See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/245706195

Grant's Atlas of Anatomy; Grant's Dissector

Article in JAMA The Journal of the American Medical Association · January 2008
DOI: 10.1001/jama.299.2.225-b

CITATIONS READS

0 9,967

1 author:

G.H. Sperber
University of Alberta
144 PUBLICATIONS 1,551 CITATIONS

SEE PROFILE

All content following this page was uploaded by G.H. Sperber on 17 January 2018.

The user has requested enhancement of the downloaded file.

 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 10: 221-225, 2002
Molecular cloning and characterization of OSR1
on human chromosome 2p24
MASARU KATOH
Genetics and Cell Biology Section, Genetics Division, National Cancer Center Research Institute,
Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
Received April 9, 2002; Accepted May 2, 2002
Abstract. During Drosophila hindgut development, bowl,
caudal/CDX, brachyenteron/Brachyury/TBX, fork head/FOX,
drumstick, lines, and wingless/WNT play important roles.
Drosophila bowl gene is homologous to Drosophila odd-
skipped (odd) gene and odd-skipped related gene (sob). Here,
human OSR1, related to Drosophila odd, was isolated using
bioinformatics and cDNA-PCR. OSR1 was found to encode
266 amino-acid protein with three C2H2-type zinc fingers, a
tyrosine phosphorylation site (Tyr 203), and several putative
PXXP SH3 binding motifs. Three zinc fingers and a tyrosine
phosphorylation site were conserved among human OSR1,
OSR2, Drosophila odd, sob, and bowl. OSR1 showed 63.6%
total amino-acid identity with OSR2. OSR1 gene consisting
of three exons was located on human chromosome 2p24. OSR1
mRNA of 2.3-kb in size was detected in adult colon, small
intestine, prostate, testis, and fetal lung. OSR1 mRNA was
significantly up-regulated in a pancreatic cancer cell line MIA
PaCa-2, and was weakly expressed in gastric cancer cell lines
OKAJIMA, MKN45, pancreatic cancer cell lines PANC-1,
BxPC-3, AsPC-1, PSN-1, Hs766T, and esophageal cancer cell
line TE10. Among 10 cases of primary gastric cancer, OSR1
mRNA was up-regulated in 5 cases, and was down-regulated
in 2 cases. This is the first report on molecular cloning and
characterization of human OSR1.
Introduction
During Drosophila hindgut development, caudal/CDX,
brachyenteron/Brachyury/TBX, fork head/FOX, bowl,
drumstick, lines and wingless/WNT play important roles (1).
Secreted-type glycoprotein WNTs transduce signals to the
ß-catenin - TCF pathway, the JNK pathway, or the Ca 2+-
releasing pathway through seven-transmembrane-type WNT
_________________________________________
Correspondence to: Dr Masaru Katoh, Genetics and Cell Biology
Section, Genetics Division, National Cancer Center Research Institute,
Tsukiji 5-chome, Chuo-ku, Tokyo 104-0045, Japan
E-mail: mkatoh@ncc.go.jp
Key words: WNT, gastric cancer, carcinogenesis, embryogenesis,
bioinformatics
221
receptors encoded by Frizzled (FZD) genes. We have cloned
and characterized WNT2B/WNT13, WNT3, WNT3A, WNT5B,
WNT6, WNT7B, WNT8A, WNT8B, WNT10A, WNT10B,
WNT11, WNT14, and WNT14B/WNT15 among 19 WNT genes
in the human genome (2-23), and FZD1, FZD2, FZD3, FZD4,
FZD5, FZD6, FZD7, FZD8, and FZD10 among 10 FZD
genes in the human genome (24-34). We have also cloned
and characterized WNT signaling molecules, such as FRAT1,
FRAT2, VANGL1/STB2, ARHU/WRCH1, ARHV/WRCH2,
GIPC2, GIPC3, NKD1, NKD2, ßTRCP2/FBXW1B, LZIC, and
TCF-3 (35-54).
Drosophila bowl, drumstick, and lines are putative trans-
criptional regulators to establish three morphologically
distinct subregions of the hindgut through spatially localized
regulation of target gene expression (1). Drosophila bowl gene
is homologous to Drosophila odd-skipped (odd) gene and
odd-skipped related gene (sob). Odd, sob, and bowl encode
C2H2-type zinc finger proteins (55).
Here, human gene fragments homologous to Drosophila
odd, sob, and bowl were identified using bioinformatics. The
novel human gene identified in this study was designated
OSR1, and OSR1 cDNAs were isolated using cDNA-PCR.
OSR1 was found to encode 266 amino-acid protein with three
C2H2-type zinc fingers, a tyrosine phosphorylation site
(Tyr 203), and several putative PXXP SH3 binding motifs.
Expression of OSR1 in normal human tissues, cancer cell
lines, and primary tumors will also be described.
Materials and methods
Bioinformatics. Human genes or expressed sequence tags
(ESTs) homologous to Drosophila odd, sob, or bowl were
searched for by using the BLAST search program (http://
www.ncbi.nlm.nih.gov) as described previously (56). Amino-
acid sequences of Drosophila odd, sob, or bowl were used as
query sequences for the Tblastn program, in which the query
amino-acid sequence was compared with the human genome
draft sequences or ESTs translated in 6 frames, namely 3
frames in the sense direction and in the anti-sense direction.
Poly(A)+ and total RNAs. Poly(A)+ RNAs of human fetal
brain, lung, liver, kidney, adult stomach, and pancreas were
purchased from Clontech Laboratories. Poly(A)+ RNAs were
extracted from gastric cancer cell lines OKAJIMA, TMK1,
MKN7, MKN28, MKN45, MKN74, KATO-III, pancreatic
222 KATOH: HUMAN HOMOLOG OF Drosophila odd-skipped

Table I. Oligonucleotide primers.

–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
Primer Orientation Nucleotide sequence Nucleotide position
–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––
POS1-01 Sense CGAAATGGGCAGCAAAACCTTG 1-22 of OSR1
POS1-02 Anti-sense CAAGAGTTTAGCCGCGTCCTAG 1027-1006 of OSR1
POS1-03 Sense TGTGGGTCACAAGGACCCTAG 814-834 of OSR1
POS1-04 Anti-sense CACTCTCCGCAGTCAGAGTTAC 1206-1185 of OSR1
BACT2 Anti-sense GCGGATGTCCACGTCACACT 943-924 of ß-actin
BACT3 Sense CCACTGGCATCGTGATGGAC 516-535 of ß-actin
–––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––––

Figure 1. Odd-skipped (odd) homologous human gene fragments, OSR1 cDNA spanning complete coding sequence, and amino-acid sequence of OSR1. (A),
Alignment of putative human gene fragments (OSR1 and OSR2) with Drosophila odd, sob, and bowl. Three zinc fingers and a tyrosine phosphorylation site were
conserved among human OSR1, OSR2, Drosophila odd, sob, and bowl. (B), Schematic representation of OSR1 cDNAs. ORF is depicted as an open box, and
UTRs as bold bars. OS1A corresponds to nucleotide position 1-1027 of OSR1 cDNA, and OS1B corresponds to nucleotide position 814-1206 of OSR1 cDNA. The
nucleotide sequence data of OSR1 cDNA will appear in the DDBJ, EMBL, GenBank data bases under the accession no. AB082568. (C), Amino-acid sequence
of OSR1. Amino-acids are numbered on the right. Three zinc fingers ZnF1-ZnF3 (double over-line), putative tyrosine phosphorylation site Tyr 203 (sharp), and
several putative PXXP SH3 binding motifs (++++) are shown above the amino-acid sequence of OSR1.
 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 10: 221-225, 2002 223

cancer cell lines PANC-1, BxPC-3, AsPC-1, PSN-1, Hs700T,

Hs766T, MIA PaCa-2, esophageal cancer cell lines TE1, TE2,
TE3, TE4, TE5, TE6, TE7, TE8, TE10, TE11, TE12, and TE13
with FastTrack 2.0 Kit (Invitrogen) as described previously
(57). Total RNAs were extracted from paired specimen of
primary gastric cancer and non-cancerous gastric mucosa with
the Isogen reagent (Nippon Gene) as described previously
(58).

One-step cDNA-PCR. cDNA-PCR with One-step RT-PCR kit

(Qiagen) was performed as described previously (59). cDNA-
PCR products, purified with the QIAEX Kit (Qiagen), were
ligated into TA cloning vector pCR2.1 (Invitrogen) for sub-
sequent nucleotide sequence analyses with ABI310 Sequencer
(PE Applied Biosystems) as described previously (60).
Nucleotide sequences of PCR primers are listed in Table I.

Northern blot analyses. After pre-hybridization for 1 h at

68˚C in QuikHyb solution (Stratagene), MTN northern blot
filters (Clontech Laboratories) were hybridized with a [·-32P]-
dCTP-labeled probe for 1 hat 68˚C in QuikHyb solution as
described previously (61). After washing, filters were exposed
to the Imaging Plate (Fuji) for image analyses with the Storm
system (Molecular Dynamics). OS1A probe corresponds to Figure 2. Northern blot analyses on OSR1. (A), Adult human tissues. (B),
nucleotide position 814-1206 of OSR1 cDNA. Fetal human tissues. (C), Human cancer cell lines. MTN blot filters were
hybridized with [·-32P]-dCTP-labeled OS1B probe (nucleotide position 814-
1206). The 2.3-kb OSR1 mRNA was expressed in adult colon, small
Results intestine, prostate, testis, and fetal lung.

Isolation of human OSR1 cDNAs. Human genome draft

sequences homologous to Drosophila odd, sob, or bowl were
searched for by using bioinformatics. Gene fragments in the
human genome draft sequence NT_031820.1 (chromosome 8)
were identical to human OSR2 cDNA (DDBJ/EMBL/GenBank
data base accession no. AY038073), while gene fragments
in the human genome draft sequence NT_005214.8 (chromo-
some 2) were found to be derived from a novel gene. There-
fore, the novel gene was designated OSR1 (Fig. 1A).
PCR primers POS1-01 - POS1-04 (Table I) were designed
based on nucleotide sequences of ESTs overlapping with OSR1
gene fragments. OS1A cDNA was isolated from a mixture of
poly(A)+ RNAs of human fetal brain, lung, liver, and kidney
(Clontech Laboratories) using cDNA-PCR with POS1-01
and POS1-02 primers, and OS1B cDNA was isolated using
cDNA-PCR with POS1-03 and POS1-04 primers. Nucleotide
sequence of human OSR1 cDNA was determined by combining
nucleotide sequences of OS1A (nucleotide position 1-1027)
and OS1B (nucleotide position 814-1206) (Fig. 1B). Human
OSR1 cDNA was found to consist of 4-bp 5'-UTR, 801-bp
ORF, and 401-bp 3'-UTR.
Amino-acid sequence of human OSR1. Human OSR1 was
found to encode a 266 amino-acid polypeptide (Fig. 1C).
Kyte and Doolittle hydrophobicity analysis revealed that
OSR1 was a rather hydrophilic protein without hydrophobic
region (data not shown). OSR1 with three C2H2-type zinc
fingers, a tyrosine phosphorylation site (Tyr 203), and several
putative PXXP SH3 binding motifs showed 63.6% total amino-
acid identity with OSR2. Three zinc fingers and a tyrosine
phosphorylation site were conserved among human OSR1,
OSR2, Drosophila odd, sob, and bowl (Fig. 1A).
Structure and chromosomal localization of human OSR1 gene.
ESTs BI819692 and BM554048 were found to overlap with
OSR1 cDNA isolated in this study. Exon-intron structure of
human OSR1 gene was determined by comparing nucleotide
sequences of human OSR1 cDNA and OSR1 ESTs with the
human genome draft sequence NT_005214.8 corresponding
to human chromosome 2p24. 5'-UTR of OSR1 mRNA was
interrupted by intron 1, and ORF of OSR1 mRNA was
interrupted by intron 2. Therefore, human OSR1 gene, located
in human chromosome 2p24 region, was found to consist of
3 exons.
Expression of OSR1 mRNA in normal human tissues.
Expression of human OSR1 mRNA was investigated using
Northern blot analyses with OS1B probe (nucleotide position
814-1206 of human OSR1 cDNA). OSR1 mRNA of 2.3-kb in
size was detected in adult colon, small intestine, prostate,
testis, and fetal lung (Fig. 2A and B).
Expression of OSR1 mRNA in human cancer cell lines. OSR1
mRNA was not detected in human cancer cell lines HL-60
(promyelocytic leukemia), HeLa S3 (cervical cancer), K-562
(chronic myelogenous leukemia), MOLT-4 (lymphoblastic
leukemia), Raji (Burkitt's lymphoma), SW480 (colorectal
cancer), A549 (lung cancer), and G-361 (melanoma) using
Northern blot analysis (Fig. 2C).
Expression of OSR1 mRNA in other human cancer cell
lines were next investigated using cDNA-PCR. Among 7
gastric cancer cell lines, OSR1 mRNA was weakly expressed
in OKAJIMA and MKN45 (Fig. 3A). Among 7 pancreatic
224 KATOH: HUMAN HOMOLOG OF Drosophila odd-skipped
Figure 3. Expression of OSR1 mRNA in human cancer cell lines. (A), Gastric
cancer. (B), Pancreatic cancer. (C), Esophageal cancer. OSR1 mRNA was
detected using 30 cycles of cDNA-PCR with POS1-03 and POS1-04 primers,
and ß-actin mRNA was detected using 17 cycles of cDNA-PCR with BACT2
and BACT3 primers. A mixture of poly(A)+ RNAs of human fetal brain,
lung, liver, and kidney was used as a positive control. OSR1 mRNA was
significantly up-regulated in a pancreatic cancer cell line MIA PaCa-2, and
was weakly expressed in gastric cancer cell lines OKAJIMA, MKN45,
pancreatic cancer cell lines PANC-1, BxPC-3, AsPC-1, PSN-1, Hs766T, and
esophageal cancer cell line TE10.
Figure 4. Expression of OSR1 mRNA in primary gastric cancer. Among 10
cases of primary gastric cancer, OSR1 mRNA was up-regulated in 5 cases, and
was down-regulated in 2 cases.
cancer cell lines, OSR1 mRNA was significantly up-regulated
in MIA PaCa-2, and was also expressed in PANC-1, BxPC-3,
AsPC-1, PSN-1, and Hs766T (Fig. 3B). Among 12 esophageal
cancer cell lines, OSR1 mRNA was weakly expressed in TE10
(Fig. 3C).
Expression of OSR1 mRNA in primary gastric cancer.
Expression of OSR1 mRNA in primary gastric cancer was
investigated using cDNA-PCR. Among 10 cases of primary
gastric cancer, OSR1 mRNA was up-regulated in 5 cases, and
was down-regulated in 2 cases (Fig. 4).
Discussion
Human OSR1 gene homologous to Drosophila odd, sob, and
bowl genes was identified using bioinformatics (Fig. 1A), and
OSR1 cDNAs were isolated using cDNA-PCR (Fig. 1B). OSR1
was found to encode 266 amino-acid protein with three C2H2-
type zinc fingers, a tyrosine phosphorylation site (Tyr 203),
and several putative PXXP SH3 binding motifs (Fig. 1C).
OSR1 showed 63.6% total amino-acid identity with OSR2.
Three zinc fingers and a tyrosine phosphorylation site were
conserved among human OSR1, OSR2, Drosophila odd, sob,
and bowl (Fig. 1A). These results indicate that OSR1 and
OSR2 constitute the human odd-skipped gene family encoding
evolutionally conserved C2H2-type zinc finger proteins.
OSR1 gene consisting of 3 exons was located on the
human genome draft sequence NT_005214.8 corresponding
to chromosome 2p24 (data not shown). On the human genome
draft sequence NT_005214.8, lysosomal-associated protein
transmembrane 4· (LAPTM4A), and matrilin 3 (MATN3)
were also located.
OSR1 mRNA of 2.3-kb in size was detected in adult colon,
small intestine, prostate, testis, and fetal lung (Fig. 2A and B).
OSR1 mRNA was significantly up-regulated in a pancreatic
cancer cell line MIA PaCa-2, and was weakly expressed in
gastric cancer cell lines OKAJIMA, MKN45, pancreatic cancer
cell lines PANC-1, BxPC-3, AsPC-1, PSN-1, Hs766T, and
esophageal cancer cell line TE10 (Fig. 3). Among 10 cases of
primary gastric cancer, OSR1 mRNA was up-regulated in 5
cases, and was down-regulated in 2 cases (Fig. 4). This is the
first report on molecular cloning and characterization of human
OSR1.
Acknowledgements
This study was supported in part by a Grant-in-Aid for
Scientific Research on Priority Areas from the Ministry of
Education, Culture, Sports, Science, and Technology of Japan.
References
1. Lengyel JA and Iwaki DD: It takes guts: the Drosophila hindgut
as a model system for organogenesis. Dev Biol 243: 1-19,
2002.
2. Katoh M, Hirai M, Sugimura T and Terada M: Cloning,
expression and chromosomal localization of WNT13, a novel
member of the WNT gene family. Oncogene 13: 873-876,
1996.
3. Katoh M, Kirikoshi H, Saitoh T, et al: Alternative splicing of
the WNT2B/WNT13 gene. Biochem Biophys Res Commun 275:
209-216, 2000.
4. Katoh M: Differential regulation of WNT2 and WNT2B expression
in human cancer. Int J Mol Med 8: 657-660, 2001.
5. Katoh M, Kirikoshi H, Terasaki H and Shiokawa K: WNT2B2
mRNA, up-regulated in primary gastric cancer, is a positive
regulator of the WNT - ß-catenin - TCF signaling pathway.
Biochem Biophys Res Commun 289: 1093-1098, 2001.
6. Katoh M: Molecular cloning and characterization of human
WNT3. Int J Oncol 19: 977-982, 2001.
7. Katoh M: Regulation of WNT3 and WNT3A mRNAs in human
cancer cell lines NT2, MCF-7, and MKN45. Int J Oncol 20:
373-377, 2002.
8. Saitoh T, Hirai M and Katoh M: Molecular cloning and
characterization of WNT3A and WNT14 clustered in human
chromosome 1q42 region. Biochem Biophys Res Commun 284:
1168-1175, 2001.
9. Saitoh T, Mine T and Katoh M: Frequent up-regulation of
WNT5A mRNA in primary gastric cancer. Int J Mol Med 9: 515-
519, 2002.
 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 10: 221-225, 2002
10. Saitoh T and Katoh M: Molecular cloning and characterization
of human WNT5B on chromosome 12p13.3 region. Int J Oncol
19: 347-351, 2001.
11. Kirikoshi H, Sekihara H and Katoh M: WNT10A and WNT6,
clustered in human chromosome 2q35 region with head to tail
manner, are strongly co-expressed in SW480 cells. Biochem
Biophys Res Commun 283: 798-805, 2001.
12. Kirikoshi H, Sekihara H and Katoh M: Molecular cloning and
characterization of human WNT7B. Int J Oncol 19: 779-783,
2001.
13. Saitoh T and Katoh M: Molecular cloning and characterization
of human WNT8A. Int J Oncol 19: 123-127, 2001.
14. Saitoh T, Mine T and Katoh M: Up-regulation of WNT8B mRNA
in human gastric cancer. Int J Oncol 20: 343-348, 2002.
15. Kirikoshi H, Sekihara H and Katoh M: Up-regulation of WNT10A
by tumor necrosis factor · and Helicobacter pylori in gastric
cancer. Int J Oncol 19: 533-536, 2001.
16. Kirikoshi H, Inoue S, Sekihara H and Katoh M: Expression of
WNT10A in human cancer. Int J Oncol 19: 997-1001, 2001.
17. Saitoh T, Kirikoshi H, Mine T and Katoh M: Proto-oncogene
WNT10B is up-regulated by tumor necrosis factor · in human
gastric cancer cell line MKN45. Int J Oncol 19: 1187-1192, 2001.
18. Kirikoshi H, Sekihara H and Katoh M: Molecular cloning and
characterization of human WNT11. Int J Mol Med 8: 651-656,
2001.
19. Katoh M: Molecular cloning and characterization of mouse
Wnt14: structural comparison between mouse Wnt14-Wnt3a
gene cluster and human WNT14-WNT3A gene cluster. Int J Mol
Med 9: 221-227, 2002.
20. Kirikoshi H, Sekihara H and Katoh M: Expression of WNT14
and WNT14B mRNAs in human cancer, up-regulation of WNT14
by IFNÁ and up-regulation of WNT14B by ß-estradiol. Int J
Oncol 19: 1221-1225, 2001.
21. Kirikoshi H, Sekihara H and Katoh M: Molecular cloning and
characterization of human WNT14B, a novel member of the
WNT gene family. Int J Oncol 19: 947-952, 2001.
22. Kirikoshi H and Katoh M: Molecular cloning and characterization
of mouse Wnt14b, clustered with mouse Wnt3 in mouse
chromosome 11. Int J Mol Med 9: 135-139, 2002.
23. Katoh M: WNT3-WNT14B and WNT3A-WNT14 gene clusters
(review). Int J Mol Med 9: 579-584, 2002.
24. Sagara N, Toda G, Hirai M, Terada M and Katoh M: Molecular
cloning, differential expression, and chromosomal localization
of human Frizzled-1, Frizzled-2, and Frizzled-7. Biochem
Biophys Res Commun 252: 117-122, 1998.
25. Kirikoshi H, Koike J, Sagara N, Saitoh T, Tokuhara M, Tanaka K,
Sekihara H, Hirai M and Katoh M: Molecular cloning and
genomic structure of human Frizzled-3 at chromosome 8p21.
Biochem Biophys Res Commun 271: 8-14, 2000.
26. Kirikoshi H, Sagara N, Koike J, Tanaka K, Sekihara H, Hirai M
and Katoh M: Molecular cloning and characterization of human
Frizzled-4 on chromosome 11q14-q21. Biochem Biophys Res
Commun 264: 955-961, 1999.
27. Sagara N, Kirikoshi H, Terasaki H, Yasuhiko Y, Toda G,
Shiokawa K and Katoh M: FZD4S, a splicing variant of
Frizzled-4, encodes a soluble-type positive regulator of the
WNT signaling pathway. Biochem Biophys Res Commun 282:
750-756, 2001.
28. Saitoh T, Hirai M and Katoh M: Molecular cloning and
characterization of human Frizzled-5 gene on chromosome
2q33.3-q34 region. Int J Oncol 19: 105-110, 2001.
29. Kirikoshi H, Sekihara H and Katoh M: Up-regulation of
Frizzled-7 (FZD7) in human gastric cancer. Int J Oncol 19:
111-115, 2001.
30. Saitoh T, Hirai M and Katoh M: Molecular cloning and
characterization of human Frizzled-8 gene on chromosome
10p11.2. Int J Oncol 18: 991-996, 2001.
31. Koike J, Takagi A, Miwa T, Hirai M, Terada M and Katoh M:
Molecular cloning of Frizzled-10, a novel member of the Frizzled
gene family. Biochem Biophys Res Commun 262: 39-43, 1999.
32. Saitoh T, Mine T and Katoh M: Up-regulation of Frizzled-10
(FZD10) by ß-estradiol in MCF-7 cells and by retinoic acid in
NT2 cells. Int J Oncol 20: 117-120, 2002.
33. Terasaki H, Saitoh T, Shiokawa K and Katoh M: Frizzled-10,
up-regulated in primary colorectal cancer, is a positive regulator
of the WNT - ß-catenin - TCF signaling pathway. Int J Mol Med
9: 107-112, 2002.
34. Kirikoshi H, Sekihara H and Katoh M: Expression profiles of 10
members of Frizzled gene family in human gastric cancer. Int J
Oncol 19: 767-771, 2001.
View publication stats
225
35. Saitoh T, Mine T and Katoh M: Molecular cloning and expression
of proto-oncogene FRAT1 in human cancer. Int J Oncol 20:
785-789, 2002.
36. Saitoh T and Katoh M: FRAT1 and FRAT2, clustered in human
chromosome 10q24.1 region, are up-regulated in gastric cancer.
Int J Oncol 19: 311-315, 2001.
37. Saitoh T, Moriwaki J, Koike J, Takagi A, Miwa T, Shiokawa K
and Katoh M: Molecular cloning and characterization of FRAT2,
encoding a positive regulator of the WNT signaling pathway.
Biochem Biophys Res Commun 281: 815-820, 2001.
38. Katoh M: Structure and expression of Strabismus 1 gene on
human chromosome 1q21-q23. Int J Oncol 20: 1197-1203,
2002.
39. Katoh M: Molecular cloning and characterization of Strabismus 2
(STB2). Int J Oncol 20: 993-998, 2002.
40. Katoh M: Strabismus (STB)/Vang-like (VANGL) gene family
(review). Int J Mol Med 10: 11-15, 2002.
41. Kirikoshi H and Katoh M: Expression of WRCH1 in human
cancer, and down-regulation of WRCH1 by ß-estradiol in MCF-7
cells. Int J Oncol 20: 777-783, 2002.
42. Katoh M: Molecular cloning and characterization of human
WRCH2 on human chromosome 15q15. Int J Oncol 20: 977-982,
2002.
43. Kirikoshi H and Katoh M: Expression of human GIPC1 in
normal tissues, cancer cell lines, and primary tumors. Int J Mol
Med 9: 609-513, 2002.
44. Kirikoshi H and Katoh M: Molecular cloning and characterization
of human GIPC2, a novel gene homologous to human GIPC1
and Xenopus Kermit. Int J Oncol 20: 571-576, 2002.
45. Kirikoshi H and Katoh M: Up-regulation of GIPC2 in human
gastric cancer. Int J Oncol 20: 1183-1187, 2002.
46. Saitoh T, Mine T and Katoh M: Molecular cloning and
characterization of human GIPC3, a novel gene homologous to
human GIPC1 and GIPC2. Int J Oncol 20: 577-582, 2002.
47. Saitoh T, Mine T and Katoh M: Molecular cloning and
characterization of mouse Gipc3. Int J Mol Med 9: 251-256,
2002.
48. Katoh M: GIPC gene family (review). Int J Mol Med 9: 585-
589, 2002.
49. Katoh M: Molecular cloning, gene structure, and expression
analyses of NKD1 and NKD2. Int J Oncol 19: 963-969, 2001.
50. Koike J, Sagara N, Kirikoshi H, Takagi A, Miwa, T, Hirai M
and Katoh M: Molecular cloning and characterization of the
ßTRCP2 gene on chromosome 5q35.1. Biochem Biophys Res
Commun 269: 103-109, 2000.
51. Saitoh T and Katoh M: Expression profiles ßTRCP1 and ßTRCP2,
and mutation analysis of ßTRCP2 in gastric cancer. Int J Oncol
18: 959-964, 2001.
52. Spiegelman VS, Tang W, Katoh M, Slaga TJ and Fuchs SY:
Inhibition of HOS expression and activities by Wnt pathway.
Oncogene 21: 856-860, 2002.
53. Katoh M: Molecular cloning and characterization of LZIC, a
novel gene encoding ICAT homologous protein with leucine
zipper domain. Int J Mol Med 8: 611-615, 2001.
54. Sagara N and Katoh M: Mitomycin C resistance induced by
TCF-3 overexpression in gastric cancer cell line MKN28 is
associated with DT-diaphorase down-regulation. Cancer Res 60:
5959-5962, 2000.
55. Hart MC, Wang L and Coulter DE: Comparison of the structure
and expression of odd-skipped and two related genes that encode
a new family of zinc finger proteins in Drosophila. Genetics
144: 171-182, 1996.
56. Katoh M: Molecular cloning and characterization of MFRP, a
novel gene encoding a membrane-type Frizzled-related protein.
Biochem Biophys Res Commun 282: 116-123, 2001.
57. Katoh M: Molecular cloning and characterization of RNF26 on
human chromosome 11q23 region, encoding a novel RING finger
protein with leucine zipper. Biochem Biophys Res Commun
282: 1038-1044, 2001.
58. Katoh M: Frequent up-regulation of WNT2 in primary gastric
cancer and colorectal cancer. Int J Oncol 19: 1003-1007, 2001.
59. Katoh M: Molecular cloning and characterization of human
SOX17. Int J Mol Med 9: 153-157, 2002.
60. Katoh M: Molecular cloning and characterization of ST7R (ST7-
like, ST7L) on human chromosome 1p13, a novel gene
homologous to tumor suppressor gene ST7 on human
chromosome 7q31. Int J Oncol 20: 1247-1253, 2002.
61. Katoh M: Expression of human SOX7 in normal tissues and
tumors. Int J Mol Med 9: 363-368, 2002.