1370 Original article
The upregulation of Nur77 decreases ketamine-induced
hippocampal neurons toxicity in rats
Min Li and Yufeng Xue
Ketamine is clinically used as a narcotic. However,
ketamine has certain deficits and produces toxicity to
neurons. As a member of the NR4A receptor subfamily,
Nur77 decreases neurodegenerative disorders. The study
aims to investigate the effects of upregulated Nur77 on
ketamine-induced rat hippocampal neurons damage
and the active mechanism. Neurons were obtained from
rat hippocampal and identified by immunofluorescence
assays. The treatment groups contained ketamine
group, Nur77 group, ketamine + Nur77 group and
ketamine + L-cam group. Neurons apoptosis and reactive
oxygen species (ROS) were determined by a related
kit using flow cytometry. Enzyme NAD(P)H quinone
oxidoreductase 1 (NQO1), enzyme heme oxygenase 1
(HO1), Nur77, the expression of Bax, Bcl-2 and cleaved-
caspase-3 and inflammatory cytokines were measured
using western blot assays and reverse transcription-
quantitative PCR (RT-qPCR) assays. Ketamine-induced
neurons apoptosis; however, Nur77 decreased ketamine-
induced neurons apoptosis. A low level of ROS was
observed in two combination groups. Neurons treated
by ketamine only had the lowest levels of Nur77, NQO1
Introduction
Ketamine is clinically used as a narcotic during surgical
operation [1,2]. Recent studies revealed that ketamine
could cause schizophrenia, hallucinations as well as tox-
icity to neurons [3–5]. Thus, it is necessary to attenuate
ketamine-induced toxicity. Nuclear receptor Nur77, alter-
natively known as NR4A1, TR3 or NGFI-B, is a member
of NR4A receptor subfamily. NR4A nuclear receptors
were shown to play an important role in regulating glu-
coneogenesis, lipolysis and adipogenesis [6]. Herein, a
previous study reported that the upregulation of Nur77
contributed to the relief of neurodegenerative disorders
[7]. We speculated that the knockdown of Nur77 could
decrease the toxicity of ketamine-induced in hippocam-
pal neurons.
The study found that L-camitine (L-cam) removed the
toxic metabolites and decreased fatty acid oxidation [8].
In addition, L-cam in diet upregulates the level of serum
triglyceride, and triglyceride accumulation is associated
with pro-oxidant [9,10]. Moreover, L-cam is also used
in clinical trials to treat patients with hemodialysis and
neurometabolic disorders [11,12]. Reactive oxygen spe-
cies (ROS) is important in regulating cell function, and
the accumulation of ROS leads to various diseases [13].
0959-4965 Copyright © 2021 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
and HO1, compared with other treatment groups. The
levels of Bax and cleaved-caspase-3 in two combination
groups were lower than those in the ketamine group.
Furthermore, the ketamine group had higher levels of
tumor necrosis factor alpha, IL-1β and IL-6 but the lowest
level of IL-4. Upregulated Nur77 reduced the ketamine-
induced toxicity in neurons. The mechanism of Nur77
involved antioxidation, apoptosis signaling pathway and
inflammation signaling pathway. Our study provides a
novel therapy that could attenuate ketamine-induced
toxicity. NeuroReport 32: 1370–1378 Copyright © 2021
Wolters Kluwer Health, Inc. All rights reserved.
NeuroReport 2021, 32:1370–1378
Keywords: ketamine, L-camitine, Nur77, rat hippocampal neurons
Department of Neurology, Taizhou First People′s Hospital, Taizhou, Zhejiang,
China
Correspondence to Yufeng Xue, Department of Neurology, Taizhou First
People′s Hospital, 218 Hengjie Road, Huangyan District, Taizhou, Zhejiang
Province, 318020, China
Tel: +86 576 84229994; e-mail: xueyufeng_xyf@163.com
Received 2 April 2021 Accepted 12 June 2021
Bax, Bcl-2 and cleaved-caspase-3 were related to cell
survival and apoptosis [14–16]. Enzyme NAD(P)H qui-
none oxidoreductase 1 (NQO1) and enzyme heme oxy-
genase 1 (HO1) protect neurons from damage [17,18].
The expressions of tumor necrosis factor-alpha (TNF-α),
IL-1β, IL-4 and IL-6 are related to inflammation [19–21].
In the present study, we investigated the effects of the
upregulation of Nur77 on ketamine-induced hippocam-
pal neurons. Moreover, the expressions of markers
related to oxidation, inflammation and apoptosis were
determined in ketamine-induced hippocampal neurons
treated by Nur77.
Materials and methods
Cell culture and cell identification
Hippocampal neurons were derived from fetal rats.
Hippocampi in fetal rats were taken out and cut into
pieces. Hippocampus pieces were centrifuged (Xiangyi,
Changsha, China) at 4 °C 1000 rad/min for 5 min. Trypsin
(Gibco, Carlsbad, California, USA) was used to digest the
pieces. The cells were planted after screening. The rat
experiments were approved by Taizhou First People′s
Hospital. Primary hippocampal neurons were cultured
in neurobasal medium (21103049, Gibco, USA) with N2
DOI: 10.1097/WNR.0000000000001738

(17502001, Gibco), B27 (17504044, Gibco) and 10000 U/
ml penicillin-10000 μg/ml streptomycin (Gibco). The
digestion solution was terminated by Dulbecco’s modified
Eagle medium (Gibco) containing 10% fetal bovine serum
(FBS; Gibco) and 1% 10000 U/ml penicillin-10000 μg/ml
streptomycin (Gibco). Hippocampal neurons were iden-
tified by immunofluorescence assays. Briefly, hippocam-
pal neurons were cultured in 24-well (142475, Thermo
Fisher Scientific, Waltham, Massachusetts, USA). After
washing the cells by PBS for three times, the neurons were
fixed by 4% formaldehyde (Thermo Fisher Scientific) for
2 h and incubated with antibody neuron-specific eno-
lase (NSE; #8171, Cell Signaling Technology, Beverly,
Massachusetts, USA) overnight at 4 °C and then by goat
anti-rabbit IgG-fluorescein isothiocyanate (Phygene,
Fuzhou, China) for 2–3 h at room temperature. Finally,
2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochlo-
ride (#4083, Cell Signaling Technology) was used to stain
the hippocampal neurons in the dark. The images were
taken by a fluorescence microscope (Nikon, Japan).
Flow cytometry assays
Cell apoptosis and ROS were detected using flow cytom-
etry assays. The hippocampal neurons were planted
in 75 mm dish at 2.0 × 105 cells/dish for 24 h. Ketamine
(Jiuxu, China) and L-cam (Saipunsai, China) were used
to treat the neurons for 72 h. Single hippocampal neu-
rons were collected using trypsin (Gibco). Apoptosis kit
(Invitrogen, Waltham, Massachusetts, USA) or dihydror-
hodamine 123 (Invitrogen) was added into hippocampal
neurons. Flow cytometry (Attune NxT, Thermo Fisher
Scientific) was used to measure the fluorescence.
Cell transfection
The overexpression vector (pcDNA3.1/+vector; V79020,
Invitrogen, Thermo Fisher Scientific) carrying Nur77
gene (Seebio, Shanghai, China) was transfected into
cells to construct Nur77 overexpression. Briefly, 0.8 µg
DNA was diluted in 50 µL serum-free basic medium
(Gibco) and 2.0 µL liposome (11668500, Thermo
Fisher Scientific) was diluted in 50 µL serum-free basic
medium as well for 5 min at room temperature. Then,
the diluted DNA was mixed with the diluted lipos-
ome and incubated for 20 min at room temperature to
form 100 µL complexes. When the cells have attached
to the bottom of dish, the solution was added to the
75 mm dish, in which 2.0 × 105 hippocampal neurons
were planted. After 24 h, the neurons were treated with
100 µL of the complexes for 72 h in a normal culture
medium. The empty vector was used as a negative con-
trol (mock group).
Western blot
Total proteins were extracted by radio-immuno-
precipitation assay buffer (R0278, Sigma, St. Louis,
Missouri, USA) by centrifuging at 4 °C 15000 rad/
min for 15 min. Total protein concentration was meas-
ured using a bicinchoninic acid kit (BCA, Sigma). The
Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
Nur77 decreases ketamine-induced toxicity Li and Xue 1371
protein samples in different treatment groups were sep-
arated on SDS-PAGE and transferred to polyvinylidene
difluoride membranes (PVDF; Sigma) by electropho-
resis. The membranes were incubated by primary
antibodies [Nur77 (ab109180, 1/1000 dilution, Abcam,
USA), Bax (ab32503, 1/1000 dilution, Abcam, USA),
Bcl-2 (ab196495, 1/500 dilution, Abcam, USA), NQO1
(ab28947, 1/1000 dilution, Abcam, USA), HO1 (ab13243,
1/2000 dilution, Abcam, USA), cleaved-caspase-3
(active caspase-3; ab49822, 1/500 dilution, Abcam,
USA) and glyceraldehyde-3-phosphate dehydrogenase
(GAPDH; ab9485, 1/2500 dilution, Abcam, USA)] for
12 h at 4 °C and washed by Tris Buffered saline Tween
for three times. Next, the secondary antibody (ab205718
or ab205719, 1/2000 dilution, Abcam, USA) was used to
incubate the membranes for 2–3 h at 25 °C. Finally, ECL
was added to the membranes, and the fluorescence was
observed in a dark room.
Reverse transcription-quantitative PCR
Total RNAs were extracted using TRIzol reagent (Sigma)
and centrifuged at 4 °C 12000 rad/min for 10 min. The
concentration of RNA was detected by spectrophotom-
etry UV machine (INESA, Shanghai, China). Reverse
transcription kit (cDNA synthesis kit; Sigma) was used
to synthesize cDNA at 42 °C for 60 min and at 70 °C for
5 min. Amplification of RNA was performed by PCR in
Tap enzyme reaction system at 95 °C for 3 min, 50 cycles
of 95 °C for 30 s, at 60 °C for 1 min and 72 °C for 1 min.
Tap enzyme reaction system included ddH2O, Tap PCR
master mix, forward primer, reverse primer and cDNA.
The sequences of primers are listed in Table 1. GAPDH
was regarded as internal reference and 2−ΔΔCt was used to
calculate relative RNA expression.
Statistical analysis
The data were shown as mean ± SD. Experiments were
repeated three times. SPSS software (version 15.0, SPSS,
Chicago, Illinois, USA) was used to analyze the data.
Analysis of variance (ANOVA) with Tukey–Kramer mul-
tiple comparison tests was conducted to perform reverse
transcription-quantitative PCR (RT-qPCR) assays, flow
cytometry assays and western blot assays. The images
were analyzed by Quantity One software. P < 0.05 was
considered as statistical significance.
Table 1 Primers used in real-time PCR analysis
Gene Forward (5′-3′) Reverse (5′-3′)
Nur77 GCCCAGTTTCAGCACCTTCAT GCAGGACAGGGTCTCGTCTAAT
NQO1 TGTCTGGGAGGAGTCACCA TTGTCGGCTGGAATGGAC
HO1 CATTGAGCTGTTTGAGGAGCTG GCGGTGTCTGGGATGAACTA
Bcl-2 TCCAAGCAAAACGTCCAGA TCCTTCCCCAGTTAATGATGC
Bax AAAGTGCCCGAGCTGATC AGGACTCCAGCCACAAAGA
TNF-α GAGATGTGGAACTGGCAGA GCTCTGAATGACTCTGGCTT
IL-6 CAGTTGCCTTCTTGGGACT GCTCTGAATGACTCTGGCTT
IL-4 CAGGGTGCTTCGCAAATTTTA CCGAGAACCCCAGACTTGTTC
IL-1β GGTATGAAATGGCAAATCG GTCGTAGCAAACCACCAAG
GAPDH GTCGGTGTGAACGGATTT ACTCCACGACGTACTCAGC
GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
1372 NeuroReport 2021, Vol 32 No 17

Results treated by ketamine and Nur77 or ketamine and L-cam

The morphology of hippocampal neurons derived from rat
As shown in Fig. 1, the fluorescence of NSE filled the
hippocampi and hippocampal neurons had dendritic
morphology. Moreover, hippocampal neurons body was
full and pyramidal.
The effects of different concentrations of ketamine on
the expression level of Nur77 in hippocampal neurons
and their apoptosis
Hippocampal neurons were treated by different concentra-
tions of ketamine (1 μM, 10 μM and 50 μM) for 72 h. As shown
in Fig. 2a–c, hippocampal neurons treated by the lowest con-
centration of ketamine (1 μM) had the highest expression
level of Nur77, whereas the highest concentration of keta-
mine (ketamine 3 group) had the lowest level of Nur77. The
results in RT-qPCR were similar to that in western blot. In
Fig. 2d, ketamine-induced apoptosis in a dose-dependent
manner, which revealed that a higher concentration of keta-
mine-induced more hippocampal neurons apoptosis.
The effects of ketamine and Nur77 alone or in
combination on the level of reactive oxygen species in
hippocampal neurons and their apoptosis
Ketamine in combination with Nur77 downregulated the
level of ROS compared with single-ketamine treatment,
and ketamine + L-cam group had lower ROS compared
with the ketamine group (Fig. 3a). The proportion of
apoptosis in hippocampal neurons treated by ketamine
was about 25%, whereas Nur77 and L-cam decreased the
proportion of apoptosis caused by ketamine (Fig. 3b).
The combination groups had significant differences from
ketamine group (P < 0.01).
The effects of ketamine and Nur77 alone or in
combination on levels of Nur77, NQO1 and HO1 in
hippocampal neurons
In Fig. 4, hippocampal neurons treated by ketamine
alone had the lowest levels of Nur77, NQO1 and HO1
compared with other groups. Hippocampal neurons
had higher levels of Nur77, NQO1 and HO1 compared
with single-ketamine groups. Ketamine in combination
with Nur77 had lower expressions of Nur77, NQO1 and
HO1 than those in the single-Nur77 group. Significant
differences were observed between combination groups
and the ketamine group (P < 0.01).
The effects of ketamine and Nur77 alone or in
combination on levels of Bax, Bcl-2 and cleaved-
caspase-3 in hippocampal neurons
As shown in Fig. 5, ketamine inhibited the level of Bcl-2
in hippocampal neurons, whereas it upregulated the lev-
els of Bax and cleaved-caspase-3. The levels of Bax and
cleaved-caspase-3 in the Nur77 group were lower than
the ketamine group and were almost equal to the control
group. Moreover, the two combination groups had lower
levels of Bax and cleaved-caspase-3 but higher Bcl-2
expressions than the ketamine group, and the differences
between the two combination groups and the ketamine
group was significant (P < 0.01).
The effects of ketamine and Nur77 alone or in
combination on levels of tumor necrosis factor-alpha,
IL-1β, IL-4 and IL-6 in hippocampal neurons
The levels of TNF-α, IL-1β and IL-6 were higher in the
ketamine group than other groups. Moreover, the level
of IL-4 was the lowest in the ketamine group compared
with other groups (Fig. 6). Moreover, the levels of TNF-
α, IL-1β and IL-6 in the Nur77 group were lower than
two combination groups. However, the level of IL-4 was
the highest in Nur77 group. There were important signif-
icance between two combination groups and ketamine
group (P < 0.01).
Discussion
Normal morphologies of hippocampal neurons include
dendritic morphology and pyramidal morphology [22–
24]. NSE is a neuronal glycolytic enzyme in neuronal cell,
and it is connected to neuronal diseases such as diabetic

Fig. 1

The morphology of rat hippocampal neurons is identified by immunofluorescence (IFA) assays. Hippocampal neurons were cultured in 24-well
and washed by PBS for three times. Next, antibody neuron-specific enolase (NSE) was used to incubate the hippocampal neurons overnight
at 4 °C after neurons had been fixed. At last, goat anti-rabbit IgG-fluorescein isothiocyanate and DAPI were used to incubate the neurons for
2–3 h at room temperature in a dark room. The photos were taken by a fluorescence microscope. Experiments were repeated three times. DAPI,
2-(4-Amidinophenyl)-6-indolecarbamidine dihydrochloride.

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
 Nur77 decreases ketamine-induced toxicity Li and Xue 1373

Fig. 2

The effects of ketamine on hippocampal neurons apoptosis and the level of Nur77. Hippocampal neurons were planted in 75 mm dish at 2.0 × 105
cells/dish for 24 h. Then, hippocampal neurons were treated by different concentrations of ketamine (1 μM, 10 μM and 50 μM) for 72 h. (a) The
levels of Nur77 mRNA in groups were detected by reverse transcription-quantitative PCR (RT-qPCR) assays. (b,c) The levels of Nur77 protein in
neurons were measured using western blot assays. (d) Apoptosis kit was added to cell suspension. Then, fluorescence in treatment groups was
detected by flow cytometry assay. Analysis of variance was used to analyze the data (a versus control group, b versus vehicle group, c versus
ketamine 1 group and d versus ketamine 2 group; a = b = c = d = *P < 0.05, aa = bb = cc = dd = **P < 0.01). Experiments were repeated three times.

peripheral neuropathy and Alzheimer′s disease [25,26].
NSE was used to confirm the identity of the extracted
cells used in the present study, and the extracted cells
were identified as hippocampal neurons. Ketamine is
widely used in pediatric anesthesia, and studies widely
support that ketamine generates neurotoxicity [27,28].
Nur77 is expressed in the central nervous systems
including in the hippocampus, cortex and other brain
regions [29]. In this study, the results revealed that the
higher concentration of ketamine resulted in the higher
proportion of cell apoptosis and lowered the expression
of Nur77, suggesting that the upregulation of Nur77
decreased the ketamine-induced hippocampal neurons
toxicity and apoptosis. Interestingly, the expression level
of Nur77 in the treatment group (1 μM ketamine) was
higher than the control group, which may be related to
the low concentration of ketamine, however, the specific
mechanism remains to be further investigated.
Next, we investigated the effect of Nur77 on ketamine-in-
duced hippocampal neurons. A previous study showed

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
1374 NeuroReport 2021, Vol 32 No 17

Fig. 3

The effects of ketamine and Nur77 alone or in combination on the level of reactive oxygen species (ROS) and hippocampal neurons apoptosis.
Hippocampal neurons were seeded in 75 mm dish at 2.0 × 105 cells/dish. After 24 h, reagents (10 μM ketamine, 30 μM L-cam) were used to treat
the hippocampal neurons for 72 h. The hippocampal neurons were treated by Nur77 RNA by transfection methods. (a) Dihydrorhodamine 123
was added to the hippocampal neurons, the level of ROS was detected by flow cytometry machine. (b) Hippocampal neurons were mixed with
apoptosis kit. Fluorescence was analyzed using flow cytometry system. Analysis of variance was used to analyze the data (a versus control group,
b versus vehicle group, c versus ketamine group, d versus mock group, e versus Nur77 group and f versus ketamine + Nur77 group; a = b = c = d
= e = f = *P < 0.05, aa = bb = cc = dd = ee = ff = **P < 0.01). Experiments were repeated three times.

that the accumulation of Nur77 attenuated inflamma-
tion and apoptosis [30,31]. Li et al., [32] demonstrated
that Nur77 deficiency led to systemic inflammation in
elderly mice, increased the production of pro-inflamma-
tory cytokines and immunoglobulin[32]. The study also
reported that the reduction of TNF-α, IL-6 and IL-1β
decreased inflammation [33]. IL-4 could protect mice and
human from inflammatory reactions [34]. It is reported
that Nur77 could attenuate the production of proinflam-
matory mediators by inhibiting the activation of nuclear

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
 Nur77 decreases ketamine-induced toxicity Li and Xue 1375

Fig. 4

The effects of ketamine and Nur77 alone or in combination on levels of Nur77, NQO1 and HO1 in hippocampal neurons. 2.0 × 105 hippocampal
neurons were seeded in 75 mm dish. Reagents (10 μM ketamine, 30 μM L-cam) were used to treat the hippocampal neurons for 72 h. Nur77 RNA
transfected hippocampal neurons. (a–c) The mRNA levels of Nur77, NQO1 and HO1 were measured by reverse transcription-quantitative PCR
(RT-qPCR) assays. (d–g) The protein levels of Nur77, NQO1 and HO1 were analyzed by western blot assays. The stains in image were quantified
by quantity one software. Analysis of variance was used to analyze the data (a versus control group, b versus vehicle group, c versus ketamine
group, d versus mock group, e versus Nur77 group and f versus ketamine + Nur77 group; a = b = c = d = e = f = *P < 0.05, aa = bb = cc = dd = ee = ff
= **P < 0.01). Experiments were repeated three times.

factor kappa-light-chain-enhancer of activated B cells and
p38 mitogen-activated protein kinase [35,36]. We found
that overexpressed Nur77 reduced the promoting effect
of ketamine on TNF-α, IL -6 and IL-1β and reversed
the inhibitory effect of ketamine on IL-4, indicating that
Nur77 reduces the toxicity of ketamine to hippocampal
neurons by regulating inflammatory responses.
To some extent, inflammation is connected with anti-
oxidation [37]. A previous study reported that NQO1
could protect cultured cells against toxic insults by
regulating plasma membrane redox system activity
[38,39]. Moreover, it has been shown that the upreg-
ulation of HO1 protects neurons from damage [40].
Furthermore, L-cam also protected hippocampal
neurons from ketamine-caused damage. Excessive
ROS can lead to oxidative stress, [41]. Li et al., [42]
showed that Nur77 suppresses TPβ oxidation to facil-
itate fatty acid oxidation in mitochondria. Our results
demonstrated that upregulated Nur77 alleviated oxi-
dative damage and increased the ability of antioxida-
tion in ketamine-treated hippocampal neurons, which
were supported by the evidence that Nur77 reduced
the inhibitory effect of ketamine on the expressions of
NQO1 and HO1 and the promoting effect of ketamine
on the expression of ROS.
The ratio of Bax to Bcl-2 was used to evaluate cell
apoptosis [43], and a higher Bax/Bcl-2 ratio induces cell
apoptosis [44]. Cleaved-caspase-3 is increased with the

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
1376 NeuroReport 2021, Vol 32 No 17

Fig. 5

The effects of ketamine and Nur77 alone or in combination on level of Bax, Bcl-2 and cleaved-caspase-3 in hippocampal neurons. Hippocampal
neurons were put in 75 mm dish at 2.0 × 105 cells/dish. After 24 h, reagents (10 μM ketamine, 30 μM L-cam) were used to treat the hippocampal
neurons for 72 h. Nur77 RNA transfected hippocampal neurons. (a,b) The mRNA expression of Bax and Bcl-2 were detected by reverse tran-
scription-quantitative PCR (RT-qPCR) assays. (c–f) The protein expressions of Bax, Bcl-2 and cleaved-caspase-3 were detected by western blot
assays. The protein stains were quantified by quantity one software. Analysis of variance was used to analyze the data (a versus control group, b
versus vehicle group, c versus ketamine group, d versus mock group, e versus Nur77 group and f versus ketamine + Nur77 group; a = b = c = d = e
= f = *P < 0.05, aa = bb =cc = dd = ee = ff = **P < 0.01). Experiments were repeated three times.

process of cell apoptosis [16]. Our results showed that
Nur77 decreased ketamine-induced hippocampal neu-
rons apoptosis via Bax/Bcl-2/cleaved-caspase-3 signaling
pathway. Previous studies have reported that excessive
ROS could activate hypoxia-inducible factor (HIF)-1α,
and that severe HIF-1α activation could induce neu-
ronal apoptosis [45,46]. In this study, upregulated Nur77
alleviates the toxicity of ketamine to hippocampal neu-
rons by reducing inflammation, enhancing antioxidant
capacity and inhibiting apoptosis. In addition, according
to our results, L-cam can be used as a drug to decrease
ketamine-induced neurotoxicity, as L-cam was found
to upregulate Nur77 in ketamine-induced neurons.
However, this study has some limitations, for example,
the specific signaling pathway mechanism of upregulat-
ing Nur77 in reducing the hippocampal neuronal toxicity
induced by ketamine in rats needs to be further explored.
Conclusion
In conclusion, the present study supported that upreg-
ulated Nur77 reduced the toxicity of ketamine-induced
hippocampal neurons. Furthermore, the mechanism of
Nur77 was involved in antioxidation, Bax/Bcl-2/cleaved-
caspase-3 apoptosis signaling pathway and TNF-α/IL-6/

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
 Nur77 decreases ketamine-induced toxicity Li and Xue 1377

Fig. 6

The effects of ketamine and Nur77 alone or in combination on levels of tumor necrosis factor alpha (TNF-α), IL-1β, IL-4, and IL-6 in hippocam-
pal neurons. Hippocampal neurons were placed in 75 mm dish at 2.0 × 105 cells/dish. Reagents (10 μM ketamine, 30 μM L-cam) treated with
hippocampal neurons for 72 h. Nur77 RNA transfected hippocampal neurons. Total RNAs were extracted by TRIzol reagent at 4 °C 12000 rad/min
for 10 min. Goal mRNAs were detected by synthesizing cDNA and amplifying goal mRNA. (a) mRNA relative expression of TNF-α in groups. (b)
Relative expressions of IL-1β mRNA in groups. (c) Expression levels of IL-4 mRNA in groups. (d) The expression levels of IL-6 mRNA in groups.
Analysis of variance was used to analyze the data (a versus control group, b versus vehicle group, c versus ketamine group, d versus mock group,
e versus Nur77 group and f versus ketamine + Nur77 group; a = b = c = d = e = f = *P < 0.05, aa = bb = cc = dd = ee = ff = **P < 0.01). Experiments
were repeated three times.

IL-1β/IL-4 inflammation signaling pathway. The study
proved that Nur77 can be a therapeutic target in keta-
mine-induced hippocampal neurons.
Acknowledgements
Conflicts of interest
There are no conflicts of interest.
References
1 Schlemmer K. [Clinical experience with ketalar-narcosis]. Klin Monbl
Augenheilkd 1972; 160:233–234.
2 Senn P, Jöhr M, Kaufmann S, Schipper I. [Brief narcosis with propofol/
ketamine for administering retrobulbar anesthesia]. Klin Monbl Augenheilkd
1993; 202:528–532.
3 Hou Y, Zhang H, Xie G, Cao X, Zhao Y, Liu Y, et al. Neuronal injury, but
not microglia activation, is associated with ketamine-induced experimental
schizophrenic model in mice. Prog Neuropsychopharmacol Biol Psychiatry
2013; 45:107–116.
4 Powers AR 3rd, Gancsos MG, Finn ES, Morgan PT, Corlett PR. Ketamine-
induced hallucinations. Psychopathology 2015; 48:376–385.
5 Slikker W Jr, Liu F, Rainosek SW, Patterson TA, Sadovova N, Hanig JP, et
al. Ketamine-induced toxicity in neurons differentiated from neural stem
cells. Mol Neurobiol 2015; 52:959–969.
6 Pols TW, Bonta PI, de Vries CJ. NR4A nuclear orphan receptors: protective
in vascular disease? Curr Opin Lipidol 2007; 18:515–520.
7 Huang HY, Chang HF, Tsai MJ, Chen JS, Wang MJ. 6-Mercaptopurine
attenuates tumor necrosis factor-α production in microglia through Nur77-
mediated transrepression and PI3K/Akt/mTOR signaling-mediated transla-
tional regulation. J Neuroinflammation 2016; 13:78.
8 Winter S, Birek L, Walker T, Phalin-Roque J, Chandler MJ, Field C, Zorn E.
Therapy of metabolic disorders with intravenous (IV) access ports and long
term intravenous L-carnitine therapy. Southeast Asian J Trop Med Public
Health 1999; 30 (Suppl 2):152–153.
9 Rezaei M, Attar A, Ghodratnama A, Kermanshahi H. Study the effects
of different levels of fat and L-carnitine on performance, carcass charac-
teristics and serum composition of broiler chicks. Pak J Biol Sci 2007;
10:1970–1976.
10 Musso G, Gambino R, De Michieli F, Biroli G, Fagà E, Pagano G, Cassader
M. Association of liver disease with postprandial large intestinal triglyc-
eride-rich lipoprotein accumulation and pro/antioxidant imbalance in nor-
molipidemic non-alcoholic steatohepatitis. Ann Med 2008; 40:383–394.
11 Ribas GS, Vargas CR, Wajner M. L-carnitine supplementation as a potential
antioxidant therapy for inherited neurometabolic disorders. Gene 2014;
533:469–476.
12 Khalatbari-Soltani S, Tabibi H. Inflammation and L-carnitine therapy in hemo-
dialysis patients: a review. Clin Exp Nephrol 2015; 19:331–335.
13 Nash KM, Ahmed S. Nanomedicine in the ROS-mediated patho-
physiology: applications and clinical advances. Nanomedicine 2015;
11:2033–2040.

Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
1378 NeuroReport 2021, Vol 32 No 17
14 Hu Q, Peng J, Liu W, He X, Cui L, Chen X, et al. Elevated cleaved
caspase-3 is associated with shortened overall survival in several cancer
types. Int J Clin Exp Pathol 2014; 7:5057–5070.
15 Lee IN, Cheng WC, Chung CY, Lee MH, Lin MH, Kuo CH, et al.
Dexamethasone reduces brain cell apoptosis and inhibits inflammatory
response in rats with intracerebral hemorrhage. J Neurosci Res 2015;
93:178–188.
16 Wichapoon B, Punsawad C, Viriyavejakul P. Expression of cleaved
caspase-3 in renal tubular cells in Plasmodium falciparum malaria patients.
Nephrology (Carlton) 2017; 22:79–84.
17 Shah ZA, Li RC, Ahmad AS, Kensler TW, Yamamoto M, Biswal S, Doré S.
The flavanol (-)-epicatechin prevents stroke damage through the Nrf2/HO1
pathway. J Cereb Blood Flow Metab 2010; 30:1951–1961.
18 Kim J, Lee S, Shim J, Kim HW, Kim J, Jang YJ, et al. Caffeinated coffee,
decaffeinated coffee, and the phenolic phytochemical chlorogenic acid
up-regulate NQO1 expression and prevent H2O2-induced apoptosis in
primary cortical neurons. Neurochem Int 2012; 60:466–474.
19 Lin HC, Lin TH, Wu MY, Chiu YC, Tang CH, Hour MJ, et al. 5-Lipoxygenase
inhibitors attenuate TNF-α-induced inflammation in human synovial fibro-
blasts. PLoS One 2014; 9:e107890.
20 Palomo J, Dietrich D, Martin P, Palmer G, Gabay C. The interleukin (IL)-1
cytokine family–Balance between agonists and antagonists in inflammatory
diseases. Cytokine 2015; 76:25–37.
21 Luzina IG, Keegan AD, Heller NM, Rook GA, Shea-Donohue T, Atamas
SP. Regulation of inflammation by interleukin-4: a review of “alternatives”. J
Leukoc Biol 2012; 92:753–764.
22 Liu Y, Kagechika H, Ishikawa J, Hirano H, Matsukuma S, Tanaka K,
Nakamura S. Effects of retinoic acids on the dendritic morphology of
cultured hippocampal neurons. J Neurochem 2008; 106:1104–1116.
23 Fujioka A, Fujioka T, Ishida Y, Maekawa T, Nakamura S. Differential effects
of prenatal stress on the morphological maturation of hippocampal neurons.
Neuroscience 2006; 141:907–915.
24 Bullis JB, Jones TD, Poolos NP. Reversed somatodendritic I(h) gradient in
a class of rat hippocampal neurons with pyramidal morphology. J Physiol
2007; 579 (Pt 2):431–443.
25 Li J, Zhang H, Xie M, Yan L, Chen J, Wang H. NSE, a potential biomarker, is
closely connected to diabetic peripheral neuropathy. Diabetes Care 2013;
36:3405–3410.
26 Schmidt FM, Mergl R, Stach B, Jahn I, Gertz HJ, Schönknecht P. Elevated
levels of cerebrospinal fluid neuron-specific enolase (NSE) in Alzheimer′s
disease. Neurosci Lett 2014; 570:81–85.
27 Cao C, Zhang Y, Zhang Z, Chen Q. Small interfering LncRNA-TUG1
(siTUG1) decreases ketamine-induced neurotoxicity in rat hippocampal
neurons. Int J Neurosci 2019; 129:937–944.
28 Yan J, Jiang H. Dual effects of ketamine: neurotoxicity versus neuroprotec-
tion in anesthesia for the developing brain. J Neurosurg Anesthesiol 2014;
26:155–160.
29 Nakai A, Kartha S, Sakurai A, Toback FG, DeGroot LJ. A human early
response gene homologous to murine nur77 and rat NGFI-B, and
related to the nuclear receptor superfamily. Mol Endocrinol 1990;
4:1438–1443.
30 Kurakula K, Vos M, Logiantara A, Roelofs JJ, Nieuwenhuis MA, Koppelman
GH, et al. Nuclear receptor Nur77 attenuates airway inflammation in mice
by suppressing NF-kappaB activity in lung epithelial cells. J Immunol
(Baltimore, Md: 1950) 2015; 195:1388–1398.
Copyright © 2021 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
31 Shao Q, Han F, Peng S, He B. Nur77 inhibits oxLDL induced apoptosis of
macrophages via the p38 MAPK signaling pathway. Biochem Biophys Res
Commun 2016; 471:633–638.
32 Li XM, Lu XX, Xu Q, Wang JR, Zhang S, Guo PD, et al. Nur77 deficiency
leads to systemic inflammation in elderly mice. J Inflamm (Lond) 2015;
12:40.
33 Zhang M, Zhou J, Wang L, Li B, Guo J, Guan X, et al. Caffeic acid reduces
cutaneous tumor necrosis factor alpha (TNF-α), IL-6 and IL-1β levels and
ameliorates skin edema in acute and chronic model of cutaneous inflamma-
tion in mice. Biol Pharm Bull 2014; 37:347–354.
34 Guenova E, Skabytska Y, Hoetzenecker W, Weindl G, Sauer K, Tham M, et al.
IL-4 abrogates T(H)17 cell-mediated inflammation by selective silencing of IL-23
in antigen-presenting cells. Proc Natl Acad Sci U S A 2015; 112:2163–2168.
35 Liu TY, Yang XY, Zheng LT, Wang GH, Zhen XC. Activation of Nur77 in
microglia attenuates proinflammatory mediators production and protects
dopaminergic neurons from inflammation-induced cell death. J Neurochem
2017; 140:589–604.
36 Li L, Liu Y, Chen HZ, Li FW, Wu JF, Zhang HK, et al. Impeding the inter-
action between Nur77 and p38 reduces LPS-induced inflammation. Nat
Chem Biol 2015; 11:339–346.
37 Sureda A, Tejada S, Bibiloni Mdel M, Tur JA, Pons A. Polyphenols: well
beyond the antioxidant capacity: polyphenol supplementation and exer-
cise-induced oxidative stress and inflammation. Curr Pharm Biotechnol
2014; 15:373–379.
38 Hyun DH, Kim J, Moon C, Lim CJ, de Cabo R, Mattson MP. The plasma
membrane redox enzyme NQO1 sustains cellular energetics and protects
human neuroblastoma cells against metabolic and proteotoxic stress. Age
(Dordr) 2012; 34:359–370.
39 Kim J, Kim SK, Kim HK, Mattson MP, Hyun DH. Mitochondrial function in
human neuroblastoma cells is up-regulated and protected by NQO1, a
plasma membrane redox enzyme. PLoS One 2013; 8:e69030.
40 Jung HY, Kim DW, Yim HS, Yoo DY, Kim JW, Won MH, et al. Heme oxygen-
ase-1 protects neurons from ischemic damage by upregulating expression
of Cu,Zn-superoxide dismutase, catalase, and brain-derived neurotrophic
factor in the rabbit spinal cord. Neurochem Res 2016; 41:869–879.
41 Hoarau E, Chandra V, Rustin P, Scharfmann R, Duvillie B. Pro-oxidant/
antioxidant balance controls pancreatic β-cell differentiation through the
ERK1/2 pathway. Cell Death Dis 2014; 5:e1487.
42 Li XX, Wang ZJ, Zheng Y, Guan YF, Yang PB, Chen X, et al. Nuclear
receptor Nur77 facilitates melanoma cell survival under metabolic stress by
protecting fatty acid oxidation. Mol Cell 2018; 69:480–492.e7.
43 Cao YH, Pan JX, Liang YQ, Shi RZ. [Effects of PKCα/c-fos, Bax/Bcl-2
expression on the proliferation and apoptosis of rat pulmonary arterial
smooth muscle cells in hypoxia]. Zhongguo Ying Yong Sheng Li Xue Za Zhi
2017; 33:218–221.
44 Du L, Fei Z, Song S, Wei N. Antitumor activity of Lobaplatin against esoph-
ageal squamous cell carcinoma through caspase-dependent apoptosis and
increasing the Bax/Bcl-2 ratio. Biomed Pharmacother 2017; 95:447–452.
45 Yan J, Huang Y, Lu Y, Chen J, Jiang H. Repeated administration of ketamine
can induce hippocampal neurodegeneration and long-term cognitive impair-
ment via the ROS/HIF-1alpha pathway in developing rats. Cell Physiol
Biochem 2014; 33:1715–1732.
46 Halterman MW, Miller CC, Federoff HJ. Hypoxia-inducible factor-1alpha
mediates hypoxia-induced delayed neuronal death that involves p53. J
Neurosci 1999; 19:6818–6824.