Stem Cell Research 74 (2024) 103282

Contents lists available at ScienceDirect

Stem Cell Research

journal homepage: www.elsevier.com/locate/scr

Lab Resource: Multiple Cell Lines

Generation of induced pluripotent stem cell lines from two unrelated

individuals with familial hypertrophic cardiomyopathy carrying the
MYBPC3 missense c.1484G>A mutation
Marta Ribeiro a, b, Sandra Martins c, *, Teresa Carvalho c, Marta Furtado c,
Joaquim Sampaio Cabral a, b, Dulce Brito d, e, Maria Carmo-Fonseca c, Simão Teixeira da
Rocha a, b, *
a
iBB - Institute for Bioengineering and Biosciences and Department of Bioengineering, Instituto Superior Técnico, Universidade de Lisboa, Portugal
b
Associate Laboratory i4HB Institute for Health and Bioeconomy, Instituto Superior Técnico, Universidade de Lisboa, Portugal
c
Instituto de Medicina Molecular João Lobo Antunes, Faculdade de Medicina, Universidade de Lisboa, Portugal
d
Heart and Vessels Department, Cardiology Division, Centro Hospitalar Universitário de Lisboa Norte, Lisboa Portugal
e
Centro Cardiovascular da Universidade de Lisboa (CCUL@RISE), Faculdade de Medicina da Universidade de Lisboa, Lisboa, Portugal

A B S T R A C T

Familial hypertrophic cardiomyopathy (HCM) is the most common inherited heart condition. HCM patients show left ventricle hypertrophy without any associated
loading conditions, being at risk for heart failure and sudden cardiac death. Two induced pluripotent stem cell (iPSC) lines were generated from peripheral blood
mononuclear cells obtained from two unrelated individuals, a 54-year-old male (F81) and a 44-year-old female (F93), both carrying the MYBPC3 c.1484G>A HCM
mutation. iPSCs show expression of pluripotency markers, trilineage differentiation capacity and a normal karyotype. This resource enables further assessment of the
pathophysiological development of HCM.

(continued )
Resource Table:
Unique stem cell lines identifier 1. IBBISTi005-A
Unique stem cell lines identifier 1. IBBISTi005-A 2. IBBISTi005-B
2. IBBISTi005-B 3. IBBISTi006-A
3. IBBISTi006-A 4. IBBISTi006-B
4. IBBISTi006-B Method of reprogramming Transgene free (CytoTune-iPSC 2.0 Sendai
Alternative name(s) of stem cell 1. F81 (940) clone 5 (5F81) Reprogramming kit). This system includes three
lines 2. F81 (940) clone 8 (8F81) vector preparations: polycistronic KOS
3. F93 clone 5 (5F93) (KLF4–OCT3/4–SOX2), C-MYC, and KLF4
4. F93 clone 6 (6F93) Genetic Modification N/A
Institution Instituto Superior Técnico, University of Lisbon Type of Genetic Modification Hereditary
Contact information of Dr. Simão Teixeira da Rocha; simao. Evidence of the reprogramming qRT-PCR
distributor rocha@tecnico.ulisboa.pt transgene loss
Type of cell lines iPSC Associated disease Hypertrophic Cardiomyopathy
Origin Human Gene/locus MYBPC3 c.1484G>A (p.Arg495Gln) Chr11:
Additional origin info required F81 47364269 (on Assembly GRCh37)
for human ESC or iPSC Age: 54 Date archived/stock date 2022
Sex: Male Cell line repository/bank https://hpscreg.eu/user/cellline/edit/IBB
F93 ISTi005-A
Age: 44 https://hpscreg.eu/user/cellline/edit/IBB
Sex: Female ISTi005-B
Cell Source Peripheral Blood Mononuclear Cells (PBMCs) https://hpscreg.eu/user/cellline/edit/IBB
Clonality Clonal ISTi006-A

(continued on next column) (continued on next page)

* Corresponding authors.
E-mail addresses: sandramartins@medicina.ulisboa.pt (S. Martins), simao.rocha@tecnico.ulisboa.pt, simaoteixeiradarocha@medicina.ulisboa.pt (S.T. da Rocha).

https://doi.org/10.1016/j.scr.2023.103282
Received 3 November 2023; Received in revised form 8 December 2023; Accepted 11 December 2023
Available online 13 December 2023
1873-5061/© 2023 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-
nc-nd/4.0/).
M. Ribeiro et al.
(continued )
Unique stem cell lines identifier 1. IBBISTi005-A
2. IBBISTi005-B
3. IBBISTi006-A
4. IBBISTi006-B
https://hpscreg.eu/user/cellline/edit/IBB
ISTi006-B
Ethical approval The study was conducted in accordance with the
Declaration of Helsinki, and approved by the
Ethics Committee of Lisbon Academic Medical
Center (Ref. n.◦ 468/20, February 23, 2020)
1. Resource utility
These iPSC lines from two unrelated individuals harbor the
c.1484G>A mutation in the MYBPC3 gene, previously associated with
HCM and reported as pathogenic/likely pathogenic. Upon cardiac dif­
ferentiation, such iPSCs can be used as a HCM disease model to elucidate
the underlying pathophysiological mechanisms of the disease associated
with this mutation.
2. Resource details
Hypertrophic cardiomyopathy (HCM) is a primary disease of the
myocardium and the most common genetic cardiovascular disorder,
with an estimated prevalence of up to 1:200 (Semsarian et al., 2015;
Maron et al., 2018). The clinical hallmark of the disease is the increase in
heart mass and left ventricular hypertrophy, being its diagnosis pri­
marily based on a left ventricular wall thickness ≥15 mm in the absence
of abnormal loading conditions (Elliott, 2014). Here, two induced
pluripotent stem cell (iPSC) lines were derived from peripheral blood
mononuclear cells (PBMCs) obtained from unrelated individuals from
different families, named F81 (male) and F93 (female), diagnosed with
familial HCM, at the ages of 31 and 20, respectively. Both individuals
had a similar maximal wall thickness of 20–21mm (normal < 12 mm)
during follow-up and genetic testing revealed they are heterozygous for
the c.1484G>A mutation (p. Arg495Gln) in MYBPC3, one of the most
frequently mutated genes in HCM (Walsh, 2017). This mutation was
previously associated with familial HCM (Niimura, 1998) and reported
as pathogenic/likely pathogenic in ClinVar. Clinically, patient F93
presented a more extensive left ventricular hypertrophy (septal, ante­
rior, and lateral) in comparison with patient F81 that only revealed
septal left ventricular hypertrophy.
PBMCs obtained from the patient’s whole blood were reprogrammed
using a non-integrative approach involving Sendai viruses (SeV) to
temporarily introduce and overexpress the reprogramming factors
OCT3/4, SOX2, KLF4, and C-MYC. Independent colonies of stem-like
cells were transferred to Matrigel-coated plates and expanded in
mTeSR™ Plus. Genomic DNA was isolated from selected iPSC clones and
Sanger sequencing confirmed the presence of the heterozygous MYBPC3
c.1484G>A mutation (Fig. 1A). The established iPSC lines for each HCM
individual, 5F81 and 6F93, showed a typical stem-like morphology and
stain positive for the pluripotent stem cell biomarkers, OCT4 and SOX2,
by immunofluorescence (Fig. 1B), after loss of expression of the SeV was
confirmed by qRT-PCR. This assay used primers for SeV normalized to
the housekeeping gene GAPDH (Table 2) and was performed in iPSCs,
PBMCs 3 days after SeV infection (SeV + cells) and non-infected cells
(NIC) (Fig. 1C). 5F81 and 6F93 iPSCs showed a normal male 46, XY and
female 46, XX karyotype, respectively (Fig. 1D). Expression of the plu­
ripotency markers OCT4, SOX2, SSEA4 and TRA-1–60 was quantita­
tively confirmed by flow cytometry for both iPSC lines (Fig. 1E). To
assess their trilineage differentiation potential, iPSCs were differentiated
using the STEMdiff™ trilineage differentiation kit and assessed for dif­
ferentiation markers by immunofluorescence (IF) and qRT-PCR. Both
5F81 and 6F93 showed the ability to correctly differentiate into
2
Stem Cell Research 74 (2024) 103282
endoderm (IF staining for SOX17 and CD184 and qRT-PCR for FOXA2),
mesoderm (IF staining for αSMA, and qRT-PCR for BRACHYURY and
TBX6) and ectoderm (IF staining for PAX6 and NESTIN) (Fig. 1F). All
iPSC cultures tested negative for mycoplasma and clonal identity was
confirmed using short tandem repeat (STR) DNA analysis of parental
PBMCs and derived iPSCs. An additional iPSC clone per individual was
generated (8F81 and 5F93), and the characterization of the two clones
derived from of each of the two individuals is presented in Supple­
mentary Fig. 1 and summarized in Table 1.
3. Materials and methods
3.1. Generation and maintenance of iPSC lines
Whole blood from patients was collected upon written informed
consent in accordance with European and National ethical regulation
(law 12/2005) of the Lisbon Academic Medical Center Biobank (Bio­
banco-iMM) and approved by the Ethics Committee of Lisbon Academic
Medical Center (Ref. n◦ 468/20, February 23, 2020).
PBMCs were isolated from whole blood using Ficoll-Paque and cry­
opreserved in 20 % DMSO in FBS, according to the Biobanco-iMM
normalized procedure. For reprogramming, PBMCs were thawed and
cultured in StemPro™-34 medium (Gibco, 10639011), with the appro­
priate cytokines (IL-3, IL-6, FLT-3 and SCF (Prepotech/Tebu-bio,
200.03, 200.06, 300-19, 300-07) for 4 days, after which they were
transduced using CytoTune™-iPS 2.0 Sendai Reprogramming Kit
(Thermo Fisher Scientific, A16517), according to the manufacturers’
instructions. At day 3 post transduction, cells were reseeded into 6-well
culture plates coated with Matrigel® (Corning, 354230) and transi­
tioned to mTeSR™Plus Medium (StemCell Technologies, 100-0276)
over the following days. Based on stem cell morphology, colonies
were individually picked and transferred to new Matrigel® (Corning,
354230) coated dishes in mTeSR™Plus. Cells were then continuously
passed and checked for SeV clearance by qRT-PCR. Cells were kept at
37 ◦ C in a humidified 5 % CO2, 20 % O2 incubator and passaged 1:3–1:6
when the colonies covered approximately 80 % of the surface area of the
culture dish, every 3–4 days, using 0.5 mM EDTA dissociation buffer
(Thermo Fisher Scientific, 15575020). No ROCK inhibitor was used
upon passaging. All analyses were performed with iPSCs between pas­
sages 10 and 20.
3.2. Targeted sequencing
Genomic DNA from iPSCs were isolated using conventional phenol:
chloroform: isoamyl alcohol extraction. DNA was PCR amplified for 35
cycles and melting temperature of 60 ◦ C using primers for the region of
interest of the MYBPC3 gene (Table 2) in a BioRad T100 thermocycler
and further sequenced using Sanger sequencing performed by StabVida
Lda. (Lisbon, Portugal).
3.3. G-banding karyotyping
iPSCs in an exponential growth phase were treated with colcemid
(10 μg/ml; Thermo Fisher Scientific, 15212012) for 5 h at 37 ◦ C to arrest
cells in the metaphase. Cells were then harvested with Accutase
(STEMCELL Technologies, 07922), incubated with hypotonic potassium
chloride solution for 30 min at 37 ◦ C and further fixed with 1:3 (v/v)
acetic acid:methanol solution. Karyotype analysis was performed by
Genomed SA (Lisbon, Portugal).
3.4. Trilineage differentiation potential
Differentiation potential of iPSCs into endoderm, mesoderm and
ectoderm germ layers was evaluated using the STEMdiff Trilineage
Differentiation Kit (STEMCELL Technologies, 05230), following manu­
facturer’s instructions. The presence of lineage specific markers was
M. Ribeiro et al. Stem Cell Research 74 (2024) 103282

Fig. 1. Characterization of the 5F81 (IBBISTi005-A) and 6F93 (IBBISTi006-B) iPSC lines. (A) Schematic representation of MYBPC3 c.1484 region and Sanger
sequencing results of generated iPSC lines. (B) On the left, bright field photomicrograph of iPSC colonies. Scale bar, 200 μm. On the right, representative immu­
nofluorescence images for OCT4 and SOX2 staining. Scale bar, 20 μm. (C) qRT-PCR analysis for SeV expression in iPSCs clones, infected (SeV +) and non-infected
cells (NIC). Relative expression normalized to GAPDH. (D) G-banding karyotyping (E) Flow cytometry analysis of SSEA4, TRA-1-60, OCT4 and SOX2 pluripotent stem
cell markers. (F) On the left, representative immunofluorescence images for trilineage differentiation: Endoderm (SOX17 and CD184), Mesoderm (αSMA) and
Ectoderm (PAX6 and NESTIN). Scale bar, 20 μm. On the right, qRT-PCR analysis for Mesoderm (Brachyury and TBX6) and Endoderm (FOXA2) markers, in both
differentiated and non-differentiated cells (hiPSCs). Relative expression normalized to U6.

3
M. Ribeiro et al. Stem Cell Research 74 (2024) 103282

Table 1
Characterization and validation.
Classification Test Result Data

Morphology Photography Bright field Normal 5F81 and 6F93 Fig. 1, panel B
8F81 and 5F93 Supplementary Fig. 1, panel
B
Phenotype Qualitative analysis Expression of pluripotency markers: OCT4 and SOX2, Fig. 1, panel B
(Immunocytochemistry) confirmed by confocal imaging Supplementary Fig. 1, panel
5F81 and 6F93 B
8F81 and 5F93
Quantitative analysis High levels of expression of pluripotency markers: Fig. 1, panel E
(Flow cytometry) OCT4, SOX2, SSEA4 and TRA1-60 Supplementary Fig. 1, panel
5F81 and 6F93 E
8F81 and 5F93
Genotype Karyotype (G-banding) and resolution 46 XY (5F81), Resolution 300–500 Fig. 1, panel D
46 XX (6F93), Resolution 300–500 Supplementary Fig. 1, panel
8F81, 46 XY, Resolution 300-500 D
5F93, 46 XX, Resolution 300-500
Identity Microsatellite PCR (mPCR) Not performed
OR 16 STR loci tested: 100 % matched 5F81, 6F93 & respective PBMCs Submitted in archive with
STR analysis 8F81, 5F93 & respective PBMCs journal
Mutation analysis (IF Sequencing Heterozygous mutation of MYBPC3 c.1484G>A (p.Arg495Gln), Fig. 1, panel A
APPLICABLE) confirmed by Sanger sequencing Supplementary Fig. 1, panel
5F81 and 6F93 A
8F81 and 5F93
Southern Blot OR WGS Not performed N/A
Microbiology and virology Mycoplasma Mycoplasma testing by PCR: Available upon request
Negative
5F81 and 6F93
8F81 and 5F93
Differentiation potential Directed differentiation All the iPSC lines differentiated into three germ layers: Fig. 1, panel F
Ectoderm (PAX6, NESTIN), Supplementary Fig. 1, panel
Endoderm (SOX17, CD184, FOXA2) F
Mesoderm (αSMA, BRACHYURY, TBX6), confirmed by immunostaining
or qRT-PCR
5F81 and 6F93
8F81 and 5F93
Donor screening (OPTIONAL) HIV 1 + 2 Hepatitis B, Hepatitis C Not performed N/A
Genotype additional info Blood group genotyping Not performed N/A
(OPTIONAL) HLA tissue typing Not performed N/A

assessed by immunofluorescence and qRT-PCR (Table 2). 3.7. Flow cytometry

3.5. Quantitative real time (qRT)-PCR
Total RNA was extracted using NZYol (NZYTech®, MB18501), fol­
lowed by DNase I (Roche®, 04716728001) treatment. cDNA was syn­
thesized using the Transcriptor High Fidelity cDNA Synthesis Kit
(Roche®, 5081963001) and further amplified by qRT-PCR using the
Universal SYBR Green Supermix (Bio-Rad, 1725274) using specific
primers for the selected genes (Table 2). All PCR reactions with 40 cycles
were run in triplicate, using the ViiA™7 RT-PCR Systems (Applied
BioSystems). mRNA expression levels are presented as the fold change of
the target gene expression upon normalization against U6 (differentia­
tion markers) or GAPDH (SeV clearance) reference genes (2–ΔCt).
3.6. Immunoflorescence (IF) assays
Cells plated on coverslips were fixed with 3.7 % PFA in PBS for 10
min at room temperature (RT), permeabilized with 0.5 % Triton X-100
in PBS for 10 min at RT and blocked with 5 % fetal bovine serum in PBS
(FBS, Life Technologies, A5256701) for 30 min at RT. Afterwards, cells
were incubated overnight at 4 ◦ C with the indicated primary antibodies
(Table 2), followed by incubation with the respective secondary anti­
bodies diluted in 1 % FBS in PBS (Table 2) for 1 h at RT. Nuclei were
counterstained with DAPI (DAPI, 0.2 mg/ml; Cat# D9542, Sigma).
Fluorescence images were acquired with Zeiss LSM 710 Confocal Laser
Point-Scanning Microscope.
After dissociation into single cells, iPSCs were fixed in 2 % PFA and
then stored at 4 ◦ C. For intracellular staining, cells were permeabilized
with 0.1 % Saponin (Sigma, SAE0073) for 15 min at RT. After washing,
cells were incubated with primary antibodies (OCT4 or SOX2) (Table 2)
for 1 h at RT, washed twice with 1 % FBS/1xPBS and further incubated
for 45 min, in the dark, with the secondary antibody. For surface
staining, cells were resuspended in conjugated primary antibodies
(SSEA4 or TRA1-60) (Table 2), diluted in 3 % FBS/1xPBS during 30 min
at RT. Prior to analysis on FACSCalibur™ flow cytometer (Becton
Dickinson), all cells were resuspended in 1xPBS. For each experimental
sample, 10.000 events were collected within the defined gate, based on
side scatter (SSC) and forward scatter (FSC). Results were analyzed using
FlowJo software.
3.8. Short tandem repeat (STR) analysis
To determine clonality of each generated cell line, genomic DNA
from both iPSCs and respective PBMCs were isolated using phenol:
chloroform: isoamyl alcohol extraction and sent to Genomed SA (Lisbon,
Portugal), where STR DNA analyses were performed. Briefly,
AmpFLSTR® Indentifiler® Plus PCR Amplification Kit was used in
multiplex PCR to amplify fifteen STR loci (D8S1179, D21S11, D7S820,
CSF1PO, D3S1358, TH01, D13S317, D16S539, D2S1338, D19S433,
vWA, TPOX, D18S51, D5S818, FGA) plus a gender determining marker,
Amelogenin (AMEL).

4
M. Ribeiro et al. Stem Cell Research 74 (2024) 103282

Table 2
Reagents details.
Antibodies used for immunocytochemistry/flow-cytometry

Antibody Dilution Company Cat # RRID

Pluripotency Markers (FC) Mouse anti-OCT4 1:400 Millipore, MAB4419 AB_1977399

Mouse anti-SOX2 1:200 R&D Systems, MAB2018 AB_358009
Mouse anti-SSEA4 (PE) 1:20 Miltenyi Biotec, 130–098–369 AB_2653519
Mouse anti-TRA1-60 (PE) 1:10 Miltenyi Biotec, 130–100–347 AB_2654227
Pluripotency Markers (IF) Mouse anti-OCT4 1:200 Millipore, MAB4419 AB_1977399
Mouse anti-SOX2 1:200 R&D Systems, MAB2018 AB_358009
Differentiation Markers (IF) Rabbit anti-PAX6 1:400 Biolegend, 901,301 AB_2565003
Mouse anti-NESTIN 1:400 R&D Systems, MAB2736 AB_2282664
Rabbit anti-SOX17 1:200 Abcam, ab224637 AB_2801385
PE Mouse anti-CD184 1:20 Biolegend, 306,506 AB_314612
Mouse anti-αSMA 1:100 SIGMA, A2547 AB_476701
Secondary antibodies (FC) Goat anti-mouse IgG, Alexa 1:1000 Thermo Fisher Scientific, A- 11,001 AB_2534069
Fluor 488
Secondary antibodies (IF) Goat anti-mouse IgG, Alexa 1:500 Thermo Fisher Scientific A- 11,003 AB_2534071
Fluor 546
Goat anti-mouse IgG, Alexa 1:500 Thermo Fisher Scientific, A- 11,001 AB_2534069
Fluor 488
Goat anti-rabbit IgG, Alexa 1:500 Thermo Fisher Scientific A-11034 AB_2576217
Fluor 488

Primers

Target Size of band Forward/Reverse primer (5′-3′)

Sendai reprogramming vector (qRT-PCR) SeV 181 bp GGATCACTAGGTGATATCGAGC/ACCAGACAAGAGTTTAAGAGATATGTATC

House-Keeping Genes (qRT-PCR) GAPDH 238 bp TCGTGGAGTCCACTGGCGTC/TCATGAGTCCTTCCACGATAC
U6 126 bp CGTTCGGCAGCACATATAC/AAATATGGAACGCTTCACGA
Differentiation Markers (qRT-PCR) BRACHYURY 102 bp TCAGCAAAGTCAAGCTCACCA/CCCCAACTCTCACTATGTGGATT
TBX6 75 bp ACCGTGTCTACATTCACCCC/CACGATGGAAAGACACAGGC
FOXA2 96 bp GGTGATTGCTGGTCGTTTGT/CTCGTGCCCTTCCATCTTCA
Targeted mutation analysis (PCR) MYBPC3 234 bp GGGTGGAGTTTGAGTGTGAAG/CAGCATGGCCTCGTTGAT

3.9. Mycoplasma detection Acknowledgements

iPSC cultures were confirmed to be mycoplasma free using qPCR
Mycoplasma Test (Mycoplasmacheck, Eurofins Genomics) following
manufacturer’s instructions.
CRediT authorship contribution statement
Marta Ribeiro: Conceptualization, Funding acquisition, Supervi­
sion, Writing – review & editing. Sandra Martins: Conceptualization,
Investigation, Methodology, Supervision, Writing – review & editing.
Teresa Carvalho: Investigation, Methodology. Marta Furtado:
Conceptualization, Funding acquisition, Supervision, Writing – review
& editing. Joaquim Sampaio Cabral: Conceptualization, Funding
acquisition. Dulce Brito: Investigation, Resources. Maria Carmo-Fon­
seca: Conceptualization, Funding acquisition, Supervision, Writing –
review & editing. Simão Teixeira da Rocha: Conceptualization,
Funding acquisition, Investigation, Methodology, Project administra­
tion, Supervision, Writing – review & editing.
Declaration of competing interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influence
the work reported in this paper.
We are grateful to the two individuals for their generous gift of a
blood sample. We are also thankful to Ângela Afonso and her team from
Biobanco-iMM for the PBMC collection. This work was supported by "la
Caixa" Foundation under the agreement LCF/PR/HR20/52400021.
Simão Teixeira da Rocha is supported by an assistant research contract
2021.00660.CEECIND from Fundação para Ciência e Tecnologia/Min­
istério da Ciência, Tecnologia e Ensino Superior (FCT/MCTES).
Appendix A. Supplementary data
Supplementary data to this article can be found online at https://doi.
org/10.1016/j.scr.2023.103282.
References
Elliott, P.M., et al., 2014. 2014 ESC Guidelines on diagnosis and management of
hypertrophic cardiomyopathy: The Task Force for the Diagnosis and Management of
Hypertrophic Cardiomyopathy of the European Society of Cardiology (ESC). Eur.
Heart J. 35, 2733–2779.
Maron, B.J., Rowin, E.J., Maron, M.S., 2018. Global burden of hypertrophic
cardiomyopathy. JACC Heart Fail 6, 376–378.
Niimura, H., et al., 1998. Mutations in the gene for cardiac myosin-binding protein C and
late- onset familial hypertrophic cardiomyopathy. N. Engl. J Med. 338, 1248–1257.
Semsarian, C., Ingles, J., Maron, M.S., Maron, B.J., 2015. New perspectives on the
prevalence of hypertrophic cardiomyopathy. J. Am. College Cardiol. 65, 1249–1254.
Preprint at https://doi.org/10.1016/j.jacc.2015.01.019.
Walsh, R., et al., 2017. Reassessment of Mendelian gene pathogenicity using 7,855
cardiomyopathy cases and 60,706 reference samples. Genet. Med. 19, 192–203.