Li 2018

Article
Transcriptional Regulation of the Warburg Effect in

Cancer by SIX1
Graphical Abstract Authors
Ling Li, Yingchun Liang, Lei Kang, ...,
Shixin Zhao, Xiaojie Xu, Qinong Ye
Correspondence
miraclexxj@126.com (X.X.),
yeqn66@yahoo.com (Q.Y.)
In Brief
Li et al. show that transcription factor
SIX1 regulates aerobic glycolysis in
cancer by binding promoters and
recruiting HBO1 and AIB1 to induce the
expression of glycolytic genes. SIX1 is
negatively regulated by miR-548a-3p,
and modulation of components of this
pathway affects tumor metabolism and
growth.
Highlights Data Resources

d SIX1 is a key transcription factor involved in the Warburg GSE93925
effect
d SIX1 potentiates the Warburg effect via HBO1 and AIB1
d SIX1 glycolytic function is directly repressed by microRNA-

548a-3p
d The miR-548a-3p/Six1 axis regulates the Warburg effect and

tumor growth
Li et al., 2018, Cancer Cell 33, 1–18

March 12, 2018 ª 2018 Elsevier Inc.
https://doi.org/10.1016/j.ccell.2018.01.010
Please cite this article in press as: Li et al., Transcriptional Regulation of the Warburg Effect in Cancer by SIX1, Cancer Cell (2018), https://doi.org/
10.1016/j.ccell.2018.01.010
Cancer Cell
Article
Transcriptional Regulation of the Warburg

Effect in Cancer by SIX1
Ling Li,1,11 Yingchun Liang,1,11 Lei Kang,1,2 Yang Liu,1,3 Shan Gao,4 Siyu Chen,1,3 Ying Li,1,5 Wenye You,1,5 Qian Dong,1
Tian Hong,1 Zhifeng Yan,6 Shuai Jin,1,3 Tao Wang,7 Wei Zhao,8 Haixing Mai,9 Jun Huang,9 Xiao Han,1 Quanbo Ji,10
Qi Song,5 Chao Yang,8 Shixin Zhao,1 Xiaojie Xu,1,* and Qinong Ye1,12,*
1Department of Medical Molecular Biology, Beijing Institute of Biotechnology, Collaborative Innovation Center for Cancer Medicine,
Beijing 100850, China

2Department of Nuclear Medicine, Peking University First Hospital, Beijing 100034, China
3Department of Thoracic Surgery, PLA General Hospital, Beijing 100853, China
4CAS Key Laboratory of Biomedical Diagnostics, Suzhou Institute of Biomedical Engineering and Technology, Chinese Academy of Sciences,
Suzhou 215163, China

5Department of Oncology, PLA General Hospital, Beijing 100853, China
6Department of Gynecology and Obstetrics, PLA General Hospital, Beijing 100853, China
7Department of Oncology, 307 Hospital of People’s Liberation Army, Beijing 100071, China
8Department of Oncology, General Hospital of the PLA Rocket Force, Beijing 100088, China
9Department of Urology, 307 Hospital of People’s Liberation Army, Beijing 100071, China
10Department of Orthopedics, PLA General Hospital, Beijing 100853, China
11These authors contributed equally
12Lead Contact
*Correspondence: miraclexxj@126.com (X.X.), yeqn66@yahoo.com (Q.Y.)

https://doi.org/10.1016/j.ccell.2018.01.010
SUMMARY
Aerobic glycolysis (the Warburg effect) facilitates tumor growth, and drugs targeting aerobic glycolysis are
being developed. However, how the Warburg effect is directly regulated is largely unknown. Here we show
that transcription factor SIX1 directly increases the expression of many glycolytic genes, promoting the
Warburg effect and tumor growth in vitro and in vivo. SIX1 regulates glycolysis through HBO1 and AIB1
histone acetyltransferases. Cancer-related SIX1 mutation increases its ability to promote aerobic glycolysis
and tumor growth. SIX1 glycolytic function is directly repressed by microRNA-548a-3p, which is down-
regulated, inversely correlates with SIX1, and is a good predictor of prognosis in breast cancer patients.
Thus, the microRNA-548a-3p/SIX1 axis strongly links aerobic glycolysis to carcinogenesis and may become
a promising cancer therapeutic target.
INTRODUCTION hallmark of cancer, and cancer therapeutic agents targeting

the Warburg effect are being developed. More than ten genes
Cancer cells exhibit aberrant metabolism characterized by encoding glycolytic enzymes are directly responsible for the
high glycolysis even in the presence of abundant oxygen. This Warburg effect (Doherty and Cleveland, 2013; Ngo et al.,
phenomenon, known as the Warburg effect or aerobic glycol- 2015). Transcription factors play a direct role in regulation of
ysis, facilitates tumor growth with elevated glucose uptake and the Warburg effect (Yeung et al., 2008). Hypoxia-inducible factor
lactate production (Koppenol et al., 2011; Liberti and Locasale, 1a (HIF-1a) is a transcriptional activator that acts as a key
2016). The Warburg effect has now been widely accepted as a regulator of the Warburg effect. HIF-1a increases expression of
Significance
The Warburg effect (aerobic glycolysis) is a hallmark of cancer, and cancer therapeutic agents targeting the Warburg effect
are being developed. HIF-1a and c-Myc transcription factors are well-known key regulators of the Warburg effect. Our study
identifies SIX1 as a major transcription factor playing a causal role in glycolysis regulation and represents an advance in the
field of transcriptional regulation of glucose metabolism. SIX1 promotes aerobic glycolysis through HBO1 and AIB1 histone
acetyltransferases and is directly repressed by microRNA-548a-3p. Since SIX1 is overexpressed and microRNA-548a-3p is
downregulated in cancer patients, and both of them predict cancer patient survival, targeting the microRNA-548a-3p/SIX1
axis may open an avenue for cancer therapy.
Cancer Cell 33, 1–18, March 12, 2018 ª 2018 Elsevier Inc. 1
10.1016/j.ccell.2018.01.010
(legend on next page)
2 Cancer Cell 33, 1–18, March 12, 2018

10.1016/j.ccell.2018.01.010
the majority of glycolytic genes by binding hypoxia-responsive lytic gene transcription could be rescued by SIX1 re-expression
elements of glycolytic gene promoters. The c-Myc oncogenic in SIX1 KD ZR75-1 breast cancer cells and HepG2 hepatoma
transcription factor also directly transactivates glycolytic genes cells (Figure S1B). Breast cancer and hepatoma cells were
and stimulates aerobic glycolysis. In contrast, the tumor-sup- chosen for glycolysis experiments since previous research has
pressive transcription factor p53 directly represses glycolytic shown that these cells exhibit the Warburg effect (Doménech
gene transcription, causing a decrease in aerobic glycolysis. et al., 2015; Finley et al., 2011). SIX1 KD also decreased the
Although a few transcription factors have been shown to control expression of GLUT1, HK2, PFKL, ALDOA, GAPDH, PGK1,
the Warburg effect, transcriptional regulation of this effect ENO1, PKM2, and LDHA proteins, but not GPI (glucose-6-
remains largely unknown. phosphate isomerase) and PGAM1 (phosphoglycerate mutase)
Transcription factor sine oculis homeobox 1 (SIX1) is a key proteins (Figure S1C). Again, this effect could be rescued by
regulator of organogenesis (Kumar, 2009; Wu et al., 2015). Six1 SIX1 re-expression. In contrast, SIX1 overexpression increased
knockout (KO) mouse embryos have defects in several organs the expression of these glycolytic genes except GPI and
and are relatively smaller in size than wild-type (WT) littermates PGAM1 (Figure S1D). Overexpression of HIF-1a, a well-known
(El-Hashash et al., 2011; Laclef et al., 2003). Six1 KO mice die master regulator of glycolysis, enhanced the expression of these
shortly after birth. SIX1 is overexpressed in many cancers, glycolytic genes except PGAM1. However, SIX1 promotion of
such as breast cancer, liver cancer, and colorectal cancer glycolytic gene expression was not dependent on HIF-1a,
(Coletta et al., 2008; Ng et al., 2006; Wu et al., 2015). Increased because HIF-1a KD had no effect on enhancement of glycolytic
SIX1 expression predicts poor clinical outcomes. SIX1 can gene expression by SIX1 overexpression (Figure S1E). More-
promote tumor growth and metastasis. However, whether SIX1 over, compared with SIX1 WT ZR75-1 cells, SIX1 KO cells gener-
regulates cancer metabolism is unclear. ated by CRISPR/Cas9 showed markedly reduced GLUT1, HK2,
PFKL, ALDOA, GAPDH, PGK1, ENO1, PKM2, and LDHA, but not
RESULTS GPI and PGAM1, at the mRNA and protein levels (Figures 1C,
1D, and S1F). SIX1 re-expression in the SIX1 KO cells rescued
Identification of SIX1 as a Key Regulator of Glycolytic these effects. Similar results were observed in Six1 KO mouse
Gene Expression embryonic fibroblasts (MEFs), Six1 KO embryos, and liver, intes-
To identify SIX1 downstream effectors, we performed RNA tine, and lung tissues from Six1 KO embryos (Figures 1E–1H and
sequencing (RNA-seq) using SIX1 stable knockdown (KD) S1G). These data indicate that SIX1 is a key regulator of glyco-
ZR75-1 breast cancer cell line or control cell line. Consistent lytic gene expression.
with previous reports (Coletta et al., 2008; Liu et al., 2014),
SIX1 had two major bands in immunoblots (Figure 1A). SIX1 SIX1 Binds SIX1-Responsive Elements to Promote
regulated the expression of over 1,900 genes, including previ- Glycolytic Gene Promoter Activity
ously reported SIX1-regulated genes (accession number GEO: Genome-wide analysis of SIX1 binding sites using chromatin
GSE93925) (Figure 1A and Table S1). KEGG (Kyoto Encyclo- immunoprecipitation sequencing (ChIP-seq) and ChIP-on-chip
pedia of Genes and Genomes) analysis showed that the top 20 revealed that the SIX1 DNA binding motif contains TCAG/TG
enriched pathways included the glycolysis pathway (Figure 1B). (Wegert et al., 2015; Liu et al., 2010, 2012a). In addition, these
Real-time RT-PCR confirmed the altered expression of known datasets showed that SIX1 binds six glycolytic genes (PFKL,
SIX1 target genes and 11 glycolysis-related genes (GLUT1/4 ALDOA, PGK1, ENO1, PKM2, and LDHA). To test whether
[glucose transporter 1/4 or SLC2A1/4], HK2 [hexokinase 2], SIX1 transcriptionally regulates glycolytic gene expression, we
PFKL [6-phosphofructokinase, liver type], ALDOA [aldolase A], searched up to approximately 3 kb of promoter regions of these
GAPDH [glyceraldehyde 3-phosphate dehydrogenase], PGK1 genes for putative SIX1 binding sites and constructed promoter
[phosphoglycerate kinase 1], ENO1 [enolase 1], ENO2, PKM2 reporters containing the putative binding sites (Figures 2A and
[pyruvate kinase M2], and LDHA [lactate dehydrogenase A]) (Fig- S2A). SIX1 overexpression increased the reporter activity of
ure S1A). Some known SIX1 target genes and glycolysis-related GLUT1, HK2, PFKL, ALDOA, GAPDH, PGK1, ENO1, PKM2,
genes were further validated using previously reported microar- and LDHA promoters. GLUT1, ALDOA, and PGK1 contained
ray data from MCF7 breast cancer cells overexpressing SIX1 one putative SIX1 binding site, and mutation of these binding
(Micalizzi et al., 2009) (Table S2). The effect of SIX1 KD on glyco- sites each abrogated SIX1-mediated potentiation of promoter
Figure 1. SIX1 Regulates Glycolytic Gene Expression

(A) Heatmap of known SIX1 target genes and glycolytic genes identified by RNA-seq using ZR75-1 cells stably infected with lentivirus carrying SIX1 short hairpin
RNA (shRNA) or control shRNA. Typical immunoblot shows the knockdown of SIX1 expression.
(B) KEGG pathway analysis of genes differentially expressed between ZR75-1 cells stably infected as in (A).
(C and D) Analysis of glycolytic gene expression in SIX1 wild-type (WT) or knockout (KO) ZR75-1 cells or SIX1 KO ZR75-1 cells transiently transfected with SIX1.
qRT-PCR (C) and immunoblot (D). Schematic diagram of aerobic glycolysis pathway is shown on the left (C).
(E and F) Glycolytic gene expression in Six1 WT or KO MEFs isolated from corresponding mouse. qRT-PCR (E) and immunoblot (F). The WT mice were littermates
of the KO mice (n = 5).
(G) Representative whole-mount IHC analysis of GAPDH and LDHA for Six1 WT and KO mouse embryos at day 15.5 of gestation. The anatomy image is shown.
Scale bar, 1 mm.
(H) Representative immunoblot analysis of glycolytic gene expression in livers, intestines, or lungs from Six1 WT and KO mouse embryos at day 15.5 of gestation.
Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results. Data were analyzed using two-tailed Student’s t test.
*p < 0.05, **p < 0.01 versus corresponding WT cells. See also Figure S1; Tables S1 and S2.
Cancer Cell 33, 1–18, March 12, 2018 3

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
reporter activity. For genes with multiple putative binding sites, of the amino acid regions 331–611 and 581–840. The HAT-
mutation of one or of multiple sites was needed to abrogate defective mutant HBO1 (G485A) did not alter the HBO1-SIX1
activity, depending on the promoter. Mutation of binding site 1, interaction (Figure S3G). SIX1 (1–183) containing the SIX1
but not other site(s), abolished SIX1-mediated induction of domain (SD) and the homeobox domain (HD) did not interact
PKM2 and HK2 promoter reporter activity. For GAPDH and with HBO1, and the amino acid region 219–253, but not
LDHA promoter reporters, mutation of binding site 1 or 2 atten- 184–218, of SIX1 was required for the SIX1-HBO1 interaction
uated activity mediated by SIX1, and mutation of both binding (Figure S3H). SIX1 (11–284), but not SIX1 (61–284), interacted
sites completely abolished the activity. Finally, mutation of bind- with AIB1 (Figure S3I), suggesting that the amino acid region
ing site 1, 2, or 3 attenuated SIX1-mediated enhancement of 11–60 is necessary for the SIX1-AIB1 interaction.
ENO1 and PFKL promoter reporter activity, and the mutation Since SIX1 interacts with HBO1/AIB1, we tested whether SIX1
of the three sites completely abolished the activity. ChIP assay regulates glycolytic gene transcription via HBO1 and AIB1.
indicated that endogenous SIX1 was recruited to the regions HBO1 KO or HBO1 KD decreased mRNA and protein expression
containing the binding sites whose mutation reduced or abol- of HK2, ALDOA, PGK1, ENO1, and LDHA, but not the other
ished SIX1-mediated enhancement of the promoter reporter glycolytic genes tested, and AIB1 KO or AIB1 KD decreased
activity, but not the binding sites whose mutation did not alter that of GLUT1, PFKL, ENO1, PKM2, and LDHA, but not the other
that of the promoter reporter activity or the regions upstream glycolytic genes examined, in ZR75-1 or HepG2 cells (Figures
of the promoters (Figures 2B and S2B). These data suggest 3D, 3E, and S3J–S3M). Importantly, HBO1/AIB1 KO or HBO1/
that SIX1 promotes glycolytic gene transcription by binding to AIB1 KD abolished or greatly attenuated the ability of SIX1 to
glycolytic gene promoters. promote expression of the corresponding glycolytic genes. The
effect of HBO1/AIB1 KO or HBO1/AIB1 KD on glycolytic gene
SIX1 Promotes Glycolytic Gene Expression Largely expression could be rescued by HBO1 or AIB1 re-expression
through Interaction with Histone Acetyltransferases in HBO1/AIB1 KO or HBO1/AIB1 KD cells, respectively (Figures
HBO1 and AIB1 3D, 3E, S3L, and S3M). Moreover, SIX1 (D219–253) or SIX1
Interaction of transcription factors with histone-modifying en- (61–284) that fails to interact with HBO1 or AIB1, respectively,
zymes is required to regulate gene transcription, and histone did not change or greatly attenuated glycolytic gene expression
acetylation regulated by histone acetyltransferases is often regulated by HBO1 or AIB1 (Figures S3N and S3O). These data
associated with active transcription (Thorne et al., 2009). To suggest that SIX1 promotes glycolytic gene expression largely
investigate how SIX1 stimulates glycolytic gene transcription, through interaction with HBO1.
we used co-immunoprecipitation (CoIP) combined with mass Next, we tested how SIX1 regulates glycolytic gene transcrip-
spectrometry to identify its interaction partners (Figure 3A and tion through HBO1 and AIB1. Like SIX1, HBO1, which acetylates
Table S3). Besides the previously reported SIX1-interacting pro- histone H4 lysine 5 (H4K5), H4K8, and H4K12 (Doyon et al.,
teins eyes absent (EYA) family members, we identified only two 2006), was recruited to the SIX1 binding sites of HK2, ALDOA,
histone acetyltransferases, HBO1 (Myst2/Kat7) and AIB1 PGK1, ENO1, and LDHA promoters, and AIB1, which acetylates
(ACTR/NCOA-3/SRC-3/RAC3/TRAM-1) (Duong et al., 2013; histones H3 and H4, especially H3, was recruited to those of
Zhao et al., 2014), as potential SIX1 interaction partners (Figures GLUT1, PFKL, ENO1, PKM2, and LDHA promoters (Figures 3F
3A and S3A). CoIP of endogenous proteins confirmed the and S3P). Re-ChIP experiments showed that SIX1 associated
SIX1-HBO1/AIB1 interaction (Figures 3B, S3B, and S3C). DNase with HBO1 or AIB1 on the corresponding binding sites (Figures
I treatment did not alter the SIX1-HBO1/AIB1 interaction, indi- 3G and S3Q). SIX1 KO or SIX1 KD abolished or reduced recruit-
cating that the interaction is not mediated by DNA (Figure 3C). ment of HBO1 and acetylation of H4K5 (H4K5ac), but not
The interaction is direct because glutathione S-transferase H4K8ac and H4K12ac, to the SIX1 binding sites of HK2, ALDOA,
(GST) or histidine (His) pull-down experiments showed PGK1, ENO1, and LDHA promoters, and SIX1 KO or SIX1 KD
that purified His-tagged HBO1/AIB1 protein interacted with abrogated or decreased recruitment of AIB1 and acetylation of
purified GST-SIX1, but not GST alone (Figures S3D–S3F). H3K4ac, but not H3K9ac, H3K14ac, and H3K56ac, to those of
HBO1 (1–330) containing the serine-rich domain, but not GLUT1, PFKL, ENO1, PKM2, and LDHA promoters (Figures 3H
HBO1 (331–611) containing the MYST domain, and AIB1 and S3R). HBO1 KO or HBO1 KD caused a marked reduction
(1,081–1,420) containing the histone acetyltransferase (HAT) of recruitment of H4K5ac, but not H4K8ac and H4K12ac, to
domain, but not other AIB1 regions, associated with SIX1 the SIX1/HBO1 binding sites, and AIB1 KO or AIB1 KD led to a
(Figures S3E and S3F). The observation that the molecular dramatic decrease in recruitment of H3K4ac, but not H3K9ac,
weights of HBO1 (331–611) and AIB1 (581–840) were larger H3K14ac, and H3K56ac, to the SIX1/AIB1 binding sites. HBO1
than expected might be due to post-translational modification or AIB1 KO had no effect on recruitment of SIX1 to these binding
Figure 2. SIX1 Binds the SIX1-Responsive Element to Enhance Glycolytic Gene Promoter Activity
(A) Luciferase activity of different glycolytic gene promoter reporters in ZR75-1 cells transfected with Myc-tagged SIX1 or empty vector. Filled circles show the
position of the putative SIX1-binding sites, and the ‘‘X’’ shows the mutated SIX1-binding sites. The red letters of each binding region indicate the putative or
mutated SIX1-binding sequences. P, putative SIX1-binding site; M, mutant; WT, wild-type.
(B) ChIP analysis of SIX1 occupancy on promoters of glycolytic genes in ZR75-1 cells. IgG (immunoglobulin G): normal serum. The different number after each
gene represents the regions containing different putative SIX1-binding sites from left to right shown in (A). The graph shows the percentage of input.
Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results. Data were analyzed using two-tailed Student’s t test.
*p < 0.05, **p < 0.01 versus respective promoter reporter without SIX1 (empty vector) (A). **p < 0.01 versus respective normal IgG (B). See also Figure S2.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
sites. Although the HAT-defective mutant HBO1 (G485A) did not expression, we tested whether this axis modulates the glycolytic
change the SIX1-HBO1 interaction, it failed to promote glycolytic phenotype in cultured cells. miR-548a-3p mimics reduced
gene expression (Figures S3S and S3T), indicating that the glucose uptake, pyruvate level, lactate production, and ATP level
histone acetylase activity is important for HBO1 modulation of in ZR75-1 and HepG2 cells (Figures 5A and S4A). These effects
glycolytic gene transcription. AIB1 (1–1,080), which lacks histone were reversed by SIX1 re-expression in the miR-548a-3p-trans-
acetylase activity, also failed to enhance glycolytic gene expres- fected cells. miR-548a-3p mimics also displayed decreased
sion (Figures S3U and S3V). Taken together, these data suggest extracellular acidification rate (ECAR), which reflects overall
that SIX1 promotes glycolytic gene transcription through HBO1- glycolytic flux, and increased oxygen consumption rate (OCR),
mediated H4K5ac or AIB1-mediated H3K4ac. an indicator of mitochondrial oxidative respiration (Figures 5B,
5C, and S4A). Again, SIX1 re-expression in the miR-548a-3p-
SIX1 Is Inhibited by miR-548a-3p, which Reduces transfected cells rescued these effects. miR-548a-3p mimics in
Glycolytic Gene Expression SIX1 KO ZR75-1 cells had no effects on the glycolytic phenotype
To identify potential microRNAs (miRNAs) regulating SIX1, we (Figures 5D–5F), indicating that miR-548a-3p represses the
used two target prediction programs, miRanda and TargetScan. glycolytic phenotype via SIX1. SIX1 KO ZR75-1 cells or SIX1
Our analysis predicted several potential SIX1-targeting miRNAs, KD HepG2 cells had reduced activities of HK, GAPDH, ALDOA,
among which only miR-548a-3p repressed SIX1 protein expres- PKM, and LDH (Figures S4B and S4C). SIX1 re-expression in the
sion in ZR75-1, HepG2 and HEK293T cells (Figures 4A and 4B). KO or KD cells rescued these effects. Similar effects of SIX1 on
In contrast, miR-548a-3p inhibition enhanced SIX1 protein glycolytic activities were observed in HCT116 colorectal cancer
expression (Figure 4C). miR-548a-3p mimics decreased SIX1 cells and A549 lung cancer cells (Figures S4D and S4E),
mRNA expression while miR-548a-3p inhibition increased SIX1 for which many papers report that the Warburg effect exists
mRNA expression (Figure 4D). miR-548a-3p mimics reduced (Faubert et al., 2013; Liu et al., 2012b).
the luciferase reporter activity of SIX1 WT 30 UTR but not mutated Since SIX1 promotes glycolytic gene expression through
30 UTR, in which the binding sites for miR-548a-3p were mutated HBO1 and AIB1, we tested whether SIX1 modulation of the
(Figure 4E). These results suggest that miR-548a-3p represses glycolytic phenotype depends on HBO1 and AIB1. Consistent
SIX1 expression by directly targeting its 30 UTR. Importantly, with HBO1/AIB1 regulation of glycolytic gene expression,
miR-548a-3p mimics reduced the expression of SIX1-regulated HBO1/AIB1 KO or HBO1/AIB1 KD caused reduced glucose up-
genes except GAPDH (Figure 4F), whereas miR-548a-3p inhibi- take, pyruvate level, lactate production, ATP level, and ECAR,
tion increased the expression of these genes (Figure 4G). and increased OCR (Figures 5G–5L, S4F, and S4G). Importantly,
Re-expression of SIX1 with mutated 30 UTR, but not WT 30 HBO1/AIB1 KO or HBO1/AIB1 KD greatly attenuated the ability
UTR, in miR-548a-3p mimics-transfected cancer cells reversed of SIX1 to regulate these effects.
the effects of miR-548a-3p on glycolytic gene expression
(Figure 4F). Moreover, SIX1 KO abolished the ability of miR- The miR-548a-3p/SIX1 Axis Regulates Glycolysis under
548a-3p to regulate these effects (Figure 4H), indicating that Hypoxia
miR-548a-3p inhibits glycolytic gene expression via SIX1. Since hypoxia is a key phenomenon in cancers (Wilson and Hay,
2011), we determined whether the miR-548a-3p/SIX1 axis has a
The miR-548a-3p/SIX1 Axis Regulates Aerobic role in regulation of glycolysis under hypoxia. Interestingly, hyp-
Glycolysis in Cultured Cells oxia stimulated SIX1 expression at both mRNA and protein
Glycolysis involves a series of reactions that metabolizes levels, and decreased miR-548a-3p expression, but did not alter
glucose to pyruvate to produce a net of two ATP from each the expression of HBO1 and AIB1 (Figure S4H). Interestingly,
glucose molecule. Cancer cells consume glucose avidly and under both normoxia and hypoxia a positive feedback loop
produce lactate from pyruvate even in the presence of oxygen. was formed. Overexpression of HIF-1a increased SIX1 expres-
Since the miR-548a-3p/SIX1 axis regulates glycolytic gene sion, and SIX1 overexpression stimulated HIF-1a expression
Figure 3. SIX1 Promotes Glycolytic Gene Expression through Association with HBO1 and AIB1
(A) Cellular extracts from ZR75-1 cells stably expressing FLAG (control) or FLAG-SIX1 were immunopurified with anti-FLAG affinity columns and eluted with FLAG
peptide. The eluates were resolved by SDS-PAGE and silver stained. The differential protein bands were retrieved and analyzed by mass spectrometry.
(B) HepG2 or ZR75-1 cells were immunoprecipitated with anti-SIX1 or normal IgG, and the precipitates were analyzed by immunoblot with the indicated
antibodies. IP, immunoprecipitation. Nonspecific band is shown (heavy chain).
(C) CoIP analysis of ZR75-1 cells treated with or without DNase I. DNA agarose gel electrophoresis serves as a control for DNase I activity. Nonspecific band is
shown (heavy chain).
(D and E) HBO1/AIB1 WT or KO ZR75-1 cells were transiently transfected with SIX1, HBO1, AIB1, or empty vector (EV). Glycolytic gene expression was measured
using qRT-PCR (D) and immunoblot (E).
(F) ChIP analysis of SIX1, HBO1, and AIB1 occupancy on glycolytic gene promoters in ZR75-1 cells. Promoter regions of each gene represent the region
containing the first SIX1 binding site shown in Figure 2B unless there is only one SIX1 binding site within the gene promoter analyzed. The graph shows the
percentage of input.
(G) Re-ChIP analysis of the occupancy of SIX1 and HBO1 or AIB1 on the indicated glycolytic gene promoters in ZR75-1 cells.
(H) ChIP analysis of SIX1, HBO1, AIB1, and histone H3 or H4 acetylation occupancy on the indicated glycolytic gene promoters in SIX1, HBO1, or AIB1 KO
ZR75-1 cells.
Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results. Statistical significance was assessed by two-tailed
Student’s t test. *p < 0.05 and **p < 0.01 versus respective WT ZR75-1 cells transfected with empty vector (D). **p < 0.01 versus respective normal IgG (F–H).
See also Figure S3 and Table S3.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
(Figure S4I). On the contrary, HIF-1a overexpression repressed PET (positron emission tomography) scans to measure glucose
miR-548a-3p expression. miR-548a-3p mimics or KO of SIX1, uptake in tumor xenografts in nude mice. The tumors with miR-
HBO1, or AIB1 repressed the transcription of their correspond- 548a-3p inhibitor revealed increased glucose uptake and those
ing glycolytic genes under both normoxic and hypoxic condi- with KO of SIX1, HBO1, or AIB1 showed decreased glucose up-
tions (Figures S4J–S4M). Consistent with this, miR-548a-3p take (Figure 6A). SIX1 KO abolished the ability of miR-548a-3p
mimics or KO of SIX1, HBO1, or AIB1 reduced glucose uptake, inhibitor to promote glucose uptake. KO of HBO1 or AIB1 greatly
pyruvate level, lactate production, and ATP level under normoxia reduced the ability of SIX1 to increase glucose uptake. miR-
and hypoxia (Figures S4N–S4Q). 548a-3p inhibitor enhanced the expression of their commonly
regulated glycolytic genes, ENO1 and LDHA, as well as lactate
Aerobic Glycolysis Is Critical for miR-548a-3p/SIX1 Axis level. The opposite effects were seen with KO of SIX1, HBO1,
Modulation of Proliferation of Cultured Cancer Cells or AIB1 (Figures 6B–6D and S5A–S5D). The tumors with higher
We first tested whether the miR-548a-3p/SIX1 axis regulates glycolysis grew faster (Figure 6E). These data suggest that
cancer cell proliferation in cultured cells. miR-548a-3p mimics miR-548a-3p regulates glycolysis via SIX1 and that SIX1 modu-
reduced cell proliferation (Figures 5M and S4R). This effect was lates glycolysis through HBO1 and AIB1 in nude mice.
reversed by SIX1 re-expression in the miR-548a-3p-transfected Next, we tested whether glycolysis plays a role in miR-548a-
cells. We then examined whether glycolysis plays a role in 3p/SIX1 axis-mediated regulation of tumor growth in nude
miR-548a-3p/SIX1 axis-mediated regulation of cancer cell prolif- mice. As expected, the glycolytic inhibitor 2-DG and KD of
eration. As expected, glycolytic inhibitors 2-deoxy-D-glucose LDHA, the enzyme that catalyzes the final step of glycolysis,
(2-DG) and 3-bromopyruvate (3-BP) inhibited cancer cell prolifer- inhibited tumor growth and lactate level (Figures 6F–6I and
ation (Figures 5N, 5O, S4S, and S4T). Importantly, 2-DG and 3-BP S5E–S5H). Importantly, 2-DG and LDHA KD greatly attenuated
greatly reduced the ability of anti-miR-548a-3p and SIX1 to pro- the ability of anti-miR-548a-3p and SIX1 to promote tumor
mote cancer cell proliferation. In addition, we tested the effect growth and lactate level, suggesting that glycolysis mediated
of SIX1 on cancer cell proliferation and ATP level using galactose by the miR-548a-3p/SIX1 axis is critical for cancer cell growth.
or glucose-containing media. Cells grown in galactose depend To examine the physiological relevance of the miR-548a-3p/
more on mitochondrial oxidative phosphorylation (OXPHOS) for SIX1 axis in glycolysis, we used Six1 KO embryos and cancer
energy production (Finley et al., 2011). As expected, cancer cells samples. Six1 KO embryos had decreased glucose uptake and
grown in galactose-treated media had similar growth behavior to lactate level (Figure 6J). Moreover, patients with breast tumors
those grown in high glucose-treated media (Figure S4U). How- who had increased glucose uptake assessed by 18FDG PET
ever, SIX1-overexpressing cells grown in glucose grew faster scans showed decreased miR-548a-3p expression and
than those grown in galactose. The glycolytic inhibitor 2-DG, increased SIX1 expression (Figure 6K). We confirmed the
but not the OXPHOS inhibitor oligomycin, almost abolished this specificity of miR-548a-3p staining by correlation analysis of
effect. Consistent with the cell proliferation results, SIX1-overex- miR-548a-3p expression in breast tissues examined by miRNA
pressing cells grown in glucose produced more ATP than those in situ hybridization (MISH) and qRT-PCR, respectively (Figures
grown in galactose (Figure S4U). Again, 2-DG, but not oligomycin, S5I and S5J), and the specificity of the SIX1 antibody by
almost abrogated this effect. These data suggest that increased immunohistochemical (IHC) staining of breast cancer tissues or
glycolysis by SIX1 drives enhanced ATP production that supports immunoblot with cell lysates (Figures S5K and S5L).
proliferation. Moreover, hypoxia increased cell proliferation and
SIX1 KO or SIX1 KD almost abolished hypoxia-stimulated Cancer-Related SIX1 Mutation Increases Its Ability to
cell proliferation (Figure S4V), suggesting the key role of SIX1 in Promote Glycolytic Gene Expression, Aerobic
hypoxia-induced cell proliferation. Glycolysis, and Tumor Growth
The Q177R mutation in SIX1 has been reported in tumors (Walz
The miR-548a-3p/SIX1 Axis Regulates Glycolysis and et al., 2015; Wegert et al., 2015). We tested the effect of the can-
Tumor Growth In Vivo cer-related mutant SIX1 (Q177R) on glycolytic gene expression.
To examine the effects of the miR-548a-3p/SIX1 axis on SIX1 (Q177R) overexpression in SIX1 KO ZR75-1 cells or Six1 KO
glycolysis in vivo, we used 18FDG (fluorodeoxyglucose) micro- MEFs caused increased HK2, GAPDH, PKM2, and LDHA
Figure 4. miR-548a-3p Represses Glycolytic Gene Expression through SIX1 Inhibition

(A) Immunoblot analysis of SIX1 expression in HEK293T cells transiently transfected with the indicated miRNAs. NC, nonspecific control for miRNAs.
(B and C) Immunoblot analysis of ZR75-1, HepG2, and HEK293T cells transfected with miR-548a-3p (B) or miR-548a-3p inhibitor (C). Histograms show
miR-548a-3p expression determined by qRT-PCR. Scramble: negative control for miRNA inhibitor.
(D) qRT-PCR analysis of SIX1 expression in cells transfected as in (B) and (C).
(E) miRNA luciferase reporter assays in ZR75-1, HepG2, and HEK293T cells transfected with WT or mutated SIX1 reporter and miR-548a-3p. The top panel
indicates WT and mutant forms of putative miR-548a-3p target sequences of SIX1 30 UTR. Red font indicates the mutated miR-548a-3p-binding sites within
human SIX1 30 UTR. SIX1 WT, wild-type SIX1 30 UTR; SIX1 MUT, mutated SIX1 30 UTR.
(F) Immunoblot analysis of glycolytic gene expression in ZR75-1 and HepG2 cells transfected with miR-548a-3p or miR-548a-3p plus SIX1 expression vector with
WT or mutated 30 UTR.
(G) Immunoblot analysis of glycolytic gene expression in ZR75-1 and HepG2 cells transfected with anti-miR-548a-3p.
(H) Immunoblot analysis of glycolytic gene expression in SIX1 WT/KO ZR75-1 cells or Six1 WT/KO MEFs transfected with miR-548a-3p.
Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results. Statistical significance was assessed by two-tailed
Student’s t test. *p < 0.05, **p < 0.01 versus respective NC or scramble.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
expression, compared with WT SIX1 (Figures 7A and 7B). It that there was no Q177R mutation in more than 20 different
should be noted that the overexpression level of WT SIX1 or human cancers, including breast cancer, liver cancer, and colo-
SIX1 (Q177R) in SIX1 KO ZR75-1 cells or Six1 KO MEFs is similar rectal adenocarcinoma (http://www.cbioportal.org).
to the endogenous SIX1 expression level in parental WT cells
(Figure S6A). To examine how the SIX1 (Q177R) mutant pro- Clinical Relevance of the miR-548a-3p/SIX1 Axis in
motes expression of the glycolytic genes, we performed ChIP Breast Cancer
experiments on the HK2 and LDHA promoters. SIX1 (Q177R) In the breast cancer patients we analyzed, miR-548a-3p expres-
was recruited to the HK2 and LDHA promoters more strongly sion negatively correlated with expression of SIX1, and SIX1
than WT SIX1 (Figure 7C). Moreover, SIX1 (Q177R) increased expression positively correlated with PGK1 and LDHA expres-
HK2 and LDHA promoter reporter activity more greatly than sion (Figure 8A). In contrast, miR-548a-3p negatively correlated
WT SIX1 (Figure 7D). The cellular localization of SIX1 (Q177R) with PGK1 and LDHA expression. Like the specificity of
was similar to that of WT SIX1 (Figure 7E). These data suggest miR-548a-3p and SIX1, the specificity of the PGK1 and LDHA
that SIX1 (Q177R) increases its ability to promote glycolytic antibodies was confirmed (Figures S7A–S7D). The correlation
gene expression through its increased binding to the glycolytic between SIX1 and PGK1 or LDHA was further validated using
gene promoters. external datasets from TCGA and Oncomine (Figures S7E and
Next, we tested the effect of hypoxia on SIX1 (Q177R)-medi- S7F). Data for miR-548a-3p are not available from TCGA and
ated glycolytic gene transcription. Like SIX1 overexpression, Oncomine. Moreover, IHC analysis showed that expression of
SIX1 (Q177R) overexpression in SIX1 KO ZR75-1 or Six1 KO HIF-1a, an intrinsic marker for hypoxia, positively correlated
MEFs under hypoxia resulted in greater glycolytic gene with SIX1 expression and the expression of PGK1 and LDHA,
transcription compared with that under normoxia (Figure S6B). the common target genes of HIF-1a and SIX1 (Figure 8A). The
Hypoxia increased the interaction between SIX1 and HBO1 association of HIF-1a with SIX1, PGK1, and LDHA was further
or AIB1 (Figure S6C). Similar effects were observed with validated by TCGA datasets (Figure S7G). In addition, IHC anal-
SIX1 (Q177R). ysis revealed that HBO1 expression positively associated with
To test the effect of cancer-related SIX1 mutation on glycolysis AIB1 expression (Figure S7H). The specificity of the AIB1 and
in vitro, we transfected WT SIX1 or SIX1 (Q177R) into SIX1 KO HBO1 antibodies was confirmed (Figures S7I and S7J). Again,
ZR75-1 or Six1 KO MEFs. SIX1 (Q177R) showed increased the correlation between AIB1 and HBO1 was further confirmed
glucose uptake, pyruvate level, lactate production, and ATP level by TCGA datasets (Figure S7K).
compared with WT SIX1 (Figure 7F). SIX1 KO ZR75-1 cells SIX1 is overexpressed in various human cancers. SIX1 mRNA
harboring SIX1 (Q177R) grew faster than those harboring WT and/or protein were overexpressed in more than 50% of breast
SIX1 (Figure 7G), and SIX1 (Q177R) had larger tumors than WT cancer patients and over 60% of liver cancer patients (Ford
SIX1 in nude mice (Figure 7H). As expected, SIX1 (Q177R) had et al., 1998; Ng et al., 2006; Reichenberger et al., 2005). Datasets
increased HK2 and LDHA expression and lactate level compared from Oncomine indicated that SIX1 mRNA was overexpressed in
with WT SIX1 (Figures 7I and 7J). Previous studies suggested 38.9% of breast cancer patients and 48.6% of liver cancer
that the Q177R mutation has been shown in kidney tumors in patients (Figures S7L and S7M). The clinical significance of
children. By sequencing of both DNA strands from 42 breast miR-548a-3p expression in cancer is unknown. Our analysis
tumor tissues, such a mutation was not observed (Figure S6D). showed that miR-548a-3p was significantly downregulated in
In addition, external datasets from TCGA (The Cancer Genome breast cancer tissues (Figure 8B) and negatively correlated
Atlas) with a sample size between 36 and 1,144 cases showed with tumor size, nodal status, and grade (Table S4). Breast
Figure 5. The miR-548a-3p/SIX1 Axis Modulates the Warburg Effect and Cell Proliferation in Cultured Cells
(A) ZR75-1 cells were transfected with nonspecific control (NC), miR-548a-3p, or miR-548a-3p plus SIX1. Glucose uptake, pyruvate level, lactate production,
and ATP level were determined as described in STAR Methods. Representative immunoblot reveals SIX1 expression. qRT-PCR analysis indicates
miR-548a-3p expression.
(B and C) ZR75-1 cells were transfected as in (A), and ECAR (B) and OCR (C) were then determined as described in STAR Methods.
(D) SIX1 WT or KO ZR75-1 cells were transfected with or without miR-548a-3p and analyzed as in (A).
(E and F) ZR75-1 cells were transfected as in (D), and ECAR (E) and OCR (F) were then examined.
(G) HBO1 WT or KO ZR75-1 cells were transiently transfected with SIX1 or empty vector and analyzed as in (A).
(H and I) HBO1 WT or KO ZR75-1 cells were transfected as in (G), and ECAR (H) and OCR (I) were then assessed.
(J) AIB1 WT or KO ZR75-1 cells were transiently transfected with SIX1 or empty vector and analyzed as in (A).
(K and L) AIB1 WT or KO ZR75-1 cells were transfected as in (J), and ECAR (K) and OCR (L) were then examined.
(M) The proliferation curve of ZR75-1 cells transfected with miR-548a-3p or miR-548a-3p plus Myc-tagged SIX1. Representative immunoblot reveals expression
of SIX1.
(N) The proliferation curve of ZR75-1 cells transfected with anti-miR-548a-3p and treated with 2.5 mM 2-DG or 100 mM 3-BP as indicated.
Representative immunoblot shows SIX1 expression. qRT-PCR analysis indicates miR-548a-3p expression.
(O) The proliferation curve of ZR75-1 cells transfected with Myc-tagged SIX1 and treated with 2.5 mM 2-DG or 100 mM 3-BP as indicated.
Representative immunoblot reveals expression of Myc-tagged Six1.
Data shown are mean ± SD of quintuplicate measurements that have been repeated 3 times with similar results (A for glucose uptake, pyruvate level, lactate
production, ATP level, and B–L). Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results (A for qRT-PCR
analysis). Data shown are mean ± SD of 3 independent experiments (M–O). Statistical significance was assessed by two-tailed Student’s t test. *p < 0.05,
**p < 0.01 versus NC (A–F). *p < 0.05, **p < 0.01 versus WT ZR75-1 cells transfected with empty vector (G–L). *p < 0.05, **p < 0.01 at the final day (M–O). See also
Figure S4.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
cancer patients with decreased miR-548a-3p expression had 2015; Wegert et al., 2015). However, our research data of 42
shorter disease-free survival and overall survival (Figure 8C). breast tumor tissues and external datasets of over 20 different
cancers from TCGA did not show a Q177R mutation, suggesting
DISCUSSION that this mutation may be specific for kidney tumors in children.
The Q177R mutation has oncogenic gain-of-function pheno-
Cancer cells frequently display high rates of aerobic glycolysis, a types in terms of the Warburg effect. Since miR-548a-3p inhibits
hallmark of cancer (Liberti and Locasale, 2016). This metabolic SIX1 expression by directly targeting its 30 UTR, it is most likely
reprogramming gives cancer cells a growth advantage by that miR-548a-3p also inhibits SIX1 (Q177R) expression.
providing energy for cancer cell growth. Our study establishes miR-548a-3p expression is downregulated in breast tumors,
the miR-548a-3p/SIX1 axis as a critical regulatory pathway in and its low expression predicts a poor prognosis in breast
the Warburg effect. SIX1 directly promotes the expression of cancer patients. In contrast to SIX1, miR-548a-3p represses
many key glycolytic genes that facilitates the Warburg effect the Warburg effect, causing tumor repression. Cancer cells
and tumor growth. The upstream regulation of SIX1 expression uses glycolysis more than oxidative respiration (OR) for their en-
and function is negatively controlled by miR-548a-3p. Using ergy requirements. miR-548a-3p overexpression and SIX1 KO or
different cancer cell lines, SIX1 KO cancer cell line, Six1 KO SIX1 KD inhibit glycolysis and facilitate OR. The glycolytic
MEFs, Six1 KO mice embryos, and tumor samples, we show inhibitor 2-DG in combination with the PI3K/mTOR inhibitor
that SIX1 regulates glycolytic gene expression, glucose uptake, PF-04691502 was shown to switch lymphoma cells from aerobic
and the level of lactate, a metabolite that can facilitate tumor glycolysis to OR, and this combination causes strong cytotox-
growth and metastasis. Our data indicate that SIX1 is a key tran- icity toward lymphoma cells but low toxicity to normal lympho-
scription factor for regulation of the Warburg effect and also indi- cytes (Chen et al., 2016). Since the miR-548a-3p/SIX1 axis is
cate a causal role for SIX1 in glycolysis regulation (Figure 8D). deregulated in cancer, correlates with prognosis, and controls
SIX1 is overexpressed in various human cancers and its glycolysis, this axis is expected to be an excellent therapeutic
elevated expression is associated with poor clinical outcomes target for curing cancer.
(Wu et al., 2015). In Six1 KO mice, multiple organs fail to develop Potentiation of glycolytic gene transcription by SIX1 is
properly due to the increase in apoptosis and the reduction in cell mediated mainly through histone acetyltransferases HBO1
proliferation (Li et al., 2003; Ozaki et al., 2004; Zheng et al., 2003). and AIB1. Like miR-548a-3p and SIX1, HBO1 is a key regulator
Six1 KO mice die shortly after birth. Mutations in SIX1 have been of the Warburg effect. AIB1 was shown to interact with HIF-1a
reported in patients with branchio-oto-renal syndrome, a devel- to promote the expression of some glycolytic genes (Zhao
opmental disorder (Ruf et al., 2004). Since SIX1 regulates et al., 2014). HBO1 and AIB1 have redundant and distinct roles
expression of many glycolytic genes such as HK2 and PKM2 in regulation of glycolytic gene expression. Our study suggests
that modulate cell proliferation and/or apoptosis (Liberti and that HBO1-mediated H4K5ac and AIB1-mediated H3K4ac are
Locasale, 2016), the function of SIX1 in glycolysis at least partly important for SIX1 modulation of glycolytic gene expression.
explains these defects induced by SIX1 KO or mutations. How- SIX1 might be directly involved in the process. The exact roles
ever, we cannot exclude the possibility that other genes of HBO1 and AIB1 in stimulating gene expression remain to be
regulated by SIX1 may also be responsible for these defects. investigated. Since it is well established that transcription
Recently, a hotspot mutation (Q177R) of SIX1 has been reported factors can orchestrate the recruitment of histone-modifying
in approximately 10% of kidney tumors in children (Walz et al., enzymes to specific sets of target genes (Thorne et al., 2009),
Figure 6. The miR-548a-3p/SIX1 Axis Modulates the Warburg Effect and Tumor Growth In Vivo
(A) Representative FDG microPET images of living nude mice injected with WT or SIX1, HBO1 or AIB1 KO ZR75-1 cells treated with antagomiR-548a-3p, or stably
expressing SIX1 or empty vector as indicated. The mouse corresponds to the fourth column in each group (right). Arrows indicate tumor glucose uptake (right).
Stripped tumors are shown (left).
(B and C) Analysis of the expression of the indicated proteins and miR-548a-3p in representative excised tumor from (A). Representative immunoblot (B) and
qRT-PCR (C). The indicated tumor tissue from a single mouse in each group was cut into several pieces and then used for immunoblot and qRT-PCR. Tumors
were from the fourth column in each group in (A).
(D) Lactate level of representative tumor tissues from (A). Tumor tissues were treated as in (B) and (C). Tumors were from the fourth column in each group in (A).
(E) Xenograft tumors were established as in (A) and the growth curve was plotted.
(F) ZR75-1 cells stably expressing LDHA shRNA or treated with antagomiR-548a-3p were injected into nude mice. 2-DG was used as indicated. The growth curve
was plotted (right). Stripped tumors are shown (left).
(G) The expression of the indicated proteins in representative excised tumor from (F) was analyzed as in (B). Tumors were from the fourth column in each group in (F).
(H) The expression of miR-548a-3p in representative excised tumor from (F) was analyzed as in (C). Tumors were from the fourth column in each group in (F).
(I) Lactate level of representative tumor tissues from (F) was assessed as in (D). Tumors were from the fourth column in each group in (F).
(J) Representative FDG microPET images of Six1 WT (+/+), heterozygous (+/), and KO (/) embryos at day 15.5 of gestation. After imaging, embryo tissues
were homogenized to measure the lactate levels as described in STAR Methods (n = 9 for WT; n = 9 for heterozygous; n = 5 for KO). The change in lactate level of
the embryos was plotted.
(K) Representative FDG PET scans and IHC or MISH analysis of 43 breast cancer patients. SIX1 was examined by IHC and miR-548a-3p by MISH. Arrows reveal
tumor glucose uptake. Scale bar, 100 mm. The correlation of glucose uptake with SIX1 or miR-548a-3p expression was determined using the Mann-Whitney
U test. Case 1 and case 2 refer to two representative samples categorized by low and high expression of miR-548a-3p.
Values shown are mean ± SD of measurements of the 3 pieces from each group that have been repeated 3 times with similar results (C). Values shown are
mean ± SD of measurements of the five pieces from each group that have been repeated 3 times with similar results (D). p Values were generated by two-tailed
Student’s t test (C–F and H–J). **p < 0.01 versus parental ZR75-1 cells (C and D). **p < 0.01 at the final day (E and F). See also Figure S5.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
the observation that HBO1 and AIB1 do not stimulate the B Luciferase Reporter Assay
expression of GAPDH, which is regulated by SIX1, suggests B Chromatin Immunoprecipitation (ChIP) and re-ChIP
that SIX1 may interact with another histone-modifying enzyme B Co-immunoprecipitation and His or GST Pull-down
to promote GAPDH expression. HBO1 can enrich breast Assays
cancer stem-like cells (Duong et al., 2013). IHC analysis dem- B Mass Spectrometry
onstrates strong HBO1 expression in various human cancers B Cell Proliferation Assays
(Iizuka et al., 2009). HBO1 inhibits the transcriptional activity B Glucose Uptake, Pyruvate, Lactate, ATP, HK, GAPDH,
of nuclear factor kB (NF-kB), although HBO1-regulated down- ALDO, PKM and LDH Assays
stream target genes are unknown (Contzler et al., 2006). How- B Extracellular Acidification Rate and Oxygen Consump-
ever, the role of NF-kB in tumorigenesis is complex, as in some tion Rate Assays
models NF-kB inhibition suppresses, whereas in others it facil- B SIX1 Q177R Mutation Screening
itates, tumor development (Pikarsky and Ben-Neriah, 2006). B miRNA In Situ Hybridization and Immunohisto-
Further studies are required to test whether HBO1 has a chemistry
context-dependent role in carcinogenesis and to determine B PET Imaging of Glucose Uptake in Mice
whether HBO1 inhibition of NF-kB activity is a negative feed- d QUANTIFICATION AND STATISTICAL ANALYSIS
back. AIB1 is overexpressed in many cancers, and its over- B Statistical Analysis
expression correlates with poor survival of patients (Zhao d DATA AND SOFTWARE AVAILABILITY
et al., 2014). Since HBO1 or AIB1 KO attenuates the ability of B Data Resources
SIX1 to promote glycolysis and tumor growth, and SIX1 is
necessary for recruitment of HBO1 and AIB1 to glycolytic SUPPLEMENTAL INFORMATION
gene promoters, targeting SIX1 may make cancer therapy
more effective than targeting HBO1 or AIB1. However, further Supplemental Information includes seven figures and seven tables and
can be found with this article online at https://doi.org/10.1016/j.ccell.2018.
investigation of potential side effects of SIX1 inhibition is
01.010.
required, as SIX1 regulates more than 1,900 genes.
ACKNOWLEDGMENTS
STAR+METHODS
This work was supported by the National Key Research And Development
Detailed methods are provided in the online version of this paper Program of China (2017YFA0505602), the National Natural Science Founda-
tion (81330053, 81630067, 81472589, 81672602, 81471466, 81572597, and
and include the following:
81502264) and Beijing Nova Program (Z141102001814055) and Logistics
Scientific Research project (BWS16J010).
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
AUTHOR CONTRIBUTIONS
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Human Clinical Samples Conceptualization, Q.Y. and X.X.; Methodology, L.L., Y. Liang, L.K., Z.Y., J.H.,
B Mice S.J., S.C., W.Y., Q.D., and T.H.; Software, X.X. and L.L.; Validation, X.H., Q.J.,
B SIX1, HBO1 and AIB1 Knockout Cancer Cell Lines Q.S., S.Z., Z.Y., J.H., and S.J.; Formal Analysis, Q.Y., X.X., L.L., and Y. Liang.;
Investigation, L.L., Y. Liang, L.K., X.H., Q.J., Q.S., S.Z., S.J., S.C., W.Y., Q.D.,
B Cell Lines and Drug Treatments
and T.H.; Resources, X.X., L.K., T.W., W.Z., Y. Liu, S.G., Y. Li, H.M., and C.Y.;
d METHOD DETAILS
Data Curation, Q.Y., X.X., L.L., and Y. Liang; Writing – Original Draft, Q.Y., L.L.,
B Plasmids, siRNAs, shRNAs, and Lentiviruses and X.X.; Writing – Review & Editing, Q.Y., X.X., and L.L.; Visualization, Z.Y.,
B Transcriptome Sequencing (RNA-Seq) J.H., and S.J.; Supervision, Q.Y.; Project Administration, Q.Y.; Funding Acqui-
B Quantitative Reverse Transcription-PCR (RT-PCR) sition, Q.Y., X.X., T.W., and Z.Y.
Figure 7. Cancer-Related SIX1 Mutation Increases Its Ability to Enhance the Warburg Effect and Tumor Growth
(A and B) Expression analysis of SIX1 KO ZR75-1 cells or Six1 KO MEFs infected with lentivirus carrying Myc-tagged SIX1 or SIX1 (Q177R). qRT-PCR (A) and
immunoblot (B).
(C) ChIP analysis of the occupancy of WT SIX1 and SIX1 (Q177R) on HK2 and LDHA promoters in SIX1 KO ZR75-1 cells infected with Myc-tagged SIX1 or
SIX1 (Q177R). Anti-Myc was used for ChIP. Immunoblot shows the expression of WT SIX1 and SIX1 (Q177R).
(D) Luciferase activity of HK2 and LDHA promoter reporter in SIX1 KO ZR75-1 cells infected with Myc-tagged SIX1 or SIX1 (Q177R). Immunoblot indicates the
expression of WT SIX1 and SIX1 (Q177R).
(E) ZR75-1 cells were infected as in (D). Cells were stained with anti-Myc (red). The nuclei were stained with DAPI (blue). Scale bar, 100 mm.
(F) SIX1 KO ZR75-1 cells or Six1 KO MEFs were infected with lentivirus carrying Myc-tagged SIX1 or SIX1 (Q177R), and the glucose uptake and the production of
pyruvate, lactate, and ATP were then detected. Immunoblot shows the expression of SIX1 or SIX1 (Q177R).
(G) SIX1 KO ZR75-1 cells were infected with the indicated constructs as in (F) and cell proliferation was determined.
(H) SIX1 KO ZR75-1 cells stably infected with the indicated constructs were injected into nude mice. The growth curve was plotted.
(I) Representative immunoblot of the expression of HK2 and LDHA in the representative excised tumor from (H) as analyzed in Figures 6B and 6C. Tumors were
from the fourth column in each group in (H).
(J) Lactate level of the representative tumor tissue from (H) as analyzed as in Figure 6D. Tumors were from the fourth column in each group in (H).
Data shown are mean ± SD of triplicate measurements that have been repeated 3 times with similar results (A–D and G). Data shown are mean ± SD of
quintuplicate measurements that have been repeated 3 times with similar results (F). Data were analyzed using two-tailed Student’s t test. **p < 0.01 versus
respective empty vector and #p < 0.01 versus Myc-SIX1 (A, C, D, F–H, and J). See also Figure S6.

10.1016/j.ccell.2018.01.010

10.1016/j.ccell.2018.01.010
DECLARATION OF INTERESTS of HSIX1: a possible mechanism of breast carcinogenesis. Proc. Natl. Acad.
Sci. USA 95, 12608–12613.
The authors declare no competing interests.
Greiner, M., Pfeiffer, D., and Smith, R.D. (2000). Principles and practical
application of the receiver operating characteristic analysis for diagnostic
Received: July 14, 2017
test. Prev. Vet. Med. 45, 23–41.
Revised: October 26, 2017
Accepted: January 18, 2018 Iizuka, M., Takahashi, Y., Mizzen, C.A., Cook, R.G., Fujita, M., Allis, C.D.,
Published: February 15, 2018 Frierson, H.F., Jr., Fukusato, T., and Smith, M.M. (2009). Histone acetyltrans-
ferase Hbo1: catalytic activity, cellular abundance, and links to primary can-
REFERENCES cers. Gene 436, 108–114.
Jin, B.F., He, K., Wang, H.X., Wang, J., Zhou, T., Lan, Y., Hu, M.R., Wei, K.H.,
Chen, X.S., Li, L.Y., Guan, Y.D., Yang, J.M., and Cheng, Y. (2016). Anticancer Yang, S.C., Shen, B.F., et al. (2003). Proteomic analysis of ubiquitin-
strategies based on the metabolic profile of tumor cells: therapeutic targeting proteasome effects: insight into the function of eukaryotic initiation factor
of the Warburg effect. Acta Pharmacol. Sin. 37, 1013–1019. 5A. Oncogene 22, 4819–4830.
Coletta, R.D., Christensen, K.L., Micalizzi, D.S., Jedlicka, P., Varella-Garcia, Koppenol, W.H., Bounds, P.L., and Dang, C.V. (2011). Otto Warburg’s
M., and Ford, H.L. (2008). Six1 overexpression in mammary cells induces contributions to current concepts of cancer metabolism. Nat. Rev. Cancer
genomic instability and is sufficient for malignant transformation. Cancer 11, 325–337.
Res. 68, 2204–2213.
Kumar, J.P. (2009). The sine oculis homeobox (SIX) family of transcription
Contzler, R., Regamey, A., Favre, B., Roger, T., Hohl, D., and Huber, M. (2006).
factors as regulators of development and disease. Cell. Mol. Life Sci. 66,
Histone acetyltransferase HBO1 inhibits NF-kappaB activity by coactivator
565–583.
sequestration. Biochem. Biophys. Res. Commun. 350, 208–213.
Laclef, C., Hamard, G., Demignon, J., Souil, E., Houbron, C., and Maire, P.
Doherty, J.R., and Cleveland, J.L. (2013). Targeting lactate metabolism for
(2003). Altered myogenesis in Six1-deficient mice. Development 130,
cancer therapeutics. J. Clin. Invest. 123, 3685–3692.
2239–2252.
Doménech, E., Maestre, C., Esteban-Martı́nez, L., Partida, D., Pascual, R.,
Liberti, M.V., and Locasale, J.W. (2016). The Warburg effect: How does it
Fernández-Miranda, G., Seco, E., Campos-Olivas, R., Pérez, M., Megias, D.,
benefit cancer cells? Trends Biochem. Sci. 41, 211–218.
et al. (2015). AMPK and PFKFB3 mediate glycolysis and survival in response
to mitophagy during mitotic arrest. Nat. Cell Biol. 17, 1304–1316. Liu, D., Li, L., Zhang, X.X., Wan, D.Y., Xi, B.X., Hu, Z., Ding, W.C., Zhu, D.,
Wang, X.L., Wang, W., et al. (2014). SIX1 promotes tumor lymphangiogenesis
Doyon, Y., Cayrou, C., Ullah, M., Landry, A.J., Côté, V., Selleck, W., Lane,
by coordinating TGFb signals that increase expression of VEGF-C. Cancer
W.S., Tan, S., Yang, X.J., and Côté, J. (2006). ING tumor suppressor proteins
Res. 74, 5597–5607.
are critical regulators of chromatin acetylation required for genome expression
and perpetuation. Mol. Cell 21, 51–64. Liu, Y., Cao, Y., Zhang, W., Bergmeier, S., Qian, Y., Akbar, H., Colvin, R., Ding,
Duong, M.T., Akli, S., Macalou, S., Biernacka, A., Debeb, B.G., Yi, M., Hunt, J., Tong, L., Wu, S., et al. (2012b). A small-molecule inhibitor of glucose
K.K., and Keyomarsi, K. (2013). Hbo1 is a cyclin E/CDK2 substrate that transporter 1 downregulates glycolysis, induces cell-cycle arrest, and inhibits
enriches breast cancer stem-like cells. Cancer Res. 73, 5556–5568. cancer cell growth in vitro and in vivo. Mol. Cancer Ther. 11, 1672–1682.
El-Hashash, A.H., Al Alam, D., Turcatel, G., Rogers, O., Li, X., Bellusci, S., and Li, X., Oghi, K.A., Zhang, J., Krones, A., Bush, K.T., Glass, C.K., Nigam, S.K.,
Warburton, D. (2011). Six1 transcription factor is critical for coordination of Aggarwal, A.K., Maas, R., Rose, D.W., et al. (2003). Eya protein phosphatase
epithelial, mesenchymal and vascular morphogenesis in the mammalian activity regulates Six1-Dach-Eya transcriptional effects in mammalian organ-
lung. Dev. Biol. 353, 242–258. ogenesis. Nature 426, 247–254.
Faubert, B., Boily, G., Izreig, S., Griss, T., Samborska, B., Dong, Z., Dupuy, F., Liu, Y., Chu, A., Chakroun, I., Islam, U., and Blais, A. (2010). Cooperation
Chambers, C., Fuerth, B.J., Viollet, B., et al. (2013). AMPK is a negative regu- between myogenic regulatory factors and SIX family transcription factors is
lator of the Warburg effect and suppresses tumor growth in vivo. Cell Metab. important for myoblast differentiation. Nucleic Acids Res. 38, 6857–6871.
17, 113–124. Liu, Y., Nandi, S., Martel, A., Antoun, A., Ioshikhes, I., and Blais, A. (2012a).
Finley, L.W., Carracedo, A., Lee, J., Souza, A., Egia, A., Zhang, J., Teruya- Discovery, optimization and validation of an optimal DNA-binding sequence
Feldstein, J., Moreira, P.I., Cardoso, S.M., Clish, C.B., et al. (2011). SIRT3 for the Six1 homeodomain transcription factor. Nucleic Acids Res. 40,
opposes reprogramming of cancer cell metabolism through HIF1a destabiliza- 8227–8239.
tion. Cancer Cell 19, 416–428. Micalizzi, D.S., Christensen, K.L., Jedlicka, P., Coletta, R.D., Barón, A.E.,
Ford, H.L., Kabingu, E.N., Bump, E.A., Mutter, G.L., and Pardee, A.B. (1998). Harrell, J.C., Horwitz, K.B., Billheimer, D., Heichman, K.A., Welm, A.L., et al.
Abrogation of the G2 cell cycle checkpoint associated with overexpression (2009). The Six1 homeoprotein induces human mammary carcinoma cells to
Figure 8. Clinical Relevance of the miR-548a-3p/SIX1 Axis in Breast Cancer

(A) Representative IHC of 187 breast cancer patients. SIX1, PGK1, LDHA, and HIF-1a were assessed by IHC, and miR-548a-3p by qRT-PCR. Scale bar, 100 mm.
The correlation of miR-548a-3p, PGK1, or LDHA with SIX1, or that of PGK1 or LDHA with miR-548a-3p, was analyzed. The association of HIF-1a with SIX1, PGK1,
and LDHA was also determined. Case 1 and case 2 refer to two representative samples categorized by low and high expression of SIX1. The low, medium, and
high expression of SIX1, PGK1, LDHA, and HIF-1a was determined as described in STAR Methods. Horizontal lines inside the box represent the median; the
bottom and top of the boxes represent the 25th and 75th percentiles. The lines above and below the box represent the upper and lower extremes. The vertical
bars represent the range of data. Any outliers are marked with a circle. Data was analyzed by one-way ANOVA with Games-Howell correction. **p < 0.01 versus
case 1.
(B) miR-548a-3p expression in 187 cancerous breast tissues and matched adjacent normal breast tissues was determined by qRT-PCR. Relative miR-548a-3p
expression levels were plotted and compared between normal and cancer tissues (Mann-Whitney U test).
(C) The disease-free and overall survival curves related to low and high expression of miR-548a-3p were analyzed in 187 breast cancer patients from (G) using the
Kaplan-Meier method.
(D) A proposed model underlying the role of the miR-548a-3p/SIX1/HBO1/AIB1 axis in cancer glycolysis and tumor growth. SIX1 activates glycolytic gene
transcription through interaction with HBO1 and AIB1 histone acetyltransferases. SIX1 is directly repressed by miR-548a-3p. Thus, the miR-548a-3p/SIX1 axis
links glycolytic gene expression to glycolysis and tumor growth.
See also Figure S7 and Table S4.

10.1016/j.ccell.2018.01.010
undergo epithelial-mesenchymal transition and metastasis in mice through Walz, A.L., Ooms, A., Gadd, S., Gerhard, D.S., Smith, M.A., Guidry Auvil, J.M.,
increasing TGF-b signaling. J. Clin. Invest. 119, 2678–2690. Meerzaman, D., Chen, Q.R., Hsu, C.H., Yan, C., et al. (2015). Recurrent
Ng, K.T., Man, K., Sun, C.K., Lee, T.K., Poon, R.T., Lo, C.M., and Fan, S.T. DGCR8, DROSHA, and SIX homeodomain mutations in favorable histology
(2006). Clinicopathological significance of homeoprotein Six1 in hepatocellular Wilms tumors. Cancer Cell 27, 286–297.
carcinoma. Br. J. Cancer 95, 1050–1055. Wegert, J., Ishaque, N., Vardapour, R., Geörg, C., Gu, Z., Bieg, M., Ziegler, B.,
Ngo, H., Tortorella, S.M., Ververis, K., and Karagiannis, T.C. (2015). The Bausenwein, S., Nourkami, N., Ludwig, N., et al. (2015). Mutations in the SIX1/
Warburg effect: molecular aspects and therapeutic possibilities. Mol. Biol. 2 pathway and the DROSHA/DGCR8 miRNA microprocessor complex under-
Rep. 42, 825–834. lie high-risk blastemal type Wilms tumors. Cancer Cell 27, 298–311.
Ozaki, H., Nakamura, K., Funahashi, J., Ikeda, K., Yamada, G., Tokano, H., Wilson, W.R., and Hay, M.P. (2011). Targeting hypoxia in cancer therapy.
Okamura, H.O., Kitamura, K., Muto, S., Kotaki, H., et al. (2004). Six1 controls Nat. Rev. Cancer 11, 393–410.
patterning of the mouse otic vesicle. Development 131, 551–562. Wu, W., Ren, Z., Li, P., Yu, D., Chen, J., Huang, R., and Liu, H. (2015). Six1: a
Pikarsky, E., and Ben-Neriah, Y. (2006). NF-kappaB inhibition: a double-edged critical transcription factor in tumorigenesis. Int. J. Cancer 136, 1245–1253.
sword in cancer? Eur. J. Cancer 42, 779–784. Yeung, S.J., Pan, J., and Lee, M.H. (2008). Roles of p53, MYC and HIF-1 in
Reichenberger, K.J., Coletta, R.D., Schulte, A.P., Varella-Garcia, M., and Ford, regulating glycolysis—the seventh hallmark of cancer. Cell. Mol. Life Sci. 65,
H.L. (2005). Gene amplification is a mechanism of Six1 overexpression in 3981–3999.
breast cancer. Cancer Res. 65, 2668–2675. Zhang, H., Xie, X., Zhu, X., Zhu, J., Hao, C., Lu, Q., Ding, L., Liu, Y., Zhou, L.,
Ruf, R.G., Xu, P.X., Silvius, D., Otto, E.A., Beekmann, F., Muerb, U.T., Kumar, Liu, Y., et al. (2005). Stimulatory cross-talk between NFAT3 and estrogen
S., Neuhaus, T.J., Kemper, M.J., Raymond, R.M., Jr., et al. (2004). SIX1 muta- receptor in breast cancer cells. J. Biol. Chem. 280, 43188–43197.
tions cause branchio-oto-renal syndrome by disruption of EYA1-SIX1-DNA Zhao, W., Chang, C., Cui, Y., Zhao, X., Yang, J., Shen, L., Zhou, J., Hou, Z.,
complexes. Proc. Natl. Acad. Sci. USA 101, 8090–8095. Zhang, Z., Ye, C., et al. (2014). Steroid receptor coactivator-3 regulates
Sun, Y., Ding, L., Zhang, H., Han, J., Yang, X., Yan, J., Zhu, Y., Li, J., Song, H., glucose metabolism in bladder cancer cells through coactivation of hypoxia
and Ye, Q. (2006). Potentiation of Smad-mediated transcriptional activation by inducible factor 1a. J. Biol. Chem. 289, 11219–11229.
the RNA-binding protein RBPMS. Nucleic Acids Res. 34, 6314–6326. Zheng, W., Huang, L., Wei, Z.B., Silvius, D., Tang, B., and Xu, P.X. (2003). The
Thorne, J.L., Campbell, M.J., and Turner, B.M. (2009). Transcription factors, role of Six1 in mammalian auditory system development. Development 130,
chromatin and cancer. Int. J. Biochem. Cell Biol. 41, 164–175. 3989–4000.

10.1016/j.ccell.2018.01.010
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies
anti-GST GE Healthcare Life Sciences Cat# RPN1236; RRID: AB_771429
anti-His GE Healthcare Life Sciences Cat# 27471001; RRID: AB_771435
anti-Myc Santa Cruz Biotechnology Cat# sc-40HRP; RRID: AB_627268
anti-b-actin Santa Cruz Biotechnology Cat# sc-47778HRP; RRID: AB_2714189
anti-GPI Santa Cruz Biotechnology Cat# sc-33777; RRID: AB_112653
anti-PFKL Santa Cruz Biotechnology Cat# sc-292523; RRID: AB_10987636
anti-ENO1 Santa Cruz Biotechnology Cat# sc-15343; RRID: AB_2099061
anti-AIB1 Santa Cruz Biotechnology Cat# sc-9119; RRID: AB_647689
anti-AIB1 Santa Cruz Biotechnology Cat# sc-56854; RRID: AB_1125469
anti-FLAG Sigma-Aldrich Cat# A8592; RRID: AB_439702
anti-FLAG M2 agarose Sigma-Aldrich Cat# A2220; RRID: AB_10063035
anti-GAPDH Sigma-Aldrich Cat# G9295; RRID: AB_1078992
anti-SIX1 Sigma-Aldrich Cat# HPA001893; RRID: AB_1079991
anti-SIX1 Proteintech Cat# 10709-1-AP; RRID: AB_2189077
anti-a-Tubulin Proteintech Cat# 11224-1-AP; RRID: AB_2210206
anti-GLUT1 Proteintech Cat# 21829-1-AP; RRID: AB_10837075
anti-ALDOA Proteintech Cat# 11217-1-AP; RRID: AB_2224626
anti-PGAM1 Proteintech Cat# 16126-1-AP; RRID: AB_2160786
anti-PGK1 Proteintech Cat# 17811-1-AP; RRID: AB_2161218
anti-LDHA Proteintech Cat# 19987-1-AP; RRID: AB_10646429
anti-HBO1 Proteintech Cat# 13751-1-AP; RRID: AB_2266703
anti-HIF-1a Proteintech Cat# 20960-1-AP; RID: AB_10732601
anti-HIF-1a Novus Cat# NB100-105; RRID: AB_10001154
anti-PKM2 Cell Signaling Technology Cat# 4053S; RRID: AB_1904096
anti-HK2 Cell Signaling Technology Cat# 2867S; RRID: AB_2232946
anti-H4K5ac Millipore Cat# 07-327; RRID: AB_310523
anti-H3K9ac Millipore Cat# ABE18; RRID: AB_10806219
Bacterial and Virus Strains
Lentiviral particles for SIX1 This paper N/A
Lentiviral particles for SIX1 shRNA This paper N/A
Lentiviral particles for HBO1 shRNA This paper N/A
Lentiviral particles for AIB1 shRNA This paper N/A
Lentiviral particles for HIF-1a shRNA This paper N/A
Lentiviral particles for PGK1 shRNA This paper N/A
Lentiviral particles for LDHA shRNA This paper N/A
Biological Samples
Human breast cancer tissues Chinese PLA General Hospital N/A
(Continued on next page)
Cancer Cell 33, 1–18.e1–e7, March 12, 2018 e1

10.1016/j.ccell.2018.01.010
Continued
Chemicals, Peptides, and Recombinant Proteins
2-deoxy-D-glucose (2-DG) Sigma-Aldrich Cat# D8375
3-bromopyruvate (3-BP) Sigma-Aldrich Cat# 16490
Oligomycin Sigma-Aldrich Cat# 75351
Critical Commercial Assays
Magna ChIP G Assay Kit Millipore Cat# 17-409
XF Glycolysis Stress Test Kit Agilent Technologies Cat# 103020
XF Cell Mito Stress Test Kit Agilent Technologies Cat# 103015
Glucose Uptake Colorimetric Assay kit Biovision Cat# K676
Pyruvate Colorimetric Assay kit Biovision Cat# K609
Lactate Colorimetric Assay Kit II Biovision Cat# K627
ATP Colorimetric Assay kit Biovision Cat# K354
Hexokinase Colorimetric Assay Kit Biovision Cat# K789
GAPDH Activity Assay Kit Biovision Cat# K680
Aldolase Activity Colorimetric Assay Kit Biovision Cat# K665
Pyruvate Kinase Activity Colorimetric Assay Kit Biovision Cat# K709
Lactate Dehydrogenase Activity Assay Kit Biovision Cat# K726
Deposited Data
RNA sequencing raw and analyzed data This paper GEO: GSE93925
RNA sequencing data from human breast cancer cells The Cancer Genome Atlas (TCGA) https://tcga-data.nci.nih.gov/
Experimental Models: Cell Lines
Human embryonic kidney HEK293T cells (N/A) ATCC ATCC # CRL-3216
Human breast cancer ZR75-1 cells (Female) ATCC ATCC #: CRL-1500
Human liver cancer HepG2 cells (Male) ATCC ATCC #: HB-8065
Human colon cancer HCT116 cells (Male) ATCC ATCC #: CCL-247
Human lung cancer A549 cells (Male) ATCC ATCC #: CRM-CCL-185
Human ZR75-1 SIX1 KO cells (Female) Genloci Biotech N/A
Human ZR75-1 HBO1 KO cells (Female) Genloci Biotech N/A
Human ZR75-1 AIB1 KO cells (Female) Genloci Biotech N/A
Six1-/- MEFs (N/A) This paper N/A
Experimental Models: Organisms/Strains
Six1 KO Mice Shanghai Model Organisms Center N/A
Oligonucleotides
shRNAs or siRNA targeting sequence, see Table S5 This paper N/A
Primers for real-time PCR, see Table S6 This paper N/A
Primers for ChIP, see Table S7 This paper N/A
Recombinant DNA
pGL4-GLUT1 promoter deletion mutants This paper N/A
pGL4-HK2 promoter deletion mutants This paper N/A
pGL4-PFKL promoter deletion mutants This paper N/A
pGL4-ALDOA promoter deletion mutants This paper N/A
pGL4-GAPDH promoter deletion mutants This paper N/A
pGL4-PGK1 promoter deletion mutants This paper N/A
pGL4-ENO1 promoter deletion mutants This paper N/A
pGL4-PKM2 promoter deletion mutants This paper N/A
pGL4-LDHA promoter deletion mutants This paper N/A
pGL4-SIX1-3’-UTR-WT and mutant This paper N/A
Flag-SIX1 and its mutants This paper N/A
(Continued on next page)
e2 Cancer Cell 33, 1–18.e1–e7, March 12, 2018

10.1016/j.ccell.2018.01.010
Continued
Myc-SIX1 and its mutants This paper N/A
GST-SIX1 This paper N/A
pCDH-SIX1 This paper N/A
pSIH-SIX1, HBO1, AIB1, HIF-1a, PGK1 and LDHA This paper N/A
His-HBO1 and its deletion mutants This paper N/A
Myc-HBO1 and its mutants This paper N/A
His-AIB1 deletion mutants This paper N/A
Flag-AIB1 and its deletion mutants Dr. Chundong Yu Lab N/A
Software and Algorithms
Wave 2.2.0 Seahorse Bioscience N/A
SPSS 13.0 IBM N/A
Other
Seahorse XFe 96 Extracellular Flux Analyzer Seahorse Bioscience N/A
Animal PET Scanner Philips Corp. N/A
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Qinong Ye
(yeqn66@yahoo.com).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Human Clinical Samples

Forty three and one hundred and eighty seven cases of primary breast carcinomas used for analyses of 18FDG PET scans and
clinical outcomes, respectively, were obtained from Chinese PLA General Hospital, with the informed consent of patients
and with the approval of the Institutional Review Committees of Chinese PLA General Hospital. Similar experiments performed
previously were used to estimate sample size. For patients used for 18FDG PET scan analysis, all cases were female with 39-68
years of age (mean age: 52.7 years). For patients used for clinical outcome analysis, all cases were female with 26-84 years
of age (mean age: 53.5 years) and the follow-up time was 1-76 months (mean: 64.3 months). Normal distribution was
performed using SPSS13.0. Out of 187 breast cancer specimens, 42 cancer tissues were available for DNA isolation and
sequencing.
Mice
All animal studies conformed to the relevant regulatory standards and were approved by the Institutional Animal Care Committee of
Beijing Institute of Biotechnology. Six1 knockout mice were generated by CRISPR/Cas9 (Shanghai Model Organisms Center, Inc.).
The guide RNA targeting exon 1 of SIX1 gene was designed. The guide RNA sequence is GTGGCTGAAAGCGCACTACG. A mixture
of plasmids encoding Cas9 and SIX1 guide RNA was microinjected into the fertilized C57BL/6 eggs, and the transgenic embryos
were planted into pseudopregnant recipients. Founder lines of successful mutation of the SIX1 gene cluster were identified through
PCR genotyping of tail DNA. PCR products were further verified through DNA sequencing. The genotyping primers were as follows:
Forward primer, 5’-GATGCTGCCGTCGTTTGGTTTTA-3’; Reverse primer, 5’-GGGTGGCGGCGGGTAGGAAG -3’. The positive
female founder mice and wild-type male mice were bred to get F1 SIX1 heterozygote mice. Male SIX1 heterozygote mice and female
SIX1 heterozygote mice were then crossed to obtain SIX1 homozygote mice. As previously reported (El-Hashash et al., 2011; Laclef
et al., 2003), mice with homozygous deletion of SIX1 die shortly after birth. For mouse embryo genotype identification, genomic DNA
was prepared from the tail tips of 14-day-old embryos and the SIX1 mutation was identified by PCR amplification, DNA sequencing
and immunoblot.
For 18FDG microPET scans, seven week-old female or male nude mice were subcutaneously inoculated in the dorsal left flank with
5 3 106 ZR75-1 or HepG2 cells. For miRNA study, cells were treated with antagomiR-548a-3p or antagomiR-NC, a negative control,
for three days, and then harvested for further study. 2-DG (500 mg/kg) was administered to mice intraperitoneally every other day.
Growth was recorded by caliper measurements at indicated times. One average-sized tumor tissue from each group was chosen and
cut into several pieces. Every piece was then weighed. For further studies, the pieces were lysed in corresponding extraction buffer.
The three pieces from each group were used for immunoblot and qRT-PCR, and the five pieces from each group for measurement of
lactate. Other tumor tissues were stored in liquid nitrogen or fixed in 4% paraformaldehyde.

10.1016/j.ccell.2018.01.010
SIX1, HBO1 and AIB1 Knockout Cancer Cell Lines

SIX1, HBO1 and AIB1 knockout cancer cells were generated by CRISPR/Cas9 (Genloci Biotechnologies Inc.). CRISPRs were
designed using a CRISPR design web tool (http://crispr.mit.edu). The sgRNA (single guide RNA) sequences targeted by SIX1,
HBO1 and AIB1 CRISPR are CCTGCACAAGAACGAGAGCGTAC, CCGACGATCTGCTCGAGTCACCC and TGATGTATATTCAAG
ATGAGTGG, respectively. The sgRNAs were cloned into the pGK1.1/CRISPR/Cas9 vector (Genloci Biotechnologies Inc.). Cells
were transfected with the sgRNA vectors, expanded and screened for mutations at nuclease target sites by PCR amplification of
genomic sequences, followed by DNA sequencing and immunoblotting. The CRISPR cell lines were clonal. Rescue experiments
were performed to avoid off-target effect.
Cell Lines and Drug Treatments

Human embryonic kidney HEK293T cells, human breast cancer ZR75-1 cells (Female), human liver cancer HepG2 cells (Male),
human colorectal cancer HCT116 cells (Male) and human lung cancer A549 cells (Male) were purchased from American Type Culture
Collection (ATCC), and have previously been tested for mycoplasma contamination. The information on the sex of HEK293T cells and
MEFs is not available due to their isolation from fetus. Cells were routinely cultured in DMEM containing 25 mM glucose (Invitrogen)
and 10% FBS (Hyclone) at 37 C. Lipofectamine 2000 reagent and Lipofectamine RNAiMAX were used for transfections of plasmids
and siRNAs, respectively, according to the manufacturer’s instructions (Invitrogen). For plasmid transfection, cells were seeded to
70–90% confluent at the time of transfection. Plasmids and Lipofectamine 2000 reagent were diluted in DMEM. The diluted plasmids
were mixed with the diluted Lipofectamine 2000. The mixtures were incubated for 5 min at room temperature and added to cells in
each dish. The transfected cells were collected after 24–48 hr. For siRNA transfection, siRNA and Lipofectamine RNAiMAX reagent
were diluted in DMEM without serum, and the contents were mixed gently. The mixtures were incubated for 10–20 min at room
temperature. The incubated mixtures of siRNA and RNAiMAX were then added to cells in each dish. Cells were incubated for
48–72 hr. In galactose study, cells were cultured in DMEM without glucose supplemented with 10 mM galactose (Invitrogen) and
10% FBS. Cells were treated with 2.5 mM 2-DG, 100 mM 3-BP or 0.1mM oligomycin at indicated times.
METHOD DETAILS
Plasmids, siRNAs, shRNAs, and Lentiviruses

The eukaryotic expression vectors encoding FLAG- or MYC-tagged proteins or untagged proteins were generated by inserting
PCR-amplified fragments into pcDNA3 (Invitrogen). Prokaryotic plasmids encoding GST- or His-fusion proteins were constructed
in pGEX-KG (Amersham Pharmacia Biotech) and pET28a (Novagen), respectively. The glycolytic gene promoter luciferase reporters
were made by inserting PCR-amplified promoter fragments from genomic DNA into the pGL4-Basic vector (Promega). The mutants
for the FLAG-, MYC- or GST-tagged proteins as well as the luciferase reporters were made by recombinant PCR. The cDNA target
sequences of siRNAs and/or shRNAs for SIX1, HBO1, AIB1, LDHA and PGK1 were listed in Table S5. Lentiviral vectors for gene over-
expression were obtained by inserting PCR-amplified gene fragments into pCDH (System Biosciences). Lentiviral shRNA vectors
were constructed by cloning short hairpin RNA fragments into pSIH-H1-Puro (System Biosciences). Lentiviruses were produced
by cotransfection of HEK293T cells with recombinant lentivirus vectors and pPACK Packaging Plasmid Mix (System Biosciences)
using Megatran reagent (Origene), and were used to infect target cells according to the manufacturers’ instructions.
Transcriptome Sequencing (RNA-Seq)

A minimum of 3 mg of total RNA was oligo (dT) selected using the Dynabeads mRNA purification kit (Invitrogen). The mRNAs isolated
from total RNA were fragmented into short fragments with a fragmentation buffer (Ambion). Double-stranded cDNA was synthesized
with these short fragments as templates. The cDNA was end-repaired, ligated to Illumina adapters, size selected on agarose gel
(approximately 250 bp) and PCR amplified. The cDNA library was sequenced on an Illumina HiSeq 2000 sequencing platform
(BerryGenomics). The gene expression levels for each transcript were estimated as the number of reads per kilobase of exon model
per million mapped reads (RPKM) using only uniquely mapped reads in exonic regions. A gene is considered significantly differentially
expressed if its expression differs between any two samples with the fold change > 2 and the p value < 0.05 as calculated by Cufflinks.
The RNA-Seq data are available at the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/, accession number GSE93925).
Quantitative Reverse Transcription-PCR (RT-PCR)

Total RNA was isolated using TRIzol reagent according to the manufacturer’s instructions (Invitrogen). The samples were homoge-
nized with TRIzol Reagent, vortexed for 1 min with 200 mL chloroform and centrifuged at 1.3 3 104 rpm for 10 min at 4 C, thereby
building two phases. The upper aqueous phase (containing RNA) was precipitated with isopropanol at – 20 C for 1 h and centrifuged
at 1.2 3 104 rpm for 15 min. The RNA pellets were washed with 70% (v/v) ethanol and 100% (v/v) ethanol in succession, air-dried, and
dissolved in 100–200 ml of nuclease-free water. Two micrograms of total RNA was reverse transcribed into first strand cDNA with
oligo (dT) primers using Moloney murine leukemia virus reverse transcriptase (Promega). One microliter of the first strand cDNA syn-
thesis reaction mixture was used for PCR amplification in a total volume of 50 ml. qPCR was performed in triplicates in a 20 ml reaction
mixture containing 10 ml of SYBR Premix Ex Taq Master Mix (23) (Takara), 0.5 mM of each of the primers and 10 ng cDNA. The relative
expression was calculated by the comparative Ct method. The primers used for real-time PCR analysis were listed in Table S6.

10.1016/j.ccell.2018.01.010
Luciferase Reporter Assay

Luciferase reporter assays were performed according to the manufacturer’s instructions (Promega). Briefly, cells were seeded in 24-
well plates. For analysis of glycolytic gene promoter activity, cells were transfected with 1 mg of promoter luciferase reporter, 0.5 mg of
empty vector, SIX1, or SIX1 mutant expression vector, and 0.1 mg of b-galactosidase reporter. For analysis of SIX1 3’-UTR activity,
cells were transfected with 1 mg of WT SIX1 3’-UTR or mutated SIX1 3’-UTR luciferase reporter, 0.5 mg of miR-548a-3p, and 0.1 mg of
b-galactosidase reporter. Twenty four hours after transfection, the cells were harvested in 13 lysis buffer and subjected to a single
freeze-thaw cycle to ensure complete lysis. Cell lysates were transferred to the microcentrifuge tubes, vortexed for 3 min and then
centrifuged at 1.2 3 104 rpm for 5 min at 4 C. Ten microliters of supernatants were mixed with 10 ml of the Luciferase Assay Reagent
per tube and measured for the luciferase activity using the luminometer. For b-galactosidase activity assay, the supernatants were
transferred to a 96-well plate and incubated in the Assay buffer for 1 h at 37 C. Reaction was stopped and OD values were measured
at 420 nm using a microplate reader.
Chromatin Immunoprecipitation (ChIP) and re-ChIP

ChIP assay was performed using the Magna ChIP G Assay Kit (Millipore) according to the manufacturer’s instructions. Briefly, cells
were cross-linked with 37% formaldehyde, pelleted, and resuspended in lysis buffer. The cells were sonicated and centrifuged to
remove the insoluble material. The supernatants were collected and incubated overnight with indicated antibodies and Protein G
magnetic beads. The beads were washed, and the precipitated chromatin complexes were collected, purified, and de-crosslinked
at 62 C for 2 h, followed by incubation at 95 C for 10 min. The precipitated DNA fragments were quantified through RT-PCR analysis.
For re-ChIP, complexes were eluted from the primary immunoprecipitation by incubation with 10 mM DTT at 37 C for 30 min and
diluted 1:50 in re-ChIP buffer (150 mM NaCl, 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl, pH 8.1) followed by re-immunoprecip-
itation with the second antibodies. Samples were analyzed by real-time PCR with primers listed in Table S7.
Co-immunoprecipitation and His or GST Pull-down Assays

Co-immunoprecipitation (Co-IP) was performed as previously described (Sun et al., 2006). For transfection-based coimmunopreci-
pitation assays, 293T cells were transfected with the indicated plasmids using Lipofectamine 2000 (Invitrogen), lysed in 500 ml of lysis
buffer (50 mM Tris at pH 8.0, 500 mM NaCl, 0.5% Nonidet P-40, 1 mM dithiothreitol, and protease inhibitor tablets from Roche
Applied Science), and immunoprecipitated with anti-FLAG or Myc-agarose beads (Sigma-aldrich) overnight at 4 C. The beads
were washed three times with the lysis buffer and eluted in SDS sample buffer. The eluted immunocomplexes were separated by
SDS-PAGE, followed by Western blotting with indicated antibodies according to the standard procedures. For detecting endoge-
nous protein interactions, cells were lysed in 500 ml of lysis buffer and immunoprecipitated with indicated antibody or control serum
(Santa Cruz Biotechnology). After extensive washing with the lysis buffer, the immunoprecipitates were resolved by SDS-PAGE,
followed by Western blot analysis.
For His or GST pull-down assays, His- or GST-fusion proteins were expressed and purified according to the manufacturers’ instruc-
tions (QIAGEN and Amersham Pharmacia). His- or GST-fusion proteins were expressed in Escherichia coli (BL21). After induction with
0.5 mM IPTG at 20 C for over 20 hr, Escherichia coli were collected, resuspended in lysis buffer and sonicated. Precipitates were
removed from the lysates through centrifugation and supernatants were loaded on nickel beads (QIAGEN) or glutathione-Sepharose
beads (Amersham Pharmacia) balanced with lysis buffer for 4 hr at 4 C. The beads were collected and washed 3 times with lysis buffer.
GST- or His -fusion proteins were eluted from their respective beads with reduced glutathione and imidazole, respectively. Purified
GST-fusion proteins were incubated with His-fusion protein bound to nickel beads (QIAGEN) or cell lysates were incubated with
GST fusion protein bound to GST beads for 4 hr at 4 C. After washing, the adsorbed proteins were analyzed by immunoblot.
Mass Spectrometry
The FLAG-tagged Six1 complex was obtained by immunoprecipitation with anti-FLAG from 108 ZR75-1 cells stably expressing
FLAG-Six1 according to the manufacturer’s instructions (Sigma-Aldrich). Cells were lysed in IP buffer (20mM Tris at PH 8.0,
0.25M NaCl, 0.5% NP-40, 5mM EDTA) and immunoprecipitated with anti-FLAG agarose beads (Sigma-aldrich) for 4 hr at 4 C.
The beads were washed four times with IP buffer and eluted with FLAG peptide. The eluted proteins were resolved on gradient
SDS-PAGE, silver stained, and subjected to mass spectrometry (MS) sequencing and data analysis. In-solution and in-gel digestion
were performed according to a previously published method (Jin et al., 2003). Briefly, gel bands were minced and destained with 50%
acetonitrile in 50 mM ammonium bicarbonate. Proteins were reduced with 10 mM DTT at 56 C, followed by alkylation with 55 mM
iodoacetamide at room temperature in the dark. Trypsin digestion was performed overnight at 37 C with gentle shaking. Peptides
were extracted using 1% trifluoroacetic acid in 50% acetonitrile. Samples were vacuum-dried and reconstituted in 0.1% formic
acid for subsequent MS analysis. The treated samples were examined by nanoLC-MS/MS (nanoACQUITY UPLC and SYNAPT
G2 HD mass spectrometer, Waters). MS/MS data were obtained with Data Dependent Analysis mode and processed with PLGS
2.4 software (Waters), and the resulting peak list was searched against the NCBI database with the MASCOT search engine.
Cell Proliferation Assays

Cell proliferation was determined by the CCK-8 Kit (Dojindo Laboratories) according to the manufacturer’s instructions. Briefly, ten
microliters of CCK-8 solution was added to cultured cells in each well, followed by incubation at 37 C for 1 hr. The OD values were
measured at 450 nm using a microplate reader.

10.1016/j.ccell.2018.01.010
Glucose Uptake, Pyruvate, Lactate, ATP, HK, GAPDH, ALDO, PKM and LDH Assays
Glucose Uptake Colorimetric Assay Kit, Pyruvate Colorimetric Assay kit, Lactate Assay Kit II, ATP Colorimetric Assay Kit, Hexokinase
Colorimetric Assay Kit, GAPDH Activity Assay Kit, Aldolase Activity Colorimetric Assay Kit, Pyruvate Kinase Activity Colorimetric
Assay Kit, and Lactate Dehydrogenase Activity Assay Kit were used to determine glucose uptake, levels of pyruvate, lactate and
ATP, and activities of HK, GAPDH, ALDO, PKM and LDH, respectively, according to the manufacturer’s protocols (Biovision).
For glucose uptake assay, cells were seeded into 10-cm plates, transfected or infected with indicated constructs, and incubated
in DMEM supplemented with 10% FBS for 48 hr. The transfected cells were harvested and the cell number was determined.
Ten thousand cells were then plated into a 96-well plate, and incubated for 10 hr, at which time cell number for each group was very
similar. Cells were washed 3 times with PBS and then starved for glucose by preincubating with 100 ml Krebs-Ringer-Phosphate-HEPES
(KRPH) buffer containing 2% BSA for 40 min. Ten microliter of 10 mM 2-DG was added and incubated for 20 min. Cells were lysed with
90 ml of extraction buffer and then frozen/thawed once and heated at 85 C for 40 min. The cell lysate was neutralized by adding 10 ml
of neutralization buffer. After centrifugation at 1.23104 rpm for 5 min, the supernatant was used for determination of glucose uptake
(Biovision). The glucose uptake was measured at 412 nm in a microplate reader. The results were normalized to cell number.
For pyruvate activity assay, cells were transfected or infected as in glucose uptake assay. Cells (53105) were collected and
extracted with 4 volume of the Pyruvate Assay Buffer (Biovision). The cells were centrifuged at 1.23104 rpm for 10 min at 4 C to
remove insoluble material. After centrifugation, the supernatant was assayed by Pyruvate Colorimetric Assay kit (Biovision).
The reaction mixture was incubated for 30 min at room temperature, protected from light and measured at 570 nm in a microplate
reader. Data were normalized to cell number.
For measurement of lactate production, cells were transfected or infected, and harvested as in glucose uptake assay. One hundred
thousand cells were then plated into a 12-well plate and incubated in DMEM containing 10% FBS for 10 hr. To measure the secretion
of lactate, the media were removed and the cells were incubated in DMEM without FBS. After incubation for 1 hr, the supernatant was
collected for measurement of lactate production (Biovision). The reaction mixture was incubated for 30 min at room temperature and
protected from light. The lactate levels were measured at 450 nm in a microplate reader and normalized with cell number. For mea-
surement of the lactate levels of mouse tumor, 10 mg of tumor tissues were isolated and homogenized in the Assay Buffer (Biovision).
The samples were centrifuged and the soluble fractions were measured and normalized to protein concentrations.
For ATP level analysis, cells were transfected or infected as in glucose uptake assay. Cells (53105) were collected and extracted in
100 ml of the ATP Assay Buffer (Biovision). The cells were centrifuged at 1.23104 rpm for 5 min and the supernatant was used for ATP
determination. The reaction mixture was incubated for 30 min at room temperature, protected from light, and measured at 570 nm in a
microplate reader. Values were normalized to cell number.
For hexokinase activity assay, cells were transfected or infected as in glucose uptake assay. Cells (53105) were harvested and
homogenized in 100 ml of Hexokinase Assay Buffer (Biovision) for 10 min. The cells were centrifuged at 1.23104 rpm for 5 min
and the supernatant was assayed by Hexokinase Colorimetric Assay Kit (Biovision). The reaction mixture was incubated at room
temperature for 20-60 min and measured at 450 nm in a microplate reader. Results were normalized to cell number.
For GAPDH or aldolase activity assay, cells were transfected or infected as in glucose uptake assay. Cells (53105) were collected
and homogenized in 100 ml GAPDH or Aldolase Assay Buffer (Biovision) for 10 min. The cells were centrifuged at 1.23104 rpm for
5 min and the supernatant was analyzed by GAPDH or Aldolase Activity Assay Kit (Biovision). The reaction mixture was incubated
at 37 C for 10-60 min and measured at 450 nm in a microplate reader. Data were normalized to cell number.
For pyruvate kinase activity assay, cells were transfected or infected as in glucose uptake assay. Cells (53105) were harvested and
extracted with 4 volume of the Pyruvate Kinase Assay Buffer (Biovision). The cells were centrifuged at 1.23104 rpm for 10 min to get
clear extract. After centrifugation, the supernatant was assayed by Pyruvate Kinase Activity Assay Kit (Biovision). The reaction
mixture was incubated for 10-20 min at room temperature, protected from light, and measured at 570 nm in a microplate reader.
Results were normalized to cell number.
For lactate dehydrogenase activity assay, cells were transfected or infected as in glucose uptake assay. Cells (23105) were collected
and homogenized in 100 ml of the Lactate Dehydrogenase Assay Buffer (Biovision). The cells were centrifuged at 1.23104 rpm for
15 min and the supernatant was assessed by Lactate Dehydrogenase Activity Assay Kit (Biovision). The reaction mixture was incu-
bated at 37 C for 30 min, protected from light and measured at 450 nm in a microplate reader. Values were normalized to cell number.
Extracellular Acidification Rate and Oxygen Consumption Rate Assays

The extracellular acidification rate (ECAR) and cellular oxygen consumption rate (OCR) were measured using the Seahorse XFe 96
Extracellular Flux Analyzer (Seahorse Bioscience). Experiments were performed according to the manufacturer’s instructions.
ECAR and OCR were measured using Seahorse XF Glycolysis Stress Test Kit and Seahorse XF Cell Mito Stress Test Kit (Agilent
Technologies), respectively. Briefly, cells were transfected or infected as in glucose uptake assay. The transfected cells were har-
vested and the cell number was counted. Ten thousand cells per well were then seeded into a Seahorse XF 96 cell culture microplate
for 10 hr, at which time cell number for each group was very similar. The cells were used for measurement of ECAR and OCR. After
baseline measurements, for ECAR, glucose, the oxidative phosphorylation inhibitor oligomycin, and the glycolytic inhibitor 2-DG
were sequentially injected into each well at the indicated time points; and for OCR, oligomycin, the reversible inhibitor of oxidative
phosphorylation FCCP (p-trifluoromethoxy carbonyl cyanide phenylhydrazone), and the mitochondrial complex I inhibitor rotenone
plus the mitochondrial complex III inhibitor antimycin A (Rote/AA) were sequentially injected. Data were analysed by Seahorse XF-96
Wave software. OCR is reported in pmols/minute and ECAR in mpH/minute. The results were normalized to cell number.

10.1016/j.ccell.2018.01.010
SIX1 Q177R Mutation Screening

Genomic DNA was isolated from 42 breast cancer tissues using the blood/tissue/cell genomic DNA Extraction Kit (Tiangen, DP304)
according to the manufacturer’s instructions. In brief, tissues were digested in lysis solution mixed with proteinase K and incubated at
58 C until being dissolved. The detergent buffer was added during lysis and mixed with binding buffer and ethanol for subsequent
DNA binding. The DNA binds to the silica-based membrane in the Spin Column and impurities are removed by thorough washing with
wash buffers. The genomic DNA was then eluted in elution Buffer and subjected to PCR. Approximately 300 bp of PCR fragment
containing the SIX1 Q177 site was first amplified using genomic DNA and re-amplified with the first amplified PCR product as the
template using the following primers. The forward primer sequence was 5’-CACCATCTGGGACGGCGAGGA-3’, and the reverse
primer sequence 5’-GGACTTGGTGGCTGGTGCCTG-3’. Both strands of the final PCR products were sequenced.
miRNA In Situ Hybridization and Immunohistochemistry

For patients used for 18FDG PET scan analysis, miRNA in situ hybridization (MISH) on paraffin tissue sections with probes specific for
human miR-548a-3p was performed according to the manufacturer’s instructions (Exonbio). The sequence of the miR-548a-3p
probe, complementary to miR-548a-3p, is 5’-GCAAAAGTAATTGCCAGTTTTG-3’. Both 5’ and 3’ ends of the probe were labeled
by digoxin. A U6 probe 5’- GAACGCTTCACGAATTTGCGTGTCATCCTTGCGCA-3’ was used as a positive control. A scramble probe
5’-GTGTAACACGTCTATACGCCCA-3’ was used as a negative control. Briefly, paraffin-embedded tissue slides were deparaffined,
rehydrated and pretreated with 3% H2O2 for 15 min to quench endogenous peroxidase activity. The slides were preincubated with
miRNA Hybridization solution at 55 C for 1 hr, followed by hybridization with DIG-labeled miR-548a-3p probe at 42 C for 48 hr.
The slides were washed 3 times at 42 C for 2 min and stained with 3, 3’-Diaminobenzidine (DAB). Slides were counterstained
with hematoxylin, dehydrated in the increased concentrations of ethanol series, cleared in xylene and mounted with neutral resin.
Immunohistochemistry (IHC) of formalin-fixed paraffin-embedded samples was performed as described previously (Zhang et al.,
2005). Briefly, the formalin-fixed paraffin sections were deparaffinized, rehydrated, and pretreated with 3% H2O2 for 20 min. The anti-
body-binding epitopes of the antigens were retrieved by microwave treatment, and the sections were then preincubated with 10% goat
serum to block nonspecific binding. Rabbit anti-SIX1 (HPA001893, Sigma-Aldrich), rabbit anti-PGK1 (17811-1-AP, Proteintech), rabbit
anti-LDHA (19987-1-AP, Proteintech), mouse-anti-AIB1 (sc-56854, Santa Cruz Biotechnology), rabbit anti-HBO1 (13751-1-AP,
Proteintech), and mouse anti-HIF-1a (NB100-105, Novus), diluted at 1: 50, 1: 100, 1:100, 1:200, 1:200 and 1:50 respectively, were
used as the primary antibodies. The specimens were incubated with the primary antibodies for 1 hr at room temperature, followed by
the addition of biotinylated anti-rabbit or anti-mouse secondary antibody and streptavidin-horseradish peroxidase. DAB was used as a
chromogen, and hematoxylin was used for counterstaining. The miR-548a-3p, SIX1, PGK1, LDHA, AIB1, HBO1 and HIF-1a score was
generated by multiplying the percentage of stained cells (0 - 100%) by the intensity of the staining (low, 1+; medium, 2+; strong, 3+). Thus,
the score is between 0-3. The optimal cutoff value of the IHC scores were estimated using receiver operating characteristic (ROC) curve
analysis as previously described (Greiner et al., 2000). For correlation analysis, we defined score <0.25, 0.25%score %0.75 and score
>0.75 as low, medium and high SIX1, PGK1, LDHA, AIB1, HBO1, or HIF-1a, respectively. For PET scan analysis, we defined score %0.75
and score >0.75 as low and high SIX1 and miR-548a-3p, respectively. When real-time PCR was used for miR-548a-3p quantification
(the score is between 0-5), we defined score %2.1 and score >2.1 as low and high miR-548a-3p.
PET Imaging of Glucose Uptake in Mice

PET imaging of mice was performed using an animal PET scanner (Philips Corp.). Mice were injected intravenously with 3.7 MBq
(100 mCi) of 18F radio-labeled fluorodeoxyglucose (18FDG) after anesthetization with pentobarbital. Five-minute emission scans
were performed to obtain attenuation correction data in the prone position at 60 minutes after injection, and delay scans of 10 minutes
were acquired at 2 hours. For each mouse, radioactivity was calibrated against a known aliquot of the injected tracer and presented
as percent injected dose of tissue.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical Analysis
Trial experiments or similar experiments done previously were used to assess sample size with adequate statistical power. Statistical
significance in the preclinical experiments was assessed by two-tailed Student’s t-test. The correlation of expression among
miR-548a-3p, SIX1, PGK1 and LDHA was determined using Spearman’s Rank Correlation test. Estimation of disease-free survival
and overall survival was performed using the Kaplan-Meier method, and differences between survival curves were determined with
the log-rank test. All statistical tests were two-sided. Statistical calculations were performed using SPSS 13.0. In all assays, p < 0.05
was considered statistically significant.
DATA AND SOFTWARE AVAILABILITY
Data Resources
The accession number for the transcriptome sequencing data reported in this paper is GEO Datasets: GSE93925.

Li 2018

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Li 2018

Uploaded by

Copyright:

Available Formats

Article

Transcriptional Regulation of the Warburg Effect in

Highlights Data Resources

d SIX1 potentiates the Warburg effect via HBO1 and AIB1

d SIX1 glycolytic function is directly repressed by microRNA-

d The miR-548a-3p/Six1 axis regulates the Warburg effect and

Li et al., 2018, Cancer Cell 33, 1–18

Transcriptional Regulation of the Warburg

Beijing 100850, China

Suzhou 215163, China

*Correspondence: miraclexxj@126.com (X.X.), yeqn66@yahoo.com (Q.Y.)

INTRODUCTION hallmark of cancer, and cancer therapeutic agents targeting

(legend on next page)

2 Cancer Cell 33, 1–18, March 12, 2018

Figure 1. SIX1 Regulates Glycolytic Gene Expression

Cancer Cell 33, 1–18, March 12, 2018 3

(legend on next page)

4 Cancer Cell 33, 1–18, March 12, 2018

Cancer Cell 33, 1–18, March 12, 2018 5

(legend on next page)

6 Cancer Cell 33, 1–18, March 12, 2018

Cancer Cell 33, 1–18, March 12, 2018 7

(legend on next page)

Figure 4. miR-548a-3p Represses Glycolytic Gene Expression through SIX1 Inhibition

Cancer Cell 33, 1–18, March 12, 2018 9

(legend on next page)

10 Cancer Cell 33, 1–18, March 12, 2018

Cancer Cell 33, 1–18, March 12, 2018 11

(legend on next page)

12 Cancer Cell 33, 1–18, March 12, 2018

Cancer Cell 33, 1–18, March 12, 2018 13

(legend on next page)

14 Cancer Cell 33, 1–18, March 12, 2018

Cancer Cell 33, 1–18, March 12, 2018 15

(legend on next page)

16 Cancer Cell 33, 1–18, March 12, 2018

Figure 8. Clinical Relevance of the miR-548a-3p/SIX1 Axis in Breast Cancer

Cancer Cell 33, 1–18, March 12, 2018 17

18 Cancer Cell 33, 1–18, March 12, 2018

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Cancer Cell 33, 1–18.e1–e7, March 12, 2018 e1

e2 Cancer Cell 33, 1–18.e1–e7, March 12, 2018

CONTACT FOR REAGENT AND RESOURCE SHARING

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Human Clinical Samples

Cancer Cell 33, 1–18.e1–e7, March 12, 2018 e3

SIX1, HBO1 and AIB1 Knockout Cancer Cell Lines

Cell Lines and Drug Treatments

Plasmids, siRNAs, shRNAs, and Lentiviruses

Transcriptome Sequencing (RNA-Seq)

Quantitative Reverse Transcription-PCR (RT-PCR)

e4 Cancer Cell 33, 1–18.e1–e7, March 12, 2018

Luciferase Reporter Assay

Chromatin Immunoprecipitation (ChIP) and re-ChIP

Co-immunoprecipitation and His or GST Pull-down Assays

Cell Proliferation Assays

Cancer Cell 33, 1–18.e1–e7, March 12, 2018 e5

Extracellular Acidification Rate and Oxygen Consumption Rate Assays

e6 Cancer Cell 33, 1–18.e1–e7, March 12, 2018

SIX1 Q177R Mutation Screening

miRNA In Situ Hybridization and Immunohistochemistry

PET Imaging of Glucose Uptake in Mice