper) and the BM (lower). The mean number of PP cells was normalized by the number of PPs
(each time point, n = 8).
Data represent the means ± SEM. ANOVA followed by Dunnett’s test for comparison with mice fed ad libitum (A–D) or ZT0 (G). *p < 0.05; **p < 0.01. CMP,
common myeloid progenitor; GMP, granulocyte/macrophage progenitor; MEP, megakaryocyte/erythrocyte progenitor; MPP, multipotent progenitor; ST/LT-
HSC, short term/long term-hematopoietic stem cell.
See also Figures S1, S2, S3, and S4 and Table S1.
1076 Cell 178, 1072–1087, August 22, 2019
trafficking with knock-in mice carrying Kikume-Green Red (KikGR)
(Tomura et al., 2014). We selectively irradiated PPs with a 430-nm
laser to induce photoconversion in PP lymphocytes before fasting
(Figure 3D) and confirmed that PP naive B cells preferentially
migrated to the BM, but not the spleen and MLN, during fasting
(Figure 3E). Based on these observations, we considered that
naive B cells might shuttle between the BM and PPs during the
fasting and refeeding stages, respectively. Similar events were
observed even under germ-free conditions (Figure S3), indicating
that the gut microbiota is unlikely to contribute to the regulation
of lymphocyte dynamics in response to fasting and refeeding.
Notably, such B cell dynamics in response to food intake and
deprivation was well conserved at all life stages (Figure S4).
Circadian Oscillation in Lymphocyte Trafficking Was
Observed in Ad Libitum-Fed Mice
The feeding behavior of mice is distinct between the daytime and
nighttime. Because mice are nocturnal, they do not feed during
the day. We observed slight body weight change of 25.0 ±
0.10 g and 23.6 ± 0.10 g at zeitgeber time 0 (ZT0) and ZT12,
respectively, in 6-week-old BALB/c male mice; body weight was
then restored by nighttime feeding. Therefore, we assumed that
PP lymphocytes may exhibit circadian oscillation in response to
nutritional status. Indeed, our time course analysis demonstrated
that the number of PP naive B cells slightly decreased until ZT12.
Conversely, in the BM, naive B cells increased with a peak value
around ZT12 and then gradually declined at ZT16–24 (Figures
2F and 2G). Given that feeding behavior is minimal at ZT0–12
and active at ZT12–24 under physiological conditions, lympho-
cyte dynamics during daytime and nighttime were similar to those
seen in the fasting-refeeding model, albeit to a lesser extent (Fig-
ures 2A–2E). We considered that food intake plays a central role in
the circadian oscillations of naive B cells, and thus fasting disturbs
the oscillation by retaining this lymphocyte population in the BM.
Nutritional Status Affects Chemokine Expression in PP
and BM
We further explored the molecular basis controlling lymphocyte
dynamics in response to nutritional status. Chemokine-chemo-
kine receptor interactions are critical in the regulation of immune
cell trafficking. Among them, the CXCL13-CXCR5 axis is essen-
tial for the migration and retention of B cell subsets in lymphoid
tissues including PPs (Ansel et al., 2000). We observed a signif-
icant decrease in Cxcl13 expression in PPs during fasting, which
was recovered by refeeding (Figure 4A). Interestingly, the oppo-
site expression pattern was observed in the BM. Although the
CCL20-CCR6 axis is also indispensable for the maturation of
B cell follicles in PPs (Varona et al., 2001), Ccl20 expression re-
mained stable during fasting (Figure 4B). These observations
 A B

Figure 3. Trafficking of Naive B Cells between PPs and the BM during Fasting
(A) The experimental protocols for adoptive cell transfer of CTV-labeled PP cells.
(B and C) Numbers of CTV+ total (B, n = 12–13) and indicated cell subsets (C, n = 7–8) in the ad libitum-fed and fasting groups.
(D) The experimental protocols for lymphocyte trafficking from PPs in KikGR mice.
(E) Numbers of KikGR-Red+ indicated cell subsets in the ad libitum-fed (n = 10) and fasting groups (n = 12).
Data represent the means ± SEM. Student’s t test. *p < 0.05; **p < 0.01; n.s., not statistically significant.

imply that differential CXCL13 expression in PPs and BM at least
partly account for the localization of naive B cells during fasting
and refeeding.
The sphingosine 1-phosphate (S1P)-S1P receptor type 1
(S1P1) axis promotes egress of lymphocytes from peripheral
lymphoid tissue into circulatory fluids under physiological condi-
tions (Matloubian et al., 2004). However, treatment with FTY720
failed to prevent the fasting-dependent naive B cell trafficking
from PPs to the BM (Figure S5), indicating that the S1P-S1P1
axis is likely not involved in regulating naive B cell dynamics in
response to nutritional status.
mTOR Signaling Partially Contributes to Lymphocyte
Dynamics
To gain mechanistic insight into lymphocyte dynamics, we as-
sessed the activation status of Akt-mTOR signaling, a sensor

Cell 178, 1072–1087, August 22, 2019 1077

 A B

D E

Figure 4. Fasting Downregulates CXCL13 Expression in PPs Independent of mTOR Signaling

(A) Cxcl12 and Cxcl13 mRNA expression in PPs (upper) and the BM (lower). PPs and the BM were obtained from mice fed ad libitum, fasted for 36 h, or refed with
CE2 for 48 h (PP, each group, n = 24; BM, ad libitum, fasting, n = 14; refeeding, n = 8).
(B) Ccl20 mRNA expression in PPs. PPs were obtained from mice fed ad libitum or fasted for 36 h (each group, n = 9).
(C) Quantification of phosphorylated p70 S6 kinase (left) and Akt (right) in PPs (n = 18) and the BM (n = 6) using whole tissue lysates from ad libitum, fasting,
refeeding, and rapamycin-treated groups.
(legend continued on next page)

1078 Cell 178, 1072–1087, August 22, 2019

and integrator of external nutritional stimuli for regulating cellular
metabolism and physiology, during fasting and refeeding. In the
same experimental setting, we also treated the ad libitum-fed
group with rapamycin, which mainly inhibits mTORC1 as well
as mTORC2 to a lesser extent (Sarbassov et al., 2006), to deter-
mine mTOR signaling dependency. As anticipated, fasting sup-
pressed phosphorylation of Akt-mTOR signaling molecules,
such as p70 S6 kinase, Akt, IRS-1, and PTEN, in both PPs and
BM (Figures 4C and S6). Phosphorylation of these molecules
recovered to normal or even higher (e.g., p70 S6 kinase in PPs)
levels after 24-h refeeding compared with that of the control
ad libitum-fed group (Figure 4C).
Rapamycin treatment also decreased phosphorylation levels
of most Akt-mTOR signaling molecules in PPs and the BM,
except for Akt in PPs (Figures 4C and S6). Notably, rapamycin
significantly reduced the number of all B cell subsets in PPs (Fig-
ure 4D). Consistent with previous studies (Limon and Fruman,
2012; Zeng et al., 2016), rapamycin markedly decreased GC
B cell number by less than 20% of vehicle control (Figure 4D).
In the BM, rapamycin treatment decreased the levels of imma-
ture B cells, but not naive B cells (Figure 4D). Meanwhile, rapa-
mycin treatment did not alter expression levels of chemokines,
including Cxcl12 and Cxcl13, in PPs and the BM (Figure 4E).
Thus, mTOR signaling may be critical for B cell survival but not
for chemokine expression.
CXCL13 Production by Stromal Cells Requires Warburg-
like Aerobic Glycolysis
To further dissect the role of nutrient signals in the regulation of
chemokine expression, we focused on cellular metabolism. In
juvenile mice, fasting drastically changed systemic nutritional
status with hypoglycemia accompanied by elevated plasma
b-hydroxybutyrate (BHB) levels (Figures 5A and 5B). We theo-
rized that such nutritional changes may affect chemokine
expression in lymphoid tissue. To test this, we took advantage
of the lymph node-derived stromal cell line BLS12, which abun-
dantly produces CXCL13 upon stimulation with tumor necrosis
factor-a (TNF-a) and anti-lymphotoxin-b receptor (LTbR) antag-
onistic antibodies (Katakai et al., 2008) (Figure 5C). We initially
investigated the intracellular metabolic status of BLS12 cells
by detecting Glut1 and MitoSOX expression, which represent
functional markers for glycolysis and mitochondrial respiration,
respectively (Kunisada et al., 2017). We found that exposure to
TNF-a and anti-LTbR antibodies strongly skewed cellular meta-
bolism toward glycolysis (Figure 5D). Correspondingly, glucose
deprivation in activated BLS12 cells prominently decreased
Cxcl13 expressions (Figure 5E). Further, inhibition of glycolysis
by 2-deoxy-D-glucose (2DG) markedly downregulated Cxcl13
in activated BLS12 cells (Figure 5F) as well as in PP of mice
fed ad libitum in association with decreases in B cell subsets
(Figures 5G and 5H). On the other hand, neither BHB nor rapa-
mycin influenced chemokine expression in BLS12 cells (Figures
(D and E) Numbers of indicated cell subsets (D) and Cxcl12 and Cxcl13 mRNA expression (E) in PP and the BM of mice treated with vehicle (PBS) or rapamycin
(each group, n = 8).
Data represent the means ± SEM. ANOVA followed by Dunnett’s test (A) or Tukey’s test (C). Mann-Whitney U test (B and E). Student’s t test (D). *p < 0.05;
**p < 0.01; n.s., not statistically significant.
See also Figures S5 and S6.
5I and 5J). These results indicate that metabolic reprogramming
into Warburg-like aerobic glycolysis is a prerequisite for induc-
tion of CXCL13 in stromal cells.
Repeated Fasting Attenuates Antigen-Specific IgA
Response and Oral Tolerance Leading to Exacerbation
of Food Antigen-Induced Diarrhea
Elimination of GC and IgA+ B cells from PPs during fasting
increases the possibility of fasting-refeeding compromising im-
mune responses against orally delivered antigens. To investigate
this possibility, mice were orally immunized with ovalbumin
(OVA) and cholera toxin (CT) as an adjuvant once a week, four
times. In the fasting group, immunization was performed after
48 h of refeeding that followed 36-h fasting (Figure 6A); this
regimen did not affect final body weight (Figure 6B). Oral immu-
nization with OVA/CT gradually increased fecal OVA-specific IgA
until day 32 in the ad libitum-fed control group; however, the
OVA-specific IgA response was markedly attenuated in the fast-
ing group (Figure 6C). Plasma OVA-specific IgA, IgM, and IgG
were also significantly decreased in the fasting group (Figure 6D).
Thus, fasted mice failed to gain the booster effect of repeated
immunization. Considering that a subset of GC B cells differenti-
ates into memory B cells, the elimination of GC B cells from PPs
by fasting may have resulted in this abnormality. Similarly, fasting
attenuated the generation of antigen-specific IgA in response to
oral infection with a recombinant Salmonella strain expressing a
tenuous toxoid fragment C (rSalmonella-ToxC) (Hase et al.,
2009; VanCott et al., 1996) (Figure S7).
Because antigen-specific IgA and IgG are considered a pro-
tective factor against allergic symptoms (Aghamohammadi
et al., 2009; Strait et al., 2006; Yamaki et al., 2014), we explored
the effect of repeated fasting on an OVA-induced diarrhea model
(Figure 7A). We found that fasting promoted the development of
diarrhea without significant increase of OVA-specific plasma IgE
levels (Figures 7B and 7C), and repeated fasting diminished in-
duction of plasma OVA-specific IgG and fecal OVA-specific
IgA on day 14 and 20, respectively (Figures 7D and 7E). Total
IgA in feces also significantly decreased in fasting group on
day 14 (Figure 7E). These results suggest that impaired produc-
tion of antigen-specific IgG and IgA, as well as total IgA, may
have led to the exacerbation of diarrhea in the repeated fast-
ing group.
Furthermore, mice that were fasted before oral administration
of OVA failed to induce oral tolerance to OVA, as evidenced by an
increase in auricular swelling due to delayed-type hypersensitiv-
ity after subcutaneous challenge (Figures 7F and 7G). In line with
this, suppression of systemic IgG response to the antigen injec-
tion by oral administration of OVA was not observed in the fasting
mice, indicative of impaired systemic unresponsiveness (Fig-
ure 7H). Altogether, our findings indicate that exacerbation of
diarrhea most likely resulted from disturbance in antigen-specific
mucosal immune responses as well as tolerogenic responses,
Cell 178, 1072–1087, August 22, 2019 1079
 A B

E F G

H I J

(legend on next page)

1080 Cell 178, 1072–1087, August 22, 2019

 A B

C D

Figure 6. Repeated Fasting Suppresses Orally Induced Antigen-Specific Immune Responses

(A) Diagram illustrating the protocol for oral immunization with OVA and CT. Mice were fasted for 36 h and refed 48 h before immunization in the fasting-re-
fed group.
(B) Body weight of mice eating ad libitum or fasting-refed.
(C and D) OVA-specific IgA titers in feces (C) and OVA-specific IgA, IgM, and IgG titers in plasma (D) on day 32 from mice eating ad libitum or fasting-refed (each
group, n = 10).
Data represent the means ± SEM. Mann-Whitney U test (C and D). *p < 0.05; **p < 0.01; n.s., not statistically significant.
See also Figure S7.

underscoring the essential role of nutrient signals in the mainte-
nance of gut immune homeostasis by securing PP cellularity.
DISCUSSION
Our findings demonstrated the dynamic behavior of lympho-
cytes during fasting and refeeding. Fasting decreased the
number of PP lymphocytes while refeeding selectively restored
naive—but not GC and IgA class-switched—B cells. GC B cells
underwent massive apoptosis due to downregulation of
mTORC1 signaling during fasting, whereas PP-derived naive
B cells migrated into the BM in a CXCL13-dependent
manner—at least in part. CXCL13 expression by peripheral
stromal cells was mostly dependent on glycolysis. Moreover,
repeated fasting attenuated antigen-specific IgA response
and oral tolerance, which eventually exacerbated antigen-
induced diarrhea.
Under physiological conditions, a variety of food antigens
accompanied by opportunistic pathogens are continuously
delivered to the intestinal mucosa. The intestinal mucosa in adult
humans possesses a total surface area of 200 m2. PPs conduct
immunosurveillance on the mucosal surface to eliminate
potentially hostile agents. A preconceived notion is that the gut
mucosal immune system constitutively induces immune re-
sponses as evidenced by active GC reactions (Cesta, 2006).
However, our findings revealed that immunological activity in
PPs is nearly shut down during fasting where approximately
half of lymphocytes egress PPs or undergo apoptotic cell death.
B cells comprise a major population of PPs, where the B cell/T
cell ratio is 5-fold higher than in peripheral lymph nodes (Abbas
et al., 2014). We found that B cell populations were highly
susceptible to food deprivation; however, the physiological
significance of this phenomenon remains to be elucidated. Given
that both luminal antigens and nutrient supply are greatly

Figure 5. Lymph Node-Derived Stromal Cells Depend on Glycolysis to Produce CXCL13

(A and B) Plasma glucose (A) and plasma b-hydroxybutyrate (BHB) (B) concentrations (each group, n = 8).
(C and D) BLS12 cells were stimulated with indicated stimulants for 24 h. CXCL13 transcripts were detected by qPCR (C, n = 6). The mitochondrial-specific
production of ROS (%MitoSOX+) and surface GLUT1 expression were detected by flow cytometry (D, n = 3). Data are representative of two independent
experiments.
(E) Cxcl13 expression in BLS12 cells cultured in control or glucose deprivation medium with TNF-a and anti-LTbR antibodies for 24 h. CXCL13 transcripts were
detected by qPCR (n = 6).
(F, I, and J) Cxcl13 expression in BLS12 cells treated with 2DG (F), BHB (I), and rapamycin (J), in the presence of TNF-a and anti-LTbR antibodies for 24 h, were
detected by qPCR (n = 6).
(G and H) Cxcl13 expression (G) and numbers of indicated cell subsets (H) in PPs of mice treated with vehicle (PBS) or 2DG (each group, n = 8).
Data represent the means ± SEM. ANOVA followed by Tukey’s test (A and B) or Dunnett’s test (C, D, F, and J). Mann-Whitney U test (E, G, and I). Student’s t test
(H). *p < 0.05; **p < 0.01; n.s., not statistically significant.

Cell 178, 1072–1087, August 22, 2019 1081

 A B

C D

F
250 μl PBS

100 μl CFA

20 μl PBS (right ear)

G H

Figure 7. Repeated Fasting Exacerbates Food Antigen-Induced Diarrhea

(A) The protocol for OVA-induced diarrhea model. In the fasting group, mice were fasted for 36 h and refed 24 or 48 h before immunization. Related to Figures 7B–7E.
(B) Fecal clinical scores. Mice were fed ad libitum or were fasting-refed (each group, n = 14).
(C and D) Total and OVA-specific IgE (C), and IgG (D) in plasma (each group, n = 8).
(E) Total and OVA-specific IgA titers in feces (each group, n = 14).
(F–H) The protocol to assess oral tolerance (F). Mice were fed ad libitum or fasted for 48 h prior to oral administration with 25 mg OVA (tolerance) or PBS (control).
Delayed-type hypersensitivity (G), and OVA-specific IgG titers in plasma (H) (each group, n = 8).
Data represent the means ± SEM. Mann-Whitney U test (B, D, and E: OVA-specific IgG and IgA). Student’s t test (C–E: total IgE, IgA, and IgG, and OVA-specific
IgE). ANOVA followed by Tukey’s test (G) or Dunnett’s test (H). *p < 0.05; **p < 0.01; n.s., not statistically significant.

1082 Cell 178, 1072–1087, August 22, 2019

reduced during the fasting period, diminution of the lymphocyte
pool may minimize energy expenditure. Despite hypoplastic
morphology under fasting conditions, the fundamental micro-
structures of PPs remained intact and showed a rapid restora-
tion in response to refeeding. Such plasticity based on dynamic
B cell movement characterizes PPs as mucosa-associated
lymphoid tissue. From another point of view, it is possible that
the hypoplastic status is the default of PPs devoid of nutritional
signals. Daily food intake most likely confers immunological ac-
tivity to PPs by recruiting lymphocytes, mainly naive B cells.
The recirculation of naive B cells between PPs and the BM also
occurred as circadian oscillation under physiological conditions.
In mouse lymph nodes, noradrenalin-dependent b2-adrenergic
stimuli at night upregulate CCR7 and CXCR4 on lymphocytes
to suppress cell egress from lymph nodes (Suzuki et al., 2016).
Accordingly, lymphocytes accumulate in the lymph node at night
and circulate in the blood during the day due to decreased
noradrenaline levels. It remains an open question whether this
mechanism also contributes to the circadian oscillation of PP
naive B cells. However, considering that fasting abrogated recir-
culation of naive B cells between PP and the BM, food intake
should serve as a primary element in the regulation of PP naive
B cell dynamics. Indeed, the naive B cell population rapidly
expanded in response to refeeding; this rapid recovery cannot
be explained by enhanced B cell generation, given that there
are multiple steps of differentiation from HSCs into naive B cells,
via pro-B, pre-B, immature B, and transitional B cell stages
(Allman and Pillai, 2008; Shapiro-Shelef and Calame, 2005).
Because naive B cells accumulate in the BM during fasting, we
considered that the BM may function as a reservoir of naive
B cells to rapidly release the cells to mucosa-associated
lymphoid tissue in response to food intake. In support of this
view, histological analysis of the BM of fasted mice detected
an accumulation of naive B cells in the BM cavity, especially in
the vicinity of blood vessels. Such a perivascular niche is also
known as a site for HSC differentiation and proliferation
(Oh and Nör, 2015), suggesting that this region can establish a
microenvironment rich in cell survival factors (e.g., BAFF and
growth factors) for naive B cells (Schweighoffer and Tybulewicz,
2018; Zhang et al., 2004).
The Akt-mTOR signaling pathway is known to converge
various external signals, including growth factors, insulin,
glucose, and amino acids (Laplante and Sabatini, 2012; Saxton
and Sabatini, 2017). Induction of GC B cells largely depends
on mTOR signaling (Ersching et al., 2017). Over-activation of
PI3K-Akt-mTOR and inhibition of mTOR exert positive and nega-
tive effects on GC B in PPs, respectively (Zeng et al., 2016).
Furthermore, B cell-specific deletion of Rictor, the core subunit
of mTORC2, affects the survival and proliferation of B cells
(Lee et al., 2013). Meanwhile, conditional deletion of a core
mTORC1 protein in activated B cells arrests GC B cell differenti-
ation, leading to a decrease in antigen-specific memory B cells
and plasma cells (Raybuck et al., 2018). In agreement with these
studies, we also observed that rapamycin treatment prominently
reduced GC B cells in PPs. Because fasting mitigated mTOR
activity in PPs, we consider that the massive cell death of GC
B cells during fasting is attributed to the downregulation of
mTORC1 signaling. Furthermore, GC B cells did not recover
rapidly by refeeding and PPs were mainly replenished by naive
B cells. Accordingly, the production of antigen-specific IgA in
feces after repeated oral immunization with OVA and CT signifi-
cantly decreased when mice were fasted before immunization.
These results, together with previous observations, indicate
that repeated fasting may eliminate antigen-specific memory
B cells due to downregulation of mTOR signaling, which eventu-
ally attenuates the mucosal immune response.
The importance of CXCL13 for the development and mainte-
nance of lymph nodes, including PPs, has been well docu-
mented (Ansel and Cyster, 2001; Ansel et al., 2000; Okada
et al., 2002). This chemokine is mainly expressed by marginal
reticular cells (MRCs) in lymphoid tissue (Katakai et al., 2008).
Recent single-cell transcriptome analysis demonstrated that
MRCs and follicular dendritic cells (FDCs) individually express
CXCL13; however, the fact that MRCs outnumber FDCs impli-
cates MRCs as a significant source of CXCL13 (Rodda et al.,
2018). BLS12 cells, which we used in this study to dissect the
molecular basis of CXCL13 production, share many characteris-
tics with MRCs. For instance, BLS12 cells express several
adherent molecules, including VCAM-1, ICAM-1, MAdCAM-1,
and RANKL. These molecules are also highly upregulated in
the MRC-like network of mucosa-associated lymphoid tissues,
such as PPs, nasopharynx-associated lymphoid tissues, and
CPs (Katakai et al., 2008). Furthermore, activation of protein
kinase C and nuclear factor kB (NF-kB) pathways upon stimula-
tion with TNF-a and anti-LTbR agonist antibodies mediates
CXCL13 expression in BLS12 cells (Katakai et al., 2008; Suto
et al., 2009). We found that activated BLS12 cells undergo meta-
bolic reprogramming to aerobic glycolysis, which is critical for
the production of CXCL13. This metabolic shift from oxidative
phosphorylation to aerobic glycolysis is well characterized in
activated M1 macrophages and monocytes as well as Th1 and
Th17 cells (Kelly and O’Neill, 2015; Michalek et al., 2011; O’Neill
and Hardie, 2013). Unexpectedly, activation of mTOR signaling
was found dispensable for metabolic reprogramming and
CXCL13 production in MRCs, because rapamycin treatment
failed to suppress both in in vitro and in vivo settings. Although
rapamycin administration did not influence Akt phosphorylation
in PPs, fasting markedly decreased phosphorylation levels. Akt
senses nutrients and upregulates not only the mTOR pathway
but also other signaling pathways. For instance, Akt signaling
activates phosphofructokinase 2/fructose-2,6-bisphosphatase
2 (PFKFB2), a key regulator of glycolysis (Novellasdemunt
et al., 2013; Sreedhar et al., 2017). Notably, inhibition of glycol-
ysis by 2DG or glucose deprivation significantly downregulated
Cxcl13 expression. Therefore, we speculate that CXCL13
expression by MRCs in PPs may be mediated by Akt signaling
in an mTORC1-independent manner, although further investiga-
tion is required to test this hypothesis.
We also found that repeated fasting exacerbates food anti-
gen-induced diarrhea in association with defects in antigen-
specific IgA response and oral tolerance. In the gastrointestinal
tract, dimeric IgA produced in the lamina propria is transported
to the mucosal surface by the action of polymeric Ig receptors
in intestinal epithelial cells (Corthésy, 2013; Pabst, 2012). Secre-
tory IgA may prevent translocation of luminal antigens in the
body, and antigen-specific monomeric IgA in the blood prevents
Cell 178, 1072–1087, August 22, 2019 1083
anaphylaxis by competitively inhibiting the association of aller-
gens with antigen-specific IgE on mast cells (Yamaki et al.,
2014). Selective IgA deficiency (IGAD) is the most common pri-
mary antibody deficiency, where IGAD patients frequently
develop allergic disorders, including asthma, atopic dermatitis,
and food allergies (Aghamohammadi et al., 2009; Schaffer
et al., 1991). Moreover, allergen-specific IgG protects against
anaphylaxis and food allergy by neutralizing allergens and
cross-linking to an inhibitory IgG receptor, FcgRIIB (Strait
et al., 2006; Wagenaar et al., 2018). We consider that the exac-
erbation of diarrhea in fasting mice may be caused by the atten-
uated induction of antigen-specific IgA and IgG, together with
insufficient oral tolerance. The mechanism underlying the abnor-
mality in oral tolerance remains unknown. Early works have
shown that PPs are essential for inducing oral tolerance to
OVA (Fujihashi et al., 2001), although MLNs can also induce
oral tolerance in the absence of PPs (Spahn et al., 2002). Several
mechanisms have been proposed to account for oral tolerance,
which includes clonal deletion or anergy of allergen-specific
T cells and the induction of regulatory T (Treg) cells (Pabst and
Mowat, 2012). Another study supports the central role of
effector/memory-type Treg cells in the establishment of oral
tolerance (Siewert et al., 2008). CD103+ dendritic cells drive
the differentiation of Treg cells by secreting all-trans retinoic
acid. Furthermore, dietary antigens are required to induce pe-
ripheral induction of Treg cells in the small intestine (Kim et al.,
2016). Fasting may thus affect the frequency of antigen-specific
Treg and/or CD103+ dendritic cells. Collectively, our findings
demonstrate that nutritional stimuli are fundamental for main-
taining gut immune homeostasis by facilitating antigen-specific
IgA and oral tolerance.
Multiple studies have defined the beneficial effects of fasting or
calorie restriction regarding metabolic diseases in overnutrition/
obesity models. In these studies, time-restricted feeding, calorie
restriction, fasting mimicking diets, and short/long-term fasting
optimize nutritional balance to prevent or ameliorate multiple dis-
orders, such as metabolic disorders, cardiovascular disease, and
autoimmune disorders (Brandhorst et al., 2015; Hatori et al., 2012;
Okada et al., 2017; Wei et al., 2017). In sharp contrast, a time-
restricted feeding regimen in juvenile mice exacerbated metabolic
disorders (Hu et al., 2019). This is analogous to our finding that
repeated fasting in juvenile mice promoted food antigen-induced
diarrhea. These observations suggest that fasting and time-
restricted feeding during growth may cause detrimental effects
depending on the feeding regimens and the age of test animals.
In conclusion, we found that food intake secures the integrity
and function of the gut mucosal immune system through nutri-
tional signaling. Nutritional deprivation impairs mucosal immunity,
leading to immune barrier dysfunction and excessive allergic
response. Our study uncovered a novel link between nutritional
signals and immune cell dynamics and functionality. Furthermore,
these findings may promote research and treatment courses for
enhancing vaccine efficacy via dietary intervention.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
1084 Cell 178, 1072–1087, August 22, 2019
d KEY RESOURCES TABLE
d LEAD CONTACT AND MATERIALS AVAILABILITY
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Mice
B Cell culture
d METHOD DETAILS
B Preparation of lymphocytes and BM cells
B Flow cytometry
B Adoptive transfer of PP cells
B Photoconversion of PPs from KikGR mice
B Oral immunization with OVA
B Detection of antibody responses by ELISA
B Salmonella infection
B Induction of oral tolerance
B Immunofluorescence
B Histological analysis
B Transmission electron microscopy
B Reverse transcription and quantitative PCR
B Bio-plex detection of phosphorylated proteins
B Plasma parameters
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information can be found online at https://doi.org/10.1016/j.
cell.2019.07.047.
ACKNOWLEDGMENTS
We thank Yuuki Obata, Yutaka Nakamura, Naomi Hoshina, Hiroaki Shiratori,
Yuma Kabumoto, Hiyori Tanabe, Seiji Minegishi, and Teruki Hagiwara for
technical support as well as Michio Tomura, Heiichiro Udono and Yun-Gi
Kim for their valuable discussion and technical consultation. This work was
supported by AMED-Crest (16gm1010004h0101 and 17gm1010004h0102;
18gm1010004h0103 to K. Hase), the Japan Society for the Promotion of Sci-
ence (17KT0055, 16H01369, 18H04680, 25293114, and 26116709 to K. Hase),
Keio Gijuku Academic Development Funds (to K. Hase), the SECOM Science
and Technology Foundation (to K. Hase), the Takeda Science Foundation (to
K. Hase.), the Science Research Promotion Fund, the Promotion and Mutual
Aid Corporation for Private Schools of Japan (to K. Hase), Daiichi Sankyo
Foundation of Life Science (to K. Hase), Terumo Foundation for Life Science
and Arts (to K. Hase), Nagase Science Technology Foundation (to K. Hase),
The Tokyo Biochemical Research Foundation (to K. Hase), the National Center
for Global Health and Medicine (26-110 and 30-1006 to Y.I.K), Yoshida Schol-
arship Foundation (to M.N.), and Keio University Doctorate Student Grant-
in-Aid Program (to M.N.).
AUTHOR CONTRIBUTIONS
M.N. and R.N. performed most of the experiments and data analysis. M.N.
wrote the manuscript. D.T., K.K., S.K., N.I., T.Y., Y.I.K., M.H., R.M., and M.S.
helped with animal experiments. K. Hattori and R.A. performed GF mouse ex-
periments. D.T. and K.M. performed KikGR mouse experiments. N.K. and Y.F.
performed infection experiments. M.T.-N. performed electron microscopy
analysis. T.Y. created the graphical abstract. Y.I.K. provided experimental re-
sources and discussed data. T.K. provided the cell line. S.S. provided tetanus
toxin. T.M. and K.T. analyzed the bone marrow data. T.D. conceived this study.
K. Hase supervised the study. T.D. and K. Hase interpreted the data and
revised the manuscript.
DECLARATION OF INTERESTS
The authors declare no competing interests.
Received: December 5, 2018
Revised: April 30, 2019
Accepted: July 25, 2019
Published: August 22, 2019
REFERENCES
Abbas, A.K., Lichtman, A.H., and Pillai, S. (2014). Cellular and molecular immu-
nology, Eighth Edition (Elsevier), pp. 299–323.
Aghamohammadi, A., Cheraghi, T., Gharagozlou, M., Movahedi, M., Rezaei,
N., Yeganeh, M., Parvaneh, N., Abolhassani, H., Pourpak, Z., and Moin, M.
(2009). IgA deficiency: correlation between clinical and immunological pheno-
types. J. Clin. Immunol. 29, 130–136.
Allman, D., and Pillai, S. (2008). Peripheral B cell subsets. Curr. Opin. Immunol.
20, 149–157.
Ansel, K.M., and Cyster, J.G. (2001). Chemokines in lymphopoiesis and
lymphoid organ development. Curr. Opin. Immunol. 13, 172–179.
Ansel, K.M., Ngo, V.N., Hyman, P.L., Luther, S.A., Förster, R., Sedgwick, J.D.,
Browning, J.L., Lipp, M., and Cyster, J.G. (2000). A chemokine-driven positive
feedback loop organizes lymphoid follicles. Nature 406, 309–314.
Basen-Engquist, K., and Chang, M. (2011). Obesity and cancer risk: recent re-
view and evidence. Curr. Oncol. Rep. 13, 71–76.
Brandhorst, S., Choi, I.Y., Wei, M., Cheng, C.W., Sedrakyan, S., Navarrete, G.,
Dubeau, L., Yap, L.P., Park, R., Vinciguerra, M., et al. (2015). A Periodic Diet
that Mimics Fasting Promotes Multi-System Regeneration, Enhanced Cogni-
tive Performance, and Healthspan. Cell Metab. 22, 86–99.
Brown, E.M., Wlodarska, M., Willing, B.P., Vonaesch, P., Han, J., Reynolds,
L.A., Arrieta, M.C., Uhrig, M., Scholz, R., Partida, O., et al. (2015). Diet and spe-
cific microbial exposure trigger features of environmental enteropathy in a
novel murine model. Nat. Commun. 6, 7806.
Caro-Maldonado, A., Wang, R., Nichols, A.G., Kuraoka, M., Milasta, S., Sun,
L.D., Gavin, A.L., Abel, E.D., Kelsoe, G., Green, D.R., and Rathmell, J.C.
(2014). Metabolic reprogramming is required for antibody production that is
suppressed in anergic but exaggerated in chronically BAFF-exposed B cells.
J. Immunol. 192, 3626–3636.
Carr, E.L., Kelman, A., Wu, G.S., Gopaul, R., Senkevitch, E., Aghvanyan, A.,
Turay, A.M., and Frauwirth, K.A. (2010). Glutamine uptake and metabolism
are coordinately regulated by ERK/MAPK during T lymphocyte activation.
J. Immunol. 185, 1037–1044.
Cesta, M.F. (2006). Normal structure, function, and histology of mucosa-
associated lymphoid tissue. Toxicol. Pathol. 34, 599–608.
Corthésy, B. (2013). Multi-faceted functions of secretory IgA at mucosal sur-
faces. Front. Immunol. 4, 185.
Ersching, J., Efeyan, A., Mesin, L., Jacobsen, J.T., Pasqual, G., Grabiner, B.C.,
Dominguez-Sola, D., Sabatini, D.M., and Victora, G.D. (2017). Germinal Center
Selection and Affinity Maturation Require Dynamic Regulation of mTORC1
Kinase. Immunity 46, 1045–1058.
Fujihashi, K., Dohi, T., Rennert, P.D., Yamamoto, M., Koga, T., Kiyono, H., and
McGhee, J.R. (2001). Peyer’s patches are required for oral tolerance to pro-
teins. Proc. Natl. Acad. Sci. USA 98, 3310–3315.
Grundy, S.M. (2004). Obesity, metabolic syndrome, and cardiovascular dis-
ease. J. Clin. Endocrinol. Metab. 89, 2595–2600.
Hase, K., Kawano, K., Nochi, T., Pontes, G.S., Fukuda, S., Ebisawa, M., Kado-
kura, K., Tobe, T., Fujimura, Y., Kawano, S., et al. (2009). Uptake through
glycoprotein 2 of FimH(+) bacteria by M cells initiates mucosal immune
response. Nature 462, 226–230.
Hatori, M., Vollmers, C., Zarrinpar, A., DiTacchio, L., Bushong, E.A., Gill, S.,
Leblanc, M., Chaix, A., Joens, M., Fitzpatrick, J.A.J., et al. (2012). Time-
restricted feeding without reducing caloric intake prevents metabolic diseases
in mice fed a high-fat diet. Cell Metab. 15, 848–860.
Hu, D., Mao, Y., Xu, G., Liao, W., Ren, J., Yang, H., Yang, J., Sun, L., Chen, H.,
Wang, W., et al. (2019). Time-restricted feeding causes irreversible metabolic
disorders and gut microbiota shift in pediatric mice. Pediatr. Res. 85, 518–526.
Humphrey, J.H. (2009). Child undernutrition, tropical enteropathy, toilets, and
handwashing. Lancet 374, 1032–1035.
Katakai, T., Hara, T., Sugai, M., Gonda, H., and Shimizu, A. (2004). Lymph node
fibroblastic reticular cells construct the stromal reticulum via contact with
lymphocytes. J. Exp. Med. 200, 783–795.
Katakai, T., Suto, H., Sugai, M., Gonda, H., Togawa, A., Suematsu, S., Ebi-
suno, Y., Katagiri, K., Kinashi, T., and Shimizu, A. (2008). Organizer-like
reticular stromal cell layer common to adult secondary lymphoid organs.
J. Immunol. 181, 6189–6200.
Kau, A.L., Ahern, P.P., Griffin, N.W., Goodman, A.L., and Gordon, J.I. (2011).
Human nutrition, the gut microbiome and the immune system. Nature 474,
327–336.
Kaufman, D.R., De Calisto, J., Simmons, N.L., Cruz, A.N., Villablanca, E.J.,
Mora, J.R., and Barouch, D.H. (2011). Vitamin A deficiency impairs vaccine-
elicited gastrointestinal immunity. J. Immunol. 187, 1877–1883.
Kawamoto, T. (2003). Use of a new adhesive film for the preparation of multi-
purpose fresh-frozen sections from hard tissues, whole-animals, insects and
plants. Arch. Histol. Cytol. 66, 123–143.
Kelly, B., and O’Neill, L.A. (2015). Metabolic reprogramming in macrophages
and dendritic cells in innate immunity. Cell Res. 25, 771–784.
Kim, K.S., Hong, S.-W., Han, D., Yi, J., Jung, J., Yang, B.-G., Lee, J.Y., Lee, M.,
and Surh, C.D. (2016). Dietary antigens limit mucosal immunity by inducing
regulatory T cells in the small intestine. Science 351, 858–863.
Kunisada, Y., Eikawa, S., Tomonobu, N., Domae, S., Uehara, T., Hori, S., Fur-
usawa, Y., Hase, K., Sasaki, A., and Udono, H. (2017). Attenuation of
CD4+CD25+ Regulatory T Cells in the Tumor Microenvironment by Metformin,
a Type 2 Diabetes Drug. EBioMedicine 25, 154–164.
Kunisawa, J., Sugiura, Y., Wake, T., Nagatake, T., Suzuki, H., Nagasawa, R.,
Shikata, S., Honda, K., Hashimoto, E., Suzuki, Y., et al. (2015). Mode of Bioen-
ergetic Metabolism during B Cell Differentiation in the Intestine Determines the
Distinct Requirement for Vitamin B1. Cell Rep. 13, 122–131.
Laplante, M., and Sabatini, D.M. (2012). mTOR signaling in growth control and
disease. Cell 149, 274–293.
Lee, K., Heffington, L., Jellusova, J., Nam, K.T., Raybuck, A., Cho, S.H.,
Thomas, J.W., Rickert, R.C., and Boothby, M. (2013). Requirement for Rictor
in homeostasis and function of mature B lymphoid cells. Blood 122,
2369–2379.
Limon, J.J., and Fruman, D.A. (2012). Akt and mTOR in B Cell Activation and
Differentiation. Front. Immunol. 3, 228.
Lycke, N.Y., and Bemark, M. (2017). The regulation of gut mucosal IgA B-cell
responses: recent developments. Mucosal Immunol. 10, 1361–1374.
Man, K., and Kallies, A. (2015). Synchronizing transcriptional control of T cell
metabolism and function. Nat. Rev. Immunol. 15, 574–584.
Mantis, N.J., Rol, N., and Corthésy, B. (2011). Secretory IgA’s complex roles in
immunity and mucosal homeostasis in the gut. Mucosal Immunol. 4, 603–611.
Matloubian, M., Lo, C.G., Cinamon, G., Lesneski, M.J., Xu, Y., Brinkmann, V.,
Allende, M.L., Proia, R.L., and Cyster, J.G. (2004). Lymphocyte egress from
thymus and peripheral lymphoid organs is dependent on S1P receptor 1. Na-
ture 427, 355–360.
Michalek, R.D., Gerriets, V.A., Jacobs, S.R., Macintyre, A.N., MacIver, N.J.,
Mason, E.F., Sullivan, S.A., Nichols, A.G., and Rathmell, J.C. (2011). Cutting
edge: distinct glycolytic and lipid oxidative metabolic programs are essential
for effector and regulatory CD4+ T cell subsets. J. Immunol. 186, 3299–3303.
Novellasdemunt, L., Tato, I., Navarro-Sabate, A., Ruiz-Meana, M., Méndez-
Lucas, A., Perales, J.C., Garcia-Dorado, D., Ventura, F., Bartrons, R., and
Rosa, J.L. (2013). Akt-dependent activation of the heart 6-phosphofructo-
2-kinase/fructose-2,6-bisphosphatase (PFKFB2) isoenzyme by amino acids.
J. Biol. Chem. 288, 10640–10651.
O’Neill, L.A.J., and Hardie, D.G. (2013). Metabolism of inflammation limited by
AMPK and pseudo-starvation. Nature 493, 346–355.
Oh, M., and Nör, J.E. (2015). The Perivascular Niche and Self-Renewal of Stem
Cells. Front. Physiol. 6, 367.
Cell 178, 1072–1087, August 22, 2019 1085
Okada, T., Ngo, V.N., Ekland, E.H., Förster, R., Lipp, M., Littman, D.R., and
Cyster, J.G. (2002). Chemokine requirements for B cell entry to lymph nodes
and Peyer’s patches. J. Exp. Med. 196, 65–75.
Okada, T., Fukuda, S., Hase, K., Nishiumi, S., Izumi, Y., Yoshida, M., Hagiwara,
T., Kawashima, R., Yamazaki, M., Oshio, T., et al. (2013). Microbiota-derived
lactate accelerates colon epithelial cell turnover in starvation-refed mice.
Nat. Commun. 4, 1654.
Okada, T., Otsubo, T., Hagiwara, T., Inazuka, F., Kobayashi, E., Fukuda, S.,
Inoue, T., Higuchi, K., Kawamura, Y.I., and Dohi, T. (2017). Intermittent fasting
prompted recovery from dextran sulfate sodium-induced colitis in mice.
J. Clin. Biochem. Nutr. 61, 100–107.
Pabst, O. (2012). New concepts in the generation and functions of IgA. Nat.
Rev. Immunol. 12, 821–832.
Pabst, O., and Mowat, A.M. (2012). Oral tolerance to food protein. Mucosal
Immunol. 5, 232–239.
Poirier, P., Giles, T.D., Bray, G.A., Hong, Y., Stern, J.S., Pi-Sunyer, F.X.,
and Eckel, R.H.; American Heart Association; Obesity Committee of the
Council on Nutrition, Physical Activity, and Metabolism (2006). Obesity
and cardiovascular disease: pathophysiology, evaluation, and effect of
weight loss: an update of the 1997 American Heart Association Scientific
Statement on Obesity and Heart Disease from the Obesity Committee of
the Council on Nutrition, Physical Activity, and Metabolism. Circulation
113, 898–918.
Rangan, P., Choi, I., Wei, M., Navarrete, G., Guen, E., Brandhorst, S.,
Enyati, N., Pasia, G., Maesincee, D., Ocon, V., et al. (2019). Fasting-
Mimicking Diet Modulates Microbiota and Promotes Intestinal Regenera-
tion to Reduce Inflammatory Bowel Disease Pathology. Cell Rep. 26,
2704–2719.
Raybuck, A.L., Cho, S.H., Li, J., Rogers, M.C., Lee, K., Williams, C.L., Shlom-
chik, M., Thomas, J.W., Chen, J., Williams, J.V., and Boothby, M.R. (2018).
B Cell-Intrinsic mTORC1 Promotes Germinal Center-Defining Transcription
Factor Gene Expression, Somatic Hypermutation, and Memory B Cell Gener-
ation in Humoral Immunity. J. Immunol. 200, 2627–2639.
Rodda, L.B., Lu, E., Bennett, M.L., Sokol, C.L., Wang, X., Luther, S.A., Barres,
B.A., Luster, A.D., Ye, C.J., and Cyster, J.G. (2018). Single-Cell RNA
Sequencing of Lymph Node Stromal Cells Reveals Niche-Associated Hetero-
geneity. Immunity 48, 1014–1028.
Sarbassov, D.D., Ali, S.M., Sengupta, S., Sheen, J.H., Hsu, P.P., Bagley, A.F.,
Markhard, A.L., and Sabatini, D.M. (2006). Prolonged rapamycin treatment
inhibits mTORC2 assembly and Akt/PKB. Mol. Cell 22, 159–168.
Savy, M., Edmond, K., Fine, P.E.M., Hall, A., Hennig, B.J., Moore, S.E., Mulhol-
land, K., Schaible, U., and Prentice, A.M. (2009). Landscape analysis of inter-
actions between nutrition and vaccine responses in children. J. Nutr. 139,
2154S–2218S.
Saxton, R.A., and Sabatini, D.M. (2017). mTOR Signaling in Growth, Meta-
bolism, and Disease. Cell 168, 960–976.
Schaffer, F.M., Monteiro, R.C., Volanakis, J.E., and Cooper, M.D. (1991). IgA
deficiency. Immunodefic. Rev. 3, 15–44.
Schmidt, T.H., Bannard, O., Gray, E.E., and Cyster, J.G. (2013). CXCR4
promotes B cell egress from Peyer’s patches. J. Exp. Med. 210,
1099–1107.
Schweighoffer, E., and Tybulewicz, V.L. (2018). Signalling for B cell survival.
Curr. Opin. Cell Biol. 51, 8–14.
Scrimshaw, N.S., and SanGiovanni, J.P. (1997). Synergism of nutrition, infec-
tion, and immunity: an overview. Am. J. Clin. Nutr. 66, 464S–477S.
Shapiro-Shelef, M., and Calame, K. (2005). Regulation of plasma-cell develop-
ment. Nat. Rev. Immunol. 5, 230–242.
Siewert, C., Lauer, U., Cording, S., Bopp, T., Schmitt, E., Hamann, A., and
Huehn, J. (2008). Experience-driven development: effector/memory-like al-
phaE+Foxp3+ regulatory T cells originate from both naive T cells and naturally
occurring naive-like regulatory T cells. J. Immunol. 180, 146–155.
Spahn, T.W., Weiner, H.L., Rennert, P.D., Lügering, N., Fontana, A.,
Domschke, W., and Kucharzik, T. (2002). Mesenteric lymph nodes are critical
1086 Cell 178, 1072–1087, August 22, 2019
for the induction of high-dose oral tolerance in the absence of Peyer’s patches.
Eur. J. Immunol. 32, 1109–1113.
Sreedhar, A., Petruska, P., Miriyala, S., Panchatcharam, M., and Zhao, Y.
(2017). UCP2 overexpression enhanced glycolysis via activation of PFKFB2
during skin cell transformation. Oncotarget 8, 95504–95515.
Strait, R.T., Morris, S.C., and Finkelman, F.D. (2006). IgG-blocking antibodies
inhibit IgE-mediated anaphylaxis in vivo through both antigen interception and
Fc gamma RIIb cross-linking. J. Clin. Invest. 116, 833–841.
Suto, H., Katakai, T., Sugai, M., Kinashi, T., and Shimizu, A. (2009). CXCL13
production by an established lymph node stromal cell line via lymphotoxin-
beta receptor engagement involves the cooperation of multiple signaling path-
ways. Int. Immunol. 21, 467–476.
Suzuki, K., Hayano, Y., Nakai, A., Furuta, F., and Noda, M. (2016). Adrenergic
control of the adaptive immune response by diurnal lymphocyte recirculation
through lymph nodes. J. Exp. Med. 213, 2567–2574.
Tomura, M., Hata, A., Matsuoka, S., Shand, F.H.W., Nakanishi, Y., Ikebuchi,
R., Ueha, S., Tsutsui, H., Inaba, K., Matsushima, K., et al. (2014). Tracking
and quantification of dendritic cell migration and antigen trafficking between
the skin and lymph nodes. Sci. Rep. 4, 6030.
Uchimura, Y., Fuhrer, T., Li, H., Lawson, M.A., Zimmermann, M., Yilmaz, B.,
Zindel, J., Ronchi, F., Sorribas, M., Hapfelmeier, S., et al. (2018). Antibodies
Set Boundaries Limiting Microbial Metabolite Penetration and the Resultant
Mammalian Host Response. Immunity 49, 545–559.e5.
VanCott, J.L., Staats, H.F., Pascual, D.W., Roberts, M., Chatfield, S.N., Yama-
moto, M., Coste, M., Carter, P.B., Kiyono, H., and McGhee, J.R. (1996). Regu-
lation of mucosal and systemic antibody responses by T helper cell subsets,
macrophages, and derived cytokines following oral immunization with live
recombinant Salmonella. J. Immunol. 156, 1504–1514.
Varanasi, S.K., Donohoe, D., Jaggi, U., and Rouse, B.T. (2017). Manipulating
Glucose Metabolism during Different Stages of Viral Pathogenesis Can Have
either Detrimental or Beneficial Effects. J. Immunol. 199, 1748–1761.
Varona, R., Villares, R., Carramolino, L., Goya, I., Zaballos, A., Gutiérrez, J.,
Torres, M., Martı́nez-A, C., and Márquez, G. (2001). CCR6-deficient mice
have impaired leukocyte homeostasis and altered contact hypersensitivity
and delayed-type hypersensitivity responses. J. Clin. Invest. 107, R37–R45.
Visscher, T.L., and Seidell, J.C. (2001). The public health impact of obesity.
Annu. Rev. Public Health 22, 355–375.
Wagenaar, L., Bol-Schoenmakers, M., Giustarini, G., Vonk, M.M., van Esch,
B.C.A.M., Knippels, L.M.J., Garssen, J., Smit, J.J., and Pieters, R.H.H.
(2018). Dietary Supplementation with Nondigestible Oligosaccharides Re-
duces Allergic Symptoms and Supports Low Dose Oral Immunotherapy in a
Peanut Allergy Mouse Model. Mol. Nutr. Food Res. 62, e1800369.
Wang, A., Huen, S.C., Luan, H.H., Yu, S., Zhang, C., Gallezot, J.D.,
Booth, C.J., and Medzhitov, R. (2016). Opposing Effects of Fasting Meta-
bolism on Tissue Tolerance in Bacterial and Viral Inflammation. Cell 166,
1512–1525.
Wei, M., Shinkura, R., Doi, Y., Maruya, M., Fagarasan, S., and Honjo, T. (2011).
Mice carrying a knock-in mutation of Aicda resulting in a defect in somatic
hypermutation have impaired gut homeostasis and compromised mucosal
defense. Nat. Immunol. 12, 264–270.
Wei, M., Brandhorst, S., Shelehchi, M., Mirzaei, H., Cheng, C.W., Budniak, J.,
Groshen, S., Mack, W.J., Guen, E., Di Biase, S., et al. (2017). Fasting-
mimicking diet and markers/risk factors for aging, diabetes, cancer, and car-
diovascular disease. Sci. Transl. Med. 9, eaai8700.
World Health Organization (2016). Report of the Commission on Ending Child-
hood Obesity (World Health Organization), pp. 1–68.
Yamaki, K., Nakashima, T., Miyatake, K., Ishibashi, Y., Ito, A., Kuranishi, A.,
Taguchi, A., Morioka, A., Yamamoto, M., and Yoshino, S. (2014). IgA attenu-
ates anaphylaxis and subsequent immune responses in mice: possible appli-
cation of IgA to vaccines. Immunol. Res. 58, 106–117.
Yamamoto, M., Fujihashi, K., Kawabata, K., McGhee, J.R., and Kiyono, H.
(1998). A mucosal intranet: intestinal epithelial cells down-regulate intraepithe-
lial, but not peripheral, T lymphocytes. J. Immunol. 160, 2188–2196.
Yamazaki, S., Ema, H., Karlsson, G., Yamaguchi, T., Miyoshi, H., Shioda, S.,
Taketo, M.M., Karlsson, S., Iwama, A., and Nakauchi, H. (2011). Nonmyelinat-
ing Schwann cells maintain hematopoietic stem cell hibernation in the bone
marrow niche. Cell 147, 1146–1158.
Zeng, H., Cohen, S., Guy, C., Shrestha, S., Neale, G., Brown, S.A., Cloer, C.,
Kishton, R.J., Gao, X., Youngblood, B., et al. (2016). mTORC1 and mTORC2
Kinase Signaling and Glucose Metabolism Drive Follicular Helper T Cell Differ-
entiation. Immunity 45, 540–554.
Zhang, M., Ko, K.H., Lam, Q.L.K., Lo, C.K.C., Xu, D.J.L., Shen, L.,
Zheng, B., Srivastava, G., and Lu, L. (2004). Novel function of TNF cyto-
kines in regulating bone marrow B cell survival. Cell. Mol. Immunol. 1,
447–453.
Cell 178, 1072–1087, August 22, 2019 1087
STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
Anti-cleaved caspase-3 (Asp175) (polyclonal) Cell Signaling Technology Cat#9661; RRID: AB_2341188
Anti-rat IgG (H+L) TRITC (polyclonal) Southern Biotech Cat#3030-03; RRID: AB_619945
Anti-rat IgG (H+L) Alexa Fluor 633 (polyclonal) Thermo Fisher Scientific Cat#A21094; RRID: AB_2535749
Anti-mouse TER-119 PerCP-Cy5.5 (TER-119) TONBO biosciences Cat#65-5921; RRID: N/A
Anti-mouse Lymphotoxin beta R/TNFRSF3 (polyclonal) R and D systems Cat#AF1008; RRID: AB_354531
Anti-mouse Ly6A/E PE-Cy7 (Sca-1) Biolegend Cat#122514; RRID: AB_756199
Anti-mouse Ly-6G/Gr1 PerCP-Cy5.5 (RB6-8C5) eBioscience Cat#45-5931; RRID: AB_906247
Anti-mouse Ki-67 PE-Cy7 (SolA15) eBioscience Cat#25-5698; RRID: AB_11220070
Anti-mouse IgM PE (R6-60.2) BD PharMingen Cat#553409; RRID: AB_394845
Anti-mouse IgM PE dozzle 594 (RMM-1) Biolegend Cat#406529; RRID: AB_2566585
Anti-mouse IgM HRP (polyclonal) Southern Biotech Cat#1020-05; RRID: AB_619903
Anti-mouse IgM Alexa Fluor 488 (polyclonal) Thermo Fisher Scientific Cat#A21042; RRID: AB_2535711
Anti-mouse IgG HRP (polyclonal) Southern Biotech Cat#1030-05; RRID: AB_2619742
Anti-mouse IgD APC (11-26c.2a) Biolegend Cat#405713; RRID: AB_10645480
Anti-mouse IgA HRP (polyclonal) Southern Biotech Cat#1040-05; RRID: AB_2714213
Anti-mouse IgA FITC(C10-3) BD PharMingen Cat#559354; RRID: AB_397235
Anti-mouse GL7 Pacific Blue (GL7) Biolegend Cat#144614; RRID: AB_2563292
Anti-mouse Endomucin (V.7C7.1) abcam Cat#ab106100; RRID: AB_10859306
Anti-mouse CD95 FITC (Jo2) BD PharMingen Cat#554257; RRID: AB_395329
Anti-mouse CD8a PerCP-Cy5.5 (53-6.7) TONBO biosciences Cat#65-0081; RRID: AB_2621882
Anti-mouse CD48 FITC (HM48-1) Biolegend Cat#103404; RRID: AB_313019
Anti-mouse CD45R/B220 V450 (RA3-6B2) BD Horizon Cat#560472; RRID: AB_1645276
Anti-mouse CD45R/B220 PE (RA3-6B2) eBioscience Cat#12-0452; RRID: AB_465671
Anti-mouse CD45R/B220 FITC (RA3-6B2) BD PharMingen Cat#553088; RRID: AB_394618
Anti-mouse CD45R/B220 APC-eFluor 780 (RA3-6B2) eBioscience Cat#47-0452; RRID: AB_1518810
Anti-mouse CD45R/B220 APC (RA3-6B2) eBioscience Cat#17-0452; RRID: AB_469395
Anti-mouse CD45R/B220 (RA3-6B2) eBioscience Cat#14-0452; RRID: AB_467254
Anti-mouse CD45R/B220 PerCP-Cy5.5 (RA3-6B2) TONBO biosciences Cat#65-0452; RRID: AB_2621892
Anti-mouse CD45 BV510 (30-F11) Biolegend Cat#103137; RRID: AB_2561392
Anti-mouse CD44 PE-Cy7 (IM7) eBioscience Cat#25-0441; RRID: AB_469623
Anti-mouse CD4 PerCP-Cy5.5 (RM4-5) TONBO biosciences Cat#65-0042; RRID: AB_2621876
Anti-mouse CD4 APC-eFluor 780 (GK1.5) eBioscience Cat#47-0041; RRID: AB_11218896
Anti-mouse CD3ε V500 (500A2) BD Horizon Cat#560771; RRID: AB_1937314
Anti-mouse CD3ε BV605 (145-2C11) Biolegend Cat#100351; RRID: AB_2565842
Anti-mouse CD3ε APC (145-2C11) TONBO biosciences Cat#20-0031; RRID: AB_2621537
Anti-mouse CD3ε (145-2C11) BD PharMingen Cat#550275; RRID: AB_393572
Anti-mouse CD34 FITC (RAM34) eBioscience Cat#11-0341; RRID: AB_465020
Anti-mouse CD31 (MEC 13.3) BD PharMingen Cat#550274; RRID: AB_393571
Anti-mouse CD16/CD32 Alexa Fluor 700 (93) eBioscience Cat#56-0161; RRID: AB_493994
Anti-mouse CD16/CD32 (2.4G2) TONBO biosciences Cat#70-0161; RRID: AB_2621487
Anti-mouse CD150/SLAM PE (TC15-12F12.2) Biolegend Cat#115904; RRID: AB_313683
Anti-mouse CD135 APC (A2F10) Biolegend Cat#135310; RRID: AB_2107050
Anti-mouse CD127/IL-7Ra PE (SB/119) Biolegend Cat#121111; RRID: AB_493510
(Continued on next page)

e1 Cell 178, 1072–1087.e1–e6, August 22, 2019

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Anti-mouse CD11b PerC-/Cy5.5 (M1/70) TONBO biosciences Cat#65-0112; RRID: AB_2621885
Anti-mouse CD117/c-kit APC-Cy7 (2B8) Biolegend Cat#105826; RRID: AB_1626278
Anti-cleaved caspase-3 (Asp175) (polyclonal) Cell Signaling technology Cat#9661; RRID: AB_2341188
Anti-mouse GULT1 Alexa Fluor 647 (EPR3915) abcam Cat#ab195020; RRID: AB_2783877
Anti-hamster IgG (H+L) FITC (polyclonal) Southern Biotech Cat#6210-02; RRID:N/A
Bacterial and Virus Strains
rSalmonella–ToxC (DaroA, DaroD) VanCott et al., 1996 N/A
Chemicals, Peptides, and Recombinant Proteins
Cholera toxin (CT) List Biological Laboratories Cat#100B
Tetanus toxoid (TT) BIKEN foundation N/A
Freund’s Adjuvant, Complete (CFA) Sigma Aldrich Cat#F5881
Imject Alum Adjuvant Thermo Fisher Scientific Cat#77161
Alubmin, Chicken Egg (Ovalbumin) Grade V (OVA) Sigma Aldrich Cat#A5503; CAS: 9006-59-1
Rapamycin LC Laboratories Cat#R-5000; CAS: 53123-88-9
Fingolimod (FTY720) Cayman Chemical Company Cat#10006292; CAS: 162359-56-0
2-Deoxy-D-glucose (2DG) abcam Cat#ab142242; CAS: 154-17-6
3-Hydroxybutyric acid/b-hydroxybutyrate (BHB) Sigma Aldrich Cat#166898; CAS: 300-85-6
Murine Tumor Necrosis Factor-a (TNF-a) Peprotech Cat#315-01A
7-Aminoactinomycin D (7-AAD) TONBO Cat#13-6993
Fixable Viability Dye eFluor 780 Thermo Fisher Scientific Cat#65-0865
LIVE/DEAD Fixable Blue Dead Cell Stain Kit, for UV excitation Thermo Fisher Scientific Cat#L23105
SYTOX Blue Dead Cell Stain, for flow cytometry Thermo Fisher Scientific Cat#S34857
MitoSOX Red Mitochondrial Superoxide Indicator (MitoSOX-PE) Thermo Fisher Scientific Cat#M36008
CellTrace Cell Proliferation Kits CellTrace Violet (CellTrace Violet) Thermo Fisher Scientific Cat#C34557
Quetol 812 Nissin EM Cat#340
Deoxyribonuclease I (DNase I) Sigma Aldrich Cat#DN25; CAS: 9003-98-9
Collagenase Wako Cat#032-22364; CAS: 9001-12-1
cOmplete, mini Protease Inhibitor Cocktail Roche Cat#04-693-124-001
TRIzol Reagent Thermo Fisher Scientific Cat#15596026
EagleTaq Universal Master Mix (ROX) Roche Cat#07-260-288-190
Power SYBR Green PCR Master Mix Applied Biosystems Cat#4367659
Critical Commercial Assays
Bio-Plex Pro Cell Signaling Akt Panel 8-Plex Assay Bio Rad Cat#LQ0-0006JK0K0RR
LEGEND MAX Mouse OVA Specific IgE ELISA Kit with Biolegend Cat#439807
Pre-coated Plates
ELISA MAX Mouse Mouse IgE Biolegend Cat#432403
Mouse IgA ELISA Quantitation Set Bethyl Laboratories Cat#E90-103
Mouse IgG ELISA Quantitation Set Bethyl Laboratories Cat#E90-131
DeadEnd Colorimetric TUNEL System Promega Cat#G7130
Target Retrieval Solution Dako Cat#S1699
Protein Block Serum-Free Dako Cat#X0909
ENVISION+ System-HRP labeled Polymer Anti-Rabbit Dako Cat#K4002
VECTOR ImmPACT DAB Peroxidase Substrate Vector Laboratories Cat#SK4105
Lamina Propria Dissociation Kit Miltenyi Biotec Cat#130-097-410
Foxp3 / Transcription Factor Staining Buffer Set eBioscience Cat#00-5523-00
Rneasy Mini Kit QIAGEN Cat#74106
iScript Advanced cDNA Synthesis Kit for RT-qPCR BIO RAD Cat#1725038
Spotchem II glucose Arkray Cat#77301
(Continued on next page)

Cell 178, 1072–1087.e1–e6, August 22, 2019 e2

Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Ketone-H kit Serotech Cat#A350
Experimental Models: Cell Lines
BLS12 cell Katakai et al., 2004 N/A
Experimental Models: Organisms/Strains
Mouse: B6.B6129-Gt(ROSA)26Sor < tm1(CAG-kikGR) RIKEN RBC Cat# RBRC04847,
Kgwa > (KikGR mice) RRID:IMSR_RBRC04847
Mouse: BALB/cA mice CLEA Japan N/A
Oligonucleotides
Cxcl13 (Mm00444533_m1) Thermo Fisher Scientific Cat# 4331182
Primer: Rpl32 Forward: GGCTTTTCGGTTCTTAGAGGA Exigen N/A
Primer: Rpl32 Reverse: TTCCTGGTCCACAATGTCAA-30 ) Exigen N/A
Primer: Cxcl12 Forward: TTTCAGATGCTTGACGTTGG Exigen N/A
Primer: Cxcl12 Reverse: GCGCTCTGCATCAGTGAC Exigen N/A
Primer: Cxcl13 Forward: CTCCAGGCCACGGTATTCTG Exigen N/A
Primer: Cxcl13 Reverse: GGAGCTTGGGGAGTTGAAGA Exigen N/A
Primer; Ccl20 Forward: GGCAGAAGCAAGCAACTACG Exigen N/A
Primer; Ccl20 Reverse: CTTTGGATCAGCGCACACAG Exigen N/A
Software and Algorithms
Prism 8 GraphPad Software RRID:SCR_002798
FlowJo Version 10 FlowJo, LCC RRID:SCR_008520
DIVA software Version 6.2 BD Biosciences RRID:SCR_001456
IMARIS Version 9.2.0 ZEISS RRID:SCR_007370
ImageJ Software Version 1.49 NIH RRID:SCR_003070
Other
Mouse diet: CE-2 CLEA Japan N/A
Sporchem Arkray Cat#EZSP-4433
Fiber coupled Blue LED Light source Prizmatix Cat#Silver-LED-430
Dial-thickness gauge Mitsutoyo Cat#MDC-25PX

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for reagents may be directed to, and will be fulfilled by the Lead Contact, Koji Hase (hase-kj@pha.
keio.ac.jp)

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice
Unless otherwise stated, four to five-week-old male BALB/c mice were purchased from CLEA Japan Inc. (Tokyo, Japan) and were
acclimated for one week under specific pathogen-free (SPF) conditions at the animal facilities of the National Center for Global Health
and Medicine, Faculty of Pharmacy, Keio University (Tokyo, Japan). Knock-in mice carrying Kikume-Green Red (KikGR) cDNA under
the CAG promoter were obtained from RIKEN RBC (Tokyo, Japan) and were maintained under SPF conditions at the animal facilities
of Faculty of Pharmacy, Keio University (Tokyo, Japan). Germ-free (GF) BALB/cA mice (CLEA Japan Inc.) were maintained in GF vinyl
isolators at an animal facility in the Faculty of Medicine, Keio University. SPF and GF mice were fed with CE-2 (CLEA Japan) and were
kept under a 12:12 h light-dark cycle. During the fasting period, mice were kept in plastic cages without bedding chips or bait, with a
stainless mesh floor to avoid coprophagia, and with ad libitum drinking water. Irrespective of the fasting and refeeding period length,
refeeding or tissue collection was set to begin at 8:00 a.m. for all experiments. To examine the effect of rapamycin, 2DG and FTY720
in vivo, rapamycin (5 mg/kg; LC laboratories, Woburn, MA) was administrated intraperitoneally daily for seven consecutive days
(Zeng et al., 2016), 2DG (250 mg/kg; Abcam, Cambridge, UK) was also administrated i.p. three times every 12 h (Varanasi et al.,
2017), while FTY720 (1 mg/kg; Cayman Chemical Company, Ann Arbor, MI) was orally administrated three times every 12 h during
fasting. All animal experiments were performed according to the Institutional Guidelines for the Care and Use of Laboratory Animals in
Research with approval by the local ethics committees at the National Center for Global Health and Medicine, and Keio University.

e3 Cell 178, 1072–1087.e1–e6, August 22, 2019

Cell culture
BLS12 cells were cultured in DMEM (Sigma-Aldrich) supplemented with 10% FBS, GlutaMAX (GIBCO; Thermo Fisher Scientific),
1 mM sodium pyruvate (Sigma-Aldrich), and antibiotics, as previously described (Katakai et al., 2004). Cells were stimulated with
10 ng/mL murine TNF-a (PeproTech, Rocky Hill, NJ) and/or goat anti-mouse LTbR agonist antibodies (R&D Systems, Minneapolis,
MN) for 24 h. In a separate experiment, BLS12 cells were cultured in glucose-deprived medium containing 10% FBS, GlutaMAX,
MEM essential amino acids (Thermo Fisher Scientific), 1 mM sodium pyruvate, inorganic salts (1.8 mM CaCl2, 0.8 mM MgSO4,
5.3 mM KCl, 44 mM NaHCO3, 110 mM NaCl, and 0.9 mM NaH2PO4-H2O), and antibiotics in the presence of TNF-a and anti-
LTbR antibodies for 24 h. Control medium was supplemented with 1 mg/ml glucose in the glucose-deprived medium. For pharma-
cological inhibition of mTORC1 or glycolysis, BSL12 cells were treated with medium containing various concentrations of rapamycin
(LC Laboratories) or 2-deoxy-D-glucose (2DG; Abcam, Cambridge, UK) for 24 h. For analyzing the effect of b-hydroxybutyrate
(BHB; Sigma-Aldrich), BLS12 cells were treated with medium containing 25 mM HEPES (GIBCO) with or without 4 mM BHB. For
flow cytometric analysis, BLS12 cells were detached using Trypsin-EDTA solution (Nacalai Tesque, Kyoto, Japan) and washed
with PBS. Mitochondrial reactive oxygen species (ROS) production was detected using MitoSOX-PE (Thermo Fisher Scientific)
according to the manufacturer’s instructions.

METHOD DETAILS

Preparation of lymphocytes and BM cells

Peyer’s patches (PPs) were cut from the intestine and washed twice with phosphate-buffered saline (PBS; pH 7.2). PPs were then
minced and stirred in 30 mL RPMI 1640 medium (pH 7.2; Sigma-Aldrich, St. Louis, MO) containing 2% fetal bovine serum (FBS;
Sigma-Aldrich), 12.5 mM HEPES, 100 U/mL penicillin, 100 U/mL streptomycin, 0.5 mg/mL collagenase (Wako Pure Chemical Cor-
poration, Osaka, Japan), and 0.5 mg/mL DNase I (Sigma-Aldrich) for 30 min at 37 C. After filtration through a 70-mm cell strainer, the
cells were resuspended in PBS with 2% FBS. MLNs and CPs were mechanically dispersed into a single-cell suspension. Lamina
propria cells of the small intestine were prepared using the Lamina Propria Dissociation Kit (Miltenyi Biotec, Bergisch Gladbach, Ger-
many) according to manufacturer’s instructions. BM cells from the right femur and tibia, and splenocytes were mechanically
dispersed into a single-cell suspension. Red blood cells were removed by RBC lysis reagent (150 mM NH4Cl, 1 mM EDTA, and
0.4 mM NaHCO3) and then cells were suspended in PBS with 2% FBS.

Flow cytometry
For surface and intracellular staining, non-specific binding was blocked with Fc receptor antibody (clone: 2.4G2; Tonbo Biosciences,
San Diego, CA) prior to staining with fluorochrome-conjugated antibodies. For intracellular staining, lymphocytes were fixed,
permeabilized, and stained with monoclonal antibodies using the Foxp3 staining set (eBioscience, San Diego, CA) according to man-
ufacturer’s instructions. 7-AAD (Tonbo Biosciences), Fixable Viability Dye eFluor 780 (Thermo Fisher Scientific, Waltham, MA), LIVE/
DEAD Fixable Blue Dead Cell Stain Kit (Thermo Fisher Scientific), or SYTOX Blue Dead Cell Stain (Thermo Fisher Scientific) was used
to discriminate dead cells. The stained samples were analyzed using LSR II, LSRFortessa, and Aria III flow cytometers with DIVA
software (all from BD Biosciences, Franklin Lakes, NJ) and FlowJo software version 10 (FlowJo LLC, Ashland, OR).

Adoptive transfer of PP cells

PP cells from ad libitum-fed mice were prepared as described above. The cells were labeled with CellTrace Violet (Thermo
Fisher Scientific) according to the manufacturer’s instructions and then suspended in PBS. The fluorescence-labeled cells
(1 3 107 cells/mouse) were intravenously injected into recipient ad libitum-fed or 18 h-fasted recipients. Both groups were maintained
under the same conditions after cell transfer. Eighteen hours later, transferred cells were detected in PPs, BM, and MLNs by flow
cytometry.

Photoconversion of PPs from KikGR mice

Photoconversion of the PPs of KikGR mice was performed as described previously (Schmidt et al., 2013; Tomura et al., 2014). Briefly,
KikGR mouse was anesthetized with isoflurane, shaved with an electric razor, and antiseptically prepared with 10% povidone-iodine.
The skin was incised anteriorly at the midline below the costal margin, and then abdominal wall was incised. Each PP was sequen-
tially drawn out from abdominal cavity, and the surgical site was covered by a piece of sterile aluminum foil with a 5 mm hole punched
in it to leave only the PP exposed. A Silver LED 430 with a high numerical aperture polymer optical fiber light guide and fiber collimator
(Prizmatix) was used as a 430-nm blue light source. Each PP was exposed for 2 minutes and immediately replaced into the peritoneal
cavity to avoid drying. The abdominal cavity and skin were closed with 4–0 nylon suture (Natsume Seisakusho). After photoconver-
sion surgery, the mice fasted for 36 h or fed ad libitum. Photoconverted cells in the BM, MLNs and the spleen were analyzed by a
FACSAria III flow cytometer (BD Biosciences).

Oral immunization with OVA

In the fasting mouse group, 36-h fasts began at 8:00 p.m. on day 0. At 8:00 a.m. on day 4, all mouse groups were given 200 mL of 7.5%
sodium bicarbonate in HBSS to neutralize gastric acid 1 h prior to oral immunization with 250 mL OVA (4 mg/mL; Sigma Aldrich) and

Cell 178, 1072–1087.e1–e6, August 22, 2019 e4

CT (40 mg/mL; List Biological Laboratories, Campbell, CA) in PBS. This immunization protocol with or without fasting was repeated
on day 7, 14, and 21. Fecal samples were collected on day 0, 18, 25, and 32 to measure OVA-specific IgA levels by enzyme-linked
immunosorbent assays (ELISA), while plasma samples were collected on day 32 to measure OVA-specific IgM, IgA, and IgG levels
by ELISA.

Detection of antibody responses by ELISA

To measure fecal IgA, fecal samples were homogenized in PBS (1 mL/100 mg feces) containing 1 3 Complete Mini Protease Inhibitor
Cocktail (Roche, Basel, Switzerland) and 0.02% sodium azide (Wako Pure Chemical Corporation), followed by centrifugation to
collect the supernatant as a fecal extract. Microlon ELISA plates (96-well; Greiner Bio-One, Kremsmünster, Austria) were coated
with 1 mg/mL OVA in PBS at 4 C overnight. After washing, the wells were blocked with 4-fold diluted Block Ace (DS Pharma Biomed-
ical, Saita, Japan) for 1 h at room temperature. After washing four times with PBS containing 0.05% Tween 20 (PBS-T), serially diluted
plasma and fecal extracts were added in duplicate (100 mL/well). Fecal extracts from day 0 or plasma from non-immunized mice were
included as a negative control. Horseradish peroxidase (HRP)-conjugated anti-mouse IgA, IgM, or IgG (Southern Biotech, Birming-
ham, AL) were used as antibodies. After incubation at room temperature for 1 h, the plates were extensively washed with PBS-T.
Specific antibody binding was visualized by adding 3,30 ,5,50 -tetramethylbenzidine as a substrate (Sigma-Aldrich) and then the
reaction was terminated by 1.2 M H2SO4. Endpoint titers were expressed as the reciprocal log2 of the last dilution, giving OD450
values higher than control samples (Yamamoto et al., 1998). For measurements of plasma total IgG and fecal total IgA, Mouse
IgG ELISA Quantitation Set (Bethyl Laboratories) and Mouse IgA ELISA Quantitation Set (Bethyl Laboratories) were used. For mea-
surements of plasma total and OVA-specific IgE, ELISA MAX Mouse IgE (Biolegend) and LEGEND Mc Mouse OVA Specific IgE ELISA
Kit with Pre-coated Plates (Biolegend) were used according to the manufacturer’s instructions.

Salmonella infection
rSalmonella–ToxC (DaroA, DaroD) and TT were kindly provided by the BIKEN Foundation (Osaka, Japan)(VanCott et al., 1996).
Ad libitum or fasting group mice were orally immunized with 5 3 107 CFU of rSalmonella-ToxC on day 4. In the fasting group,
36-h fasts began at 8:00 p.m. on day 0, 17, and 31. TT-specific IgA in feces was measured by ELISA. Flat-bottomed, 96-well
MaxiSorp Nunc-Immuno plates were coated overnight with 500 ng/well of TT. Plates were blocked with 2% BSA in PBS, and optically
diluted fecal extracts and sera were added into the plate wells. The Mouse IgA ELISA Quantitation Set (Bethyl Laboratories) was used
for antibody detection. To produce HRP signals were visualized by adding 3,30 ,5,50 -tetramethylbenzidine as a substrate (Sigma-
Aldrich) and then the reaction was terminated by 1.2 M H2SO4.
Food antigen-induced diarrhea model
To establish diarrhea, female mice were injected intraperitoneally with 100 mL OVA (1 mg/mL) and alum (1 mg/mL; Thermo Fisher
Scientific) in PBS on day 0 and 7. Starting on day 14, OVA (50 mg) was administered orally every three days (on day 14, 17, and
20). In the fasting group, 36-h fasts began at 8:00 p.m. on day 10 and 17. The severity of allergic reactions to OVA was evaluated
based on total and OVA-specific IgE in plasma and diarrhea occurrence, which was assessed by visually monitoring the mice for
up to 1 h after oral challenge. Fecal and plasma samples were collected on day 14 and 20 to measure total and OVA-specific IgA
and IgG, respectively.

Induction of oral tolerance

Mice in the fasting group were fasted for 36 h. After 36-h refeeding (9:00 a.m. on day 3), the mice were gavaged with 25 mg OVA in
200 mL PBS. Control mice received PBS only. On day 10, the mice were immunized subcutaneously with 100 mg OVA in 100 mL com-
plete Freund’s adjuvant (CFA; Sigma-Aldrich). Delayed-type hypersensitivity (DTH) was measured on day 17 as described previously
(Fujihashi et al., 2001). Briefly, 20 mL PBS containing 10 mg OVA was injected into the left ear pinna of the mice, while the right ear pinna
received PBS as a negative control. After 24 h, ear swelling was measured using a dial thickness gauge (Mitutoyo, Kanagawa, Japan).
The DTH response was expressed as the difference in ear thickness between the right and left ears. Plasma samples were collected
on day 24 to measure OVA-specific IgG levels by ELISA.

Immunofluorescence
For immunostaining, PPs were snap-frozen in liquid nitrogen and embedded in OCT compound (Sakura, Tokyo, Japan). Frozen sec-
tions (4-mm thick) were fixed in dry ice-cold acetone for 15 min and then completely dried at room temperature for 1 h. After blocking
with an anti-CD16/CD32 antibody (Tonbo Biosciences) in 10-fold diluted Block Ace (blocking buffer; DS Pharma Biomedical) for
30 min, the sections were incubated with primary antibodies (hamster monoclonal anti-mouse CD3ε; BD pharmagen, or rat mono-
clonal anti-mouse CD45R/B220; eBiosciences) in blocking buffer overnight at 4 C. Bound antibodies were detected with FITC-
labeled anti-hamster (Southern Biotech) or TRITC-labeled anti-rat antibodies (Southern Biotech) and counterstained with DAPI.
The sections were then examined with a confocal microscope (BX50; Olympus, Tokyo, Japan).
Frozen BM sections (10-mm thick) were prepared according to the Kawamoto method (Kawamoto, 2003; Yamazaki et al., 2011)
and were fixed in 4% paraformaldehyde. After blocking with Protein Block (Dako, Jena, Germany) for 1 h, the fixed sections were
washed with 0.3% (v/v) Triton X-100 in PBS and incubated with Alexa Fluor 488-conjugated anti-IgM antibodies (Thermo Fisher
Scientific), anti-CD31 and anti-endomucin antibody, for 16 h at 4 C. The stained sections were again washed with 0.3% (v/v) Triton

e5 Cell 178, 1072–1087.e1–e6, August 22, 2019

X-100 in PBS and further stained with DAPI and secondary antibodies (Alexa Fluor 633-conjugated anti-rat IgG; Thermo Fisher Sci-
entific) for 4 h at room temperature. All antibodies were diluted in Protein Block. Immunofluorescence data were obtained and
analyzed with a confocal laser scanning microscope (FV1000; Olympus). B cell number and the distance between naive B cells
and vessels were determined using Imaris (Zeiss, Oberkochen, Germany) and ImageJ Software (NIH).

Histological analysis
PPs were fixed in 4% paraformaldehyde and embedded in paraffin. Tissue sections (3.5-mm thick) were then stained after deparaffi-
nization. For histological examination, the sections were stained with hematoxylin (Dako) and eosin (Wako Pure Chemical Corpora-
tion). Antigen retrieval was performed by autoclaving the sections in Target Retrieval Solution (Dako). Then, the sections were treated
with 3% H2O2 (Wako Pure Chemical Corporation) in methanol to inactivate endogenous peroxidase. After blocking with Protein Block
Serum-Free (Dako) for 1 h, the sections were incubated with anti-cleaved Caspase-3 (0.5 mg/mL; Cell Signaling Technology, MA,
USA) for 16 h at 4 C. After washing with PBS, sections were incubated with ENVISION+ System-HRP labeled Polymer Anti-Rabbit
(Dako) for 30 min at room temperature. The ImmPACTTM DAB peroxidase substrate (Vector Laboratories) was used for diaminoben-
zidine staining, and hematoxylin was used for counterstaining. For TUNEL staining, the DeadEnd Colorimetric TUNEL System
(Promega, Madison, WI) were used according to the manufacturer’s instructions. All sections were examined via confocal micro-
scopy (BX50).

Transmission electron microscopy

PPs were pre-fixed in an aldehyde mixture (2% paraformaldehyde and 2% glutaraldehyde in 30 mM HEPES buffer containing
100 mM NaCl and 2 mM CaCl2; pH adjusted to 7.4) for 1 h at room temperature and post-fixed in an aldehyde-OsO4 mixture (1%
OsO4, 1.25% glutaraldehyde, 1% paraformaldehyde, and 0.32% K3[Fe(CN)6] in 30 mM HEPES buffer; pH 7.4) for 1 h at room tem-
perature. The fixed blocks were washed three times with Milli Q water (Milli Q Integral; Merck Millipore, Burlington, MA), dehydrated
using a graded ethanol series, and then embedded in Quetol 812 (Nisshin EM, Tokyo, Japan). The resin blocks were sectioned
(70-nm thick) using an ultramicrotome (EM UC7; Leica, Wetzlar, Germany), contrasted with uranyl acetate and lead citrate, and finally
examined with a transmission electron microscope (JEM-1400; JEOL, Tokyo, Japan).

Reverse transcription and quantitative PCR

Total RNA from the BM was extracted using TRIzol Reagent (Thermo Fisher Scientific) while total RNA from PPs and BLS12 cells was
isolated using the RNeasy Mini Kit (QIAGEN, Hilden, Germany) according to manufacturer’s instructions. RNA was reverse-
transcribed to obtain cDNA using the iScript Advanced cDNA Synthesis Kit (Bio-Rad Laboratories, Hercules, CA). RT-qPCR was
performed using the 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA) or the CFX384 Real-Time System
(Bio-Rad Laboratories) with SYBR Green (Applied Biosystems) and TaqMan assay (Roche). The oligonucleotide primers for Rpl32,
Cxcl12, Cxcl13, and Ccl20 were purchased from Exigen (Tokyo, Japan). TaqMan assay probe for Cxcl13 was obtained from Applied
Biosystems.

Bio-plex detection of phosphorylated proteins

Tissues were homogenized in 500 mL lysis solution (1X cell lysis factor QG and 2 mM phenylmethylsulfonyl fluoride in cell lysis buffer),
vortexed, and placed on ice. The tissue homogenate was transferred to a microcentrifuge tube and frozen at 70 C. The samples
were then thawed, sonicated, and centrifuged at 15,000 3 g for 10 min, after which the supernatant was collected. Protein concen-
trations were determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific) according to manufacturer’s instructions.
Lysates were adjusted to 200 mg/mL to detect the following key phosphorylated proteins of Akt downstream signaling, Akt (Ser473),
BAD (Ser136), GSK-3a/b (Ser21/Ser9), IRS-1 (Ser636/Ser639), mTOR (Ser2448), PTEN (Ser280), p70 S6 kinase (Thr389), and S6 ribosomal
protein (Ser235/Ser236), in PPs and the BM, followed by quantitative analysis with the Bio-Plex Phosphoprotein Assay (Bio-Plex Pro
Cell Signaling Akt Panel; 8-plex #lq00006jk0k0rr; Bio-Rad Laboratories) and the Bio-Plex 3D System (Bio-Rad Laboratories)
according to manufacturer’s instructions.

Plasma parameters
Plasma glucose levels were measured using Spotchem EZ SP-4430 (Arkray, Kyoto, Japan) with an automated dry chemistry system
(Spotchem II; Arkray). Plasma BHB concentration was measured using the Serotec Ketone-H Kit (Serotec Co., Ltd., Sapporo, Japan)
according to the manufacturer’s instructions.

QUANTIFICATION AND STATISTICAL ANALYSIS

For statistical analyses of two or more groups, we used Student’s t test or ANOVA followed by Tukey’s test. When variances were not
homogeneous, the data were analyzed by the non-parametrical Mann-Whitney U test or the Dunnett’s test. Two-way ANOVA was
applied to the time-course analysis of TT-specific IgA production. Differences with P-values < 0.05 were considered statistically sig-
nificant. Statistical analyses were performed using GraphPad Prism 8 software (GraphPad Software, Inc., La Jolla, CA). The exper-
iments were not randomized, and the investigators were not blinded to allocation during experiments and outcome assessment.

Cell 178, 1072–1087.e1–e6, August 22, 2019 e6

Supplemental Figures

Figure S1. The Behavior of Lymphocytes in Multiple Organs during Fasting and Refeeding, Related to Figure 2
(A) Numbers of the indicated cell subsets in PPs, the CPs, the MLNs, and SILP of mice fed ad libitum (PPs, n = 9; CPs, MLNs, and SILP, n = 10) or mice fasted for
36 h (PPs, n = 12; CPs, MLNs, and SILP, n = 10).
(B) Numbers of PP cells from proximal (Prox), middle (Mid), or distal (Dis) small intestine (each group, n = 10).
(C) Numbers of the indicated cell subsets from PPs at each time point. Mice were fasted for 36 h (blue background) and refed with CE2 for 72 h (red background)
(0, 84, and 108 h, n = 9; 24, 36, and 60 h, n = 12).
(D) Numbers of the indicated cell subsets in the spleen of mice fed ad libitum, mice fasted for 36 h, and mice refed with CE2 for 48 h (each group, n = 8).
Data represent the means ± SEM. Student’s t test (A and B). ANOVA followed by Dunnett’s test (C) or Tukey’s test (D). *p < 0.05; **p < 0.01; n.s., not significant.
(legend on next page)
Figure S2. Flow Cytometry Gating Strategies and Localization of Naive B Cells in the BM, Related to Figure 2
(A) Flow cytometry gating strategies on lymphocytes, granulocytes, macrophages, hematopoietic stem cells, and multipotent progenitors in the BM.
(B) Sections of the BM, which were obtained from mice fed ad libitum, fasted for 36 h, or refed with CE2 for 48 h, were stained with Abs against IgM (green) and
DAPI (gray) shown on the left and Abs against CD31 (blue), Emcn (blue), and DAPI (gray) shown on the right. The solid arrow indicates IgM+ naive B cells in
intravascular space. Scale bar: 20 mm.
(C) The ratio of IgM+ naive B cells in DAPI+. Calculated from Figure S2B (each group, n = 8).
Data represent the means ± SEM (C) ANOVA followed by Tukey’s test. *p < 0.05, **p < 0.01.
Figure S3. Minimal Contribution of Gut-Microbiota to the Behavior of Lymphocytes during Fasting, Related to Figure 2
Numbers of the indicated cell subsets in PPs and the BM of mice fed ad libitum (n = 9) or fasted for 36 h (n = 8). Six-week-old mice were kept under germ-free
conditions. Data represent the means ± SEM. Student’s t test. *p < 0.05; **p < 0.01.
Figure S4. The Behavior of Lymphocytes during Fasting and Refeeding in Aged Mice, Related to Figure 2
(A and B) Numbers of the indicated cell subsets in PPs and the BM of mice fed ad libitum, fasted for 36 h, or refed with CE2 for 48 h. Sixteen-week-old (A) and
40–50-week-old (B) mice were kept under SPF conditions (each group, n = 8).
Data represent the means ± SEM. ANOVA followed by Tukey’s test. *p < 0.05; **p < 0.01.
Figure S5. Minimal Effects of FTY720 on B Cell Dynamics in PPs and the BM, Related to Figure 4
(A) Diagram illustrating the FTY720 treatment protocol. FTY720 or vehicle (PBS) were orally administered into ad libitum-fed or fasting mice.
(B and C) Body weight (B) and numbers of the indicated cell subsets in PPs and the BM (C) of mice fed ad libitum or fasted for 36 h. Mice were treated with vehicle
or FTY720 (each group, n = 8).
Data represent the means ± SEM. ANOVA followed by Tukey’s test (B). Student’s t test (C).
*p < 0.05; **p < 0.01; n.s., not statistically significant.
Figure S6. Quantification of Phosphorylated Akt-mTOR Signaling Proteins in PPs and the BM, Related to Figure 4
(A and B) Quantification of phosphorylated Akt, BAD, GSK-3a/b, IRS-1, PTEN, S6 ribosomal protein, mTOR, and p70 S6 kinase in PPs (A, n = 18) and the BM
(B, n = 6) using whole tissue lysates. The mean of mean fluorescent intensity (MFI) from mice fasted for 36 h, mice refed with CE2 for 24 h and 48 h, and mice
treated with rapamycin was normalized by that of mice fed ad libitum. Data are represented as a heatmap.
Figure S7. The Effect of Fasting on Salmonella-Induced Mucosal Responses, Related to Figure 6
(A) Diagram illustrating the protocol for oral immunization model using S. Typhimurium expressing the fragment C of the tetanus toxoid (Salmonella-ToxC).
Mice were fasted for 36 h on day 0, 17, and 31 in the fasting-refed group.
(B) Absorbance of tetanus toxoid (TT)-specific IgA in feces from mice eating ad libitum (n = 8) or fasting-refed (n = 7). Data represent the means ± SEM.
Two-way ANOVA.