Haarmann Full Dissertation 4-19-1

INFLUENCE OF APPLICATION PLACEMENT, RESISTANCE
GENOTYPE, AND PPO-INHIBITING HERBICIDE ON THE PPO-

RESISTANCE PHENOTYPE IN WATERHEMP
by
Jesse Andrew Haarmann
A Dissertation
Submitted to the Faculty of Purdue University
In Partial Fulfillment of the Requirements for the degree of
Doctor of Philosophy
Department of Botany and Plant Pathology

West Lafayette, Indiana
May 2023
THE PURDUE UNIVERSITY GRADUATE SCHOOL
STATEMENT OF COMMITTEE APPROVAL
Dr. William G. Johnson, Chair

Dr. Bryan G. Young

Dr. Joshua R. Widhalm

Department of Horticulture and Landscape Architecture
Dr. Robert E Pruitt

Dr. Patrick J. Tranel

Department of Crop Sciences
University of Illinois Urbana – Champaign
Approved by:
Dr. Tesfaye Mengiste
Dedicated to my wife Brittany
ACKNOWLEDGMENTS
Completion of my degree would not have been possible without the help and support of
several groups of people. First, I would like to thank my advisor Dr. Bill Johnson for allowing me
to stay on at Purdue for my PhD degree. Also, thank you to my graduate committee, Dr. Bryan
Young, Dr. Josh Widhalm, Dr. Bob Pruitt, and Dr. Pat Tranel for the guidance, advisement, and
use of facilities. I also want to thank Julie Young for all of the assistance with logistics and
planning, methods advisement, and supply acquisition. To all my fellow graduate students and the
undergraduate employees at Purdue, both past and present, especially Cade Hayden, Dr. Joe Ikley,
Dr. Cara McCauley, Connor Hodgskiss, Stephanie Desimini, Dr. Nick Steppig, Marcelo Zimmer,
Dr. Ben Westrich, Dr. Matthew Osterholt, Lucas Maia, Rose Vagedes, and Claudia Bland, thank
you for all of your help over the years, and for your friendship. A big thank you also goes to Dr.
Mearaj Shaikh and the rest of the Widhalm lab for assistance with extractions and PCR.
To my wife, Brittany, thank you for remaining by my side during these challenging years.
To my parents, Tom and Janet Haarmann, thank you for supporting me through my never-ending
education and inspiring a passion for lifelong learning and achievement and a love of agriculture.
I owe so much of who I am today to your encouragement and guidance. I am truly honored and
humbled to have received the support and friendship of so many wonderful people over the last
four years.
4
TABLE OF CONTENTS
LIST OF TABLES .......................................................................................................................... 8

LIST OF FIGURES ...................................................................................................................... 10
ABSTRACT.................................................................................................................................. 13
A REVIEW OF THE LITERATURE ................................................................. 15
1.1 PPO is an Important Herbicide Target .............................................................................. 15
1.2 Trifludimoxazin, a New PPO-Inhibiting Herbicide .......................................................... 16
1.3 PPO-Inhibitor Resistance Mutations................................................................................. 19
1.4 Herbicide Resistance Genotyping Assays ........................................................................ 22
1.5 Herbicide Dose Responses ................................................................................................ 24
1.6 Biologically Effective Dose .............................................................................................. 26
1.7 Herbicide Effectiveness PRE vs POST............................................................................. 28
1.8 Natural Selection in Weed Populations ............................................................................ 29
1.9 Organelle Targeting of Plant Enzymes ............................................................................. 30
1.10 PPO-Pathway Control and Flux ..................................................................................... 32
1.11 Summary......................................................................................................................... 36
1.12 Justification of Research................................................................................................. 37
1.13 Literature Cited ............................................................................................................... 37
ARE PRE-APPLIED PPO INHIBITORS SELECTING FOR NEW
RESISTANCE MUTATIONS IN WATERHEMP (AMARANTHUS TUBERCULATUS)? .... 52
2.1 Abstract ............................................................................................................................. 52
2.2 Introduction ....................................................................................................................... 53
2.3 Materials and Methods ...................................................................................................... 57
2.4 Results and Discussion ..................................................................................................... 60
2.4.1 Flumioxazin ............................................................................................................... 60
2.4.2 Fomesafen .................................................................................................................. 61
2.4.3 Oxadiazon .................................................................................................................. 61
2.4.4 Saflufenacil ................................................................................................................ 63
2.4.5 Sulfentrazone ............................................................................................................. 63
2.4.6 Trifludimoxazin ......................................................................................................... 64
5
2.4.7 Variance in Observed Resistance .............................................................................. 64
2.4.8 Practical Implications ................................................................................................ 66
2.5 Literature Cited ................................................................................................................. 68
DOES TRIFLUDIMOXAZIN SELECT FOR RESISTANT WATERHEMP
(AMARANTHUS TUBERCULATUS) SIMILARLY TO OTHER PPO-INHIBITING
HERBICIDES? ........................................................................................................................... 86
3.1 Abstract ............................................................................................................................. 86
3.2 Introduction ....................................................................................................................... 87
3.3 Materials and Methods ...................................................................................................... 91
3.3.1 Site Selection and Experimental Design.................................................................... 91
3.3.2 Data Collection and Analysis .................................................................................... 93
3.4 Results and Discussion ..................................................................................................... 95
3.4.1 PRE Herbicide Efficacy ............................................................................................. 95
3.4.2 PRE Resistance Selection .......................................................................................... 96
3.4.3 POST Efficacy ......................................................................................................... 100
3.4.4 POST Resistance Selection...................................................................................... 101
3.5 Acknowledgements ......................................................................................................... 104
INVESTIGATING THE POTENTIAL CO-OCCURRENCE OF TARGET-SITE
AND NON-TARGET-SITE RESISTANCE IN WATERHEMP (AMARANTHUS
TUBERCULATUS) POPULATIONS ....................................................................................... 122
4.1 Abstract ........................................................................................................................... 122
4.2 Introduction ..................................................................................................................... 123
4.3 Materials and Methods .................................................................................................... 127
4.3.1 Plant Materials ......................................................................................................... 127
4.3.2 Spray Applications and Preparations ....................................................................... 128
4.3.3 Experimental Design, Data Collection, and Analysis ............................................. 129
4.4 Results and Discussion ................................................................................................... 129
4.4.1 Response to Detoxification Inhibitors Alone .......................................................... 129
4.4.2 PPO-Resistance Response ....................................................................................... 131
6
INVESTIGATIONS OF PPO-INHIBITOR RESISTANCE IN WATERHEMP
(AMARANTHUS TUBERCULATUS) LACKING KNOWN RESISTANCE-CONFERRING
MUTATIONS ......................................................................................................................... 148
5.1 Abstract ........................................................................................................................... 148
5.2 Introduction ..................................................................................................................... 149
5.3 Materials and Methods .................................................................................................... 152
5.3.1 Preliminary Purifying Screen .................................................................................. 152
5.3.2 Gene Sequencing and PCR Reactions ..................................................................... 155
5.3.3 Dose-Response Assays ............................................................................................ 156
5.3.4 Gene Expression Assay ........................................................................................... 157
5.3.5 Lipid Peroxidation Assay ........................................................................................ 158
5.4 Results and Discussion ................................................................................................... 159
5.4.1 Preliminary Purifying Screen .................................................................................. 159
5.4.2 Target-Site Gene Sequencing .................................................................................. 160
5.4.3 Dose-Response Assays ............................................................................................ 161
5.4.4 Gene-Expression Assay ........................................................................................... 164
5.4.5 Lipid-Peroxidation Assay ........................................................................................ 165
5.5 Acknowledgements ......................................................................................................... 167
VITA ........................................................................................................................................... 187
7
LIST OF TABLES
Table 2.1. Discovery of novel PPO-inhibitor resistance mutations in waterhemp and Palmer
amaranth. ....................................................................................................................................... 76
Table 2.2. Herbicides used for PRE dose-response experiments on susceptible and resistant
waterhemp biotypes with ΔG210 and R128G mutations.............................................................. 77
Table 2.3. Response of ΔG210, R128G and susceptible biotypes of waterhemp to PRE application
of PPO-inhibiting herbicides in the greenhouse, as measured by seedling emergence (LD50) and
shoot biomass (GR50). ................................................................................................................... 78
Table 2.4. Resistance ratios between susceptible, R128G, and ΔG210 waterhemp biotypes for six
PPO-inhibiting herbicides applied PRE in the greenhouse........................................................... 79
Table 3.1. Site characteristics for field trials conducted in 2020 and 2021a. .............................. 111
Table 3.2. Trial initiation and tissue collection dates for PRE and POST field trials at
Throckmorton and Davis field sites in 2020 and 2021. .............................................................. 112
Table 3.3. Weekly rainfall totals for Davis and Throckmorton field locations in 2020 and 2021.
..................................................................................................................................................... 113
Table 3.4. Control of waterhemp recorded 35 days after PRE herbicide application at
Throckmorton and Davis field sites in 2020 and 2021. .............................................................. 114
Table 3.5. Waterhemp emergence at the time of each tissue collection following PRE herbicide
treatments at Throckmorton and Davis Field Sites in 2020 and 2021. ....................................... 115
Table 3.6. Frequency of the first waterhemp to emerge after PRE PPO-inhibitor application that
are heterozygous or homozygous for the ΔG210 mutation in 2020 and 2021 at Throckmorton and
Davis Field Sites. ........................................................................................................................ 116
Table 3.7. Zygosity percentages of ΔG210 in the first waterhemp to emerge after treatment with
PRE PPO-inhibitor application at Throckmorton and Davis field sites in 2020 and 2021......... 117
Table 3.8. Herbicide soil properties of PPO inhibitors used in the current experiments. ........... 118
Table 3.9. Waterhemp control and survival assessed 14 days after POST PPO-inhibitor treatment
at Throckmorton and Davis field sites in 2020 and 2021. .......................................................... 119
Table 3.10. Frequency of surviving waterhemp that have at least one ΔG210 allele after treatment
with POST herbicide. .................................................................................................................. 120
Table 3.11. Zygosity percentages of the ΔG210 mutation in waterhemp surviving treatment with
POST PPO-inhibitor treatments at Throckmorton and Davis field sites in 2020 and 2021. ...... 121
Table 4.1 Waterhemp control after treatment with a detoxification inhibitor followed by fomesafen
application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment. ........................................ 143
8
Table 4.2. Waterhemp height and biomass after treatment with a detoxification inhibitor followed
by fomesafen application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment................... 144
Table 4.3. Waterhemp height and biomass after treatment with a detoxification inhibitor followed
by fomesafen application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment................... 145
Table 5.1. Phenotypic assignment for each plant sprayed with fomesafen at 14 days after treatment.
..................................................................................................................................................... 174
Table 5.2. Amino acid polymorphisms observed in isolated waterhemp PPX2 genes that survived
a dose of fomesafen. ................................................................................................................... 175
Table 5.3. Amino acid polymorphisms observed in isolated waterhemp PPX1 genes that survived
a dose of fomesafen. ................................................................................................................... 176
Table 5.4. Comparison of GR50 and LD50 values and R:S ratios calculated from waterhemp
biomass and survival at 14 days after fomesafen treatment for one susceptible population (Des),
two resistant populations with ΔG210 (Car and Was), and four populations displaying a delayed
regrowth resistance phenotype (Fran, IA-340, IA-358, and IA-369). ........................................ 177
9
LIST OF FIGURES
Figure 1.1. Names and structure of PPO-inhibiting herbicide molecules commonly mentioned in
the literature. ................................................................................................................................. 50
Figure 1.2. Tetrapyrrole synthesis pathway as presented in (Czarnecki et al. 2012) Abbreviations:
ALAD, ALA dehydratase; CAO, Chl a oxygenase; CBR, chlorophyll b reductase; ChlS,
chlorophyll synthase; CPO, coproporphyrinogen III oxidase; DVR, divinyl protochlorophyllide
reductase; FeCh, Fe chelatase; FLU, flourescent; GluRS, glutamyl-tRNA synthetase; GluTR,
glutamyl-tRNA reductase; GluTRBP, GluTR binding protein; GSAT, glutamate-1-semialdehyde
aminotransferase; HBS, hydroxymethylbilane synthase; HCAR, 7-hydroxymethyl chlorophyll a
reductase; HO, heme oxygenase; MgCh, Mg chelatase; MTF, Mg protoporphyrin IX
methyltransferase; PBS, phytochromobilin synthase; POR, light dependent NADPH-
protochlorophyllide oxidoreductase; PPOX, protoporphyrinogen IX oxidase; UROD,
uroporphyrinogen III decarboxylase; UROM, uroporphyrinogen III methyltransferase; UROS,
uroporphyrinogen III synthase. Colors represent different organelle localizations. ..................... 51
Figure 2.1. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to
flumioxazin applied preemergence. Emergence and biomass were evaluated 14 days after
treatment and normalized to a percentage of the untreated for each biotype. .............................. 80
fomesafen applied preemergence. Emergence and biomass were evaluated 14 days after treatment
and normalized to a percentage of the untreated for each biotype. .............................................. 81
oxadiazon applied preemergence. Emergence and biomass were evaluated 14 days after treatment
saflufenacil applied preemergence. Emergence and biomass were evaluated 14 days after treatment
sulfentrazone applied preemergence. Emergence and biomass were evaluated 14 days after
trifludimoxazin applied preemergence. Emergence and biomass were evaluated 14 days after
Figure 4.1. Isolated lesions on waterhemp leaves occurring after NBD-Cl application. Photo taken
at 48 h after treatment. ................................................................................................................ 146
Figure 4.2. The IL-WAS waterhemp population was sprayed with detoxification inhibitor
treatments followed by 60 g ha-1 of fomesafen. Plants portrayed in the photographs are replications
of the same treatment. ................................................................................................................. 147
10
Figure 5.1. Waterhemp control 14 days after fomesafen application for susceptible, ΔG210
resistant, and unknown cause resistant waterhemp from 6 populations. Populations are pooled due
to lack of significance in ANOVA. Means were separated using Tukeys HSD at α=0.05. Presence
of ΔG210 was confirmed by qPCR assay of leaf tissue collected after waterhemp survival.
Assignment to putative novel resistance mechanism group was made if the plant was controlled
less than susceptible plants and was confirmed as being absent of the ΔG210 mutation via qPCR
assay of leaf tissue collected after waterhemp survival. Assignment to susceptible group was made
at waterhemp death or individual waterhemp control was similar to the susceptible waterhemp
population and was confirmed as being absent of the ΔG210 mutation via qPCR assay of leaf tissue
collected after waterhemp survival. ............................................................................................ 178
Figure 5.2. Phylogenetic tree of selected Miseq PPX2 sequences and multiple Genbank accessions
of waterhemp and closely related species. Accessions shown in red are more closely related to
Palmer amaranth and redroot pigweed than wild type waterhemp accessions. .......................... 179
Figure 5.3. Comparison of plant symptomatology at 24 hours after treatment with fomesafen at 20
g ha-1. Colored boxes represent different types of populations with red indicating ΔG210 resistant,
yellow indicating susceptible, and blue indicating delayed regrowth phenotype populations. .. 180
Figure 5.4. Comparison of plant symptomology between populations at 3d after treatment with 7
rates of fomesafen. Red arrows in each frame point to the 20 g ha-1 and 63 g ha-1 rate of fomesafen
treatments. ................................................................................................................................... 181
Figure 5.5. Comparison of plant symptomology between populations at 14d after treatment with 8
rates of fomesafen. Red arrows in each frame point to the 20 g ha-1 and 63 g ha-1 rate of fomesafen
treatments. ................................................................................................................................... 182
Figure 5.6. Dose-response curves of susceptible (Des) ΔG210 resistant (Car and Was), and putative
novel R mechanism populations (Fran, IA-340, IA-358, and IA-369) to fomesafen. Aboveground
biomass was harvested 14 days after fomesafen treatment and normalized to a percentage of the
untreated for each population...................................................................................................... 183
Figure 5.7. Dose-response curves of susceptible (Des) ΔG210 resistant (Car and Was), and putative
novel R mechanism populations (Fran, IA-340, IA-358, and IA-369) to fomesafen. Waterhemp
survival was assessed 14 days after fomesafen treatment. ......................................................... 184
Figure 5.8. Mean gene expression of protoporphyrinogen oxidase 1 (PPX1) and 2 (PPX2) in
susceptible (Des) ΔG210 resistant (Car and Was), and four resistant populations with a putative
novel mechanism (Fran, IA-340, IA-358, and IA-369) prior to fomesafen treatment as determined
by qPCR assays. Expression values for each target are normalized to that of elongation factor-1
alpha and are expressed as percentages of the susceptible population. Means of each population
are indicated by X symbol. Overall F test P values were 0.077 and 0.0438 for PPX1 and PPX2
respectively. Expression differences between Was and IA-358 PPX2 were the only mean
differences using Tukey’s HSD (α = 0.05). ................................................................................ 185
Figure 5.9. Lipid peroxidation as indicated by MDA content of mature leaf tissue (top) and
meristem/young leaf tissue (bottom) in known susceptible (Des), ΔG210 resistant (Car) and two
resistant populations with putative novel mechanism (Fran and IA-369) following treatment with
fomesafen at 20 g ha-1. Significant differences of Fran and IA-369 populations compared to Des
11
and Car populations are denoted by * and † symbols respectively using Fishers protected LSD
(α = 0.05)..................................................................................................................................... 186
12
ABSTRACT
The PPO inhibitors are a valuable group of herbicides that provide soil-residual and foliar
control of glyphosate-resistant Amaranthus species. The ΔG210 mutation in the PPX2 gene
confers PPO-inhibitor resistance and has been present in the Midwest for more than a decade. Until
recently, PPO-inhibitor resistance in waterhemp was attributable to just the ΔG210 mutation in the
PPX2 gene, but recently, several new PPO-resistant biotypes have been discovered in waterhemp
and Palmer amaranth. A possible explanation is a change in PPO-inhibitor use patterns and
commonly used active ingredients.
Research was conducted to directly compare the ΔG210 mutation with the recently
discovered R128G mutation to PPO inhibitors applied PRE. The greatest resistance observed was
to fomesafen with a 20- to 37-fold resistance ratio. Other herbicides tested had resistance ratios
less than 9 for both mutations. Sulfentrazone was the only herbicide for which the R128G mutation
conferred greater resistance than did the ΔG210 mutation with a 0.48 ΔG210 to R128G ED50 ratio
(4.2 vs 8.8 R/S ratios). Overall, the data do not support our hypothesis that the R128G mutation
was selected for by soil-applied PPO inhibitors. We conclude that the R128G mutation in
waterhemp is not more robust than the ΔG210 mutation with respect to conferring resistance to
PPO inhibitors applied preemergence. Furthermore, there is no evidence that the utility of PPO
inhibitors applied preemergence will diminish any further as a result of the R128G mutation
increasing in frequency.
A set of field trials was conducted to investigate how a new PPO inhibitor, trifludimoxazin,
will select for resistant biotypes in the field. Plants that emerged through or survived a PPO-
inhibitor application were genotyped for the ΔG210 mutation. Overall, a greater number of
resistant plants survived the foliar herbicide applications than emerged through soil applications.
13
Trifludimoxazin did not increase the frequency of PPO-resistant individuals when applied to soil,
but when applied to foliage, increased the frequency of PPO-resistant individuals by 2.5- to 2.6-
fold, similar to other PPO inhibitors applied to foliage.
Several waterhemp populations have been identified that have PPO-inhibitor resistance not
completely explained by known target-site mutations. Malathion and NBD-Cl, known inhibitors
of cytochrome P450 and GST, were coapplied with fomesafen to partially reverse resistance to
fomesafen. While there was some support for the initial hypothesis, that fomesafen detoxification
is contributing to overall resistance, the lack of consistency between herbicide rates and the
noticeable phytotoxic response to malathion and NBD-Cl renders it impossible to rule out additive
effects from the multiple applied xenobiotics. We conclude that our methodology was insufficient
to address our hypothesis.
Another set of waterhemp populations had a resistance phenotype in the absence of target-
site mutations. After a purifying screen and confirmed absence of target site resistance mutations,
the progeny generation of four waterhemp populations were subjected to dose-response, target-
site expression, and lipid-peroxidation assays. Models for lethal dose (LD) indicate a less robust
R phenotype than ΔG210, with LD50 ratios of only 1.9- to 6.1- vs 19- to 27-fold resistance in the
ΔG210 populations. A target site expression experiment and lipid peroxidation experiment were
inconclusive, but provided some evidence of increased target-site expression or increased
antioxidant capacity as causal mechanisms, although no mechanisms have been fully ruled out.
These data add to the body of literature that suggests that many factors contribute to PPO-inhibitor
resistance. With greater utilization of PPO-inhibitors in the future, the complexity of resistance
will likely increase also.
14
A REVIEW OF THE LITERATURE
1.1 PPO is an Important Herbicide Target
Protoporphyrinogen IX oxidase (PPO)-inhibiting herbicides are an important class of
herbicides used worldwide. First introduced in the 1960s, these herbicides provide preemergence
(PRE) and postemergence (POST) weed control in a variety of crops. Major chemical classes
include diphenylethers, N-Phenyl-imides, N-Phenyl-triazolinones, and N-Phenyl-oxadiazolones,
and thiadiazoles (Hao et al. 2011) (Figure 1.1).
PPO enzymes are present in nearly all life including humans (Maneli et al. 2003).
Deficiencies in PPO enzyme activity in humans result in a pathological condition known as
variegate porphyria. Symptoms include sensitivity to sunlight and surface tissue damage which
appear to be analogous to phytotoxic herbicide symptoms (Ramanujam and Anderson 2015).
PPO inhibitors target the last common step in heme and chlorophyll biosynthesis,
protoporphyrinogen IX oxidase (Matringe et al. 1989) (Figure 1.2). More detail about specific
pathway enzymes will occur later in this review. Phytotoxicity and plant death occurs via
generation of reactive oxygen species following herbicide application. Inhibition of PPO leads to
buildup of the substrate protoporphyrinogen (protogen). Protogen is actively transported out of the
plastid where it is enzymatically oxidized to protoporphyrin (Proto) by non-specific oxidases
(Jacobs and Jacobs 1993, Lee et al. 1993). Proto rings are potent photo dynamic molecules which
absorb photons and discharge energy. While in the cytosol, energy absorbed by proto is discharged
into oxygen radicals which initiate a cascade of lipid peroxidation (Jacobs and Jacobs 1993,
Matringe et al. 1989). Lipid peroxidation leads to the destruction of cell membranes and eventual
cell death.
15
Despite their prolonged period of use, resistance to PPO inhibitors is relatively uncommon
in terms of number of resistant species (Heap 2023). The first documented incidence of resistance
was not until 2001 with waterhemp [Amaranthus tuberculatus (Moq.) J.D.Sauer] (Heap 2023,
Patzoldt et al. 2006, Shoup et al. 2003), followed shortly thereafter by common ragweed (Ambrosia
artemissifolia L.) (Heap 2023, Rousonelos et al. 2012). In the past 10 years, there have been 10
new species documented as resistant to PPO inhibitors for 14 resistant species worldwide (Heap
2023). The most prolific and problematic resistant species, particularly in the United States, have
been waterhemp and Palmer amaranth (Amaranthus palmeri S. Wats). Increased incidence of
PPO-inhibitor resistance in these species is primarily due to the increased use of PPO inhibitors in
crops after widespread glyphosate resistance. Further discussion about resistance to PPO inhibitors
can be found later in this review.
1.2 Trifludimoxazin, a New PPO-Inhibiting Herbicide
PPO-inhibiting herbicides are a place of renewed herbicide development interest. With the
introduction of glyphosate-resistant crops in 1996, weed control methods shifted away from
multiple products applied PRE and POST to nearly exclusively glyphosate (Young 2006).
Exclusive use of glyphosate led to a nearly complete halt of investment by the agro-chemical
industry into new herbicide chemistries (Dayan 2019, Duke 2012). As a result, a new herbicide
mechanism of action has not been released in over 25 years. At present, 15 years after the
widespread incidence of glyphosate resistance, there are no new mechanisms of action on the
immediate horizon for corn and soybean use (Dayan 2019). With the increased incidence of
glyphosate resistance, pesticide manufacturers have resorted to releasing existing compounds that
have activity on known herbicide targets that can be effective on glyphosate-resistant weed species.
PPO is a common target site for this purpose (Hao et al. 2011, Meazza et al. 2004). One example
16
is saflufenacil. Saflufenacil is a PPO inhibitor that was brought to market by BASF in 2010 as a
solution to glyphosate resistance in horseweed (Conyza canadensis) (Grossmann et al. 2010,
Kraehmer et al. 2014).
Newer PPO-inhibiting compounds are currently in development. These new PPO-
inhibiting compounds putatively control PPO-inhibitor resistant biotypes (Armel et al. 2017,
Steppig 2022, Witschel et al. 2021). More is currently known about BASF’s compound
trifludimoxazin than other similar PPO inhibitors under development. Trifludimoxazin has PRE
and POST activity and is active on major Midwest weed species including waterhemp, Palmer
amaranth, and giant ragweed (Steppig 2022). It does not have crop selectivity when applied POST,
so use in crops is limited to PRE only at this time. Recent research has confirmed that foliar
applications of trifludimoxazin to PPO-inhibitor resistant waterhemp and Palmer amaranth does
not result in a dose-response shift compared to a susceptible, that is typical of fomesafen or
saflufenacil (Steppig 2022). An in vitro experiment conducted by Porri et al. (2022a) demonstrated
that trifludimoxazin in vitro had only a 10- to 100-fold difference in affinity between resistant and
susceptible PPO2 enzymes, whereas other PPO inhibitors tested had a 10,000+ fold difference in
affinity between susceptible and resistant PPO2 enzymes.
A similar phenomenon occurs with Photosystem II (PSII) inhibitors which all target the Qb
binding site of the D1 protein (Devine et al. 1992). Prior to separation into three herbicide site of
action groups, it was documented that triazine-resistant weed biotypes were also resistant to
triazinone and uracil herbicides, partially resistant to uracils and amides, and more susceptible to
nitrophenols, phenols, and bentazon (Pfister and Arntzen 1979). These classifications correspond
to separation into WSSA groups 5, 6, and 7. If trifludimoxazin binds differently to the target
17
enzymes than other PPO inhibitors, then a reclassification of PPO-inhibiting compounds may be
warranted.
It remains unclear how PRE applications of trifludimoxazin will influence emergence of
PPO-resistant weeds. Previous research by Wuerffel et al. (2015c) indicated that applications of
PPO-inhibiting herbicides PRE to a PPO-inhibitor resistant waterhemp population still provided
some control. However, the length of residual activity is compromised. The reason for partial
control is possibly that herbicide concentrations in the soil where seeds are germinating are
sufficient to control resistant biotypes, but as the herbicide dissipates through the soil profile, the
concentration decreases to a point where resistant seedlings can survive, but susceptible seedlings
cannot survive, which is known as a discriminating dose. Inclusion of an alternative mode of action
may partially reduce selection for resistant plants, but the alternative mode of action must be more
persistent or less soluble in order to be present in sufficient concentration for control. (Mansfield
2021, Westrich 2022, Wuerffel et al. 2015c). Despite this theory, Mansfield (2021) found that
increasing concentration ratio of S-metolachlor did not reduce selection pressure for PPO-resistant
waterhemp even though the S-metolachlor would have been present in sufficient quantity to
control PPO-resistant waterhemp that was the first to emerge. In the same study, saflufenacil
applications increased the frequency of homozygous resistant waterhemp, but not total number of
resistant waterhemp. The mechanism for this phenomenon was not discussed in the thesis. A
trifludimoxazin formulation currently under development is a premix with saflufenacil in a 2:1
saflufenacil to trifludimoxazin ratio. Herbicide premixes typically increase control spectrum and
length of residual in addition to being a resistance management tool (Beckie and Reboud 2009,
Kraehmer et al. 2014). The interaction of saflufenacil combinations with trifludimoxazin or other
PPO inhibitors and the resulting genotypes of emerging plants is unknown.
18
1.3 PPO-Inhibitor Resistance Mutations
Resistance to PPO-inhibiting herbicides was first identified in a Kansas waterhemp
population in 2001 (Shoup et al. 2003). Since confirmation of resistance in waterhemp, PPO-
resistance has been identified in 14 species (Heap 2023). Of those species, waterhemp, common
ragweed, and Palmer amaranth have been subjected to the most research. PPO-inhibitor resistance
in all three species is conferred by mutations in the PPX2 gene (Giacomini et al. 2017, Patzoldt et
al. 2006, Rousonelos et al. 2012, Salas et al. 2016).
Patzolt et al. (2006) elucidated that deletion of glycine at the 210th position conferred
resistance in waterhemp in a bacterial functional complementation assay. This mutation was an
unexpected finding as a deletion event that maintains the reading frame is relatively unusual. The
210th position is part of a short sequence repeat, so deletion of this amino acid is likely a result of
slippage of the DNA replication machinery (Dayan et al. 2010, Patzoldt et al. 2006). Protein-ligand
modeling suggests that deletion of glycine at the 210th position results in the loss of a hydrogen
bond and causes a partial uncoiling of the alpha-8 helix (Dayan et al. 2010). Partial uncoiling
results in a several fold increase in the size of the binding pocket which causes a loss of affinity
for PPO inhibitors without a loss of affinity for protogen.
Common ragweed resistance was also evolved with a mutation in PPX2, but via a R98L
mutation rather than a glycine deletion at position 210 (Rousonelos et al. 2012). The 98th position
was predicted to be a site of herbicide resistance, because the negative charge of the arginine
residue is critical in substrate binding in the target site (Heinemann et al. 2007, Koch et al. 2004).
Analysis of sequence homology of common ragweed and other species indicates that a ΔG210 or
analogous mutation is very unlikely in common ragweed, because it does not have the same short
sequence repeats that would allow a homologous deletion. Given that Palmer amaranth has a very
similar PPX2 sequence and the same intense selection pressures of waterhemp, researchers
19
predicted that it was only a matter of time before Palmer amaranth evolved the same resistance
mutation (Riggins and Tranel 2012). Indeed, Palmer amaranth was confirmed as resistant to PPO
inhibitors in Arkansas via the same ΔG210 mutation (Salas et al. 2016).
PPO-resistant waterhemp and Palmer amaranth are increasingly common (Copeland et al.
2018, Salas et al. 2016, Wuerffel et al. 2015b). However, it was observed that the ΔG210 mutation
did not explain a large number of apparent resistance cases that were being investigated by
diagnostic labs and Extension agents (Copeland et al. 2018, Giacomini et al. 2017, Salas-Perez et
al. 2017). Giacomini et al. (2017) confirmed two new resistance mutations, R128G and R128M,
at the 128th position (equivalent to the 98th position in common ragweed) of PPX2 in Palmer
amaranth. Sequence comparisons of waterhemp and Palmer amaranth indicated that the same R128
mutations found in Palmer amaranth are highly unlikely in waterhemp. The palmer amaranth wild
type codon is AGG whereas the waterhemp wild type codon is AGA. Both codons encode an
arginine, however, a single substitution in the Palmer amaranth sequence can yield ATG, encoding
methionine or GGG, encoding a glycine. While R128G is possible in waterhemp with a single
substitution (AGA to GGA), an R128M mutation or a, R128G mutation with the same codon
would require 2 nucleotide substitutions and is therefore highly unlikely. Interestingly, Nie et al.
(2019) sequenced PPX2 from waterhemp populations across the Midwest and found AGG, GGA,
GGG, AAA, and ATA codons conferring R128G, R128I, and R128K mutations. Only the R128G
and R128I were found to be resistant in a bacterial functional complementation assay. These
unlikely codon sequences as well as unique phenotypes from the respective populations strongly
suggests interspecies hybridization and gene flow with Palmer amaranth and tumble pigweed.
Given the multitude of possibilities for R128 mutations, determining exactly which mutations
confer resistance is of interest. Porri et al. (2022a) tested PPO inhibitors in vitro with all possible
20
substitutions at the 128th position of PPX2. Several mutations resulted in a non-functional protein,
and several mutations resulted in significant resistance. Most recently, a G399A mutation has been
discovered in Palmer amaranth (Rangani et al. 2019). Plant assays indicate that that it confers an
11 to 16-fold resistance to the herbicide fomesafen. Structural modeling indicates that this
resistance SNP causes stearic hindrance of PPO-inhibitor binding.
The ΔG210 mutation has been found to be the most abundant resistance mutation in
waterhemp across the Midwest (80 to 100%) (Nie et al. 2019) whereas Palmer amaranth has a
much lower incidence of the ΔG210 mutation and a higher frequency of other resistance
conferring mutations, such as R128 and G399 (approximately 50 to 70%) (Copeland et al. 2018,
Rangani et al. 2019, Salas-Perez et al. 2017). Reasons for differences in mutation frequency are
unclear. Perhaps there is an unknown fitness penalty in Palmer amaranth but not waterhemp,
leading to its lower frequency. It could also be a result of the near-simultaneous evolution of the
ΔG210 and R128 resistance mutations in Palmer amaranth. PPO-inhibitor resistance was
confirmed in waterhemp in 2001 but not until 2016 in Palmer amaranth, followed by confirmation
of R128 mutations in 2018. Some have suggested that particular PPO-inhibitor chemical families,
relative potencies, or application timings such as PRE or POST select for particular resistance
mutations (Wu et al. 2020). Non-target-site resistance also contributes to PPO-inhibitor resistance.
Varanasi et al. (2018) reported a Palmer amaranth population that is resistant to PPO inhibitors
and does not have any target-site mutations.
Until recently, all known mutations conferring resistance to PPO inhibitors were due to
mutations in the PPX2 gene. Goosegrass [Eleusine indica (L.) Gaertn.], conversely, has evolved
resistance to oxadiazon in turfgrass settings via an A212T mutation in the PPX1 gene (Bi et al.
2019). The fact that the mutation is in PPX1 is unusual and poses many questions due to the fact
21
that both goosegrass and oxadiazon are unique in terms of weed biology and herbicidal
characteristics. Of the few PPO inhibitors labeled for use in turfgrass, only oxadiazon is labeled
for control of grass weeds (McElroy and Martins 2013). Even broad-spectrum PPO inhibitors used
in major row crops do not control grass weeds PRE or POST particularly well (Loux et al. 2022).
Research is lacking on which factors control grass weed selectivity for PPO-inhibiting herbicides.
Oxadiazon is one of the few PPO inhibitors labeled for weed control in turf and is used at a massive
use rate of over 1 kg ha-1 (Anonymous, Ronstar Flo® Herbicide label). Oxadiazon also does not
have a row crop label, so its activity on Amaranthus spp. or common ragweed both resistant and
susceptible, is unknown. Oxadiazon appears to bind differently to PPO2 than other PPO inhibitors
(Rangani et al. 2019). Rangani et al. (2019) included oxadiazon in in vitro PPO2 assays. Oxadiazon
had a resistance factor of 100- to 1000-fold less than that of diphenyl ether herbicides for the
ΔG210 mutation and had a resistance factor of 1 for the R128L mutation. Thus, it remains
unknown if this PPX1 mutation is a result of goosegrass biology, oxadiazon/target-site interactions,
or a combination of the two factors.
1.4 Herbicide Resistance Genotyping Assays
Rapid identification of resistance is critical for effective weed management decisions
(Burgos et al. 2013). Traditional resistance assays are either discriminating dose or dose-response
assays (Burgos et al. 2013, Heap 2020). These assays, particularly full dose-response assays, can
provide robust evidence of resistance. The problem with these assays, however, is the length of
time required to conduct them. First, seeds from a suspected resistant plant must be collected. Then
the seeds must be grown and sprayed in a controlled environment. From the first instance of
suspected resistance to confirmation can take as much as 9 months to a year.
22
Molecular assays offer an alternative to whole plant assays, provided that the particular
resistance mechanism has been identified. Several genotyping assays have been developed that
detect a particular mutation in the DNA, such as single nucleotide polymorphisms (SNP) or
deletion/insertion mutations. A general method known as PCR-RFLP is the most broadly
applicable method (Burgos et al. 2013). A specific method known as derived cleaved amplified
polymorphic sequences (dCAPS) assay is a common resistance assay, and it has been developed
for all of the PPO-resistance mutations in Amaranthus species (Giacomini et al. 2017, Patzoldt et
al. 2006, Rangani et al. 2019). A dCAPS assay functions by allele-specific primers, cleaving a
DNA PCR product. The cleaved fragments are separated via gel electrophoresis. The presence of
particular bands indicates the presence or absence of a mutation. Shortcomings of dCAPS assays
are that they require gel electrophoresis which is relatively low throughput, gel bands can be
ambiguous, and the assay does not reliably distinguish between homozygous and heterozygous
mutants (Wuerffel et al. 2015a).
TaqMan® is a quantitative polymerase chain reaction (qPCR)-based assay that can reliably
distinguish between homozygous and heterozygous mutants. TaqMan® assays function through
binding of a fluorescent probe to a PCR-amplified product. The fluorescence of the probe is
quantified in a special machine hence the name qPCR. TaqMan® assays have been developed for
the ΔG210 mutations in waterhemp and Palmer amaranth. The major disadvantage for the qPCR
assay is access to a qPCR machine which can be costly (Kaundun et al. 2020). Most Recently, A
new PCR-RFLP method named derived Polymorphic Amplified cleaved sequence (DPACS) assay
has been developed for the ΔG210 mutation (Kaundun et al. 2020). Benefits of this system are that
it is broadly applicable to a wider range of species due to longer primer sequences, and it does not
require costly machinery. The same disadvantages of dCAPS are present in this method, so the
23
qPCR-based assay is the most preferred. Other methods for detecting mutations include
pyrosequencing, ELISA, next-generation sequencing, and many others (Barres et al. 2016). The
only other genotyping assay used to my knowledge is Illumina MISEQ Next generation
sequencing (Nie et al. 2019). This method was used to identify novel R128 mutations in waterhemp.
This method potentially could be used to assay resistance for diagnostic purposes if samples are
submitted frequently enough to fill a 96-well tray with samples, otherwise the single sample would
be cost-prohibitive.
Genotype assays are useful only insofar as the frequency of that particular genotype. In the
case of waterhemp and Palmer amaranth, PPO-inhibitor resistance can be caused by 2 or 3 different
mutations, respectively (Nie et al. 2019, Rangani et al. 2019). Therefore, to confirm a resistance
genotype, up to three assays must be run. In addition, a particular genotype is also not necessarily
a phenotype. The presence of a novel resistance mechanism, such as enhanced detoxification or
an uncharacterized polymorphism, renders each genotyping assay less useful. An assay that could
simultaneously detect multiple mutations would be beneficial to laboratories and diagnosticians
for more robust and efficient resistance confirmation. Also of interest would be a mobile assay that
does not require DNA extraction or PCR so that the assay can be more accessible to growers and
agronomists.
1.5 Herbicide Dose Responses
The gold standard for determining plant resistance to herbicides is the whole plant dose-
response assay (Burgos et al. 2013, Seefeldt et al. 1995). A typical herbicide dose-response assay
treats a plant or group of plants to a known dose of herbicide usually expressed as g ai ha-1. The
treatment structure should encompass the entire range of responses from no visible effect to
complete plant death. Data are typically analyzed using log logistic models to derive an ED50 value.
24
ED50 values generated can be lethal dose, but are usually growth reduction expressed as a
percentage of the untreated control. Ultimately, the statistic of interest is the R/S ratio, or the ratio
of ED50 of the resistant population compared to the susceptible population. One of the major
drawbacks of the whole plant dose-response assay is how many factors can influence not only the
ED values, but also the R/S ratio. Multiple research groups report a large variety of resistance
magnitudes to PPO inhibitors in waterhemp and Palmer amaranth (Lillie et al. 2020, Patzoldt et al.
2005, 2006, Rangani et al. 2019, Salas-Perez et al. 2017, Salas et al. 2016, Shoup et al. 2003,
Steppig 2022, Wuerffel et al. 2015b). Explanations for the range of ED50 values are primarily
greenhouse conditions at the time of application and plant size. PPO-inhibitor activity is influenced
heavily by temperature and light intensity, so time of year and sunshine on the day of application
can drastically influence PPO-inhibitor activity (Fausey and Renner 2001, Hatterman-Valenti et
al. 2011, Wichert et al. 1992).
Plant size is the other major influence on dose response (Lillie et al. 2020, Soltani et al.
2016). Plant size has a known influence on herbicide sensitivity because larger plants have greater
detoxification capabilities via CyP450 and GST as well as greater capabilities of absorbing ROS
(Dayan et al. 2019). With increasing plant size also comes an associated increase in leaf area index
(LAI), defined as the ratio of leaf area per unit of ground area covered. For contact herbicides such
as PPO inhibitors, plant coverage is a critical application parameter necessary for an effective
application (Franca et al. 2020). Herbicides applications are broadcast evenly across an area with
little regard for plant size parameters like leaf area index, nodes, or biomass. As a result, a larger
weed is getting a smaller relative dose than a smaller weed. Researchers in other plant protection
disciplines, such as viticulture pathology have experimented with variable dosing based on target
canopy characteristics (Siegfried et al. 2007). Siegfried et al. (2007) was able to develop a LAI
25
adapted dosage for grape fungicides that allows the application of fungicide at reduced rates, that
results in equal disease control as full labeled rates in season long spray programs.
1.6 Biologically Effective Dose
Biologically effective dose (BED) is generally defined as the minimum dose of a chemical
required to elicit a particular response. LD50 and GR50 are examples of biologically effective dose.
BED is the culmination of multiple processes from the molecular to the community level,
beginning with target enzyme kinetics. Enzyme inhibitors mimic an enzyme substrate or product
and block the normal catalysis reaction either transiently or permanently. Substrates and inhibitors
bind to the enzyme through a combination of hydrogen bonds, hydrophilic or hydrophobic
interactions, and charge-charge interactions. A small change in the target-site binding pocket can
have profound changes on BED. For example, a single hydrogen bond has a binding energy of 1
to 3 kcal mol-1, which equates to a 10-fold change in the kinetic parameter ki and a tenfold change
in BED (Fersht et al. 1985, Pace et al. 2014). Most cases of target-site herbicide resistance occur
through amino acid changes in the protein structure that disrupt the molecular interactions listed
above. (Dayan et al. 2010, 2014, Gaines et al. 2020, Patzoldt et al. 2006). Also influencing kinetic
parameters is the abundance of substrate and product interfering with inhibitor binding, and the
quantity of the target enzyme (Strelow et al. 2004). Glyphosate resistance in Palmer amaranth and
waterhemp are well-known examples of herbicide resistance through target-site abundance
(Gaines et al. 2010, Lorentz et al. 2014). To my knowledge, there has been no incidence of
herbicide resistance through altered substrate or product abundances.
Enzyme inhibitors must reach the target enzyme in a quantity necessary to be effective
which is the relevance of absorption, translocation, and detoxification processes in herbicide action.
Absorption and translocation of herbicides is a popular area of study and has profound impacts on
26
herbicide efficacy. The focus of many research groups is to improve absorption and translocation
with manipulation of droplet characteristics and the addition of adjuvants and tank mix partners
(Butts et al. 2018, Franca et al. 2020, Nandula et al. 2007). Other researchers have sought to
understand the environmental factors that influence absorption and translocation such as
temperature, humidity, and water potential, and how those factors interact with the composition of
plant cuticles and vasculature. (Hatterman-Valenti et al. 2011, Matzenbacher et al. 2014).
Herbicide detoxification is another critical aspect of herbicide action, particularly for
resistance and crop selectivity. The primary mechanisms of herbicide detoxification is through
CyP450 and glutathione-S-transferases (GST). These pathways are utilized by both crops and
weeds to survive a herbicide application. While there are several exceptions, detoxification is the
primary means of crop selectivity for herbicides. Detoxification is also a problematic means to
herbicide resistance in several weed species and is anticipated to be a primary concern for herbicide
resistance in the future (Gaines et al. 2020, Jugulam and Shyam 2019, Scarabel et al. 2015).
Herbicide interception is the last determination of BED. Larger leaves will intercept a
greater quantity of herbicide, and overlapping canopies from crop or high weed density will result
in less herbicide interception per plant. Several groups have quantified biologically effective doses
of herbicides and acknowledge that there is a shift with weed size, but no research to date has
related the shift in plant dose response with any parameter related to increasing size (Barker and
Dayan 2020, Hager et al. 2003, Soltani et al. 2016, Steckel et al. 1997). While the dose parameter
of g ha-1 is useful for describing a field scale application, it is inadequate for describing plant
physiology. A model that explains an increase in dose required to control weeds increasing in size
is justified so that future research can more accurately describe plant/herbicide physiology. Also,
emerging technologies will allow for more precise sensing of plant canopies and detecting a pest
27
species. Precision technologies have already been developed that enable a spray boom to spray
herbicide when a weed is detected and to be shut off in the absence of a weed as well as variable
rate application technologies (Hong et al. 2012, Ruixiu Sui et al. 2003, Wen et al. 2019). If a similar
technology were developed that could sense the size or ground cover of a weed, then an adjusted
dose could be applied both higher and lower than the regular labeled rate to enable the most
effective control while using a minimum amount of product.
1.7 Herbicide Effectiveness PRE vs POST
Weed populations resistant to a given herbicide site of action can still be partially managed
with PRE-applications of the respective herbicide group. (Boe 2019, Mansfield 2021, Westrich
2022, Wuerffel et al. 2015c) Length of residual activity is shortened and the frequency of resistant
plants is increased depending on species, herbicide active ingredient, and herbicide rate. It is
unknown if the partial control is a result of relative dose of the herbicide overcoming the resistance
mechanism, or if there is a difference in plant physiology that is altering the susceptibility of the
target plants. Seeds, seedlings, and established plants have very distinctive metabolic activities
compared to established plants (Silva et al. 2017). In addition, germinating seeds are not fully
developed, particularly in the case of plastids, which are where several major herbicide target
enzymes are located (Pyke 1999). Rather than chloroplasts, germinating seeds have proplastids
which develop into chloroplasts. While all shoot apical meristems contain proplastids,
comparatively little of a mature plant’s cells contain proplastids. Research is lacking if the different
metabolic states of emerged plants and seedlings causes a major metabolic shift that explains
partial control, or if relative dose is what is driving the partial control response of PRE-herbicides
on resistant populations.
28
1.8 Natural Selection in Weed Populations
Modern agricultural practices place immense selection pressure on herbicide resistance
evolution. While currently the ΔG210 mutation is the most common PPO-inhibitor resistance
mutation in waterhemp, Palmer amaranth populations are much more diverse in PPO-resistance
mutations (Copeland et al. 2018, Nie et al. 2019, Wuerffel et al. 2015a). It remains unclear if other
mutations are mere novelties or if one of them provides a sufficient fitness benefit that enables it
to overtake ΔG210 as the most widespread resistance mutation. Such a replacement is certainly
possible, especially in Amaranthus species.
Previously, triazine resistance in waterhemp was identified as being caused by a target-site
mutation in the pbsA gene coding for the D1 protein (Foes et al. 1998). More recently, a GST-
based detoxification was determined to be the most common mechanism of triazine resistance (Ma
et al. 2013, Patzoldt et al. 2003, Vennapusa et al. 2018). The S264G mutation associated with
triazine target-site resistance carries a known fitness penalty (Anderson et al. 1996). The spread of
this resistance mechanism is further limited by the fact that the pbsA gene is plastid-encoded, which
presumably limits the spread via only maternal inheritance (Murphy and Tranel 2019). While not
completely analogous to PPO-inhibitor resistance, the previous example demonstrates that a single
resistance mutation or mechanism is likely not the end of resistance evolution.
Some speculate that various resistance mutations are the product of particular selection
pressures, such as PRE vs POST applications or different chemical families (Wu et al. 2020). Wu
et al. (2020) sprayed PPO-inhibitor-resistant Palmer amaranth plants in a greenhouse with full
labeled rates of fomesafen and saflufenacil and conducted PPX2/inhibitor modeling. The
resistance genotypes were the three known PPX2 mutations (ΔG210, R128G, and G399A). Their
conclusion was that fomesafen selects for more diverse mutations because of weaker target-site
binding and that saflufenacil binding to the target site is more robust to the known resistance
29
mutations. Further experiments are necessary to solidify those conclusions, and the selection
pressure of PRE vs POST applications on different resistance genotypes is widely understudied.
Fitness costs are a nebulous subject in the weed science discipline (Keshtkar et al. 2019,
Vila-Aiub et al. 2009). Multiple studies have sought to identify fitness costs of herbicide resistance
traits with limited success in both findings and experimental execution (Vila-Aiub et al. 2009, Wu
et al. 2018). To date, no fitness penalty for PPO-inhibitor resistance has been identified at the
whole plant or community level (Murphy and Tranel 2019, Wu et al. 2018). However, a decrease
in PPO2 activity has been documented for enzymes with resistance mutations. Dayan et al. 2010
reported 10 fold decrease in kcat (turnover number) for PPO2 enzymes with the ΔG210 mutation
(Dayan et al. 2010). (Porri et al. 2022a) similarly reported less enzyme activity in vitro for resistant
enzymes with multiple substitutions in the R128 position. Other groups using in vitro assays are
seeing similar results (Porri et al. 2022b, Rangani et al. 2019).
The apparent lack of fitness cost may be a consequence of multiple isoforms (PPO1 and
PPO2) in shoot tissues (Watanabe et al. 2001). The resistant enzyme may have enough activity to
prevent the toxic accumulation of proto in the cytosol, but in the absence of PPO-inhibiting
compounds, the normal pathway needs are met by PPX1. PPX1 as the main metabolic enzyme
may be a reason that resistance to PPX1 has only been recently documented in goosegrass (Bi et
al. 2019). Any compromise in PPO1 metabolic efficiency may be heavily selected against in nature.
1.9 Organelle Targeting of Plant Enzymes
Subcellular localization of multiple forms of plant isoenzymes play a role in several
herbicide modes of action. For example, plants have two isoforms of glutamine synthetase, the
enzymatic target of the herbicide glufosinate (Castro-Rodríguez et al. 2011, Takano et al. 2020).
Glufosinate primarily targets the plastidial isoform (GS2) (Takano and Dayan 2020). GS2 is also
30
known to have a resistance mutation that confers glufosinate resistance in Lolium perenne L. ssp.
multiflorum (Avila-Garcia et al. 2012). The other isoform, GS1 is localized to the cytosol. the GS
isozymes have different metabolic roles, and their activities vary with plant development in
different organs and cell types (Castro-Rodríguez et al. 2011).
ACCase inhibitor selectivity is determined by the presence of an insensitive ACCase
enzyme in the chloroplast. All plants have ACCase enzymes in both the cytosol and the chloroplast.
The cytosolic enzyme for all plants is approximately 220 kd and is of eukaryotic origin. Grasses
have the 220 kd protein localized to both the plastid and the cytosol, whereas most dicots contain
a 35-kd isoform of ACCase of prokaryotic origin and localized to the plastid (Konishi et al. 1996).
ACCase inhibitors only inhibit the cytosol-localized isoform, and the plastid-localized isoform
remains functional for dicots. Grasses are susceptible to ACCase inhibitors because their single
eukaryotic version of the enzyme is localized to both the cytosol and chloroplasts (Konishi et al.
1996). Evolution of chloroplast targeting was likely necessary to maintain normal pathway
function (Konishi et al. 1996).
PPO inhibitors also have two isoenzymes; PPO1, which is targeted to the plastid, and PPO2
which is targeted to the mitochondria (Lermontova et al. 1997). PPO-inhibiting compounds inhibit
both PPO1 and PPO2 with relatively equal affinity, but PPO1 is understood as the primary target
(Dayan et al. 2018, Matringe et al. 1992). Despite PPO1 being the primary herbicide target, the
most widespread resistance mechanisms to PPO inhibitors are mutations in the mitochondrial
isoform of the gene, PPX2 (Nie et al. 2019, Patzoldt et al. 2006, Rangani et al. 2019). Therefore,
the PPO2 enzyme clearly plays a major role in the mechanism of action that has not been fully
investigated. Dual targeting of PPO2 to both the mitochondria and the plastid in resistant species
may contribute to the herbicide resistance mechanism. Dual targeting of PPO2 is known to occur
31
in spinach and Arabidopsis (Watanabe et al. 1998, Zybailov et al. 2008). Evidence for Arabidopsis
PPO2 dual targeting is from LCMS identification of the enzyme from chloroplast extracts
(Zybailov et al. 2008). In spinach, dual targeting occurs via multiple in-frame initiation codons
leading to synthesized proteins of different size being targeted to different organelles. The different
size proteins are due to a 30 amino acid extension to the 5’ sequence. If synthesis begins at the
first initiation codon, the long form of the gene is transcribed, and a 57 kd protein is synthesized
and targeted to the plastid. If transcription begins at the second initiation codon, a 55 kd protein is
synthesized and targeted to the mitochondria (Watanabe et al. 2001).
Several plant species exhibit multiple in-frame initiation codons separated by
approximately 30 aa in their PPX2 sequence including potato, maize, waterhemp, and Palmer
amaranth, so it seems likely that PPO2 is dual targeted to both the plastid and mitochondria in all
plants. Experimental evidence is needed to confirm that PPO2 is truly dual-targeted in all plants.
Common ragweed gene sequence has not been fully determined at the 5’ end, so it is unknown if
common ragweed PPO2 protein has multiple in-frame initiation codons (Rousonelos et al. 2012).
Proteins can be targeted in other ways, however. Some proteins rely on ambiguous signals that
export proteins different compartments with equal affinity (Kunze and Berger 2015). Dual
targeting to multiple plant organelles is more common than previously thought, with many genes
being targeted to both organelles in a sample (Dayan et al. 2014, Xu et al. 2013). The evolutionary
function of this phenomenon is not well understood.
1.10 PPO-Pathway Control and Flux
The fact that the PPX2 gene has evolved most resistance mutations thus far indicates that
the PPO2 enzyme is more involved in the PPO-inhibitor mechanism of action than previously
thought. Knowledge is lacking about the interaction of the two enzymes in situ, and whether
32
presence of resistant PPO enzyme in one organelle or the other is sufficient to confer resistance to
PPO inhibitors.
Most isoenzymes have some distinct tissue expression, subcellular localization, or
functional difference, such as the examples mentioned previously. However, plant PPOs seem to
be unique in that they are both expressed in the plastid and apparently perform the same function
(Watanabe et al. 2001). The normal PPO1 is present as well as the dual targeted mitochondrial
isoform which appears to be redundant in the plastid. It is plausible that PPO enzymes facilitate
the partitioning of tetrapyrrole precursors into their final end product (Sobotka et al. 2008). Proto
can go on to be catalyzed into heme via the enzymes ferrochelatase 1 (FC1) and ferrochelatase 2
(FC2), or chlorophyll via Mg chelatase (MGC) (Hey et al. 2016, Yaronskaya et al. 2002).
Ferrochelaase 1 and 2 are homodimers whereas Mg-chelatase is a heterotrimer encoded by 3 genes
(Axelsson et al. 2006, Scharfenberg er al. 2015).
Intuitively, MGC is localized to the plastid to produce chlorophyll, however the
relationship between FC1 and FC2 is more complex. FC2 is localized to the plastid. Heme
produced by FC2 is associated with hemoproteins related to photoprotection and photosynthetic
machinery. Whereas FC1 is associated with maintenance role hemoproteins (Espinas et al. 2016).
There is some disagreement in the literature regarding the localization of FC1, however the most
recent evidence suggests that it is localized to both the mitochondria and the plastid, but mostly
limited to the chloroplast (Chow et al. 1997, Dyer 2018, Lister et al. 2001, Masuda et al. 2003). It
is unknown to what degree flux is partitioned into each of the downstream enzymes and in what
organelles.
Jacobs and Jacobs (1995) are often cited in weed science literature where they
demonstrated that isolated chloroplasts export up to 50% of detectable protogen in the absence of
33
an inhibitor which suggests that a large portion of pathway flux is processed through the
mitochondria. This could be evidence of pathway partitioning. They suggested that protogen and
proto are transported out of the plastid and toward the mitochondria via a porphyrin carrier protein
similar to what has been identified in animals and humans (Hamza and Dailey 2012). However,
this was prior to the knowledge of dual targeting of PPO2 to both organelles which begs the
question of why the plant would export highly toxic compounds if the remainder of the pathway
is localized in the plastid, including downstream steps from PPO2.
A porphyrin transporter has been identified in Arabidopsis that supports the hypothesis that
large quantities of proto and protogen are exported from the chloroplast. AtABC1 encodes a
plastid-targeted ABC transporter (Møller et al. 2001). Arabidopsis mutants with a defect in the
gene ABC1 accumulate proto and have deficiencies in light signaling. Overexpression of this gene
in wild type Arabidopsis reduces proto accumulation after flumioxazin application (Møller et al.
2001). Homologous genes have not been well characterized in weed species. A homologous gene
in weed or crop species could contribute to PPO-inhibitor selectivity or resistance. ABC
transporters are known to contribute to the metabolism of xenobiotics. One such transporter has
been implicated in the glyphosate-resistance mechanism in horseweed (Ge et al. 2010, Tani et al.
2015). Plastid-targeted ABC transporters have also been patented by industry for conferring
herbicide resistance in crops.
PPO inhibitors cause buildup of protoporphyrinogen which leaks out and is converted to
protoporphyrin outside of the plastid and causes phytotoxicity (Jacobs and Jacobs 1993). Resistant
PPO enzymes prevent protoporphyrinogen buildup, but metal chelatase enzymes must process the
protoporphyrin to prevent too much from accumulating, or phytotoxicity would still occur (Kim
et al. 2014, Yaronskaya et al. 2002). Mg- and Fe-chelatases are the next step in chlorophyll and
34
heme biosynthesis. Overexpression of these enzymes are known to confer PPO resistance in crop
plants (Kim et al. 2014). Overexpression in weed species would possibly assist in prevention of
phytotoxicity by eliminating excess protoporphyrin and preventing production of ROS.
The compound 2,2’ bipyridine has been shown to be an iron chelator (Hendry and Stobart
1978). Treating barley plants with 2,2’ bipyridine has been shown to cause a decline in the cell’s
heme pool, increase flux through the porphyrin synthesis pathway, and increase synthesis of Mg-
chelated intermediates (Duggan and Gassman 1974). Such a compound may be useful in
combination with PPO inhibitors. PPO-inhibitor action depends on the accumulation of proto, so
an increase in pathway flux would theoretically render plants more susceptible to PPO inhibitors.
Its utility could be more useful in PPX2-resistant weeds. If localization to the mitochondria is an
important factor in PPO resistance, then there must be a diversion of the PPO pathway toward
heme synthesis because only the heme portion of the pathway occurs in the mitochondria. An
increase in heme synthesis as a result of PPO-inhibitor application coupled with blockage of iron
chelatase activity from iron chelation induced by 2,2-bipyridine may render PPO-inhibitor-
resistant biotypes susceptible.
Herbicide synergism as a method to overcome resistance has occurred before with target-
site triazine resistance. Co-application of HPPD-inhibiting herbicides such as mesotrione in
combination with atrazine results in synergistic effects. Even in triazine resistant biotypes, the
treated plants exhibit PSII inhibitor symptomology rather than characteristic bleaching that occurs
with HPPD-inhibiting herbicides (Walsh et al. 2012, Woodyard et al. 2009). The synergism occurs
because HPPD is an enzyme in the pathway for synthesizing plastoquinone (Ma et al. 2013). The
inhibition of 4 HPPD causes a depletion of plastoquinone which shifts the kinetic parameters of
atrazine binding to the Qb binding site (Woodyard et al. 2009). If the previously theorized
35
mechanism of PPO-pathway flow is accurate, then the combination of 2,2-bipyridine with PPO
inhibitors would be considered herbicide synergy and would be a viable innovation for the control
of resistant biotypes.
1.11 Summary
PPO inhibitors are among the most versatile and valuable chemical weed control tools in
global agriculture. Resistance to these compounds, especially in Amaranthus species threatens
their long-term utility. While the genetic basis for target-site resistance to PPO inhibitors is well
characterized, the variability of the resistance phenotype is noteworthy. Several likely contributing
factors have been identified in the weed science and plant physiology literature such as PPO-
inhibitor chemical family, variability in the PPO-pathway expression and flux, and interaction of
the two isoenzyme target sites. First, knowledge of how novel PPO inhibitors such as
trifludimoxazin affect control and selection for resistant biotypes will aid in the management of
problematic populations. Second, variability in how the PPO pathway is expressed and how much
pathway flux is utilized can vary by species, population, and plant life stage. Predicting and
manipulating pathway abundance and throughput can potentially assist with the control of resistant
populations by overwhelming or overcoming the resistance mechanism. Finally, PPO inhibitors
target two different isoenzymes. The presumed primary herbicide target is the chloroplast localized
isoform. However, this understanding is greatly complicated by the fact that most target-site
mutations conferring PPO-inhibitor resistance are in the gene for mitochondrial isoform, which
may be targeted to both the chloroplast and mitochondria. Knowledge of exactly which protein is
targeted by PPO-inhibiting herbicides and in which organelles can aid in the future development
of more specific inhibitor molecules.
36
1.12 Justification of Research
The use of PPO-inhibiting herbicides has increased as a response to glyphosate resistance
and will continue to increase with growing utilization of PRE and POST PPO-inhibiting herbicides.
Selection for novel PPO-inhibitor-resistant biotypes is occurring in waterhemp and Palmer
amaranth and threatens the long-term utility of PPO inhibitors. Given the recent proliferation of
novel resistant genotypes, a comparison of novel resistance biotypes with ΔG210 biotype is
justified to determine the cause of selection and to anticipate the loss of utility of PPO-inhibiting
herbicides as new biotypes spread. Novel PPO inhibitors, particularly trifludimoxazin, are
currently under development that are able to control PPO-inhibitor-resistant Amaranthus species.
We currently do not know how the use of these products, both PRE and POST, will influence the
selection for known and unknown resistance mechanisms. Understanding how resistance will
develop for new herbicide products is crucial for pesticide stewardship, product value, and benefit
to the end users. Finally, non-target-site resistance is a growing threat to the utility of PPO-
inhibiting herbicides. Previous research indicates that it may be present as a partial resistance
mechanism or an independent cause of resistance to PPO inhibitors in waterhemp. Investigations
into particular populations are justified to confirm the presence or absence of non-target-site
resistance mechanisms to PPO inhibitors in waterhemp. These investigations of PPO-inhibiting
herbicides and PPO-resistant biotypes will help to preserve the utility of PPO inhibitors, predict
future resistance developments, and contribute to broader knowledge about resistance evolution.
1.13 Literature Cited
Anonymous (2021) Ronstar® FLO herbicide product label. Cary, NC: Bayer Environmental
Science
37
Anderson DD, Higley LG, Martin AR, Roeth FW (1996) Competition between triazine-resistant
and -susceptible common waterhemp (Amaranthus rudis). Weed Sci 44:853–859
Armel GR, Hanzlik K, Witschel M, Hennigh DS, Bowe S, Simon A, Liebl R, Mankin L (2017)
Trifludimoxazin: a new PPO inhibitor that controls PPO resistant weed biotypes. In
Proceedings of the Weed Science Society of America Annual Meeting. Tuscon, AZ:
Weed Science Society of America
Avila-Garcia WV., Sanchez-Olguin E, Hulting AG, Mallory-Smith C (2012) Target-site mutation
associated with glufosinate resistance in Italian ryegrass (Lolium perenne L. ssp. multiflorum).
Pest Manag Sci 68:1248–1254
Axelsson E, Lundqvist J, Sawicki A, Nilsson S, Schröder I, Al-Karadaghi S, Willows RD, Hansson

M (2006) Recessiveness and dominance in barley mutants deficient in Mg-chelatase subunit
D, an AAA protein involved in chlorophyll biosynthesis. Plant Cell 18:3606–3616
Barker A, Dayan F (2020) The physiological basis of differential resistance to PPO-inhibiting

herbicides used pre- and post-emergent. in Proceedings of the Weed Science Society of
America Annual Meeting. Maui, HI: Weed Science Society of America
Barres B, Micoud A, Corio-Costet MF, Debieu D, Fillinger S, Walker AS (2016) Trends and
challenges in pesticide resistance detection. Trends Plant Sci 21:834-853
Beckie HJ, Reboud X (2009) Selecting for weed resistance: Herbicide rotation and mixture. Weed
Technol 23:363–370
Bi B, Wang Q, Coleman JJ, Porri A, Peppers JM, Patel JD, Betz M, Lerchl J, McElroy JS (2019)
A novel mutation A212T in chloroplast Protoporphyrinogen Oxidase (PPO1) confers
resistance to PPO inhibitor oxadiazon in Eleusine indica. Pest Manag Sci:76:1786–1794
Boe JE (2019) Establishing the value of ALS-inhibiting herbicides in fields with confirmed weed
resistance to ALS-inhibiting herbicides. MS thesis. West Lafayette IN: Purdue University.
190 p
Burgos NR, Tranel PJ, Streibig JC, Davis VM, Shaner D, Norsworthy JK, Ritz C (2013) Review:
confirmation of resistance to herbicides and evaluation of resistance levels. Weed Sci 61:4–
20
38
Butts TR, Samples CA, Franca LX, Dodds DM, Reynolds DB, Adams JW, Zollinger RK, Howatt
KA, Fritz BK, Clint Hoffmann W, Kruger GR (2018) Spray droplet size and carrier volume
effect on dicamba and glufosinate efficacy. Pest Manag Sci 74:2020–2029
Castro-Rodríguez V, García-Gutiérrez A, Canales J, Avila C, Kirby EG, Cánovas FM (2011) The

glutamine synthetase gene family in Populus. BMC Plant Biol 11:119
Chow KS, Singh DP, Roper JM, Smith AG (1997) A single precursor protein for ferrochelatase-I
from Arabidopsis is imported in vitro into both chloroplasts and mitochondria. J Biol Chem
272:27565–27571
Copeland JD, Giacomini DA, Tranel PJ, Montgomery GB, Steckel LE (2018) Distribution of
PPX2 mutations conferring PPO-inhibitor resistance in Palmer amaranth populations of
Tennessee. Weed Technol 32:592–596
Czarnecki O, Gläßer C, Chen JG, Mayer KFX, Grimm B (2012) Evidence for a contribution of
ALA synthesis to plastid-to-nucleus signaling. Front Plant Sci 3:236
Dayan FE (2019) Current status and future prospects in herbicide discovery. Plants (Basel,
Switzerland) 8:341
Dayan FE, Barker A, Dayan L, Ravet K (2019) The role of antioxidants in the protection of plants
against inhibitors of protoporphyrinogen oxidase. React Oxyg Species 7:55–63
Dayan FE, Barker A, Tranel PJ (2018) Origins and structure of chloroplastic and mitochondrial
plant protoporphyrinogen oxidases: implications for the evolution of herbicide resistance.
Dayan FE, Daga PR, Duke SO, Lee RM, Tranel PJ, Doerksen RJ (2010) Biochemical and
structural consequences of a glycine deletion in the α-8 helix of protoporphyrinogen oxidase.
Biochim Biophys Acta - Proteins Proteomics 1804:1548–1556
Dayan FE, Owens DK, Tranel PJ, Preston C, Duke SO (2014) Evolution of resistance to phytoene
desaturase and protoporphyrinogen oxidase inhibitors - state of knowledge. Pest Manag Sci
70:1358–1366
Devine M, Duke SO, Fedtke C, ed (1992) Physiology of herbicide action. Englewood Cliffs, New
Jersey, USA: PTR Prentice Hall 441 p
39
Duggan J, Gassman M (1974) Induction of porphyrin synthesis in etiolated bean leaves by
chelators of iron. Plant Physiol 53:206–215
Duke SO (2012) Why have no new herbicide modes of action appeared in recent years? Pest
Manag Sci 68:505–512
Dyer WE (2018) Exploiting weed seed dormancy and germination requirements through
agronomic practices 1. Weed Sci 43:498–503
Espinas NA, Kobayashi K, Sato Y, Mochizuki N, Takahashi K, Tanaka R, Masuda T (2016)

Allocation of heme is differentially regulated by ferrochelatase isoforms in arabidopsis cells.
Front Plant Sci 7:1326
Fausey JC, Renner KA (2001) Environmental effects on CGA-248757 and flumiclorac

efficacy/soybean tolerance. Weed Sci 49:668–674
Fersht AR, Shi JP, Knill-Jones J, Lowe DM, Wilkinson AJ, Blow DM, Brick P, Carter P, Waye
MMY, Winter G (1985) Hydrogen bonding and biological specificity analysed by protein
engineering. Nature 314:235–238
Foes MJ, Tranel PJ, Wax LM, Stoller EW (1998) A biotype of common waterhemp (Amaranthus
rudis) resistant to triazine and ALS herbicides. Weed Sci 46:514–520
Franca LX, Dodds DM, Butts TR, Kruger GR, Reynolds DB, Mills JA, Bond JA, Catchot AL,
Peterson DG (2020) Evaluation of optimal droplet size for control of Palmer amaranth
(Amaranthus palmeri) with acifluorfen. Weed Technol 34:511–519
Gaines TA, Duke SO, Morran S, G Rigon CA, Tranel PJ, Küpper A, Dayan FE (2020) Mechanisms
of evolved herbicide resistance J Biol Chem 295:10307–10330
Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL, Nissen SJ, Patzoldt WL,
Tranel PJ, Culpepper AS, Grey TL, Webster TM, Vencill WK, Sammons RD, Jiang J, Preston
C, Leach JE, Westra P (2010) Gene amplification confers glyphosate resistance in
Amaranthus palmeri. Proc Natl Acad Sci U S A 107:1029–1034
Ge X, André d’Avignon D, Ackerman JJH, Douglas Sammons R (2010) Rapid vacuolar

sequestration: The horseweed glyphosate resistance mechanism. Pest Manag Sci 66:345–348
40
Giacomini DA, Umphres AM, Nie H, Mueller TC, Steckel LE, Young BG, Scott RC, Tranel PJ
(2017) Two new PPX2 mutations associated with resistance to PPO-inhibiting herbicides in
Amaranthus palmeri. Pest Manag Sci 73:1559–1563
Grossmann K, Niggeweg R, Christiansen N, Looser R, Ehrhardt T (2010) The herbicide

saflufenacil (kixorTM) is a new inhibitor of protoporphyrinogen IX oxidase activity. Weed Sci
58:1–9
Hager AG, Wax LM, Bollero G a, Stoller EW (2003) Influence of diphenylether herbicide
application rate and timing on common waterhemp (Amaranthus rudis) control in soybean
(Glycine max). Weed Technol 17:14–20
Hamza I, Dailey HA (2012) One ring to rule them all: Trafficking of heme and heme synthesis
intermediates in the metazoans Biochim Biophys Acta 1823:1617–1632
Hao GF, Zuo Y, Yang S-G, Yang G-F (2011) Protoporphyrinogen oxidase inhibitor: An ideal
target for herbicide discovery. Chim Int J Chem 65:961–969
Hatterman-Valenti H, Pitty A, Owen M (2011) Environmental effects on velvetleaf (Abutilon

theophrasti) epicuticular wax deposition and herbicide absorption. Weed Sci 59:14–21
Heap I (2020) Criteria for confirmation of herbicide-resistant weeds with specific emphasis on
confirming low level resistance
Heap I (2023) International survey of herbicide resistant weeds. http://www.weedscience.org.

Accessed March 25, 2023
Heinemann IU, Diekmann N, Masoumi A, Koch M, Messerschmidt A, Jahn M, Jahn D (2007)

Functional definition of the tobacco protoporphyrinogen IX oxidase substrate-binding site.
Biochem J 402:575–80
Hendry GAF, Stobart AK (1978) Effect of 2,2′-bipyridyl on porphyrin synthesis in etiolated and
light-treated barley leaves. Phytochemistry 17:671–674
Hey D, Ortega-Rodes P, Fan T, Schnurrer F, Brings L, Hedtke B, Grimm B (2016) Transgenic

tobacco lines expressing sense or antisense FERROCHELATASE 1 RNA show modified
ferrochelatase activity in roots and provide experimental evidence for dual localization of
ferrochelatase 1. Plant Cell Physiol 57:2576–2585
41
Hong S, Minzan L, Zhang Q (2012) Detection system of smart sprayers: Status, challenges, and
perspectives. Int J Agric Biol Eng 5:10–23
Jacobs JM, Jacobs NJ (1993) Porphyrin accumulation and export by isolated barley (Hordeum
vulgare) plastids: Effect of diphenyl ether herbicides. Plant Physiol 101:1181–1188
Jacobs JM, Jacobs NJ (1995) Terminal enzymes of heme biosynthesis in the plant plasma
membrane. Arch Biochem Biophys 323:274–278
Jugulam M, Shyam C (2019) Non-target-site resistance to herbicides: recent developments. Plants

8:417
Kaundun SS, Hutchings S, Marchegiani E, Rauser R, Jackson L V (2020) A derived polymorphic

amplified cleaved sequence assay for detecting the Δ210 PPX2L codon deletion conferring
target‐site resistance to protoporphyrinogen oxidase‐inhibiting herbicides. Pest Manag Sci
76:789–796
Keshtkar E, Abdolshahi R, Sasanfar H, Zand E, Beffa R, Dayan FE, Kudsk P (2019) Assessing
fitness costs from a herbicide-resistance management perspective: A review and insight.
Weed Sci 67:137–148
Kim JG, Back K, Lee HY, Lee HJ, Phung TH, Grimm B, Jung S (2014) Increased expression of
Fe-chelatase leads to increased metabolic flux into heme and confers protection against
photodynamically induced oxidative stress. Plant Mol Biol 86:271–287
Koch M, Breithaupt C, Kiefersauer R, Freigang J, Huber R, Messerschmidt A (2004) Crystal

structure of protoporphyrinogen IX oxidase: a key enzyme in haem and chlorophyll
biosynthesis. EMBO J 23:1720–1728
Konishi T, Shinohara K, Yamada K, Sasaki Y (1996) Acetyl-CoA carboxylase in higher plants:

Most plants other than gramineae have both the prokaryotic and the eukaryotic forms of this
enzyme. Plant Cell Physiol 37:117–122
Kraehmer H, Van Almsick A, Beffa R, Dietrich H, Eckes P, Hacker E, Hain R, John Strek H,
Stuebler H, Willms L (2014) Herbicides as weed control agents: State of the Art: II. Recent
achievements. Plant Physiol 166:1132–1148
42
Kunze M, Berger J (2015) The similarity between N-terminal targeting signals for protein import
into different organelles and its evolutionary relevance. Front Physiol 6:259
Lee HJ, Duke M V., Duke SO (1993) Cellular localization of protoporphyrinogen-oxidizing

activities of etiolated barley (Hordeum vulgare L.) leaves: Relationship to mechanism of
action of protoporphyrinogen oxidase-inhibiting herbicides. Plant Physiol 102:881–889
Lermontova I, Kruse E, Mock HP, Grimm B (1997) Cloning and characterization of a plastidal
and a mitochondrial isoform of tobacco protoporphyrinogen IX oxidase. Proc Natl Acad Sci
U S A 94:8895–8900
Lillie KJ, Giacomini DA, Tranel PJ (2020) Comparing responses of sensitive and resistant
populations of Palmer amaranth (Amaranthus palmeri) and waterhemp (Amaranthus
tuberculatus var. rudis) to PPO inhibitors. Weed Technol. 34: 140–146. doi:
10.1017/wet.2019.84
Lister R, Chew O, Rudhe C, Lee MN, Whelan J (2001) Arabidopsis thaliana ferrochelatase-I and
-II are not imported into Arabidopsis mitochondria. FEBS Lett 506:291–295
Lorentz L, Gaines TA, Nissen SJ, Westra P, Strek HJ, Dehne HW, Ruiz-Santaella JP, Beffa R
(2014) Characterization of glyphosate resistance in Amaranthus tuberculatus populations. J
Agric Food Chem 62:8134–8142
Loux MM, Doohan D, Dobbels AF, Johnson WG, Young BG, Legleiter TR, Hager A (2022) Weed
Control Guide for Ohio, Indiana and Illinois
Ma R, Kaundun SS, Tranel PJ, Riggins CW, McGinness DL, Hager AG, Hawkes T, Mc EI,
Riechers DE (2013) Distinct detoxification mechanisms confer resistance to mesotrione and
atrazine in a population of waterhemp. Plant Physiol 163:363–377
Maneli MH, Corrigall A V, Klump HH, Davids LM, Kirsch RE, Meissner PN (2003) Kinetic and
physical characterisation of recombinant wild-type and mutant human protoporphyrinogen
oxidases. Biochim Biophys Acta 1650:10–21
Mansfield BC (2021) Characterization of protoporphyrinogen oxidase (PPO) herbicide resistance

in tall waterhemp (Amaranthus tuberculatus). MS thesis. West Lafayette IN: Purdue
University. 158 p
43
Masuda T, Suzuki T, Shimada H, Ohta H, Takamiya K (2003) Subcellular localization of two
types of ferrochelatase in cucumber. Planta 217:602–609
Matringe M, Camadro JM, Labbe P, Scalla R (1989) Protoporphyrinogen oxidase as a molecular

target for diphenyl ether herbicides. Biochem J 260:231–235
Matringe M, Camadroll JM, Block MA, Joyards J, Scallall R, Labbe P, Douces R (1992)
Localization within chloroplasts of protoporphyrinogen oxidase, the target enzyme for
diphenylether-like herbicides J Biol Chem 267:4646–4651
Matzenbacher FO, Vidal RA, Merotto Jr. A, Trezzi MM (2014) Environmental and physiological
factors that affect the efficacy of herbicides that inhibit the enzyme protoporphyrinogen
oxidase: a literature review. Planta Daninha 32:457–463
McElroy JS, Martins D (2013) Use of herbicides on turfgrass. Planta Daninha 31:455–467
Meazza G, Bettarini F, La Porta P, Piccardi P, Signorini E, Portoso D, Fornara L (2004) Synthesis

and herbicidal activity of novel heterocyclic protoporphyrinogen oxidase inhibitors. Pest
Manag Sci 60:1178–1188
Møller SG, Kunkel T, Chua NH (2001) A plastidic ABC protein involved in intercompartmental
communication of light signaling. Genes Dev 15:90–103
Murphy BP, Tranel PJ (2019) Target-site mutations conferring herbicide resistance. Plants 8:382
Nandula VK, Poston DH, Reddy KN, Koger CH (2007) Formulation and adjuvant effects on
uptake and translocation of clethodim in bermudagrass (Cynodon dactylon) Weed Sci 55:6–
11
Nie H, Mansfield BC, Harre NT, Young JM, Steppig NR, Young BG (2019) Investigating target‐
site resistance mechanism to the PPO‐inhibiting herbicide fomesafen in waterhemp and
interspecific hybridization of Amaranthus species using next generation sequencing. Pest
Manag Sci 75:3235–3244
Pace CN, Fu H, Fryar KL, Landua J, Trevino SR, Schell D, Thurlkill RL, Imura S, Scholtz JM,
Gajiwala K, Sevcik J, Urbanikova L, Myers JK, Takano K, Hebert EJ, Shirley BA, Grimsley
GR (2014) Contribution of hydrogen bonds to protein stability. Protein Sci 23:652–661
44
Park J, Ahn YO, Nam J-W, Hong M-K, Song N, Kim T, Yu G-H, Sung S-K (2018) Biochemical
and physiological mode of action of tiafenacil, a new protoporphyrinogen IX oxidase-
inhibiting herbicide. Pestic Biochem Physiol 152:38–44
Patzoldt WL, Dixon BS, Tranel PJ (2003) Triazine resistance in Amaranthus tuberculatus (Moq)
Sauer that is not site-of-action mediated. Pest Manag Sci 59:1134–1142
Patzoldt WL, Hager AG, McCormick JS, Tranel PJ (2006) A codon deletion confers resistance to
herbicides inhibiting protoporphyrinogen oxidase. Proc Natl Acad Sci U S A 103:12329–
12334
Patzoldt WL, Tranel PJ, Hager AG (2005) A waterhemp (Amaranthus tuberculatus) biotype with
multiple resistance across three herbicide sites of action. Weed Sci 53:30–36
Pfister K, Arntzen CJ (1979) The mode of action of photosystem II-specific inhibitors in herbicide-
resistant weed biotypes Z Naturforsch 34:996–1009
Porri A, Betz M, Seebruck K, Knapp M, Johnen P, Witschel M, Aponte R, Liebl R, Tranel PJ,
Lerchl J (2022a) Inhibition profile of trifludimoxazin towards PPO2 target site mutations.
Porri A, Noguera MM, Betz M, Sälinger D, Brändle F, Bowe SJ, Lerchl J, Meyer L, Knapp M,
Roma-Burgos N (2022b) Can double PPO mutations exist in the same allele and are such
mutants functional? Pest Manag Sci 78:2258–2264
Pyke KA (1999) Plastid division and development. Plant Cell 11:549–556
Ramanujam VMS, Anderson KE (2015) Porphyria diagnostics-part 1: A brief overview of the

porphyrias. Curr Protoc Hum Genet:17.20.1–17.20.26
Rangani G, Salas-Perez RA, Aponte RA, Knapp M, Craig IR, Mietzner T, Langaro AC, Noguera
MM, Porri A, Roma-Burgos N (2019) A novel single-site mutation in the catalytic domain of
Protoporphyrinogen Oxidase IX (PPO) confers resistance to PPO-inhibiting herbicides. Front
Plant Sci 10:568
Riggins CW, Tranel PJ (2012) Will the Amaranthus tuberculatus resistance mechanism to PPO-
inhibiting herbicides evolve in other Amaranthus species? Int J Agron 2012:305764
45
Rousonelos SL, Lee RM, Moreira MS, VanGessel MJ, Tranel PJ (2012) Characterization of a
common ragweed (Ambrosia artemisiifolia) population resistant to ALS- and PPO-inhibiting
herbicides. Weed Sci 60:335–344
Ruixiu Sui, J. Alex Thomasson, Jeffrey L. Willers, F. Paul Lee, Rui Wang (2003) Variable-rate
spray system dynamic evaluation. in Proceedings of the 2003 ASAE Annual Meeting. Las
Vegas, NV: American Society of Agricultural and Biological Engineers
Salas-Perez RA, Burgos NR, Rangani G, Singh S, Paulo Refatti J, Piveta L, Tranel PJ,
Mauromoustakos A, Scott RC (2017) Frequency of gly-210 deletion mutation among
protoporphyrinogen oxidase inhibitor–resistant Palmer amaranth (Amaranthus palmeri)
populations. Weed Sci 65:718–731
Salas RA, Burgos NR, Tranel PJ, Singh S, Glasgow L, Scott RC, Nichols RL (2016) Resistance
to PPO-inhibiting herbicide in Palmer amaranth from Arkansas. Pest Manag Sci 72:864–869
Scarabel L, Pernin F, Délye C (2015) Occurrence, genetic control and evolution of non-target-site
based resistance to herbicides inhibiting acetolactate synthase (ALS) in the dicot weed
Papaver rhoeas. Plant Sci 238:158–169
Scharfenberg M, Mittermayr L, Von Roepenack-Lahaye E, Schlicke H, Grimm B, Leister D,

Kleine T (2015) Functional characterization of the two ferrochelatases in Arabidopsis
thaliana. Plant Cell Environ 38:280–298
Seefeldt SS, Jensen JE, Patrick Fuerst E (1995) Log-logistic analysis of herbicide dose-response
relationships. Weed Technol 9:218–227
Shoup DE, Al-Khatib K, Peterson DE (2003) Common waterhemp (Amaranthus rudis) resistance
to protoporphyrinogen oxidase-inhibiting herbicides. Weed Sci 51:145–150
Siegfried W, Viret O, Huber B, Wohlhauser R (2007) Dosage of plant protection products adapted
to leaf area index in viticulture. Crop Prot 26:73–82
Silva AT, Ligterink W, Hilhorst HWM (2017) Metabolite profiling and associated gene expression
reveal two metabolic shifts during the seed-to-seedling transition in Arabidopsis thaliana.
Plant Mol Biol 95:481–496
46
Sobotka R, McLean S, Zuberova M, Hunter CN, Tichy M (2008) The C-terminal extension of
ferrochelatase is critical for enzyme activity and for functioning of the tetrapyrrole pathway
in Synechocystis strain PCC 6803. J Bacteriol 190:2086–2095
Soltani N, Nurse RE, Sikkema PH (2016) Biologically effective dose of glyphosate as influenced
by weed size in corn. Can J Plant Sci 96:455–460
Steckel GJ, Wax LM, Simmons FW, Phillips II WH (1997) Glufosinate efficacy on annual weeds
is influenced by rate and growth stage. Weed Technol 11:484–488
Steppig NR (2022) Evaluation of trifludimoxazin, a new protoporphyrinogen oxidase- inhibiting

herbicide, for use in soybean. PhD dissertation West Lafayette, IN: Purdue University. 172p
Strelow J, Dewe W, Iversen PW, Brooks HB, Radding JA, McGee J, Weidner J (2004) Mechanism
of action assays for enzymes. Assay Guidance Manual. Eli Lilly & Company and the National
Center for Advancing Translational Sciences
Takano HK, Beffa R, Preston C, Westra P, Dayan FE (2020) A novel insight into the mode of
action of glufosinate: how reactive oxygen species are formed. Photosynth Res 144:361–372
Takano HK, Dayan FE (2020) Glufosinate‐ammonium: a review of the current state of knowledge.
Tani E, Chachalis D, Travlos IS (2015) A glyphosate resistance mechanism in Conyza canadensis

involves synchronization of EPSPS and ABC-transporter genes. Plant Mol Biol Report
33:1721–1730
Varanasi VK, Brabham C, Norsworthy JK (2018) Confirmation and characterization of non-target

site resistance to fomesafen in Palmer amaranth (Amaranthus palmeri). Weed Sci 66:702–
709
Vennapusa AR, Faleco F, Vieira B, Samuelson S, Kruger GR, Werle R, Jugulam M (2018)
Prevalence and mechanism of atrazine resistance in waterhemp (Amaranthus tuberculatus)
from Nebraska. Weed Sci 66:595–602
Vila-Aiub MM, Neve P, Powles SB (2009) Fitness costs associated with evolved herbicide
resistance alleles in plants. New Phytol 184:751–767
47
Walsh MJ, Stratford K, Stone K, Powles SB (2012) Synergistic effects of atrazine and mesotrione
on susceptible and resistant wild radish (Raphanus raphanistrum) populations and the
potential for overcoming resistance to triazine herbicides. Weed Technol 26:341–347
Watanabe N, Che FS, Iwano M, Takayama S, Nakano T, Yoshida S, Isogai A (1998) Molecular
characterization of photomixotrophic tobacco cells resistant to protoporphyrinogen oxidase-
inhibiting herbicides 1
Watanabe N, Che FS, Iwano M, Takayama S, Yoshida S, Isogai A (2001) Dual targeting of spinach
protoporphyrinogen oxidase II to mitochondria and chloroplasts by alternative use of two in-
frame initiation codons. J Biol Chem 276:20474–20481
Wen S, Zhang Q, Yin X, Lan Y, Zhang J, Ge Y (2019) Design of plant protection UAV variable
spray system based on neural networks. Sensors 19:1112
Westrich BC (2022) Influence of mesotrione, ALS-inhibitor resistance, and self incompatability

on giant ragweed management in soybean. PhD dissertation West Lafayette, IN: Purdue
University. 189 p
Wichert RA, Bozsa R, Talbert RE, Oliver LR (1992) Temperature and relative humidity effects
on diphenylether herbicides. Weed Technol 6:19–24
Witschel M, Aponte R, Armel G, Bowerman P, Mietzner T, Newton T, Porri A, Simon A, Seitz T

(2021) Tirexor®—design of a new resistance breaking protoporphyrinogen IX oxidase
inhibitor. Recent Highlights Discov Optim Crop Prot Prod:501–509
Woodyard AJ, Hugie JA, Riechers DE (2009) Interactions of mesotrione and atrazine in two weed
species with different mechanisms for atrazine resistance. Weed Sci 57:369–378
Wu C, Davis AS, Tranel PJ (2018) Limited fitness costs of herbicide-resistance traits in

Amaranthus tuberculatus facilitate resistance evolution. Pest Manag Sci 74:293–301
Wu C, Goldsmith MR, Pawlak J, Feng P, Smith S, Navarro S, Perez-Jones A (2020) Differences

in efficacy, resistance mechanism and target protein interaction between two PPO inhibitors
in Palmer amaranth (Amaranthus palmeri). Weed Sci 68:105–115
48
Wuerffel RJ, Young JM, Lee RM, Tranel PJ, Lightfoot DA, Young BG (2015a) Distribution of
the ΔG210 protoporphyrinogen oxidase mutation in Illinois waterhemp (Amaranthus
tuberculatus) and an improved molecular method for detection. Weed Sci 63:839–845
Wuerffel RJ, Young JM, Matthews JL, Young BG (2015b) Characterization of PPO-inhibitor–
resistant waterhemp (Amaranthus tuberculatus) response to soil-applied PPO-inhibiting
Wuerffel RJ, Young JM, Tranel PJ, Young BG (2015c) Soil-residual protoporphyrinogen oxidase–
inhibiting herbicides influence the frequency of associated resistance in waterhemp
(Amaranthus tuberculatus). Weed Sci 63:529–538
Xu L, Carrie C, Law SR, Murcha MW, Whelan J (2013) Acquisition, conservation, and loss of
dual-targeted proteins in land plants. Plant Physiol 161:644–662
Yaronskaya EB, Rassadina V V., Averina NG (2002) Regulation of magnesium chelatase activity
during excessive accumulation of porphyrins in green barley leaves. Russ J Plant Physiol
49:771–776
Young BG (2006) Changes in herbicide use patterns and production practices resulting from
glyphosate-resistant crops. Weed Technol 20:301–307
Zybailov B, Rutschow H, Friso G, Rudella A, Emanuelsson O, Sun Q, Van Wijk KJ (2008) Sorting
signals, N-terminal modifications and abundance of the chloroplast proteome. PLoS One
3:e1994
49
Diphenyl ether N-Phenyl-Triazolinone
Fomesafen Lactofen Acifluorfen Sulfentrazone Carfentrazone
N-Phenyl-imide N-Phenyl-
50
oxadiazolinone
Flumioxazin Trifludimoxazin Saflufenacil Butafenacil Oxadiazon
Figure 1.1. Names and structure of PPO-inhibiting herbicide molecules commonly mentioned in the literature.
Figure 1.2. Tetrapyrrole synthesis pathway as presented in (Czarnecki et al. 2012) Abbreviations:
ALAD, ALA dehydratase; CAO, Chl a oxygenase; CBR, chlorophyll b reductase; ChlS,
chlorophyll synthase; CPO, coproporphyrinogen III oxidase; DVR, divinyl protochlorophyllide
reductase; FeCh, Fe chelatase; FLU, flourescent; GluRS, glutamyl-tRNA synthetase; GluTR,
glutamyl-tRNA reductase; GluTRBP, GluTR binding protein; GSAT, glutamate-1-semialdehyde
aminotransferase; HBS, hydroxymethylbilane synthase; HCAR, 7-hydroxymethyl chlorophyll a
reductase; HO, heme oxygenase; MgCh, Mg chelatase; MTF, Mg protoporphyrin IX
methyltransferase; PBS, phytochromobilin synthase; POR, light dependent NADPH-
protochlorophyllide oxidoreductase; PPOX, protoporphyrinogen IX oxidase; UROD,
uroporphyrinogen III decarboxylase; UROM, uroporphyrinogen III methyltransferase; UROS,
uroporphyrinogen III synthase. Colors represent different organelle localizations.
51
ARE PRE-APPLIED PPO INHIBITORS SELECTING
FOR NEW RESISTANCE MUTATIONS IN WATERHEMP
(AMARANTHUS TUBERCULATUS)?
Short title: ΔG210 vs R128G
2.1 Abstract
The PPO inhibitors are a valuable group of herbicides that provide soil and foliar control of
glyphosate-resistant Amaranthus species. The ΔG210 mutation in the waterhemp PPX2 gene
confers PPO-inhibitor resistance and has been common in the Midwest for more than a decade.
While most PPO-inhibitor resistance in waterhemp is attributable to the ΔG210 mutation, R128
mutations have recently been identified in several populations of waterhemp throughout the
Midwest. Given the already widespread distribution and the broad cross resistance of the ΔG210
mutation, it is unclear why R128 mutations would evolve so much later in waterhemp. We
hypothesized that either the soil-applied PPO inhibitor use pattern or specific active ingredients
that are applied primarily preemergence are selecting for novel mutations conferring resistance to
PPO inhibitors. We conducted a series of dose-response experiments with flumioxazin,
sulfentrazone, fomesafen, oxadiazon, saflufenacil and trifludimoxazin applied preemergence to
greenhouse flats containing waterhemp seeds homozygous for ΔG210, R128G, and susceptible
PPX2 alleles. Both the R128G and ΔG210 mutations exhibited resistance for all herbicides tested
including trifludimoxazin. The greatest resistance ratio was for fomesafen (20- to 37-fold)
followed by saflufenacil (10 to 15-fold). All other herbicides had resistance ratios less than 9 for
both mutations. Sulfentrazone was the only herbicide for which the R128G mutation conferred
greater resistance (R/S = 8.8) than did the ΔG210 mutation (R/S = 4.2). The R128G mutation in
52
waterhemp was not more robust than the ΔG210 mutation with respect to conferring resistance to
PPO inhibitors applied preemergence; and this research does not support a hypothesis that the
R128G mutation was selected using the soil-applied PPO inhibitors. Furthermore, there is no
evidence that the commercial efficacy of PPO inhibitors applied preemergence will diminish any
further as a result of the R128G mutation increasing in frequency, relative to the what has been
realized with the ΔG210 mutation.
Nomenclature: Waterhemp, Amaranthus tuberculatus (Moq.) J.D.Sauer, flumioxazin, fomesafen,
oxadiazon, saflufenacil, sulfentrazone, trifludimoxazin
Key words: PPO-inhibitor resistance, target-site resistance, ΔG210 mutation, R128G mutation,
resistance selection
2.2 Introduction
Protoporphyrinogen IX oxidase (PPO)-inhibiting herbicides are an important class of
herbicides used worldwide that provide preemergence (PRE) and postemergence (POST) weed
control in a variety of crops (Hao et al. 2011). Despite the fact that they have been used since the
1960s, resistance to PPO inhibitors is relatively uncommon in terms of the number of resistant
species (Heap 2023). The first documented incidence of resistance was not until 2001, in
waterhemp [Amaranthus tuberculatus (Moq.) J.D.Sauer] (Heap 2023, Shoup et al. 2003) followed
shortly thereafter by common ragweed (Ambrosia artemisiifolia L.) (Rousonelos et al. 2012). In
the past 10 years, there have been 9 new species documented as resistant to PPO inhibitors and a
total of 13 resistant species worldwide (Heap 2023). The most prolific and problematic resistant
species in the United States have been waterhemp and Palmer amaranth (Amaranthus palmeri S.
Wats) (Van Wychen 2022). Increased incidence of PPO-inhibitor resistance in these species is
53
primarily due to the increased use of PPO inhibitors in crops as a result of widespread glyphosate
resistance (Green and Owen 2010, Legleiter et al. 2009, Young 2006).
Plants have two nuclear genes (PPX1 and PPX2) that encode for two distinct PPO enzymes
(PPO1 and PPO2) (Lermontova et al. 1997). PPO1 is localized to the chloroplast while PPO2 is
dual targeted to both the plastid and the mitochondria (Watanabe et al. 2001). Prior to the evolution
of resistance, there has been a widespread assumption that PPO1 is the primary target of PPO
inhibitors (Dayan et al. 2018, Lee et al. 1993). However, mutations in the PPX2 gene actually
confer the vast majority of PPO-inhibitor resistance in several species (Giacomini et al. 2017,
Mendes et al. 2020, Patzoldt et al. 2006, Rousonelos et al. 2012, Salas et al. 2016). Table 2.1
describes the PPX2 resistance mutations in waterhemp and Palmer amaranth that have been
discovered to date. Patzoldt et al. (2006) determined that a glycine deletion at the 210th position
(ΔG210) conferred resistance in waterhemp. Different models suggest that deletion of glycine at
the 210th position results in altered geometry of the binding pocket resulting in reduced inhibitor
binding affinity (Dayan et al. 2010, Noguera et al. 2021). Palmer amaranth was confirmed as
resistant to PPO inhibitors in Arkansas via the same ΔG210 mutation (Salas et al. 2016). Shortly
thereafter, Giacomini et al. (2017) confirmed two new resistance mutations, R128G and R128M,
at the 128th position of PPO2 in Palmer amaranth (equivalent to R98 in common ragweed).
Interestingly, Nie et al. (2019) sequenced PPX2 from waterhemp populations across the
Midwest and found multiple codons, previously unknown to be present in waterhemp, coding for
R128G, R128I, and R128K. Only the R128G and R128I were found to be resistant in bacterial
functional complementation assays. These unlikely codon sequences indicate that waterhemp
PPX2 wild type alleles are more diverse than previously observed. Most recently a G399A
54
mutation was found in an Arkansas Palmer amaranth population, indicating that there is still active
selection for new PPO-inhibitor resistant biotypes (Rangani et al. 2019).
Most instances of herbicide resistance in Amaranthus species are conferred by single
mutations or at least single mechanisms that are widespread across the United States (Murphy and
Tranel 2019). There are several known instances of multiple mutations or mechanisms of
resistance to the same herbicide being present in the same species (Bell et al. 2013, Chatham et al.
2015, Patzoldt and Tranel 2007, Schultz et al. 2015, Vennapusa et al. 2018). In all cases, there is
a known fitness benefit of one of the two existing resistance mutations in either the presence or
absence of herbicide selection (Cahoon et al. 2022, Patzoldt and Tranel 2007, Vila-Aiub et al. 2009,
Wu et al. 2018).
Why new mutations are being selected despite the relative abundance of the ΔG210
mutation has not been elucidated. One possible explanation is a fitness penalty conferred by the
ΔG210 mutation. A fitness penalty is the loss of competitiveness of the resistant biotype in the
absence of herbicide selection, leading to eventual decline of allele frequency in the population.
To date, there is no evidence of a fitness penalty conferred by the ΔG210 mutation at the whole
organism level (Wu et al. 2018).
Potentially, these new PPX2 mutations are accumulating in the same plants and having
additive effects. In a survey of Palmer amaranth for PPO-inhibitor resistance, the most highly
resistant populations possessed two or even three resistance alleles in the same population
(Noguera et al. 2021). Other modeling and in vitro experiments indicate that PPX2 double mutants
are more resistant than single mutants (Porri et al. 2022a). However, double mutants appear to
have a severe fitness penalty compared to single mutants (Porri et al. 2022b). For example,
Noguera et al. (2021) only observed 32 plants, out of thousands that were genotyped, with 2
55
resistance mutations in the same allele. Porri et al. (2022b) found that ΔG210 and R128G double
mutant alleles can only exist as a heterozygote because of a severe loss of enzyme activity.
Therefore, with the present set of known resistance mutations, mutation accumulation is not greatly
contributing to selection of novel resistance mutations.
A potential explanation for why new resistance mutations are being selected is the change
in PPO-inhibitor use patterns. Prior to the commercialization of glyphosate-resistant soybeans in
1996, POST PPO inhibitors such as lactofen, acifluorfen, and fomesafen were applied to
approximately 25% of soybean hectares (USDA NASS 1994). As growers increasingly adopted
multiple glyphosate applications as their primary weed control practice, glyphosate resistance
began to emerge in key weed species and spread throughout the entire United States from
approximately 2005 to 2010 (Legleiter and Bradley 2008, Young 2006). As a result, growers
resumed use of PPO inhibitors for control of glyphosate-resistant species, but with greater adoption
of PRE applications (USDA NASS 2020, Legleiter et al. 2009). PRE applications are significant
because weed seedlings receive a greater relative herbicide dose, and the PPO-inhibiting herbicide
active ingredients are different for PRE products and POST products. Flumioxazin, sulfentrazone,
and saflufenacil are the most common PRE herbicides used in soybean, with nationwide usage
between 9% and 20% for each compound, and even greater regional usage for some active
ingredients (USDA NASS 2020). Fomesafen is still a commonly used herbicide used both POST
and PRE on 20% of soybean hectares, and is the only herbicide that has been used extensively in
both the 1990s and the present (USDA NASS 1994, USDA NASS 2020).
Herbicide resistance is not the complete insensitivity to the herbicide, but rather a shift of
the dose-response curve. The potency of an herbicide is typically quantified using the ED50 statistic,
the dose of herbicide required to reduce growth by 50% (Burgos et al. 2013). The amount of curve
56
shift, or magnitude of resistance, is quantified with an R/S ratio. R:S ratios are calculated by
dividing the ED50 of the resistant biotype by the ED50 of the susceptible biotype. Each PPO
inhibitor has a unique R/S ratio for any given herbicide, which can vary by population. Reported
resistance ratios can be very different between research groups depending on variables measured,
experimental design, and growing conditions during the experiments. However, one consistent
observation is that the magnitude of resistance to lactofen and acifluorfen is typically much greater
than that of other PPO inhibitors (Lillie et al. 2020, Patzoldt et al. 2005, Shoup et al. 2003, Wuerffel
et al. 2015a). PPO-inhibitor resistance was first confirmed in waterhemp in 2001, shortly after a
period when lactofen, acifluorfen, and fomesafen were the most common PPO inhibitors in use
(Shoup et al. 2003). In contrast, R128 mutations were identified in waterhemp and Palmer
amaranth during a period when sulfentrazone, flumioxazin, saflufenacil, and fomesafen were the
most widely used PPO-inhibiting herbicides. To date there has not been a published direct
comparison of PPO-inhibitor resistance conferred by the ΔG210 and R128 mutations in either a
PRE or POST experiment for any PPO-inhibiting herbicides other than fomesafen. The objective
of this research was to determine if PPO inhibitors applied PRE select for the R128G more so than
for the ΔG210 mutation in waterhemp, which would be indicated by a greater magnitude of
resistance.
2.3 Materials and Methods
A series of greenhouse dose-response experiments were conducted to compare the PPO-
inhibitor resistance phenotypes conferred by the ΔG210 and R128G mutations in waterhemp for
soil-applied herbicides. The herbicides flumioxazin, fomesafen, saflufenacil, sulfentrazone,
trifludimoxazin, and oxadiazon were used to characterize PPO-inhibitor resistant (PPO-R)
57
waterhemp response to common soil-applied PPO inhibitors as well as unique PPO inhibitors with
unknown effects on resistant biotypes.
Biotypes homozygous for ΔG210, R128G, and susceptible PPX2 alleles were used. The
two resistant biotypes were sourced from a single population of waterhemp from Gibson County,
IN collected in 2016. Multiple individuals with homozygous alleles for ΔG210 and R128G were
identified via sanger sequencing and allowed to cross pollinate in isolation to increase seed
quantity and obtain pure lines with the desired genotype. The susceptible population was sourced
from a field population in Vigo County, IN collected in 2016 as part of a multi-state waterhemp
survey. Greenhouse experiments as well as genotyping data have confirmed that all individuals
are susceptible to the herbicide fomesafen and do not contain any known resistance-conferring
mutations (Mansfield 2021).
Seeds of each biotype were scarified with a 10% sodium hypochlorite solution. After
drying completely, 200 seeds were placed in a vial, then stored at 4C until planting within 24 hours.
The seeds were planted in square 10 cm by 10 cm plastic pots filled with 450 ml of pulverized
sandy-loam soil (pH 7, 3.2% OM) wetted to field capacity. The seeds were covered with another
50 ml of soil which corresponded to seed coverage of approximately 5 mm. Pots were again
watered to field capacity. To protect against soil borne pathogens, all pots were treated with a 10
ml drench of mefonoxam (Subdue Maxx, Syngenta Crop Protection, LLC, Greensboro, NC) at a
rate of 1 mg mefonoxam pot-1 (Wuerffel et al. 2015a).
Six PPO-inhibiting herbicides that are commonly used for soil-residual control were
applied to each pot using a track-mounted research sprayer (Generation III Research Sprayer,
DeVries Manufacturing, Hollandale, MN) calibrated to deliver 140 L ha-1 of spray solution at 207
kPa with an even-fan XR8002 nozzle (TeeJet Technologies, Glendale Heights, IL). Each herbicide
58
was applied at six rates in addition to a 0 g ai ha-1 rate in a log3 dosing structure. Rates were selected
based on previous research by Bi et al. (2019), Lillie et al. (2020), Steppig (2022), and Wuerffel
et al. (2015a). Herbicides and doses utilized for each experiment are shown in Table 2.2. After
application, herbicide treatments were incorporated into the soil profile via overhead irrigation
calibrated to deliver 1 cm of water. Soil moisture was maintained by placing pots into individual
plastic dishes and sub-irrigating with 80 ml of water when surface dryness occurred approximately
every other day (Harder et al. 2012, Lillie et al. 2020, Wuerffel et al. 2015a).
Waterhemp emergence was enumerated at 7 and 14 days after treatment (DAT).
Waterhemp control was assessed at 7 and 14 DAT on a 0 to 100% scale with 0 indicating no
reduction in waterhemp growth and emergence and 100 indicating complete waterhemp control.
Also at 14 DAT, waterhemp aboveground biomass was clipped at the soil surface and dried at 60C
prior to weighing. Data were converted to a percentage of the non-treated and used to fit non-linear
regression models using the DRC package in R studio 4.1.2 (Knezevic et al. 2007, Ritz et al. 2015).
Emergence data were used to fit Weibul type I models (Equation 1).
𝑓(𝑥) = 0 + (𝑑 − 0)𝑒𝑥𝑝 (−𝑒𝑥𝑝(𝑏(𝑙𝑜𝑔(𝑥) − 𝑒))) [1]
where b is the slope of the curve, , d is the upper asymptote, and e is the herbicide rate required to
produce 50% emergence reduction (i.e. LD50 value), using the drc package in R software v. 3.6.2
(Ritz et al. 2015). Biomass data were used to fit log logistic models (Equation 2).
𝑑
𝑓(𝑥) = [2]
1+exp (𝑏(log(𝑥)−log (𝑒)))
where b is the slope of the curve, d is the upper asymptote, and e is the herbicide rate required to
produce 50% biomass reduction (i.e. GR50 value), also using the drc package in R software v. 3.6.2
(Ritz et al. 2015). For both models, data were pooled over experimental runs after validating lack
of run interactions with ANOVA.
59
2.4 Results and Discussion
Calculated LD50 (emergence) and GR50 (biomass) values are shown in Table 2.3. Based on
weed emergence, the R128G and ΔG210 biotypes produced a significant resistance ratio for all
herbicides (p<0.05), with RG210/S ratios between 2.9 and 20 and RR128/S ratios between 2.5 and 37
(Table 2.4). Conversely, not all resistance ratios were significant for the biomass data with RG210/S
ratios of 1.1 to 3.9 and RR128/S ratios from 0.9 to 5.2. The GR50 values are the preferred statistic to
report resistance in POST experiments because growth reduction is a direct measure of herbicidal
activity. On the other hand, GR is an inferior way to measure PRE activity compared to LD because
it is not a direct measure of herbicide activity like LD. The following discussion will focus on LD
models because they are the most powerful and indicative of the true herbicide response observed
during these experiments. GR models generally showed similar trends, but with less power and
some spurious results that do not correlate with emergence or visual control data.
2.4.1 Flumioxazin
The two resistance mutations conferred a similar, low level of resistance to flumioxazin at
2.9 to 3.8-fold (Figure 2.1, Table 2.4). Fitted LD50 values were 3.9, 11, and 15 g ha-1 from the
susceptible, ΔG210, and R128G biotypes, respectively (Table 2.3). Our resistance ratio for ΔG210
is similar to that observed by Patzoldt et al. (2005), slightly lower than Lillie et al. (2020) and
substantially lower than Wuerffel et al. (2015a). These results fail to support our hypothesis
because flumioxazin is one of the most commonly used PRE herbicides in soybean production. If
flumioxazin was a major contributor to R128 mutation evolution and spread, then we would expect
a greater magnitude of resistance from R128 mutations toward flumioxazin. Because the two
mutations confer relatively equal resistance and flumioxazin is widely used in locations where
60
resistance is evolving, we find it very unlikely that the new mutations have been preferentially
selected by flumioxazin more so than other PPO herbicides applied PRE or POST.
2.4.2 Fomesafen
Waterhemp resistance to fomesafen was the greatest of all herbicides with 20 to 37-fold
resistance ratios (Figure 2.2, Table 2.4). The resistance ratio of 20 for the ΔG210 mutation is
slightly lower than that observed by Lillie et al. (2020) and Wuerffel et al. (2015a), who evaluated
PRE activity of fomesafen, but greater than Patzolt et al. (2005), Shoup et al. (2003), and Mansfield
(2021) who evaluated only POST activity. Given that fomesafen is used as both a PRE and POST
herbicide, had the greatest observed resistance in the present study, and is widely in U.S. soybean
production, we conclude that selection for R128 mutations was likely influenced by fomesafen
applications and not by other PRE PPO inhibitors (NASS 2020). This is somewhat surprising since
precedent in herbicide resistance literature would predict that a single resistance mutation would
dominate a geographical area, and the ΔG210 biotype predated the R128 biotype by a decade (Nie
et al. 2019, Shoup et al. 2003). Due to a hormetic response in the R128G biotype observed only
with fomesafen applications, it is difficult to determine the true difference in resistance between
ΔG210 and R128G biotypes for this herbicide. However, previous experiments (Steppig 2022,
Steppig et al. 2017) demonstrate that fomesafen elicits greater resistance response from R128G
than ΔG210 in POST dose-response experiments.
2.4.3 Oxadiazon
Both waterhemp biotypes had a significant resistance ratio in response to oxadiazon with
resistance ratios of 7.4 for ΔG210 and 2.5 for R128G (Figure 2.3, Table 2.4). The ΔG210 mutation
did confer a greater resistance to oxadiazon than the R128G mutation (2.9-fold). This result is
61
similar to PPO2 enzyme kinetic data that showed in vitro that PPO2 with the ΔG210 mutation had
a resistance ratio of 151, whereas a R128L mutation had a resistance factor of only 1 (Rangani et
al. 2019). However, the current experiment used waterhemp with an R128G mutation whereas the
in vitro experiment utilized an R128L mutation, so the resistance factor of R128G in vitro is not
entirely known.
Oxadiazon is a PRE PPO-inhibiting herbicide used for control of annual grasses in turfgrass
(Anonymous 2021). Oxadiazon is not used in soybean or labeled for control of waterhemp, so the
effect of PPO-inhibitor resistance mutations in the PPX2 gene on oxadiazon efficacy has not been
previously tested. It was included in this experiment because goosegrass [Eleusine indica (L.)
Gaertn.], a labeled target weed, has evolved resistance to oxadiazon (McElroy et al. 2017).
Goosegrass resistance to oxadiazon is unique in that it involves a mutation in the PPX1 gene rather
than the PPX2 gene, as has been observed in other species (Bi et al. 2019). It is unknown if
evolution of PPX1 mediated resistance is a consequence of goosegrass biology, oxadiazon-enzyme
interaction, or a combination of other factors.
These results may provide some insight as to why goosegrass evolved resistance via a
PPX1 mutation. The evolution of the ΔG210 mutation is only likely in a minority of species and
may not be possible in goosegrass (Dayan et al. 2018). Furthermore, our observed resistance to
oxadiazon conferred by the R128G mutation was low level (2.5-fold). A PPX1 mutation may have
been necessary to confer a sufficient selective advantage. If this is the case, then we can expect an
increase in resistance conferring mutations in the PPX1 gene in Amaranthus or other weedy
species as growers increase the use of previously under-utilized PPO inhibitors or novel PPO
inhibitors that are soon to be commercialized. (Porri et al. 2022a, Witschel et al. 2021).
62
2.4.4 Saflufenacil
Resistance to saflufenacil was second only to fomesafen with resistance ratios of 10 to 14
(Table 2.4, Figure 2.4). These results are very different from Steppig (2022) who only observed
R/S ratios of 1.3 to 1.9 in an identical PRE experiment and ratios of 2.0 to 2.4 in a POST
experiment using the same populations. The only other experiment utilizing a saflufenacil dose
response is Wu et al. (2020) who reported a 2.6 to 3-fold resistance in a POST experiment on
Palmer amaranth. However, their model was fitted with visual control estimates and did not have
a sufficiently low dose range to avoid extrapolation of a large portion of the dose-response curve.
2.4.5 Sulfentrazone
Resistance to sulfentrazone was 4.2-fold for ΔG210 and 8.8 for R128G (Table 2.4, Figure
2.5). Sulfentrazone is the only herbicide that appears to support our hypothesis in that it is the only
herbicide where R128G conferred a greater magnitude of resistance than ΔG210 (R128G/ΔG210
ratio of 2.1). Such an observation is odd considering that the R128 mutations are also present in
Palmer amaranth and at a greater frequency than in waterhemp, yet growers in the Mid-South
region of the United States use very little sulfentrazone. We conclude that greater observed
resistance to sulfentrazone by plants with the R128G mutation is likely more of a coincidence than
a major influence in the selection for the R128G mutation. Especially considering that the
maximum observed resistance ratio was 8.8 for sulfentrazone compared to 20 to 30 for fomesafen.
Despite being an unlikely cause of resistance selection, the observed difference in resistance is
potentially meaningful for resistance selection and efficacy in the field.
63
2.4.6 Trifludimoxazin
Both R biotypes exhibited resistance to trifludimoxazin of 2.4 to 3.5-fold (Figure 2.6, Table
2.4). This observation was similar to Steppig (2022) who observed resistance ratios of 1.5 to 2.5
in an identical experiment. This observation was unexpected, because trifludimoxazin is purported
to control resistant biotypes equally well as susceptible biotypes due to unique target enzyme
binding properties (Porri et al. 2022a, Steppig 2022, Witschel et al. 2021). An in-vitro experiment
by Porri et al. (2022a) showed that ΔG210 PPO2 protein had only a 7-fold resistance (IC50) to
trifludimoxazin compared to the wild type compared to a resistance factor of over 1000 for
saflufenacil, lactofen, and fomesafen. This translates to ΔG210 and R128G waterhemp biotypes
not having resistance in a POST dose-response experiment (Steppig 2022). Our observed
resistance to trifludimoxazin is very similar to flumioxazin which has a very similar molecular
structure (Asher et al. 2021, Shaner 2014). Given these apparently contradictory results, it is
unclear how field applications of trifludimoxazin will affect the spread of PPO resistance. If
trifludimoxazin truly does not elicit a resistance response then field applications may not select for
target-site resistance just like a herbicide of a different site of action (Wuerffel et al. 2015b).
2.4.7 Variance in Observed Resistance
Direct comparisons between resistance bioassay results from different research groups,
especially for resistance ratios, requires scrutiny of the differences in the experimental methods
and plant materials. First, exact experimental conditions can never be replicated. Plant response to
herbicides can vary due to differences in growing medium, greenhouse temperature, time of year,
and light regime (Schafer et al. 2012, Wichert et al. 1992). Further, the plant response to herbicides
is so variable that comparisons in terms of absolute dose, such as g ha-1, are nearly meaningless.
64
This is especially true when comparing field experiments to greenhouse experiments and when
using a recommended herbicide use rate as a benchmark in a greenhouse experiment.
Because magnitude of resistance is a more stable indicator of resistance phenotype, the
most valuable parameter for evaluating resistance is the R/S ratio (Burgos et al. 2013). Even so,
R/S ratios reported in the literature are quite variable and difficult to compare, especially for PPO-
inhibiting herbicides (Lillie et al. 2020, Rangani et al. 2019, Shoup et al. 2003, Steppig 2022,
Wuerffel et al. 2015a). Even our own methods repeated with the same populations and similar
dose structure resulted in very different observed R/S ratios (Steppig 2022). The factors that
contribute to a R/S ratio are the enzyme kinetic effects conferred by the mutation of interest, as
well as quantitative traits that influence herbicide efficacy of both resistant and susceptible plants.
In an ideal scenario, dose-response assays would be conducted on near isogenic lines that are
homozygous resistant and susceptible. However, in wild, obligate outcrossing species such as
waterhemp and Palmer amaranth, generating isogenic lines is impossible in any reasonable amount
of time. The next best option, which is still intensive, is selecting resistant and susceptible F1
individuals from a cross and using F3 seeds homozygous at the gene of interest for experiments.
Such a strategy would reduce plant to plant variance, but population level variance would still be
present. However, producing these lines is superior because it isolates the effect of the resistance
mutation and controls for minor, quantitative genes that could influence herbicide susceptibility.
Because of the difficulty of generating pure lines, published results are often a comparison of an
unrelated susceptible population compared to the resistant population.
The lack of consistency in reported resistance to PPO inhibitors suggests that there is some
underlying covariate has contributed to the magnitude of resistance and has a variable influence
by population and/or environment. To date, there has been no evidence of either reactive oxygen
65
species (ROS) scavenging or PPO-protein expression level as contributors to PPO resistance
(Mansfield 2021, Barker and Dayan 2020, Montgomery et al. 2021). One potential contributing
factor is herbicide detoxification. Soybean varieties are known to have differential PPO-inhibitor
metabolism capabilities (Dayan et al. 1997). Waterhemp and Palmer amaranth have also been
shown to be resistant in the absence of target-site resistance mutations indicating the high
likelihood of metabolic resistance (Noguera et al. 2021, Obenland et al. 2019, Varanasi et al. 2018).
There are several examples of target-site and non-target-site resistance co-occurring in the same
plants, so it is possible that herbicide detoxification is a major contributor to population level PPO-
inhibitor response (Alcántara-de la Cruz et al. 2016, Hatami et al. 2016, Kaundun 2010, Rey-
Caballero et al. 2017).
2.4.8 Practical Implications
One point of consideration in resistance selection is the number of obstacles before
reproduction. The most noticeable cases of herbicide resistance are to POST applications, because
they are often the final selection event for a weed in a field. In contrast, PRE herbicides will usually
have a POST herbicide application of a different mode of action prior to a weed being able to
reproduce. Current recommendations for growers are to utilize herbicide programs in which a PRE
herbicide is followed by a planned POST herbicide in combination with an overlapping residual
herbicide (Norsworthy et al. 2012). For troublesome Palmer amaranth and waterhemp populations,
a zero-tolerance approach is recommended where growers should not allow a single weed to
produce seed in their fields where resistant plant are either confirmed or suspected (Norsworthy et
al. 2014). Given these current resistance management recommendations, the risk of herbicide
resistance to PRE herbicides broadly has been low because of effective POST herbicide
technologies. However, this current state is fragile and actively degrading. To date there is
66
confirmation of glufosinate resistant Palmer amaranth and several reports of herbicide failure and
resistance to dicamba and 2,4-D in waterhemp (Bobadilla et al. 2022, Priess et al. 2022, Shergill
et al. 2018).
The PPO inhibitors used PRE have maintained a high level of utility when used on PPO-
inhibitor resistant populations, especially when used in combination with other modes of action
(Falk et al. 2006, Umphres et al. 2018, Wuerffel et al. 2015b). Based on the present study, there is
little evidence that the utility of PPO inhibitors applied PRE will diminish any further as the R128
mutation increases in frequency. Furthermore, waterhemp or other plants that have both mutations
may not pose a serious threat to PPO-inhibitor effectiveness either. A heterozygous plant will
likely exhibit an intermediate response, and a double mutant allele with both the R128 and ΔG210
mutation carries a significant fitness penalty if the enzyme is functional at all (Noguera et al. 2021,
Porri et al. 2022b, Steppig et al. 2017).
To mitigate PPO-inhibitor resistance, a farmer should exchange diphenyl-ether herbicides
(lactofen, fomesafen, and acifluorfen) for other effective POST and overlapping residual
applications, particularly herbicides from HRAC Groups 4, 10, and 15. While switching to non-
PPO-inhibiting herbicides is ideal to stop the spread of resistance, PRE PPO inhibitors can still be
part of a weed management program and can help to reduce total seedbank populations. In
conclusion, the R128G mutation in waterhemp is not substantially different from the ΔG210
mutation with respect to resistance. PPO inhibitors are still partially effective PRE and growers
must steward these products to prolong their utility in weed management programs. Further
investigations are warranted to explain trifludimoxazin resistance selection and the variability of
PPO-inhibitor resistance.
67
Anonymous (2021) Ronstar® FLO herbicide product label. Cary, NC: Bayer Environmental
Science
Alcántara-de la Cruz R, Fernández-Moreno PT, Ozuna C V., Rojano-Delgado AM, Cruz-Hipolito
HE, Domínguez-Valenzuela JA, Barro F, de Prado R (2016) Target and non-target site
mechanisms developed by glyphosate-resistant hairy beggarticks (Bidens pilosa L.)
populations from Mexico. Front Plant Sci 7:1492
Asher BS, Dotray PA, Liebl RA, Keeling JW, Ritchie GD, Udeigwe TK, Reed JD, Keller KE,
Bowe SJ, Aldridge RB, Simon A (2021) Vertical mobility and cotton tolerance to
trifludimoxazin, a new protoporphyrinogen oxidase-inhibiting herbicide, in three West Texas
soils. Weed Technol 35:144–148
Barker A, Dayan F (2020) The physiological basis of differential resistance to PPO-inhibiting

herbicides used pre- and post-emergent. in Proceedings of the Weed Science Society of
America Annual Meeting. Maui, HI: Weed Science Society of America
Bell MS, Hager AG, Tranel PJ (2013) Multiple resistance to herbicides from four site-of-action
groups in waterhemp (Amaranthus tuberculatus). Weed Sci 61:460–468
A novel mutation A212T in chloroplast Protoporphyrinogen Oxidase (PPO1) confers
resistance to PPO inhibitor oxadiazon in Eleusine indica. Pest Manag Sci:76:1786–1794
Bobadilla LK, Giacomini DA, Hager AG, Tranel PJ (2022) Characterization and inheritance of
dicamba resistance in a multiple-resistant waterhemp (Amaranthus tuberculatus) population
from Illinois. Weed Sci 70:4–13
20
Cahoon CW, Jordan DL, Tranel PJ, Riggins C, Seagroves R, Inman M, Everman W, Leon R,
Professor A, Professor A, Professor Emeritus R, Cahoon Jr CW (2022) In-field assessment
of EPSPS amplification on fitness cost in mixed glyphosate-resistant and -sensitive
populations of Palmer amaranth (Amaranthus palmeri). Weed Sci 70:1–20
68
Chatham LA, Wu C, Riggins CW, Hager AG, Young BG, Roskamp GK, Tranel PJ (2015) EPSPS
gene amplification is present in the majority of glyphosate-resistant Illinois waterhemp
(Amaranthus tuberculatus) populations. Weed Technol 29:48–55
Dayan FE, Weete JD, Duke SO, Hancock HG (1997) Soybean (Glycine max) cultivar differences
in response to sulfentrazone. Weed Sci 45:634–641
Falk JS, Shoup DE, Al-Khatib K, Peterson DE (2006) Protox-resistant common waterhemp
(Amaranthus rudis) response to herbicides applied at different growth stages. Weed Sci
54:793–799
Green JM, Owen MDK (2010) Herbicide-resistant crops: Utilities and limitations for herbicide-
resistant weed management. J Agric Food Chem 59:5819–5829
Harder DB, Nelson KA, Smeda RJ (2012) Management options and factors affecting control of a
common waterhemp (Amaranthus rudis) biotype resistant to protoporphyrinogen oxidase-
inhibiting herbicides . Int J Agron 2012:1–7
Hatami ZM, Gherekhloo J, Rojano-Delgado AM, Osuna MD, Alcántara R, Fernández P,

Sadeghipour HR, de Prado R (2016) Multiple mechanisms increase levels of resistance in
rapistrum rugosum to ALS herbicides. Front Plant Sci 7:169
69
Kaundun SS (2010) An aspartate to glycine change in the carboxyl transferase domain of acetyl
CoA carboxylase and non-target-site mechanism(s) confer resistance to ACCase inhibitor
herbicides in a Lolium multiflorum population. Pest Manag Sci 66:1249–1256
Knezevic SZ, Streibig JC, Ritz C (2007) Utilizing R software package for dose-response studies:
The concept and data analysis. Weed Technol 21:840–848
Lee HJ, Duke M V., Duke SO (1993) Cellular localization of protoporphyrinogen-oxidizing

activities of etiolated barley (Hordeum vulgare L.) leaves: Relationship to mechanism of
action of protoporphyrinogen oxidase-inhibiting herbicides. Plant Physiol 102:881–889
Legleiter TR, Bradley KW (2008) Glyphosate and multiple herbicide resistance in common
waterhemp (Amaranthus rudis) populations from Missouri. Weed Sci 56:582–587
Legleiter TR, Bradley KW, Massey RE (2009) Glyphosate-resistant waterhemp (Amaranthus

rudis) control and economic returns with herbicide programs in soybean. Weed Technol
23:54–61
USA 94:8895–8900
10.1017/wet.2019.84

University. 158 p
McElroy JS, Head WB, Wehtje GR, Spak D (2017) Identification of goosegrass (Eleusine indica)
biotypes resistant to preemergence-applied oxadiazon. Weed Technol 31:675–681
70
Mendes RR, Takano HK, Adegas FS, Oliveira RS, Gaines TA, Dayan FE (2020) R128L target site
mutation in PPO2 evolves in wild poinsettia (Euphorbia heterophylla) with cross-resistance
to PPO-inhibiting herbicides. Weed Sci. 68:437–444
Manag Sci 75:3235–3244
Noguera MM, Rangani G, Heiser J, Bararpour T, Steckel LE, Betz M, Porri A, Lerchl J,
Zimmermann S, Nichols RL, Roma-Burgos N (2021) Functional PPO2 mutations: co-
occurrence in one plant or the same ppo2 allele of herbicide-resistant Amaranthus palmeri in
the US mid-south. Pest Manag Sci 77:1001–1012
Norsworthy JK, Griffith G, Griffin T, Bagavathiannan M, Gbur EE (2014) In-field movement of

glyphosate-resistant Palmer amaranth (Amaranthus palmeri) and its impact on cotton lint
yield: Evidence supporting a zero-threshold strategy. Weed Sci 62:237–249
Norsworthy JK, Ward SM, Shaw DR, Llewellyn RS, Nichols RL, Webster TM, Bradley KW,
Frisvold G, Powles SB, Burgos NR, Witt WW, Barrett M (2012) Reducing the risks of
herbicide resistance: best management practices and recommendations. Weed Sci 60:31–62
Obenland OA, Ma R, O’Brien SR, Lygin A V., Riechers DE (2019) Carfentrazone-ethyl resistance
in an Amaranthus tuberculatus population is not mediated by amino acid alterations in the
PPO2 protein. PLoS One 14:e0215431
herbicides inhibiting protoporphyrinogen oxidase. Proc Natl Acad Sci USA 103:12329–34
Patzoldt WL, Tranel PJ (2007) Multiple ALS mutations confer herbicide resistance in waterhemp
71
Lerchl J (2022a) Inhibition profile of trifludimoxazin towards PPO2 target site mutations.
Porri A, Noguera MM, Betz M, Sälinger D, Brändle F, Bowe SJ, Lerchl J, Meyer L, Knapp M,
Roma-Burgos N (2022b) Can double PPO mutations exist in the same allele and are such
mutants functional? Pest Manag Sci 78:2258–2264
Priess GL, Norsworthy JK, Godara N, Mauromoustakos A, Butts TR, Roberts TL, Barber T (2022)
Confirmation of glufosinate-resistant Palmer amaranth and response to other herbicides.
Weed Technol 36:368–372
Plant Sci 10:568
Rey-Caballero J, Menéndez J, Osuna MD, Salas M, Torra J (2017) Target-site and non-target-site
resistance mechanisms to ALS inhibiting herbicides in Papaver rhoeas. Pestic Biochem
Physiol 138:57–65
Ritz C, Baty F, Streibig JC, Gerhard D (2015) Dose-response analysis using R. PLoS One 10(12):
e0146021. https://doi.org/10.1371/journal.pone.0146021
Schafer JR, Hallett SG, Johnson WG (2012) Response of giant ragweed (Ambrosia trifida),
horseweed (Conyza canadensis), and common lambsquarters (Chenopodium album) biotypes
to glyphosate in the presence and absence of soil microorganisms. Weed Sci 60:641–649
72
Schultz JL, Chatham LA, Riggins CW, Tranel PJ, Bradley KW (2015) Distribution of herbicide
resistances and molecular mechanisms conferring resistance in Missouri waterhemp
(Amaranthus rudis Sauer) populations. Weed Sci 63:336–345
Shaner DL, ed (2014) Herbicide Handbook. 10th edn. Lawrence, KS: Weed Science Society of
America. 513 p
Shergill LS, Barlow BR, Bish MD, Bradley KW (2018) Investigations of 2,4-D and multiple
herbicide resistance in a Missouri waterhemp (Amaranthus tuberculatus) population. Weed
Sci 66:386–394

herbicide, for use in soybean. PhD dissertation. West Lafayette, IN: Purdue University. 172p
Steppig NR, Mansfield BC, Nie H, Young JM, Young BG (2017) Presence of an alternative
mechanism of resistance to PPO-inhibiting herbicides in tall waterhemp populations from
Indiana, Illinois, Iowa, Missouri, and Minnesota. Proceedings of the 2017 North Central
Weed Science Society Annual Meeting. St. Louis, MO: North Central Weed Science
Society
Umphres AM, Steckel LE, Mueller TC (2018) Control of protoporphyrinogen oxidase inhibiting
herbicide resistant and susceptible Palmer amaranth (Amaranthus palmeri) with soil-applied
protoporphyrinogen oxidase–inhibiting herbicides. Weed Technol 32:95–100
[USDA-NASS] US Department of Agriculture, National Agricultural Statistics Service (2020)

Agricultural chemical use program.
https://www.nass.usda.gov/Surveys/Guide_to_NASS_Surveys/Chemical_Use/. Accessed:
March 15, 2022
[USDA NASS] US Department of Agriculture, National Agricultural Statistics Service (1994)

Field crops chemical use survey.
http://usda.mannlib.cornell.edu/usda/nass/AgriChemUsFC//1990s/1994/AgriChemUsFC-
03-16-1994.txt. Accessed December 15, 2017
73
Van Wychen L (2022) 2022 Survey of the most common and troublesome weeds in broadleaf
crops, fruits & vegetables in the United States and Canada. Weed Science Society of America
National Weed Survey Dataset. Available: http://wssa.net/wp-content/uploads/2022 Weed-
Survey Broadleaf crops.xlsx

709
Vila-Aiub MM, Neve P, Powles SB (2009) Fitness costs associated with evolved herbicide
resistance alleles in plants. New Phytol 184:751–767
on diphenylether herbicides.Weed Technol 6:19–24

Wu C, Davis AS, Tranel PJ (2018) Limited fitness costs of herbicide-resistance traits in

Amaranthus tuberculatus facilitate resistance evolution. Pest Manag Sci 74:293–301

Wuerffel RJ, Young JM, Matthews JL, Young BG (2015a) Characterization of PPO-inhibitor–
74
Wuerffel RJ, Young JM, Tranel PJ, Young BG (2015b) Soil-residual protoporphyrinogen oxidase–
75
Table 2.1. Discovery of novel PPO-inhibitor resistance mutations in waterhemp and Palmer amaranth.
Mutation Species Sample Collected Author(s) Place of Collection
ΔG210 Waterhemp 2001 Patzoldt et al. 2006, Kansas
Shoup et al. 2003
ΔG210 Palmer 2011 Salas et al. 2016 Lawrence County, Arkansas
Amaranth
R128G and R128M Palmer 2016 Giacomini et al. 2017 Shelby County, Tennessee, Lauderdale
76
Amaranth County, Tennessee, and Woodruff County,

Arkansas
G399A Palmer 2015 Rangani et al. 2019 Mississippi County, Arkansas
Amaranth
R128G and R128I Waterhemp 2016 Nie et al. 2019 14 counties across Illinois, Indiana, Minnesota,
and Missouri
Table 2.2. Herbicides used for PRE dose-response experiments on susceptible and resistant waterhemp biotypes with ΔG210 and
R128G mutations.
Common name Trade name Manufacturer Manufacturer location Lower ratea Upper rate
--------g ai ha-1--------
Fomesafen Flexstar® Syngenta Crop Protection LLC Greensboro, NC 2.47 600
Flumioxazin Valor® SX Valent USA Corp. Walnut Creek, CA 0.61 150

77
Saflufenacil Sharpen® BASF Research Triangle Park, NC 0.61 150
Sulfentrazone Spartan® FMC Corp Philadelphia PA 2.88 700
Trifludimoxazin Tirexor® BASF Research Triangle Park, NC 0.31 75
Oxadiazon Ronstar® Flo Bayer Environmental Sciences Cary, NC 28.0 6800

a
All herbicides were applied at 6 rates in addition to a nontreated check in a log3 dosing structure.
Table 2.3. Response of ΔG210, R128G and susceptible biotypes of waterhemp to PRE
application of PPO-inhibiting herbicides in the greenhouse, as measured by seedling emergence
(LD50) and shoot biomass (GR50).
Emergence Biomass
Herbicide Biotype LD50a std err GR50b std err
--------------------g ai ha-1--------------------
Flumioxazin ΔG210 11.4 2.9 6.2 3.2
R128G 15.1 4.2 11.3 3.7
Susceptible 3.9 0.8 2.8 0.7
Fomesafen ΔG210 662.9 214.8 87.4 24.4
R128G 1199.3 338.1 199.9 118.2
Susceptible 32.6 7.4 22.4 7.6
Oxadiazon ΔG210 1413.3 337.3 92.4 30.0
R128G 474.0 80.7 192.8 37.2
Susceptible 191.0 34.1 66.3 11.9
Sulfentrazone ΔG210 75.9 17.2 17.0 4.4
R128G 161.3 52.5 25.6 7.2
Susceptible 18.4 4.5 11.1 2.2
Saflufenacil ΔG210 186.6 61.2 7.0 1.6
R128G 127.4 53.1 21.3 4.0
Susceptible 12.8 4.0 4.1 0.7
Trifludimoxazin ΔG210 10.2 1.9 6.4 0.5
R128G 7.1 1.6 5.2 0.4
Susceptible 2.9 0.5 6.0 0.3

a
LD50 value was fitted with a 3-parameter Weibull type I model.
b
GR50 value was fitted with a 3-parameter log logistic model.
78
Table 2.4. Resistance ratios between susceptible, R128G, and ΔG210 waterhemp biotypes for
six PPO-inhibiting herbicides applied PRE in the greenhouse.
Emergence (LD50) Biomass (GR50)
Herbicide RR128/RG210a RG210/S RR128/S RR128/RG210a RG210/S RR128/S
Flumioxazin 1.3 2.9* 3.8* 1.9 2.2 4.0*
Fomesafen 1.8 20.3* 36.8* 2.3* 3.9 8.9
Oxadiazon 0.3* 7.4* 2.5* 2.1* 1.4 2.9*
Sulfentrazone 2.1* 4.2* 8.8* 1.5 1.5 2.3
Saflufenacil 0.7 14.6* 10.0* 3.1* 1.7 5.2*
Trifludimoxazin 0.7 3.5* 2.4* 0.8 1.1 0.9

a
abbreviations RG210- ΔG210, RR128 – R128G, S- Susceptible
b
ratio values with a * indicate a ratio significantly different than 1.0 at α = 0.05
79
Waterhemp emergence (% of nontreated)
Adjusted dry weight (% of nontreated)

S
1
0
0
0
80
Flumioxazin rate (g ai ha-1) Flumioxazin rate (g ai ha-1)
Figure 2.1. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to flumioxazin applied preemergence.
Emergence and biomass were evaluated 14 days after treatment and normalized to a percentage of the untreated for each biotype.
81
Fomesafen rate (g ai ha-1) Fomesafen rate (g ai ha-1)
Figure 2.2. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to fomesafen applied preemergence.

82
Oxadiazon rate (g ai ha-1) Oxadiazon rate (g ai ha-1)
Figure 2.3. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to oxadiazon applied preemergence.
83
Saflufenacil rate (g ai ha-1) Saflufenacil rate (g ai ha-1)
Figure 2.4. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to saflufenacil applied preemergence.

84
Sulfentrazone rate (g ai ha-1) Sulfentrazone rate (g ai ha-1)
Figure 2.5. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to sulfentrazone applied preemergence.

85
Trifludimoxazin rate (g ai ha-1) Trifludimoxazin rate (g ai ha-1)
Figure 2.6. Dose-response curves of the ΔG210, R128G, and susceptible waterhemp biotypes to trifludimoxazin applied preemergence.
DOES TRIFLUDIMOXAZIN SELECT FOR RESISTANT
WATERHEMP (AMARANTHUS TUBERCULATUS) SIMILARLY TO
OTHER PPO-INHIBITING HERBICIDES?
Short title: Trifludimoxazin ΔG210
3.1 Abstract
Resistance to PPO-inhibiting herbicides in waterhemp [Amaranthus tuberculatus (Moq.)
J.D.Sauer] is primarily conferred by the ΔG210 mutation in the PPX2 gene. Soil applications of
PPO inhibitors provide partial control of resistant populations at the cost of reduced length of
residual activity while selecting for a greater frequency of PPO-inhibitor-resistant (PPO-R)
individuals. Trifludimoxazin is a PPO-inhibiting herbicide currently under development that has
soil and foliar activity and has been documented to control PPO-R waterhemp (ΔG210 and R128G)
in foliar applications. Our objective was to determine if applications of trifludimoxazin select for
PPO-R individuals when applied PRE or POST in a similar manner as do other PPO inhibitors,
and determine if combinations of trifludimoxazin with other PPO inhibitors can reduce selection
for PPO-R individuals. Separate PRE and POST field experiments were conducted in 2020 and
2021 at two Indiana locations. Trifludimoxazin, saflufenacil, and fomesafen were applied PRE or
POST at rates of 12.5, 25, and 263 g ai ha-1, respectively, along with all two- and three-way
combinations of those herbicides and a no herbicide control. Leaf tissue from the first 25 plants
emerging in each plot in the PRE experiment were collected, and also from 25 surviving plants in
each plot from the POST experiment. Following DNA extraction, qPCR assays were performed to
test for ΔG210 mutation on all plant tissue samples. Overall, a greater number of PPO-R plants
survived the foliar herbicide applications than emerged through soil applications. Trifludimoxazin
86
did not increase the frequency of PPO-resistant individuals when applied to soil, but when applied
to foliage, increased the frequency of PPO-resistant individuals by 2.5 to 2.6-fold, similar to other
PPO inhibitors applied to foliage. Despite selection for PPO-R individuals, herbicide combinations
increased the length of residual waterhemp control. Therefore, fewer waterhemp plants survived,
which reduces the reliance on subsequent herbicide applications or other non-chemical practices
to control surviving waterhemp plants.
Nomenclature: Waterhemp, Amaranthus tuberculatus (Moq.) J.D.Sauer, fomesafen, saflufenacil,
trifludimoxazin
Key words: PPO-inhibitor resistance, target-site resistance, ΔG210 mutation, resistance selection
3.2 Introduction
Waterhemp [Amaranthus tuberculatus (Moq.) J.D.Sauer] is a summer annual weed native
to the midwestern United States that is capable of producing over 500,000 seeds per plant
(Heneghan and Johnson 2017). Waterhemp is particularly troublesome because of its propensity
to evolve resistance to several different herbicide site-of-action groups (Heap 2023, Schultz et al.
2015). Confirmed cases of herbicide resistance in waterhemp occurred in the 1990’s to acetolactate
synthase (ALS) inhibitors and Photosystem II (PSII) inhibitors (Heap 2023). In the 2000s,
resistance to PPO inhibitors and glyphosate was confirmed (Legleiter and Bradley 2008, Shoup et
al. 2003). Given the widespread reliance on glyphosate for weed control, growers returned to
utilizing soil-residual herbicides (also known as preemergence or PRE herbicide) and added tank
mix partners to glyphosate, or substituted other herbicides with glyphosate to control resistant
species. The primary substituted herbicides were glufosinate and PPO-inhibiting herbicides such
87
as lactofen and fomesafen (Green and Owen 2010, Legleiter et al. 2009, Takano and Dayan 2020,
Young 2006).
Despite an increased reliance on PPO-inhibiting herbicides in soybean production, PPO-
inhibitor resistance has been confirmed in waterhemp since 2001, and is common across soybean
growing areas in both waterhemp and Palmer amaranth (Amaranthus palmeri S. Wats) (Copeland
et al. 2018, Heap 2023, Nie et al. 2019, Shoup et al. 2003). Both species have evolved similar
mutations in the PPX2 gene, which encodes one of the target enzymes, protoporphyrinogen
oxidase II (PPO2) (Lermontova et al. 1997, Matringe et al. 1989). In waterhemp and Palmer
amaranth, a glycine deletion at the 210th position (ΔG210) and multiple substitutions at the R218
position were shown to confer resistance to lactofen and other PPO inhibitors (Giacomini et al.
2017, Nie et al. 2019, Patzoldt et al. 2006, Salas et al. 2016). Palmer amaranth has also evolved
resistance via a glycine substitution at the 399th position (G399A) (Rangani et al. 2019). Recently,
a Palmer amaranth population lacking target-site mutations demonstrated resistance to fomesafen
(Varanasi et al. 2018). The authors suggested that increased fomesafen detoxification was the
mechanism of resistance. Therefore, non-target-site resistance may be a future concern for the
long-term viability of PPO-inhibiting herbicides.
Despite widespread resistance to PPO inhibitors, several PPO-inhibiting herbicides,
particularly flumioxazin, sulfentrazone, saflufenacil, and fomesafen, are used for PRE residual
control of Amaranthus species on 10 to 21% of soybean hectares each, (NASS 2020). Soil-applied
PPO inhibitors are used for management of PPO-R populations, although at the cost of reduced
length of residual control and an increased frequency of resistant individuals that emerge through
the soil-residual herbicide layer (Falk et al. 2006, Umphres et al. 2018, Wuerffel et al. 2015c). A
common theory is that soil-applied PPO-inhibiting herbicides control resistant individuals via the
88
increased relative dose that germinating seeds encounter coupled with the relatively low level of
resistance conferred by the ΔG210 mutation. As the herbicide dissipates or degrades in the soil
profile, the segregating weed population is exposed to a discriminating dose of the PPO-inhibiting
herbicide, a dose that is lethal to a susceptible individual and non-injurious or at least non-lethal
to a resistant individual. For resistance selection to occur, the discriminating dose must occur in
the presence of an imbibing seed or emerging radicle, and there must not be a lethal dose of another
herbicide present in the soil as well. Thus, the increase in frequency of PPO-R waterhemp after a
soil-residual PPO-inhibitor application appears to be less than that of other weed species and
herbicide combinations for weed resistance.
Westrich (2022) and Boe (2019) assayed giant ragweed (Ambrosia trifida L.) and waterhemp,
respectively, for ALS-inhibitor resistance after germination through a soil-residual application of
ALS-inhibiting herbicides. The frequency of ALS resistance in survivors increased to nearly 100%,
whereas Wuerffel et al. (2015c) and Mansfield (2021) observed that the frequency of PPO-R
increased by only 10 to 30% after PPO-inhibitor application. The resistance selection was variable
by environmental conditions and did not always rise to statistical significance.
The differential response of various resistant biotypes after a herbicide application appears
to be dependent on the magnitude of resistance. Previous research suggests that different PPO-
inhibiting herbicides elicit different resistance magnitudes at the whole-plant and target enzyme
level (Lillie et al. 2020, Patzoldt et al. 2005, Porri et al. 2022, Rangani et al. 2019, Shoup et al.
2003, Wuerffel et al. 2015b). Therefore, different PPO-inhibiting herbicide active ingredients
could potentially select for resistant individuals more or less strongly than other herbicides.
Limited comparisons have been made between fomesafen and other residual PPO inhibitors, but
89
in the experiments, there were not enough treatments of other herbicides to draw firm conclusions
(Wuerffel et al. 2015c, Mansfield 2021)
Trifludimoxazin is a PPO-inhibiting herbicide under development by BASF that is shown to
have high levels of activity on PPO-resistant biotypes of waterhemp and Palmer amaranth in field
research, greenhouse research, and in vitro (Porri et al. 2022, Witschel et al. 2021, Steppig 2022).
Dose-response experiments on greenhouse grown waterhemp and Palmer amaranth with target-
site resistance (ΔG210 and R128G) demonstrated that foliar applications of trifludimoxazin to
waterhemp and Palmer amaranth populations did not result in a dose-response shift between
susceptible and resistant populations (Steppig et al. 2022). This result is potentially explained by
the maintained affinity of trifludimoxazin to the resistant PPO enzymes (Porri et al. 2022).
Trifludimoxazin in vitro has only a 7-fold difference in affinity (IC50) between ΔG210 and
susceptible PPO2 enzymes, whereas other PPO inhibitors tested had over 1000-fold difference in
affinity between susceptible and resistant PPO2 enzymes. Conversely, results from Chapter 2
demonstrated that soil applications of trifludimoxazin caused a 2.4 to 3.5-fold dose-response shift,
which was a similar response to that of flumioxazin in the very same populations of waterhemp
tested by Steppig (2022).
Given these apparently contradictory results, it is unclear if trifludimoxazin applied PRE or
POST will select for resistant individuals in the same way as do other PPO inhibitors. POST
applications are also relevant because resistance to foliar applications of trifludimoxazin in
soybean are envisioned for future commercialization (Witschel et al. 2021). Furthermore, little has
been published regarding how foliar applications of PPO inhibitors select for resistance.
Presumably, selection for resistance is quite high, but there are some nuances to consider. In order
for resistance selection to occur, the treated plants must be exposed to a discriminating dose.
90
However, several circumstances can arise that would lead to reduced selection. For example, if the
herbicide application is compromised by environmental conditions or weeds that are so large so as
to be uncontrollable, the S plants would be more likely to survive and reduce selection for
resistance. Conversely, a herbicide rate that is so high that it controls even the R individuals would
not select for resistance either. Control of low-level resistant individuals is commonly
recommended in that growers are advised to spray plants that are less than 10cm in height and with
the maximum labeled herbicide rate (Norsworthy et al. 2012). How PPO-resistant waterhemp
populations will respond to applications of trifludimoxazin alone or in combination with other
PPO inhibitors is unclear. Therefore, experiments were conducted to quantify trifludimoxazin
selection for the ΔG210 mutation in segregating field populations of waterhemp after soil and
foliar applications. The secondary objective was to investigate if combinations of trifludimoxazin
with other PPO inhibitors influences resistance selection.
3.3.1 Site Selection and Experimental Design
Field experiments were conducted in 2020 and 2021 to evaluate trifludimoxazin selection
for target-site resistance in field populations of waterhemp. The field sites were intentionally
chosen based on low frequency of PPO-R waterhemp at Throckmorton Purdue Agricultural Center
(Throckmorton) near Lafayette, IN (40.27N, 86.88W), and high frequency of PPO-R waterhemp
at Davis Purdue Agricultural Center (Davis) near Farmland, IN (40.26, 85.15W) based on previous
genotyping and experimental evidence (Mansfield 2021, Steppig 2022). Soil properties at each
location are described in Table 3.1.
91
A set of two independent experiments were conducted at each field location and year in
close proximity. One trial evaluated waterhemp emergence through PRE PPO-inhibiting
herbicides in soybean while the other evaluated waterhemp survival after a POST application of
PPO-inhibiting herbicides in a non-crop area. The two trials consisted of an identical set of
herbicide treatments; the only difference being that the PRE trials received a PPO-inhibiting
herbicide application PRE at soybean planting, while the POST trials received a PPO-inhibiting
herbicide with crop oil concentrate (Prime oil® Winfield Solutions, LLC, St. Paul, MN) added at
1% v/v applied POST when waterhemp was 10 to 20 cm in height.
Herbicide treatments consisted of trifludimoxazin (Tirexor®, BASF Corporation, Research
Triangle Park, NC) at 12.5 g ai ha-1, Saflufenacil (Sharpen®, BASF Corporation, Research
Triangle Park, NC) at 25 g ai ha-1, fomesafen (Flexstar®, Syngenta Crop Protection, LLC,
Greensboro, NC) at 263 g ai ha-1, as well as all two and three-way combinations of those herbicides
and a non-treated control. Application rates for the herbicides applied in mixture were the same as
the herbicides applied alone. Rates of saflufenacil and fomesafen were selected based on previous
research conducted by Wuerffel et al. (2015c) and Mansfield (2021). The rate of trifludimoxazin
was chosen because the anticipated commercial product will be formulated in a 2:1 ratio of
saflufenacil to trifludimoxazin (Findley et al. 2020). All herbicide treatments were applied to plots
measuring 3m in width by 9m in length using a 2m-handheld spray boom equipped with four
XR8002 nozzles (TeeJet® Spraying Systems, Wheaton, IL) propelled using compressed CO2 and
calibrated to deliver 140 L ha-1 at a pressure of 207 kPa.
Both trials received a burndown of paraquat (Gramoxone®, Syngenta Crop Protection LLC,
Greensboro,NC) in late May to remove unwanted vegetation including winter annual weeds and
early-emerging waterhemp. Immediately after burndown, PRE trials were planted with soybean
92
variety Stine 32EA12, featuring resistance to glufosinate and 2,4-D, (Enlist E3®, Corteva
Agriscience, Indianapolis, IN) at a rate of 340,000 seeds ha-1 in 76-cm row spacing. POST trials
were initiated in late June or early July when the subsequent cohort of emerged waterhemp reached
a targeted average height of 15 to 20 cm. The middle 2m of plot were sprayed, thus leaving an
untreated strip between plots.
3.3.2 Data Collection and Analysis
For PRE experiments, visual assessments of soil-residual control of waterhemp were
conducted weekly from 2 to 6 weeks after the PRE application using a 0 to 100% scale (100
corresponds to complete waterhemp control; 0 corresponds to no inhibition of waterhemp
emergence). Waterhemp emergence was also assessed by counting emerged plants in two quadrats
(0.25 m2 ) per plot at the time of waterhemp tissue collections. Waterhemp tissue was collected
once for each treatment at one of two collection timings for subsequent DNA extraction and RT-
qPCR assays for the ΔG210 mutation. (Table 3.2). The decision to collect tissue was made when
either 25 waterhemp plants per plot had emerged in a treatment or at the final evaluation of the
season, whichever occurred first. For tissue sampling, the largest and likely oldest 25 plants were
cut at the ground level from each plot, placed in a bag, then stored at -20C until DNA extraction
and subsequent RT-qPCR assays. The first plants to emerge were chosen because those are the
most likely to have experienced herbicide exposure. A POST application of glufosinate (Liberty®,
BASF Corporation, Research Triangle Park, NC) at 660 g ai ha-1 was made immediately after
waterhemp tissue collection in the PRE trials to remove emerged weeds in an attempt to assess a
second cohort of waterhemp emergence. Lack of rainfall in June and July in both trial years
coupled with soybean canopy closure, resulted in an inadequate second emergence cohort of
waterhemp. Therefore, only data from the single collection timing was collected, but later
93
evaluation timings were affected by the glufosinate application. The only affected data presented
in this manuscript is waterhemp emergence at the collection 2 timing. In all site years, treatments
of no herbicide, trifludimoxazin, saflufenacil, and trifludimoxazin+saflufencacil received POST
glufosinate, so the presented % emergence is reduced from collection 1 to collection 2. Because
the vegetation was removed, emergence % values are calculated based on emergence in the no
herbicide treatment at collection 1.
Visual assessments of waterhemp control were taken at 7, 14, and 21 days after POST
treatments using a similar 0 to 100% scale. Waterhemp survival following POST treatments was
quantified by counting surviving waterhemp plants in two 0.25m2 quadrats per plot at 14 days after
herbicide treatment (DAT). Waterhemp tissue was collected at 14 to 16 DAT at which time a total
of 25 surviving plants per plot were clipped at the soil surface, placed in a plastic bag, and stored
at -20C until DNA extraction and RT-qPCR assays. To reduce bias of a particular plant size or age,
plants were randomly selected without regard for size or injury at the time of collection.
Waterhemp DNA was extracted using a modified cetyltrimethylammonium bromide
(CTAB) protocol originally designed by Saghai-Maroof et al. (1984). A TaqMan® SNP genotyping
assay developed by Wuerffel et al. (2015a), modified by Giacomini et al. (2017), and sourced from
ABI (Applied Biosystems Inc. Grand Island, NY) was used to genotype each sample as
homozygous susceptible, homozygous resistant, or heterozygous based on fluorescence of specific
fluorophores in the presence of a PCR product generated with forward primer (5′-
TGATTATGTTATTGACCCTTTTGTTGCG) and reverse primer (5′ GAGGGAGTATAA
TTTATTTACAACCTCCAGAA). For each sample, a 10-µl reaction was prepared with 4.8 µl of
nuclease free nano-pure water, 2 µl of GoTaq Flexi buffer, 1.2 µl of 25 mM MgCl2, 0.4 µl of 10
mM dNTP, 0.5 µl of 20X primers and TaqMan® probes, 0.1 µl of GoTaq Flexi polymerase (5 U
94
µl−1), and 1 µl of genomic DNA. Reactions were amplified using a CFX384 RT-PCR detection
system (Bio-Rad Laboratories, Hercules, CA 94547) with the following cycle conditions: 2 min at
95 C; 39 cycles of 95 C for 15 s and 60 C for 1 min; followed by a plate read after every cycle.
Experiments were arranged in a randomized complete block design with four replications.
All data were subjected to analysis of variance (ANOVA) using PROC GLIMMIX in SAS 9.4
(SAS Institute; Cary, NC) using a one-way ANOVA for herbicide treatment with other model
fixed effects of location, and year to determine experimental interactions. Data were square root
or arcsin square root transformed when appropriate to better conform to model assumptions and
combined over site, and/or years when the effects did not interact with herbicide treatment.
Transformed means were separated using Tukey’s honestly significant difference (HSD) (α = 0.05)
and presented as non-transformed means for ease of interpretation.
3.4.1 PRE Herbicide Efficacy
All site years received an activating rainfall within 6 d of herbicide application (Table 3.3).
Waterhemp control at 35 DAT is presented by year and pooled over site due to a significant
treatment by year interaction (Table 3.4). In 2020, a dry period occurring after trial initiation and
herbicide activation (7 to 28 DAT) resulted in reduced waterhemp emergence and extended
residual control with the exception of trifludimoxazin alone at both locations. All of the herbicide
treatments except trifludimoxazin provided 83 to 98% control of waterhemp. Trifludimoxazin
resulted in 52% control of waterhemp. In 2021, greater amounts of activating rainfall occurring
during days 0 to 6, and rainfall events occurring between 21 and 27 DAT at both locations resulted
in reduced waterhemp control for both saflufenacil and trifludimoxazin alone in comparison to
95
fomesafen and herbicide mixture treatments. In contrast, fomesafen and combinations of
fomesafen with trifludimoxazin and saflufenacil provided greater control. Due to rate selection,
fomesafen containing treatments provided the greatest length of residual control.
Waterhemp emergence data showed similar trends as control data (Table 3.5). The number
of emerged waterhemp after trifludimoxazin treatment in all site years and saflufenacil at the Davis
location was not reduced in comparison to no herbicide treatment. Waterhemp emergence was the
lowest (0 to 19% of non-treated) at all site years for fomesafen herbicide combinations. Even at
later evaluation timings, waterhemp emergence in fomesafen combination treatments remained
low at 1 to 20% emergence of the non-treated (Table 3.5).
3.4.2 PRE Resistance Selection
The field locations had different resistance selection intensities. At the Davis location, all
treatments with the exception of trifludimoxazin, increased the frequency of ΔG210 from 34% in
the untreated plot to between 58 and 70% (Table 3.6). The frequency of resistance after
trifludimoxazin application was an intermediate level similar to both the no herbicide treatment
and the other single or two-way combination herbicide treatments. Conversely, at the
Throckmorton location, only saflufenacil applied alone increased the frequency of resistance from
18% in the no herbicide treatment to 48%. These results are similar to Wuerffel et al. (2015c) in
that resistance selection after PPO-inhibitor application does not always increase.
Trifludimoxazin, fomesafen, and saflufenacil+fomesafen had similar frequencies of
heterozygous individuals compared to the non-treated while saflufenacil, trifludimoxazin+
saflufenacil, trifludimoxazin+fomesafen, and trifludimoxazin+saflufenacil+fomesafen increased
the frequency of heterozygous individuals by 15% to 21% (Table 3.7). In 2021, saflufenacil,
fomesafen, and saflufenacil+fomesafen increased the frequency of homozygous resistant
96
genotype/total samples by 11% to 20 %. In 2020, the increase was not significant for any treatment.
An increase in homozygous and heterozygous individuals with ΔG210 out of total collected plants
was expected because they are the two component parts of the overall frequency of resistance.
Out of the total number of resistant plants, the ratio of homozygous individuals/total
resistant individuals for fomesafen and saflufenacil+fomesafen increased from 6% in the non-
treated to 37% and 38%, respectively, in 2021 (Table 3.7). Other herbicide treatments were
intermediate, but statistically similar to both the no herbicide treatment and the fomesafen and
fomesafen+saflufenacil treatments, ranging from 14% to 21%. In 2020, there was no significant
change in homozygous waterhemp frequency between herbicide treated and non-treated treatments.
An increase in homozygous/total resistant ratio likely occurred for a couple of reasons. The
first is that PPO resistance via the ΔG210 mutation is an incompletely dominant trait (Patzoldt et
al. 2006). Incomplete dominance in the context of herbicide resistance means that a heterozygous
individual has a resistant phenotype, but the homozygous individual has a more resilient phenotype.
The inconsistent selection for more homozygous individuals is likely from the exposure of
germinating seedlings to a discriminating dose that still controls heterozygous individuals but does
not control homozygous individuals. The inconsistency is expected, because the selection for
overall resistance is inconsistent and relatively weak, so the selection for homozygous resistant
plants would be even more so. Another potential reason is the observation that not all plants
carrying the PPO-resistance mutation necessarily have a resistant phenotype (Wu et al. 2020).
Such an observation may be part of the incompletely dominant nature of the allele or perhaps there
are uncharacterized differences in pathway expression patterns or interactions of PPO1 and PPO2
target enzymes contributing to the phenomenon (Dayan et al. 2018, Watanabe et al. 2001)
97
While selection for resistance was inconsistent even for labeled PPO inhibitors,
trifludimoxazin generally did not increase the frequency of resistant individuals or any of the
genotype ratios. The lack of resistance selection is consistent with previous research that shows
that trifludimoxazin has a smaller resistance ratio than other PPO inhibitors at the target site and
whole plant level (Porri et al. 2022, Steppig 2022).
Some potential considerations that should be explored given the experimental conditions
and rate selection is whether the trifludimoxazin was adequately activated or completely washed
out of the soil profile at herbicide activation to where germinating waterhemp was not exposed at
all, or secondly, whether there was a consistent frequency of resistance emerging throughout the
season. We find the lack of exposure to trifludimoxazin to be unlikely for several reasons. The
first is that at all site years, there was at least 14 d of waterhemp control, indicating that emergence
in the treated area was slowed at least for some period of time (data not shown). The second is the
comparison with saflufenacil alone. In 2021, saflufenacil provided less control than
trifludimoxazin yet selected for an increased frequency of resistance. Finally, there is little
apparent association with waterhemp control and resistance selection. Overall resistance selection
was influenced by location interactions, whereas waterhemp control was influenced by year
interactions. Even where genotypic frequencies were influenced by year interactions, there was no
pattern of length of residual control and resistance selection.
Our other consideration was the resistance frequency of emerging waterhemp throughout
the growing season. Resistant individuals can potentially be more or less likely to emerge at
different times of the season either from independent selection or pleiotropic effects of the
resistance mutation (Kremer and Lotz 1998, Owen et al. 2011, Shergill et al. 2015). If differential
emergence of resistant individuals were occurring, then the interpretation of the entire experiment
98
would be severely complicated. We tested this possibility in 2021 by collecting newly emerged
waterhemp every 2 weeks in an area of the nontreated plots. There was no pattern of differential
emergence of resistant and susceptible individuals throughout the season (data not shown). While
differential emergence and dormancy of waterhemp and Palmer amaranth can vary by adapted
geography and management practice, there is no documented differences in dormancy or
emergence associated with herbicide resistance in these species (Jha and Norsworthy 2009,
Sosnoskie et al. 2013, Wu and Owen 2014).
We conclude that PRE applications of trifludimoxazin do not select for ΔG210 waterhemp
as much as do other PPO inhibitors. The lack of selection likely comes from a combination of the
physical properties of trifludimoxazin in soil and the lesser magnitude of resistance to
trifludimoxazin in comparison to other PPO inhibitors (Table 3.8) (Asher et al. 2021, Porri et al.
2022). Since trifludimoxazin is used at a lower rate than other PPO inhibitors, and is relatively
hydrophobic, the trifludimoxazin may become unavailable, i.e. adsorbed to soil, more readily at
low soil volumetric water content than more water soluble herbicides such as fomesafen and
saflufenacil. Future research should investigate the influence of herbicide properties on availability
in soil solution and influence on the herbicide dose that weed seedlings receive.
Our second objective, evaluating if trifludimoxazin in combination with other PPO
inhibitors could reduce resistance selection, could not be fully tested. Because the residual control
provided by fomesafen was much greater than that of trifludimoxazin and saflufenacil, the latter
two herbicides were likely not available in the soil any longer and did not contribute to waterhemp
control. Wuerffel et al. (2015c) observed the same shortcoming with combinations of S-
metolochlor and fomesafen because of the equal or lesser persistence of S-metolachlor at the
chosen rate ratio. However, since trifludimoxazin and saflufenacil had similar residual control, the
99
treatment of trifludimoxazin+saflufenacil can allow a partial evaluation of the objective. We
observed that the addition of trifludimoxazin to saflufenacil does not reduce selection for ΔG210
waterhemp. To reduce selection for resistance, the alternative herbicide must have the same or
greater length of availability in the soil (Wrubel and Gressel 1994). Our results, as well as
Mansfield (2021), demonstrate that an alternative herbicide does not alleviate resistance selection
despite having equal or greater available dose in the soil. Perhaps a hormetic effect on germination
is stimulating germination of resistant individuals at non-lethal rates and, therefore, increasing the
frequency of resistant individuals. Hormetic effects of herbicides have been documented for PPO-
inhibitor applications and other herbicides, but it is unclear truly what is happening at the seed
germination and physiological level (Chapter 2, Chandran et al. 1999, Goggin and Powles 2014,
Wuerffel et al. 2015b).
3.4.3 POST Efficacy
Waterhemp control was pooled across sight years and waterhemp survival analyzed
separately by location (Table 3.9). The location interaction likely occurred from a higher baseline
frequency of resistance leading to greater waterhemp survival. While there were similar trends in
waterhemp control at all sight years, the control ratings are based on both waterhemp injury and
waterhemp death. Trifludimoxazin and trifludimoxazin combinations with other herbicides
provided 79% to 87% control of waterhemp. Which was greater than saflufenacil and fomesafen
alone which provided only 45% to 56% control of waterhemp. Similar trends were present in
waterhemp survival data at the Throckmorton site with 13% to 22% waterhemp survival compared
to as much as 52% to 65% survival after fomesafen and saflufenacil application. The Davis
location had no differences in waterhemp survival between any of the herbicide treatments. In
100
contrast to PRE experiments, trifludimoxazin-containing treatments had the greatest efficacy when
applied POST, whereas trifludimoxazin residual activity was lower than that of other herbicides.
3.4.4 POST Resistance Selection
For overall resistance selection (Table 3.10), all treatments, with the exception of
saflufenacil in 2020, increased the frequency of ΔG210 waterhemp by at least 31% in 2020 and
39% in 2021. In 2020, the frequency of ΔG210 for trifludimoxazin was not different than in other
treatments. In 2021, treatments containing saflufenacil selected for a greater frequency of ΔG210
than trifludimoxazin treatment by at least 21%. The cause of such a greater resistance selection in
2021, especially for saflufenacil, is likely because of less herbicide efficacy for all treatments
observed in 2020. Less overall efficacy means that all plants are more likely to survive, including
susceptible plants, thus diluting the resistance selection effects.
For each individual genotype, there were different interaction effects that are difficult to
interpret. Heterozygous/total samples had a three-way interaction of location, year, and herbicide
treatment (Table 3.11), but homozygous/ total samples and homozygous/ total resistant only had a
two-way interaction of location and treatment. The location interaction for homozygous ratios is
possibly a result of the existing frequency of resistance. If the baseline allele frequency is not high
enough, it is possible that there were insufficient numbers of homozygous resistant individuals to
get consistent, powerful, and interpretable results. According to Hardy Weinberg equilibrium
calculations and observed genotypic ratios of untreated plots at the Throckmorton location, only
1% of plants were homozygous for ΔG210. Therefore, a selection event is more likely to result in
differences. The three-way interaction for the heterozygous genotype ratio likely comes from the
combined effects of year that influenced overall resistance selection, and the location effect that
influenced the homozygous ratios.
101
There were no differences in heterozygous frequency for any herbicide treatments with the
exception of Davis in 2021 where saflufenacil and saflufenacil+trifludimoxazin selected for a
greater percentage of heterozygous waterhemp than trifludimoxazin alone. Trifludimoxazin
increased the percentage of heterozygous waterhemp only at the Throckmorton site in 2021.
For frequency of homozygous/ total samples, at the Davis location, only fomesafen increased
the percentage of homozygous individuals from 6% in the non-treated to 24% after treatment with
fomesafen. At the Throckmorton location, treatments containing trifludimoxazin and
trifludimoxazin+saflufenacil increased the frequency of homozygous individuals from 1% in the
non-treated, to 15 to 20% after herbicide treatment. This increase caused a nearly identical increase
in the ratio of homozygous/total resistant plants.
In contrast to the PRE experiments, trifludimoxazin did cause significant selection for
ΔG210 in waterhemp when applied POST. However, there is some evidence that the selection is
weaker than that caused by other PPO inhibitors. Primarily, the 2021 trial year showed that
trifludimoxazin selected for ΔG210 waterhemp less than saflufenacil and saflufenacil
combinations. Also, the frequency of heterozygous individuals did not significantly increase after
trifludimoxazin application in three out of four site years, but there was an observed increase in
the frequency of homozygous resistant waterhemp. Similarly to what was previously discussed
with PRE activity, an increase in homozygous individuals is consistent with an incompletely
dominant trait (Patzoldt et al. 2006). Perhaps only homozygous individuals had a strong enough
phenotype to confer resistance to trifludimoxazin. The observation that trifludimoxazin selects for
resistance is inconsistent with Steppig et al. (2022), who observed that target-site mutations in
waterhemp and Palmer amaranth did not cause a dose-response shift. A potential explanation for
102
this discrepancy is that there is a true dose-response shift, but the greenhouse and plant growth
conditions as well as dose-response modeling failed to detect the small effect.
While combination with other PPO inhibitors can increase efficacy and reduce the number
of surviving plants, the frequency of resistant individuals is similar for PPO-inhibitor combination
treatments with or without trifludimoxazin (Table 3.10). Since trifludimoxazin is so much more
effective than other herbicides and it still selects for increased resistance, the marginal increase in
control from combination with other PPO inhibitors is a positive attribute at minimal cost.
Potential limitations to the current dataset are the potential presence of other target-site
resistance alleles, or other small effect genes that could co-select with herbicide resistance. While
we did not directly assay for the presence of R128 or G399A alleles, we find it extremely unlikely
that they are present in any frequency that would influence our results. First, a 2016 survey of
Midwest U.S. waterhemp and other internal experiments using the subject populations have failed
to detect any target-site resistance allele other than ΔG210 (Nie et al. 2019). Secondly, our results
in both site years are consistent with previous research about resistance selection after PPO-
inhibitor application (Wuerffel et al. 2015c). There were no site years, treatments, or plots that
indicated any anomaly in control or unexplained resistance.
However, we cannot rule out the presence of secondary-partial resistance mechanisms that
may be present. With the comparatively small resistance selection that occurs from PPO-inhibitor
application PRE, trifludimoxazin and other soil-applied PPO inhibitors are at increased risk of
developing a new resistance mechanism or a partial secondary resistance mechanism that will
increase its ability to emerge through a herbicide layer. Non-target-site resistance has already been
reported in Palmer amaranth (Varanasi et al. 2018). Furthermore, the most recent cases of herbicide
resistance in waterhemp are to herbicides with heavy soil-applied usage i.e. HPPD inhibitors and
103
VLCFA inhibitors via herbicide detoxification (Ma et al. 2013, Murphy et al. 2021, Strom et al.
2020). While trifludimoxazin has unique structural properties that allow it to bind to PPO2 (Porri
et al. 2022) and overcome resistance mutations, there are still many structural moieties that could
potentially be avenues for cross resistance, particularly with flumioxazin and saflufenacil because
of their structural similarity (Dimaano et al. 2020, Jugulam and Shyam 2019).
Overall, we conclude that trifludimoxazin exerts a selection pressure for ΔG210 waterhemp
that is less than other PPO inhibitors, but still potentially meaningful for the spread of the ΔG210
mutation. While co-application of trifludimoxazin with other PPO inhibitors can increase weed
control both PRE and POST, the presence of another PPO-inhibiting herbicide may cause further
selection for resistance. Therefore, trifludimoxazin can be used to increase waterhemp control and
reduce the amount of waterhemp survivorship. However, management of escaped waterhemp
plants with effective POST herbicide options or other tactics must be available and implemented
to reduce the shift toward greater ΔG210 frequencies in the weed populations.
3.5 Acknowledgements
This research received no specific grant from any funding agency, commercial or not-for-
profit sectors. No conflicts of interest have been declared.
Asher BS, Dotray PA, Liebl RA, Keeling JW, Ritchie GD, Udeigwe TK, Reed JD, Keller KE,
Bowe SJ, Aldridge RB, Simon A (2021) Vertical mobility and cotton tolerance to
trifludimoxazin, a new protoporphyrinogen oxidase-inhibiting herbicide, in three West Texas
soils. Weed Technol 35:144–148
104
Boe JE (2019) Establishing the value of ALS-inhibiting herbicides in fields with confirmed weed
resistance to ALS-inhibiting herbicides. MS thesis. West Lafayette IN: Purdue University.
190 p
Chandran RS, Singh M, Salihu S (1999) Thiazopyr stimulates hairy beggarticks (Bidens pilosa)
germination. Weed Technol 13:576–580
Copeland JD, Giacomini DA, Tranel PJ, Montgomery GB, Steckel LE (2018) Distribution of
PPX2 mutations conferring PPO-inhibitor resistance in Palmer amaranth populations of
Tennessee. Weed Technol 32:592–596
Dimaano NG, Yamaguchi T, Fukunishi K, Tominaga T, Iwakami S (2020) Functional

characterization of cytochrome P450 CYP81A subfamily to disclose the pattern of cross-
resistance in Echinochloa phyllopogon. Plant Mol Biol 102:403–416
Falk JS, Shoup DE, Al-Khatib K, Peterson DE (2006) Protox-resistant common waterhemp
(Amaranthus rudis) response to herbicides applied at different growth stages. Weed Sci
54:793–799
Findley D, Youmans C, Bowe S (2020) Tirexor (trifludimoxazin): next generation burndown

update. in Proceedings of the 2020 Weed Science Society of America Annual Meeting. Maui,
HI: Weed Science Society of America
Goggin DE, Powles SB (2014) Fluridone: a combination germination stimulant and herbicide for
problem fields? Pest Manag Sci 70:1418–1424
Green JM, Owen MDK (2010) Herbicide-resistant crops: Utilities and limitations for herbicide-
resistant weed management. J Agric Food Chem 59:5819–5829
105
Heneghan JM, Johnson WG (2017) The growth and development of five waterhemp (Amaranthus
tuberculatus) populations in a common garden. Weed Sci 65:247–255
Jha P, Norsworthy JK (2009) Soybean canopy and tillage effects on emergence of Palmer amaranth
(Amaranthus palmeri) from a natural seed bank. Weed Sci 57:644–651

8:417
Kremer E, Lotz LAP (1998) Germination and emergence characteristics of triazine-susceptible

and triazine-resistant biotypes of Solanum nigrum. J Appl Ecol 35:302–310
Legleiter TR, Bradley KW (2008) Glyphosate and multiple herbicide resistance in common
waterhemp (Amaranthus rudis) populations from Missouri. Weed Sci 56:582–587

23:54–61
U S A 94:8895–8900
10.1017/wet.2019.84

University. 158 p
106
Matringe M, Camadro JM, Labbe P, Scalla R (1989) Protoporphyrinogen oxidase as a molecular
target for diphenyl ether herbicides. Biochem J 260:231–235
Murphy BP, Beffa R, Tranel PJ (2021) Genetic architecture underlying HPPD-inhibitor resistance
in a Nebraska Amaranthus tuberculatus population. Pest Manag Sci 77:4884–4891
Manag Sci 75:3235–3244
Norsworthy JK, Ward SM, Shaw DR, Llewellyn RS, Nichols RL, Webster TM, Bradley KW,
Frisvold G, Powles SB, Burgos NR, Witt WW, Barrett M (2012) Reducing the risks of
herbicide resistance: best management practices and recommendations. Weed Sci 60:31–62
Owen MJ, Michael PJ, Renton M, Steadman KJ, Powles SB (2011) Towards large-scale prediction
of Lolium rigidum emergence. II. correlation between dormancy and herbicide resistance
levels suggests an impact of cropping systems. Weed Res 51:133–141
Papiernik SK, Koskinen WC, Barber BL (2012) Low Sorption and fast dissipation of the herbicide
saflufenacil in surface soils and subsoils of an eroded prairie landscape. J Agric Food Chem
60:10936–10941
herbicides inhibiting protoporphyrinogen oxidase. Proc Natl Acad Sci U S A 103:12329–34
Lerchl J (2022) Inhibition profile of trifludimoxazin towards PPO2 target site mutations. Pest
protoporphyrinogen oxidase IX (PPO) Confers Resistance to PPO-inhibiting herbicides.
Front Plant Sci 10:568
107
Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW (1984) Ribosomal DNA spacer-
length polymorphisms in barley: mendelian inheritance, chromosomal location, and
population dynamics. Proc Natl Acad Sci U S A 81:8014–8018
Schultz JL, Chatham LA, Riggins CW, Tranel PJ, Bradley KW (2015) Distribution of herbicide
resistances and molecular mechanisms conferring resistance in Missouri waterhemp
(Amaranthus rudis Sauer) populations. Weed Sci 63:336–345
America. 513 p
Shergill LS, Fleet B, Preston C, Gill G (2015) Incidence of herbicide resistance, seedling
emergence, and seed persistence of smooth barley (Hordeum glaucum) in South Australia.
Weed Technol 29:782–792
Sosnoskie LM, Webster TM, Culpepper AS (2013) Glyphosate resistance does not affect Palmer
amaranth (Amaranthus palmeri) seedbank longevity. Weed Sci 61:283–288

herbicide, for use in soybean. Ph.D dissertation. West Lafayette, IN: Purdue University. 172p
Strom SA, Hager AG, Seiter NJ, Davis AS, Riechers DE (2020) Metabolic resistance to S-
metolachlor in two waterhemp (Amaranthus tuberculatus) populations from Illinois, USA.
Takano HK, Dayan FE (2020) Glufosinate‐ammonium: a review of the current state of knowledge.
Umphres AM, Steckel LE, Mueller TC (2018) Control of protoporphyrinogen oxidase inhibiting
herbicide resistant and susceptible Palmer amaranth (Amaranthus palmeri ) with soil-applied
protoporphyrinogen oxidase–inhibiting herbicides. Weed Technol 32:95–100
108
Agricultural Chemical Use Program.
January 15, 2022

709
Westrich BC (2022) Influence of mesotrione, ALS-inhibitor resistance, and self incompatability

on giant ragweed management in soybean. Ph.D dissertation. West Lafayette, IN: Purdue
University. 189 p

Wrubel RP, Gressel J (1994) Are herbicide mixtures useful for delaying the rapid evolution of
resistance? a case study. Weed Technol 8:635–648

Wu C, Owen MDK (2014) When is the best time to emerge: reproductive phenology and success
of natural common waterhemp (Amaranthus rudis) cohorts in the Midwest United States?
Weed Sci 62:107–117
109
Wuerffel RJ, Young JM, Tranel PJ, Young BG (2015c) Soil-residual protoporphyrinogen oxidase–
110
Table 3.1. Site characteristics for field trials conducted in 2020 and 2021a.
Soil Properties
Locationb Sand Silt Clay Texture OM pH CEC
----------%---------- % mEq 100 g-1 soil
Davis 15 42 43 SiC 3.5 6.3 16.0
Throckmorton 41 38 21 L 2.3 6.5 14.3

a
Abbreviations: CEC, cation exchange capacity; Davis, Davis Purdue Agriculture Center; L,
loam; Throckmorton, Throckmorton Purdue Agricultural Center; OM, organic matter; SiC, silty
clay.
b
GPS coordinates for field locations: Davis (40.25N, -86.88W) and Throckmorton (40.29N,
-86.90W)
111
Table 3.2. Trial initiation and tissue collection dates for PRE and POST field trials at Throckmorton and Davis field sites in 2020 and 2021.
Collection 1a Collection 2b
Date of Days since Date of Days since
Trial Year Site Application date collection application collection application
PREc 2020 Throckmorton 5/26/2020 7/3/2020 38 7/31/2020 66
Davis 5/26/2020 7/9/2020 44 7/31/2020 66
2021 Throckmorton 5/24/2021 6/28/2021 35 7/21/2021 59
Davis 5/25/2021 6/29/2021 36 7/13/2021 49

112
POST 2020 Throckmorton 7/2/2020 7/15/2020 14
Davis 7/4/2020 7/17/2020 14
2021 Throckmorton 6/17/2021 7/3/2021 16
Davis 6/22/2021 7/6/2021 14

a
Collection 1 was triggered when multiple treatments had at least 25 plants per plot large enough for tissue collection for PRE trials and at
14 days after treatment for POST trials.
b
Collection 2 occurred when the remainder of treatments had 25 plants per plot large enough for tissue collection or at the last evaluation
of the season; whichever occurred first.
c
Glufosinate was sprayed after tissue was collected for PRE treatments which removed existing vegetation and affected emergence data
counted at the time of collection 2.
Table 3.3. Weekly rainfall totals for Davis and Throckmorton field locations in 2020 and 2021.
Throckmorton Davis
2020 2021 2020 2021
Rainfall Interval Precipitation
DATab ------------------------cm------------------------
-7 to -1 0.86 1.19 0.91 0.03
0 to 6 0.36 2.69 1.65 3.35
7 to 13 0.33 0.18 0.08 0.36
14 to 20 0.79 0.28 0.38 0.43
21 to 27 0.81 1.22 0.66 2.24
28 to 34 3.28 8.05 3.99 0.13
35 to 41 1.83 1.17 3.68 2.36
42 to 48 1.62 3.73 1.50 3.66
49 to 55 0.63 5.21 0.00 3.23
56 to 62 3.23 0.00 7.57 0.66
a
Abbreviations: DAT, days after treatment.
b
Numbering begins (day 0) on the day of PRE herbicide application for each site year
113
Table 3.4. Control of waterhemp recorded 35 days after PRE herbicide application at
Throckmorton and Davis field sites in 2020 and 2021.
Waterhemp control 35 d after applicationa
Treatment 2020 2021
----------------%---------------
Trifludimoxazin 52 d 58 c
Saflufenacil 83 c 41 c
Fomesafen 91 abc 89 ab
Trifludimoxazin+Saflufenacil 86 bc 83 b
Triflufimoxazin+Fomesafen 96 ab 91 ab
Saflufenacil+Fomesafen 98 a 95 ab
Trifludimoxazin+Saflufenacil+Fomesafen 97 ab 97 a
No Herbicide 0- 0-
a
Means within a column followed by the same letter are not significantly different according to
Tukey’s HSD test at α=0.05.
114
Table 3.5. Waterhemp emergence at the time of each tissue collection following PRE herbicide treatments at Throckmorton and Davis Field Sites
in 2020 and 2021.
Waterhemp emergence recorded at collection 1a Waterhemp emergence recorded at collection 2b
Davis Throckmorton Davis Throckmorton
Treatmentc 2020 2021 2020 2021 2020 2021 2020 2021
-----------------------------------------------------------%-------------------------------------------------------------
Trifludimoxazin 117 a 63 ab 41 ab 42 ab 0b 5 ab 0b 21 ab
Saflufenacil 69 a 57 abc 11 bc 32 bc 0b 4 ab 1 ab 25 ab
Fomesafen 16 b 13 cd 12 bc 1d 22 a 0b 9a 1c
115
Tri+Saf 166 a 30 bcd 11 bc 14 bcd 0b 7 ab 11 a 41 a
Tri+Fom 19 b 8d 2c 4 cd 15 a 16 a 5 ab 7 bc
Saf+Fom 18 b 7d 0c 3 cd 15 a 16 a 2 ab 2c
Tri+Saf+Fom 18 b 3d 1c 2d 20 a 14 a 3 ab 1c
No Herbicide 100 a 100 a 100 a 100 a 0b 7 ab 0b 10 abc
a
Means within a column followed by the same letter are not significantly different according to Tukey’s HSD test at α=0.05.
b
Treatments that were collected at the first timing were sprayed with glufosinate to remove existing vegetation including the no herbicide control.
Percentages calculated for collection 2 timing are based on emergence in the no herbicide control observed at collection 1.
c
Abbreviations: Tri, trifludimoxazin; Saf, saflufenacil; Fom, fomesafen.
Table 3.6. Frequency of the first waterhemp to emerge after PRE PPO-inhibitor application that
are heterozygous or homozygous for the ΔG210 mutation in 2020 and 2021 at Throckmorton and
Davis Field Sites.
Frequency of waterhemp with one or more
ΔG210 allelea
Treatment Davis Throckmorton
----------------------%-----------------------
Trifludimoxazin 46 bc 29 ab
Saflufenacil 59 ab 48 a
Fomesafen 60 ab 28 ab
Trifludimoxazin+Saflufenacil 69 a 39 ab
Triflufimoxazin+Fomesafen 63 ab 39 ab
Saflufenacil+Fomesafen 67 ab 29 ab
Trifludimoxazin+Saflufenacil+Fomesafen 70 a 27 ab
No Herbicide 34 c 18 b
a
116
Table 3.7. Zygosity percentages of ΔG210 in the first waterhemp to emerge after treatment with PRE PPO-inhibitor application at
Homozygous Resistant/Total Homozygous
Resistanta Resistant/Total Collected Heterozygous /Total
Treatmentb 2020 2021 2020 2021 collected
---------------------------------------------------%-------------------------------------------------
Trifludimoxazin 17 ns 21 ab 4 ns 11 ab 31 ab
Saflufenacil 19 21 ab 11 13 a 42 a
117
Fomesafen 12 38 a 5 16 a 33 ab
Tri+Saf 19 14 ab 8 9 ab 45 a
Tri+Fom 14 21 ab 8 12 ab 41 a
Saf+Fom 6 37 a 4 22 a 35 ab
Tri+Saf+Fom 11 19 ab 6 13 ab 39 a
No Herbicide 14 6b 3 2b 24 b
a
Means within a column followed by the same letter are not significantly different according to Tukey’s HSD test at α=0.05.
b
Abbreviations: Tri, trifludimoxazin; Saf, saflufenacil; Fom, fomesafen
Table 3.8. Herbicide soil properties of PPO inhibitors used in the current experiments.
Herbicide Chemical family Water solubility Koca Kdb,c Soil half-life
mg L-1 mL g-1 day
fomesafen diphenylether 600,000 (salt at pH 7, 25 C) 60 1.11 to 12.76 100
saflufenacil N-phenyl-imide 2100 (pH 7) 9 to 56 0.02 to 0.2 1 to 36

118
trifludimoxazin N-phenyl-imide 1.78 315 to 692 0.52 12-383

a
Koc: soil/water partition coefficient - defined as the tendency of the herbicide to bind to soil by organic matter. A small value
means the herbicide will less likely be adsorbed to the soil and thus more mobile in the soil.
b
Kd: soil sorption index - defined as the ratio of the herbicide amount in soil compared to the amount in water. A small value
means a greater herbicide concentration in water.
c
References: Papiernik et al. (2012); Shaner (2014); Asher et al. (2021).
Table 3.9. Waterhemp control and survival assessed 14 days after POST PPO-inhibitor treatment
at Throckmorton and Davis field sites in 2020 and 2021.
Waterhemp survival
Treatment Waterhemp controla Davis Throckmorton
--------------------- %-------------------
Trifludimoxazin 79 ab 53 b 17 c
Saflufenacil 56 cd 56 ab 65 ab
Fomesafen 45 d 56 b 52 b
Trifludimoxazin+Saflufenacil 87 a 37 b 13 c
Triflufimoxazin+Fomesafen 82 a 38 b 21 c
Saflufenacil+Fomesafen 68 bc 54 b 34 bc
Trifludimoxazin+Saflufenacil+Fomesafen 87 a 34 b 22 c
No Herbicide 0- 100 a 100 a

a
119
Table 3.10. Frequency of surviving waterhemp that have at least one ΔG210 allele after
treatment with POST herbicide.
Frequency of resistancea
Treatment 2020 2021
-----------------%----------------
Trifludimoxazin 55 a 64 b
Saflufenacil 45 ab 85 a
Fomesafen 54 a 82 ab
Trifludimoxazin+Saflufenacil 54 a 79 ab
Triflufimoxazin+Fomesafen 58 a 70 ab
Saflufenacil+Fomesafen 64 a 87 a
Trifludimoxazin+Saflufenacil+Fomesafen 66 a 87 a
No Herbicide 22 b 25 c
a
120
Table 3.11. Zygosity percentages of the ΔG210 mutation in waterhemp surviving treatment with POST PPO-inhibitor treatments at
Homozygous Resistant/ Homozygous
Total Resistanta Resistant/Total Collected Heterozygous/Total collected
Davis Throckmorton
Treatmentb Davis Throckmorton Davis Throckmorton 2020 2021 2020 2021
-------------------------------------------------------------------%------------------------------------------------------------
Trifludimoxazin 19 ns 22 a 13 ab 15 a 39 ab 48 bc 47 ab 49 a
Saflufenacil 14 9 ab 11 ab 5 ab 41 ab 77 a 41 ab 69 a
121
Fomesafen 29 16 ab 24 a 9 ab 44 ab 53 abc 42 ab 66 a
Tri+Saf 12 21 a 10 ab 15 a 40 ab 77 a 49 a 54 a
Tri+Fom 15 9 ab 12 ab 7 ab 40 ab 56 abc 64 a 57 a
Saf+Fom 22 9 ab 19 ab 6 ab 61 a 65 ab 53 a 74 a
Tri+Saf+Fom 21 30 a 17 ab 20 a 60 a 71 ab 37 ab 62 a
No Herbicide 17 2b 6b 1b 16 b 31 c 20 b 13 b
a
Means within a column followed by the same letter are not significantly different according to Tukey’s HSD test at α=0.05
b
Abbreviations: Tri, trifludimoxazin; Saf, saflufenacil; Fom, fomesafen.
INVESTIGATING THE POTENTIAL CO-
OCCURRENCE OF TARGET-SITE AND NON-TARGET-SITE
RESISTANCE IN WATERHEMP (AMARANTHUS TUBERCULATUS)
POPULATIONS
Short title: Fomesafen and detox inhibitors
4.1 Abstract
Widespread glyphosate resistance in waterhemp [Amaranthus tuberculatus (Moq.)
J.D.Sauer] during the last decade resulted in increased use of protoporphyrinogen IX oxidase (PPO)
herbicides in soybean. A 2016 field survey across several Midwestern states discovered two PPO-
resistant (R) waterhemp populations that exhibited an exceptionally high magnitude of fomesafen
resistance (16 to 17-fold) in comparison to other R populations (4 to 10-fold). This greater
resistance was not explained by presence of novel mutations or R allele zygosity. Furthermore,
non-target-site resistance, particularly CyP450 and GST based detoxification, has become
increasingly important for other herbicide groups. We hypothesized that enhanced fomesafen
detoxification was contributing to the increased resistance in these select PPO-R waterhemp
populations. Our objective was to reduce the PPO-inhibitor resistance phenotype using CyP450
and GST inhibitors (malathion and NBD-Cl, respectively) in combination with fomesafen
applications. Waterhemp populations named IN-RAN and IA-340 were the susceptible
populations. IL-BRO and IN-PIKE were 6 to 9X resistant. Finally, IL-WAS and IN-DUB were 16
to 17X resistant. Plants of each population were sprayed with NBD-CL, Malathion, NBD-Cl
followed by Malathion, or neither inhibitor prior to being sprayed with fomesafen at rates of 0, 20,
or 60 g ai ha-1. Malathion and NBD-Cl applications without fomesafen resulted in stunting that
was variable by population. At the 60 g ha-1 rate, malathion + NBD-Cl increased control of IL-
122
WAS by 20 to 26 percentage points in comparison to no inhibitor and NBD-Cl alone. While this
statistic appears to support our hypothesis, the lack of consistency between high and low herbicide
rates, and the noticeable phytotoxic response to malathion and NBD-Cl does not exclude potential
additive effects from the multiple applied xenobiotics. We conclude that our methodology was
insufficient to address our hypothesis because of the presence of many unvalidated assumptions
about the action of detoxification inhibitors applied to foliage as well as the issue of phytotoxicity
of malathion and NBD-Cl by themselves.
Nomenclature: Waterhemp, Amaranthus tuberculatus (Moq.) J.D. Sauer, fomesafen, NBD-Cl, 4-
Chloro-7-nitro-2,1,3-benzoxadiazole, Malathion
Key words: PPO inhibitor resistance, target-site resistance, ΔG210 mutation, Non-target-site
resistance, herbicide metabolism, Glutathione-S-transferase, Cytochrome P450
4.2 Introduction
One of the most troublesome characteristics of waterhemp [Amaranthus tuberculatus (Moq.)
J.D. Sauer] is its propensity to evolve herbicide resistance (Tranel et al. 2011). To date, waterhemp
has evolved resistance to herbicides from seven sites of action including PPO-inhibiting herbicides
(Heap 2023, Shoup et al. 2003). The first case of PPO-inhibitor resistance was confirmed in
waterhemp in 2001 and is primarily caused by a codon deletion at the 210th position of the PPX2
gene encoding one of the target enzymes protoporphyrinogen IX oxidase 2 (PPO2) (Patzoldt et al.
2006, Shoup et al. 2003). Mutations at the 128th position of the PPX2 gene (R128G and R128I)
also confer resistance in waterhemp, but populations with this mutation are less widespread (Nie
et al. 2019).
123
Palmer amaranth (Amaranthus Palmeri S. Wats), a closely related species, has also evolved
resistance via the ΔG210 mutation, as well as R128G, R128M, and G399A mutations (Giacomini
et al. 2017, Rangani et al. 2019, Salas et al. 2016). Other species that have evolved PPO-inhibitor
resistance include common ragweed (Ambrosia artemisiifolia L.) (Rousonelos et al. 2012), wild
poinsettia (Euphorbia heterophylla L.) (Mendes et al. 2020), and redroot pigweed (Amaranthus
retroflexus L.) (Huang et al. 2020) via R128 (or equivalent) mutations in PPX2 as well as
goosegrass [Eleusine indica (L.) Gaertn.] via an A212T mutation in the PPX1 gene (Bi et al. 2019).
Resistance to PPO inhibitors that is not explained by target-site mutations has also been
documented in waterhemp and Palmer amaranth to the herbicides carfentrazone-ethyl and
fomesafen, respectively (Obenland et al. 2019, Varanasi et al. 2018). Both authors claim that
resistance is explained by enhanced detoxification of the herbicide.
One of the most concerning trends in herbicide resistance evolution, particularly in
Amaranthus species, is the growing prevalence of non-target-site resistance (Jugulam and Shyam
2019). Waterhemp has evolved resistance to HRAC groups 5, 15, and 27 via enhanced
detoxification by Phase I and Phase II detoxification enzymes (Lygin et al. 2018, Patzoldt et al.
2003, Strom et al. 2020, Vennapusa et al. 2018). While multiple enzymes can contribute to phase
I and phase II xenobiotic metabolism, the most commonly implicated enzymes are cytochrome
P450 (P450) and glutathione S-transferase (GST) respectively. Other weed species have evolved
detoxification-based resistance to nearly all known herbicide mode of action groups (Heap 2023,
Jugulam and Shyam 2019). A potential threat of weeds with non-target-site resistance is broad
cross resistance to multiple modes of action. Potentially, a single P450 or GST enzyme could be
upregulated that is able to metabolize multiple herbicide molecules (Dimaano and Iwakami 2021).
A single P450 gene from Echinochloa phyllopogon overexpressed in a bacterial system was able
124
to metabolize herbicides from 6 different site of action groups (Dimaano et al. 2020). Such an
ability portends that cross resistance will accelerate and current resistance management practices
are potentially worsening metabolic resistance evolution.
The resistance phenotype to PPO inhibitors is variable in terms of population and active
ingredient response. Resistance to lactofen is typically reported at between 20 to 80 fold and up to
280 fold (Lillie et al. 2020, Patzoldt et al. 2005, Shoup et al. 2003, Wuerffel et al. 2015).
Resistances to other PPO inhibitors, most notably, a similar diphenyl-ether herbicide, fomesafen,
are typically reported at lower levels. Fomesafen resistance is typically reported at 6 to 15 fold,
but sometimes approaches 20- or 30-fold (Lillie et al. 2020, Patzoldt et al. 2005, Shoup et al. 2003,
Wuerffel et al. 2015). Resistances to other PPO inhibitors are reported at 5 to 30 fold, depending
on the lab group and experiment. From several studies, it is clear that the ΔG210 mutation confers
the greatest resistance to lactofen, but also confers meaningful cross resistance to other PPO
inhibitors. The wide range of reported resistance ratios is difficult to explain. Potential contributing
factors are application conditions, growth conditions and plant size, population genetic purity, and
evaluation period (Hatterman-Valenti et al. 2011, Lillie et al. 2020, Salas et al. 2016, Wichert et
al. 1992). However, these do not fully explain the range in resistance responses observed by so
many research groups. In unpublished research, we have evaluated many Midwest populations for
PPO-inhibitor resistance and observed R/S ratios of between 4.4X and 17X despite all populations
being fixed or nearly fixed for the ΔG210 mutation. The only remaining factor that can contribute
to the observed resistance variance is background genetic effects. Background genetic effects can
take the form of more sensitive susceptible populations and more resistant R populations.
According to our unpublished PPO-resistance screen, increases in GR50 account for the variable
resistance rather than variance in S populations.
125
Target-site resistance is typically a monogenic, Mendelian trait (Murphy and Tranel 2019).
However, recent experiments and increasing awareness of non-target-site resistance is causing a
paradigm shift toward all herbicide resistance as a quantitative trait (Kreiner et al. 2021, Murphy
et al. 2021). While single locus target-site alleles are a large effect contributor, they are a single
component to an overall resistance phenotype. Multigenic resistance has been documented in
several species for many herbicide site of action groups, particularly target-site and enhanced
detoxification occurring in the same plant (Alcántara-de la Cruz et al. 2016, Hatami et al. 2016,
Kaundun 2010, Rey-Caballero et al. 2017). A large proportion of glyphosate resistance in
waterhemp throughout the Midwest is explained by polymorphisms in genes throughout the
genome and not just related to EPSP synthase (Kreiner et al. 2021). A recent Palmer amaranth
survey observed high phenotypic variance in PPO-resistance (Noguera et al. 2021). Populations
were clustered into five response groups in which multiple target-site resistance alleles were
associated with greater resistance. The authors credited much of the increasing resistance with
accumulation of target-site resistance alleles; however, they did not fully rule out the potential
accumulation of non-target-site resistance alleles. Notably, populations predominantly from
Mississippi carried no target-site alleles, but had resistant individuals (Noguera et al. 2021). Given
the increasing incidence of non-target-site resistance and the unexplained variance in PPO-
inhibitor resistance observed in waterhemp, we hypothesized that increased detoxification is
contributing to the overall resistance phenotype to fomesafen in waterhemp populations. Our
objective was to determine if co-applying a P450 inhibitor, a GST inhibitor, or both in combination
with fomesafen would cause a partial reversal of fomesafen resistance.
126
4.3.1 Plant Materials
Greenhouse experiments were conducted in the Fall of 2021 to investigate co-occurrence
of target-site and non-target-site resistance occurring in waterhemp. The subject waterhemp
populations were selected from a 2016 PPO-resistance survey (Nie et al. 2019). The selected
populations were all previously subjected to full dose-response characterization and genotyping
assays for the ΔG210 mutation. There were two populations of each desired response range of
susceptible, highly resistant, and moderately resistant (unpublished data). Susceptible populations
had a GR50 of 2.1 to 2.7 g ai ha-1 of fomesafen and are designated as IA-340 and IN-RAN.
Moderately resistant populations were named IL-BRO1 and IN-PIKE1 and had a GR50 of 18 and
25 g ai ha-1 (6.7 and 9.3 fold resistant) respectively. Highly resistant populations were named IN-
DUB and IL-WAS and had GR50 values of 43 and 45 g ai ha-1 (16- and 17-fold resistant). In all of
the resistant populations, at least 95% of individual plants were either heterozygous or
homozygous for the ΔG210 mutation and were confirmed as being absent of any R128 mutations.
Seeds of each population were sown for germination in flats containing a peat moss-based
potting mix. At approximately 1 wk after sowing, seedlings at the 1-leaf stage were transplanted
into 164 ml cone-tainers (Ray Leach SC-10 Super Cell Cone-tainers; Stuewe & Sons, Tangent,
OR) filled with a mixture of two parts peatmoss-based potting mix and one part sand. Pots were
watered as needed and fertilized weekly with a micro- and macronutrient fertilizer (Jack’s Classic
Professional 20-20-20, JR Peters Inc., Allentown PA) throughout the course of the experiments.
Greenhouse environmental conditions included 16:8 light/dark photoperiods, where natural light
was supplemented with high-pressure sodium bulbs delivering 1100 μmol m-2 s-1 photon flux
during daylight hours, and day/night temperatures of 30 and 25C, respectively.
127
4.3.2 Spray Applications and Preparations
Applications of malathion and NBD-Cl (4-Chloro-7-nitro-2,1,3-benzoxadiazole) were
applied to inhibit cytochrome P450 and glutathione-S-transferase respectively (Kreuz and Fonné-
Pfister 1992, Ricci et al. 2005). Malathion (Spectracide Malathion Insect Spray Concentrate,
Spectrum Group, United Industries Corporation, St. Louis MO) was applied 2h prior to fomesafen
application at a rate of 1500 g ai ha-1 plus a non-ionic surfactant (Activator 90, Loveland Products,
Inc., Greeley, CO) at 0.25% v/v similar to methodologies described previously (Oliveira et al.
2018, Varanasi et al. 2018). NBD-Cl 98% powder (CAS No. 10199-89-0) was dissolved in DMSO
and applied 48 h prior to fomesafen application at a rate of 270 g ha-1 (Cummins et al. 2013,
Varanasi et al. 2018).
NBD-CL is highly soluble in DMSO and acetone, but highly insoluble in water. The
following procedure was developed by trial and error to create a sprayable mixture composed of
mostly water. NBD-CL powder was dissolved into a quantity of DMSO corresponding to 1% of
final spray volume, followed by mixing with COC at 1% v/v and Tween20 (2% v/v stock solution)
at 2.5% v/v. The solvent and surfactant solution was decanted into a spray bottle, to which, water
was added and shaken vigorously for several minutes to create a final volume to spray at 140 L ha-
1
. The final product was a sprayable mixture of partially dissolved, partially suspended NBD-CL.
Fomesafen (Flexstar®, Syngenta Crop Protection, LLC, Greensboro, NC) was applied at
the 5 to 7 leaf stage at a rate 0, 20, or 60 g ai ha-1 with 1% (v/v) crop oil concentrate (Prime Oil®,
Winfield Solutions, LLC, St. Paul, MN). Herbicide and detoxification-inhibitor applications were
made using a track-mounted research sprayer (Generation III Research Sprayer, DeVries
Manufacturing, Hollandale MN) calibrated to deliver 140 L ha-1 at 207 kPa via an even flat fan
XR8002E (TeeJet Technologies, Glendale Heights, IL) nozzle.
128
4.3.3 Experimental Design, Data Collection, and Analysis
Each population received one of twelve treatment regimens from the three-factor factorial
arrangement. Factors consisted of: 1. NBD-CL or blank DMSO-solvent solution; 2. Malathion or
no malathion; 3. Fomesafen applied at 0, 20, or 60 g ai ha-1. Plants receiving only the blank DMSO-
adjuvant solution served as the control. The experiment utilized a randomized complete block
design with 8 replications and was repeated once in time.
Visual estimates of control and plant height were recorded at 7 and 14 d after treatment
(DAT). Control estimates were taken on a 0 to 100% scale with 100% = complete plant death and
0% = no injury. At 14 DAT plants were clipped at the soil surface and oven dried at 60C until dry
biomass was recorded. Biomass data were normalized to a percentage based on the adjuvant-
solvent only treatment for each population. Data were subjected to analysis of variance using
PROC GLIMMIX in SAS 9.4 (SAS Institute; Cary, NC), with means separated using Tukey’s
HSD (α = 0.05). Waterhemp population, herbicide rate, and detoxification inhibitor treatment were
considered fixed effects while rep nested within run was considered a random factor.
4.4.1 Response to Detoxification Inhibitors Alone
Applications of detoxification inhibitors were made so that they conformed to previously
published research while still meeting our own experimental objectives. Published experiments
utilizing malathion in combination with herbicides typically use 1500 or 2000 g ha-1 followed by
some groups with a soil drench of malathion solution 2 d after application (Ma et al. 2013,
Obenland et al. 2019, Oliveira et al. 2018, Shyam et al. 2021, Varanasi et al. 2018). Malathion
application is a straightforward process since the compound is readily available as a formulated
129
concentrate for spray application. Multiple research groups have used malathion to successfully
demonstrate P450 based herbicide metabolism (Kreuz and Fonné-Pfister 1992, Ma et al. 2013,
Oliveira et al. 2018, Shyam et al. 2021, Tardif and Powles 1999).
In contrast, NBD-Cl has a relatively short history in the peer reviewed literature. The
property of being a non-reversable inhibiter of GST, along with other analogues, was first
demonstrated by Ricci et al. (2005). The first use in studying herbicide resistance was for
demonstrating GST based resistance to chlorotoluron and fenoxaprop-p-ethyl in blackgrass
(Alopecurus myosuroides Huds.) (Cummins et al. 2013). NBD-Cl applied to resistant blackgrass
prior to herbicide application completely or almost completely reversed resistance to the herbicides.
Other groups have utilized NBD-Cl with mixed results. Some groups successfully reversed the
resistance phenotype of the subject population, others had a phenotype reversal in some, but not
all populations, lastly some groups did not see a phenotype reversal effect. (Ma et al. 2016, Rangani
et al. 2021, Shyam et al. 2021, Strom et al. 2020, Varanasi et al. 2018).
One immediate observation that we made was the difficulty required to prepare the NBD-
Cl for spraying. NBD-Cl can be readily dissolved in a small volume of acetone or DMSO, however
water added to the solvent solution causes precipitation. We wanted to avoid spraying a primarily
solvent based spray solution because of phytotoxicity concerns, so maintaining a mostly dissolved
solution required oil adjuvants and surfactant. A description of the methods used by other groups
for spraying NBD-Cl in the literature was almost entirely absent. Only Cummins et al. (2013)
provided mixing and spraying procedures in their manuscript in which they applied 1600 L ha-1 of
carrier volume. We attempted to replicate the mixing procedure with the exception of reducing
final spray volume, but were unsuccessful. A spray volume of approximately 1600 L ha-1 was
required to obtain a sprayable solution of NBD-CL at 270 g ha-1. We observed that applying 1600
130
L ha-1 with our chosen adjuvants caused severe phytotoxicity and even caused some waterhemp
lethality in a preliminary experiment (data not shown). The toxicity was not due to the NBD-Cl
but rather the spray mix components, because other plants sprayed with only the water-solvent-
adjuvant solution using the same volume had equal injury (data not shown). While some other
groups mention the chosen solvent used with no other preparation details, most methods entirely
omit mixing procedures for NDB-CL (Ma et al. 2016, Shyam et al. 2021, Varanasi et al. 2018).
Our final developed mixing procedure was a semi-dissolved, low volume (140 L ha-1)
mixture that did cause observable plant injury. Within 24 hours after spraying, NBD-Cl treated
plants developed small lesions on the treated leaf surface (Figure 4.1). Newly emerged leaves were
unaffected, but treated plants lacked vigor and had a general unhealthy appearance. Long term
injury from NBD-CL, malathion, and NBD-Cl+malathion was observable at 14 d after application
(Table 4.1). The injury was variable by population, but generally manifested as height reduction
and stunting (Table 4.2). The cause of waterhemp injury is unclear. Since GSTs and their precursor
molecules and pathways are involved in a variety of plant processes, perhaps inhibiting waterhemp
GST and P450 created a metabolic drain that reduced growth (Dixon et al. 2002, Xu et al. 2015).
4.4.2 PPO-Resistance Response
Waterhemp control is presented as two-way factorial of population and detoxification
inhibitor treatment, and separated by fomesafen rate due to significant three-way interaction of
rate, population, and detoxification inhibitor. The interaction occurred due to variable effects of
detoxification inhibitors alone on each population, as well as differing effects of detoxification
inhibitors at the two herbicide rates. Control of S populations at 14 d after fomesafen application
was much greater than R populations at both the 20 and 60 g ha-1 rate (Table 4.1). Fomesafen alone
provided 86 to 88 % control at 20 g ha-1 and 98 to 100% control at 60 g ha-1. In resistant waterhemp
131
populations, the previously characterized moderately and highly resistant characterizations were
not apparent. The 20 g ha-1 rate of fomesafen provided 35 to 40% control of IL-BRO1, IN-PIKE,
and IL-WAS compared to 63% control of IN-DUB, the most resistant waterhemp population
according to previous dose-response experiments. A similar trend was present at the 60 g ha-1 rate
where control of IL-WAS was 54% compared to control of IN-DUB of 76%. Height and biomass
means for each population also indicate that IN-DUB did not exhibit the resistant phenotype as
was previously characterized, evidenced by the lack of differences between the other 3 resistant
populations (Table 4.3). A possible reason for why the previous resistance characterization was
not reproduced in the present study is the experimental conditions. The original experiments were
part of a multi-state survey of PPO-resistant waterhemp in which dozens of populations were
screened and sprayed at the same time. Perhaps variance in germination or growth rate contributed
to greater than usual plant size differences leading to the appearance of a more or less resistant
phenotype (Mansfield 2021).
There were few differences between fomesafen alone and fomesafen preceded by
detoxification inhibitor treatment. At 60 g fomesafen ha-1, control of IL-WAS treated with both
malathion and NBD-CL was increased to 73% compared to 47 to 54% from NBD-CL and no
detoxification inhibitor. Because IL-WAS was previously characterized as highly resistant and
there was a significant increase in control, there is some evidence that fomesafen detoxification is
contributing to the overall resistance (Figure 4.2). However, biomass and height data indicate that
the observation in IL-WAS was not unique.
Data for height and biomass are separated by herbicide rate but combined over population
and detoxification inhibitor due to insignificant interactions of population and detoxification
inhibitor. (Table 4.2, Table 4.3). The lack of a significant population by detoxification inhibitor
132
term is countervailing evidence that some waterhemp populations are more rapidly metabolizing
fomesafen. Similar numerical trends were present for each individual population and no individual
population responded in terms of height or biomass for any of the detoxification inhibitor
treatments. At the 20 g ha-1 rate, NBD-CL and fomesafen alone treatments had greater height by
1.9 to 3.2 cm and greater biomass by 8 to 11 percentage points compared to malathion and
malathion+NBD-Cl treatments. This observation may indicate that all waterhemp reduces
phytotoxicity to some extent via partial metabolism of fomesafen. However, the presence of
similar biomass and height reductions in the absence of fomesafen treatment indicates that the
increased phytotoxicity is an additive effect of multiple applied xenobiotics. Interestingly, the
application of NBD-CL created a significant height and biomass reduction when applied alone,
but NBD-CL applied prior to fomesafen application appeared to have a safening or antagonistic
effect.
With the assumption that malathion and NDB-Cl truly inhibited P450 and GST enzymes in
the treated plants, there is some weak evidence that P450 enzymes are contributing to partial
fomesafen tolerance in all waterhemp populations and the IL-WAS population may be
metabolizing fomesafen to a greater extent than other populations. Fomesafen and other diphenyl-
ether metabolism in soybean occurs via GST mediated ether bond cleavage (Andrews et al. 1997,
Frear et al. 1983). To our knowledge, there is no documented evidence of P450-mediated
metabolism of diphenyl-ether herbicides in crops or weeds. However, metabolism of saflufenacil
and sulfentrazone in soybean is through P450-mediated demethylation (Dayan et al. 1997, Wu et
al. 2019). Also, resistance mechanisms to herbicides in weeds is not always the same pathway as
in the associated crops (Lygin et al. 2018, Strom et al. 2020). P450 enzymes as a group are capable
133
of double bond oxidation, ring structure oxidations, and heteroatom dealkylations (Dimaano and
Iwakami 2021).
The methodology and conclusions in our research rely on the previously stated assumption
that these P450 and GST inhibitors were truly inhibiting their respective enzymes and having no
secondary herbicidal effects. The first part, inhibition of P450 and GST is unverifiable with our
chosen methods, and previous literature indicates that it is not a reliable assumption in all
circumstances (Ma et al. 2016, Oliveira et al. 2018, Strom et al. 2020). P450 and GST are a diverse
set of enzymes that are likely not going to be universally inhibited by a single molecule. Several
groups apply multiple known P450 inhibitors as separate treatments with malathion, such as
piperonyl butoxide and amitrole (Oliveira et al. 2018, Varanasi et al. 2018). At least one of these
treatments would commonly not inhibit resistance conferring P450 adequately for phenotype
reversal. Plant tissue may also play a role. Strom et al. (2020) successfully exposed waterhemp
seedlings to NBD-Cl and documented differential S-metolachlor metabolism. However, NBD-Cl
did not successfully inhibit corn GSTs well enough to reduce metabolism of S-metolachlor. It is
unclear if the exposure event was not adequate for absorption, or if some enzyme level physiology
is different in corn vs waterhemp such as expression or binding characteristics. With the lack of
precedent in the literature, NBD-Cl treatment rates have likely not been optimized (Cummins et
al. 2013, Ma et al. 2016).
The second assumption about no secondary herbicidal effects is verifiably false. We cannot
conclusively say whether the increased waterhemp control is from the additive general
phytotoxicity of malathion followed by fomesafen or if the inhibition of P450 enzymes caused
reduced fomesafen detoxification and therefore increased herbicide activity. Since the central
catalytic molecule of P450s is heme, potentially the inhibition of P450s is causing a secondary
134
effect on the PPO pathway. Perturbations in chemical pathways can often result in herbicide
synergy (Takano et al. 2020, Walsh et al. 2012, Woodyard et al. 2009).
When studying herbicide interactions, there are specific statistical approaches for
determining herbicide synergy or additivity. The most common methods are isobole analysis and
Colby’s method. Both approaches use statistics to determine if plant response exceeds that of the
theoretical additive response, with isobole analysis being more robust, but more complex in
experimental design and modeling. Formal additivity/synergy analysis may be appropriate for
resistance phenotype reversal, especially in the case of partially phytotoxic chemicals like NBD-
Cl and malathion (Cedergreen 2014, Cedergreen et al. 2008, Colby 1967).
In comparing our research to others with similar methodology, we see a disturbing lack of a
consistent standard for what is considered adequate resistance phenotype reversal. Several authors
conclude metabolic resistance from any statistical increase in control compared to no P450 or GST
inhibitor. This conclusion of metabolic resistance seems to be reached even in the presence of
either a similar effect occurring in the susceptible, or with a complete lack of susceptible or target-
site resistant population for comparison. We suggest that a consistent standard be implemented
where either a particular benchmark increase in efficacy be achieved or have supplemental

14
experiments that measure degradation of herbicide and/or increase in metabolites with C or
chromatography-based experiments.
Several groups have successfully demonstrated a compelling resistance phenotype reversal
where co-application of detoxification inhibitors with herbicide provides a complete or nearly
complete phenotype reversal (Brabham et al. 2019, Chen et al. 2020, Cummins et al. 2013, Oliveira
et al. 2018, Strom et al. 2020). Others have measured parent herbicide disappearance or performed
genetic assays as a supplemental experiment with the co-application of detoxification inhibitors
135
and herbicides (Chen et al. 2020, Ma et al. 2013, Nandula et al. 2020, Oliveira et al. 2018, Rangani
et al. 2021, Strom et al. 2020). However, others present an unclear increase in control in
unbalanced experiments and no supplemental experiments (González-Torralva and Norsworthy
2021, Obenland et al. 2019, Varanasi et al. 2018, 2019). Some of the less interpretable results are
repeatedly cited as a clear-cut phenomenon, when the conclusions are much less conclusive. The
assumptions required to interpret detoxification inhibitor experiments, the confounding factor of
phytotoxic additivity from multiple chemical applications, as well as the lack of consistent
methodology leads us to the conclusion that these types of experiments should not be standalone
experiments. While there are limitations, our opinion is that this methodology still has merit, but
only as a preliminary hypothesis building experiment.
In conclusion, the hypothesis that increased detoxification is contributing to the overall
resistance phenotype to fomesafen in waterhemp populations was not fully testable with our
chosen methodology. Despite the methodological flaws, it is unlikely that fomesafen detoxification
is meaningfully contributing to the overall resistance phenotype to fomesafen. The greater value
of this manuscript is a call for increased materials and methods transparency, a more consistent
standard for diagnosing detoxification-based resistance, and more robust supplemental
experiments that directly measure herbicide degradation or concentrations in treated plants.
Alcántara-de la Cruz R, Fernández-Moreno PT, Ozuna C V., Rojano-Delgado AM, Cruz-Hipolito

HE, Domínguez-Valenzuela JA, Barro F, de Prado R (2016) Target and non-target site
mechanisms developed by glyphosate-resistant hairy beggarticks (Bidens pilosa L.)
populations from Mexico. Front Plant Sci 7:1492
136
Andrews CJ, Skipsey M, Townson JK, Morris C, Jepson I, Edwards R (1997) Glutathione
transferase activities toward herbicides used selectively in soybean. Pest Manag Sci 51:213–
222
A novel mutation A212T in chloroplast protoporphyrinogen oxidase (PPO1) confers
resistance to PPO inhibitor oxadiazon in Eleusine indica. Pest Manag Sci 76:1786–1794
Brabham C, Norsworthy JK, Houston MM, Varanasi VK, Barber T (2019) Confirmation of S -
metolachlor resistance in Palmer amaranth (Amaranthus palmeri). Weed Technol 33:720–
726
Cedergreen N (2014) Quantifying synergy: a systematic review of mixture toxicity studies within
environmental toxicology. PLoS One 9:1-12
Cedergreen N, Christensen AM, Kamper A, Kudsk P, Mathiassen SK, Streibig JC, Sorensen H
(2008) A review of independent action compared to concentration addition as reference
models for mixtures of compounds with different molecular target sites. Environ Toxicol
Chem 27:1621-1632
Chen W, Wu L, Wang J, Yu Q, Bai L, Pan L (2020) Quizalofop-p-ethyl resistance in Polypogon
fugax involves glutathione S-transferases. Pest Manag Sci 76:3800–3805
Colby SR (1967) Calculating synergistic and antagonistic responses of herbicide combinations.

Weeds 15:20-22
Cummins I, Wortley DJ, Sabbadin F, He Z, Coxon CR, Straker HE, Sellars JD, Knight K, Edwards
L, Hughes D, Kaundun SS, Hutchings SJ, Steel PG, Edwards R (2013) Key role for a
glutathione transferase in multiple-herbicide resistance in grass weeds. Proc Natl Acad Sci U
S A 110:5812–5817
Dayan FE, Weete JD, Duke SO, Hancock HG (1997) Soybean (Glycine max) cultivar differences
in response to sulfentrazone. Weed Sci 45:634–641
Dimaano NG, Iwakami S (2021) Cytochrome P450-mediated herbicide metabolism in plants:

current understanding and prospects. Pest Manag Sci 77:22–32
137
Dixon DP, Lapthorn A, Edwards R (2002) Plant glutathione transferases. Genome Biol
3:reviews3004.1–reviews3004.10
Frear DS, Swanson HR, Mansager ER (1983) Acifluorfen metabolism in soybean: diphenylether
bond cleavage and the formation of homoglutathione, cysteine, and glucose conjugates. Pestic
Biochem Physiol 20:299–310
González-Torralva F, Norsworthy JK (2021) Understanding resistance mechanisms to trifluralin

in an Arkansas Palmer amaranth population. Genes 2021, Vol 12, Page 1225 12:1225
Hatami ZM, Gherekhloo J, Rojano-Delgado AM, Osuna MD, Alcántara R, Fernández P,

Sadeghipour HR, de Prado R (2016) Multiple mechanisms increase levels of resistance in
rapistrum rugosum to ALS Herbicides. Front Plant Sci 7:169
Hatterman-Valenti H, Pitty A, Owen M (2011) Environmental effects on velvetleaf (Abutilon

theophrasti) epicuticular wax deposition and herbicide absorption. Weed Sci 59:14–21

Huang Z, Cui H, Wang C, Wu T, Zhang C, Huang H, Wei S (2020) Investigation of resistance

mechanism to fomesafen in Amaranthus retroflexus L. Pestic Biochem Physiol 165:104560

8:417
Kaundun SS (2010) An aspartate to glycine change in the carboxyl transferase domain of acetyl
CoA carboxylase and non-target-site mechanism(s) confer resistance to ACCase inhibitor
herbicides in a Lolium multiflorum population. Pest Manag Sci 66:1249–1256
138
Kreiner JM, Tranel PJ, Weigel D, Stinchcombe JR, Wright SI (2021) The genetic architecture and
population genomic signatures of glyphosate resistance in Amaranthus tuberculatus. Mol
Ecol 30: 5373-5389
Kreuz K, Fonné-Pfister R (1992) Herbicide-insecticide interaction in maize: Malathion inhibits

cytochrome P450-dependent primisulfuron metabolism. Pestic Biochem Physiol 43:232–240
tuberculatus var. rudis) to PPO inhibitors. Weed Technol. 34: 140–146.
Lygin A V., Kaundun SS, Morris JA, Mcindoe E, Hamilton AR, Riechers DE (2018) Metabolic
pathway of topramezone in multiple-resistant waterhemp (Amaranthus tuberculatus) differs
from naturally tolerant maize. Front Plant Sci 9:1644
Ma R, Evans AF, Riechers DE (2016) Differential responses to preemergence and postemergence

atrazine in two atrazine-resistant waterhemp populations. Agron J 108:1196–1202

University. 158 p
Mendes RR, Takano HK, Adegas FS, Oliveira RS, Gaines TA, Dayan FE (2020) R128L target site
mutation in PPO2 evolves in wild poinsettia (Euphorbia heterophylla) with cross-resistance
to PPO-inhibiting herbicides. Weed Sci. 68:437–444
Murphy BP, Beffa R, Tranel PJ (2021) Genetic architecture underlying HPPD-inhibitor resistance
in a Nebraska Amaranthus tuberculatus population. Pest Manag Sci 77:4884–4891
Nandula VK, Giacomini DA, Lawrence BH, Molin WT, Bond JA (2020) Resistance to clethodim
in Italian ryegrass (Lolium perenne ssp. multiflorum) from Mississippi and North Carolina.
139
Manag Sci 75:3235–3244
occurrence in one plant or the same ppo2 allele of herbicide-resistant Amaranthus palmeri in
the US mid-south. Pest Manag Sci 77:1001–1012
Oliveira MC, Gaines TA, Dayan FE, Patterson EL, Jhala AJ, Knezevic SZ (2018) Reversing
resistance to tembotrione in an Amaranthus tuberculatus (var. rudis) population from
Nebraska, USA with cytochrome P450 inhibitors. Pest Manag Sci 74:2296–2305
Patzoldt WL, Dixon BS, Tranel PJ (2003) Triazine resistance in Amaranthus tuberculatus (Moq)
Sauer that is not site-of-action mediated. Pest Manag Sci 59:1134–1142
Rangani G, Noguera M, Salas-Perez R, Benedetti L, Roma-Burgos N (2021) Mechanism of

resistance to S-metolachlor in Palmer amaranth. Front Plant Sci 12:652581
protoporphyrinogen oxidase IX (PPO) confers resistance to PPO-inhibiting herbicides. Front
Plant Sci 10:568
140
Rey-Caballero J, Menéndez J, Osuna MD, Salas M, Torra J (2017) Target-site and non-target-site
resistance mechanisms to ALS inhibiting herbicides in Papaver rhoeas. Pestic Biochem
Physiol 138:57–65
Ricci G, De Maria F, Antonini G, Turella P, Bullo A, Stella L, Filomeni G, Federici G, Caccuri

AM (2005) 7-Nitro-2,1,3-benzoxadiazole derivatives, a new class of suicide inhibitors for
glutathione S-transferases. J Biol Chem 280:26397–26405
Shyam C, Borgato EA, Peterson DE, Dille JA, Jugulam M (2021) Predominance of metabolic
resistance in a six-way-resistant Palmer amaranth (Amaranthus palmeri) population. Front
Plant Sci 11:2162
Takano HK, Beffa R, Preston C, Westra P, Dayan FE (2020) Glufosinate enhances the activity of
protoporphyrinogen oxidase inhibitors. Weed Sci 68:324–332
Tardif FJ, Powles SB (1999) Effect of malathion on resistance to soil-applied herbicides in a

population of rigid ryegrass (Lolium rigidum). Weed Sci 47:258–261
Tranel PJ, Riggins CW, Bell MS, Hager AG (2011) Herbicide resistances in Amaranthus
tuberculatus: A call for new options. J Agric Food Chem 59:5808–5812
Varanasi VK, Brabham C, Korres NE, Norsworthy JK (2019) Nontarget site resistance in Palmer
amaranth [Amaranthus palmeri (S.) Wats.] confers cross-resistance to protoporphyrinogen
oxidase-inhibiting herbicides. Weed Technol 33:349–354
141
709
Walsh MJ, Stratford K, Stone K, Powles SB (2012) Synergistic effects of atrazine and mesotrione
on susceptible and resistant wild radish (Raphanus raphanistrum) populations and the
potential for overcoming resistance to triazine herbicides. Weed Technol 26:341–347
on diphenylether herbicides. Weed Technol 6:19–24
Woodyard AJ, Hugie JA, Riechers DE (2009) Interactions of mesotrione and atrazine in two weed
species with different mechanisms for atrazine resistance. Weed Sci 57:369–378
Wu C, Liu X, Wu X, Dong F, Xu J, Zheng Y, Zheng Y (2019) Simultaneous determination of

saflufenacil and three metabolites in five agriculture products using liquid chromatography—
tandem mass spectrometry. J Food Biochem 43:e12778
Wuerffel RJ, Young JM, Matthews JL, Young BG (2015) Characterization of PPO-inhibitor–
Xu J, Wang XY, Guo WZ (2015) The cytochrome P450 superfamily: key players in plant
development and defense. J Integr Agric 14:1673–1686
142
Table 4.1 Waterhemp control after treatment with a detoxification inhibitor followed by
fomesafen application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment.
Waterhemp controla
Population Detoxification inhibitor 0 g ai ha-1 20 g ai ha-1 60 g ai ha-1
-----------------%-----------------
IN-RAN Both 12 abc 94 a 97 ab
Malathion 4c 67 bcd 100 a
NBD-Cl 23 ab 87 a 98 ab
None 0c 88 a 98 ab
IA-340 Both 2c 91 a 97 ab
Malathion 2c 93 a 100 a
NBD-Cl 3c 87 a 98 ab
None 0c 86 ab 100 a
IL-BRO1 Both 5 bc 47 efg 70 c-f
Malathion 3c 49 d-g 51 fg
NBD-Cl 1c 36 g 54 efg
None 0c 40 fg 58 d-g
IN-PIKE Both 3c 48 d-g 65 c-g
Malathion 2c 45 efg 66 c-g
NBD-Cl 3c 39 fg 59 d-g
None 0c 37 g 67 c-f
IL-WAS Both 6 abc 47 efg 73 cde
Malathion 0c 47 efg 59 d-g
NBD-Cl 1c 38 g 47 g
None 2c 35 g 54 fg
IN-DUB Both 25 a 75 abc 77 cd
Malathion 26 a 67 bcd 80 bc
NBD-Cl 13 abc 58 c-f 76 cd
None 0c 63 cde 76 cd
a
Means within a column followed by the same letter are not significantly different
according to Tukey’s HSD test at α=0.05.
143
Table 4.2. Waterhemp height and biomass after treatment with a detoxification inhibitor
followed by fomesafen application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment.
Heighta Biomassb
Detoxification 0 g ai 20 g ai 60 g ai 0 g ai 20 g ai 60 g ai
inhibitorc ha-1 ha-1 ha-1 ha-1 ha-1 ha-1
---------------cm--------------- ----------------%----------------
Both 23.1 b 12.2 b 9.3 b 84 c 34 b 28 ns
Malathion 24.4 ab 13.0 b 9.9 ab 94 ab 36 b 28
NBD-Cl 23.8 b 15.4 a 11.0 a 87 bc 45 a 34
None 26.0 a 14.9 a 10.2 ab 100 a 44 a 27

a
Means within a column followed by the same letter are not significantly different according
to Tukey’s HSD test at α=0.05.
b
log transformation was used for mean separation and presented as untransformed means for
ease of interpretation.
c
Effect of detoxification inhibitor presented and pooled over population due to insignificant
two-way interaction of detoxification inhibitor and population.
144
Table 4.3. Waterhemp height and biomass after treatment with a detoxification inhibitor
followed by fomesafen application at 0, 20, or 60 g ai ha-1 accessed 14 days after treatment.
Heighta Biomassb
Populationc 0 g ai ha-1 20 g ai ha-1 60 g ai ha-1 0 g ai ha-1 20 g ai ha-1 60 g ai ha-1
---------------cm--------------- ----------------%----------------
IN-RAN 21.6 b 6.3 c 1.8 c 77 b 14 c 9b
IA-340 26.2 a 7.4 c 2.3 c 93 a 15 c 7b
IL-BRO1 26.6 a 18.4 a 16.6 a 90 a 49 ab 42 a
IN-PIKE 25.7 a 18.5 a 14.3 a 95 a 58 a 41 a
IL-WAS 26.0 a 19.6 a 15.7 a 95 a 56 a 39 a
IN-DUB 19.9 b 12.9 b 9.7 b 98 a 46 b 37 a

a
b
Log transformation was used for mean separation and presented as untransformed means for ease
of interpretation.
c
Effect of population presented and pooled over detoxification inhibitor due to insignificant two-
way interaction of detoxification inhibitor and population.
145
Figure 4.1. Isolated lesions on waterhemp leaves occurring after NBD-Cl application. Photo taken
at 48 h after treatment.
146
147
Figure 4.2. The IL-WAS waterhemp population was sprayed with detoxification inhibitor treatments followed by 60 g ha-1 of fomesafen.
Plants portrayed in the photographs are replications of the same treatment. Scale bar shown on the left of each photograph is equal to
12.6 cm
INVESTIGATIONS OF PPO-INHIBITOR RESISTANCE
IN WATERHEMP (AMARANTHUS TUBERCULATUS) LACKING
KNOWN RESISTANCE-CONFERRING MUTATIONS
5.1 Abstract
Protoporphyrinogen oxidase (PPO)-inhibitor resistance in Amaranthus species has evolved
beyond just the presence of the ΔG210 mutation. Multiple target-site mutations, double mutants,
and non-target-site resistance have been identified. We have identified several populations of
waterhemp [Amaranthus tuberculatus (Moq.) J.D.Sauer] with individual plants that display a
resistance phenotype to fomesafen that do not have the ΔG210 mutation. Our objective was to
determine if non-target-site resistance was present at low frequency in the observed populations.
A purifying selection and preliminary screen were conducted to identify resistant waterhemp
individuals from these populations and perform a seed increase. Resistant plants from four
populations were identified that did not have ΔG210 or R128 mutations. Full-length PPX1 and
PPX2 genes were sequenced, and there were no mutations that were likely to be causal for the
putative novel resistance mechanism. Progeny were grown and subjected to a dose-response assay.
At onset of plant symptom development from fomesafen, the populations with a putative novel
resistance mechanism displayed a unique phenotype. The putative novel resistant individuals
displayed initial phytotoxicity symptoms indistinguishable from the S through 5 to 7 d after
treatment, but eventually exhibited plant regrowth and survival (delayed regrowth phenotype). In
contrast, plants with the ΔG210 mutation had noticeably less phytotoxicity immediately upon
herbicide symptom onset. Models for lethal dose (LD) indicate a less robust R phenotype than
148
ΔG210, with LD50 ratios of only 1.9- to 6.1-fold vs 19- to 27-fold resistance in the ΔG210
populations. A target site expression experiment and lipid peroxidation experiment were
inconclusive, but provided some evidence of increased target-site expression or increased
antioxidant capacity as causal mechanisms, although no mechanisms have been fully ruled out.
This unique mechanism may be a component of a multigenic resistance complex, multiple
resistance from other sites of action, or a precursor to a more robust resistance phenotype.
5.2 Introduction
Protoporphyrinogen IX oxidase (PPO)-inhibiting herbicides are an important tool for weed
management in global agriculture (Hao et al. 2011). Despite their usage in multiple crops since the
1970s, PPO-inhibitor resistance is relatively uncommon, with 14 resistant species globally (Heap
2023). Most of these species have been confirmed as resistant in the past 10 years due to the
increased use of PPO inhibitors as a response to glyphosate resistance, particularly in waterhemp
[Amaranthus tuberculatus (Moq.) J.D.Sauer] and Palmer amaranth (Amaranthus Palmeri S. Wats)
(Legleiter et al. 2009, Young 2006). Waterhemp is a problematic weed native to the Midwest
capable of producing over 500,000 seeds per plant (Heneghan and Johnson 2017). It is one of the
most troublesome and most problematic weeds in the Midwest region primarily because of its
propensity to evolve herbicide resistance. To date, resistance to herbicides targeting seven different
sites of action have been confirmed in waterhemp (Heap 2023). With the evolution of glyphosate
resistance in waterhemp and other key species, growers responded by increasing usage of
alternative herbicides and use patterns, including PPO inhibitors applied both PRE and POST
(NASS 2020).
Resistance to PPO inhibitors is conferred primarily by target-site mutations. There are two
PPO isoforms in plants. PPO1 is encoded by the PPX1 gene and is localized to the chloroplast.
149
PPO2 is encoded by the PPX2 gene and is localized to the mitochondria and the chloroplast
(Lermontova et al. 1997, Watanabe et al. 2001). The first species confirmed as resistant was
waterhemp in 2001 (Shoup et al. 2003). The mechanism of resistance was later confirmed to be a
deletion of a glycine codon at the 210th position in the PPX2 gene (ΔG210), leading to a change in
binding site geometry (Dayan et al. 2010, Porri et al. 2022). Other resistance-conferring mutations
in the PPX2 gene include R128 (or equivalent) in waterhemp, Palmer amaranth, redroot pigweed
(Amaranthus retroflexus L.), common ragweed (Ambrosia artemisiifolia L.), and wild poinsettia
(Euphorbia heterophylla L.) (Giacomini et al. 2017, Jiang et al. 2021, Mendes et al. 2020, Nie et
al. 2019, Rousonelos et al. 2012). Palmer amaranth has also evolved resistance via a G399A
mutation in PPX2 (Rangani et al. 2019). In goosegrass [Eleusine indica (L.) Gaertn.], An A212T
mutation in the PPX1 gene has been shown to confer resistance to oxadiazon (Bi et al. 2019).
PPO-inhibitor resistance is not limited to target-site mutations. A survey of Palmer amaranth
accessions from around the mid-south revealed multiple populations, particularly in Mississippi,
that had no target-site resistance alleles, yet had a PPO-inhibitor-resistant phenotype (Noguera et
al. 2021). Another Palmer amaranth population from Arkansas was also shown to be resistant to
PPO inhibitors, but had no target-site mutations (Varanasi et al. 2018). In waterhemp, a population
susceptible to fomesafen, and resistant to carfentrazone-ethyl contained no resistance mutation in
the PPX2 gene, indicating the possibility of non-target-site resistance as well (Obenland et al.
2019).
In a recent survey of PPO-inhibitor-resistant waterhemp, we have observed multiple
populations that have a low frequency of plants exhibiting a resistant phenotype that is not
explained by ΔG210 or R128 mutations (Mansfield 2021, Nie et al. 2019). While the populations
had individuals possessing ΔG210 alleles, genotyping of individual plants did not explain the
150
resistant phenotype of multiple plants. The consistent and repeatable observation of these plants
in multiple experiments indicates that no genotyping errors occurred.
Potential causes for the observed phenotype are previously uncharacterized target-site
mutations, increased expression of the target enzymes, or non-target-site related responses (Gaines
et al. 2020). Non-target-site resistance is most often the evolved ability to metabolize the herbicide
via phase I or phase II enzymes (Dimaano and Iwakami 2021, Gaines et al. 2020, Jugulam and
Shyam 2019). However, other mechanisms are possible including herbicide sequestration, reduced
uptake or translocation, or ROS scavenging to prevent cell damage (Dayan et al. 2019, Gaines et
al. 2020). Non-target-site resistance is increasingly common in many weed species, including
waterhemp. Non-target-site resistance has been confirmed to HRAC groups 5, 15, and 27 in
waterhemp, while in other species, non-target-site resistance has been confirmed for nearly every
herbicide site of action group (Heap 2023, Ma et al. 2013, Strom et al. 2020). A potentially
disastrous scenario is a resistance event that confers cross-resistance to herbicides of multiple
modes of action. Dimaano et al. (2020) demonstrated a single CyP450 enzyme capable of
metabolizing multiple herbicide groups when expressed in Escherichia coli. Many herbicides of
different chemical families possess similar moieties that may be recognizable by a single
overexpressed CyP450 or GST enzyme. For example, fomesafen is a diphenyl-ether herbicide. In
addition to other diphenyl-ether PPO inhibitors, 13 herbicides from 4 different sites of action have
ether linkages of phenyl- or heterocyclic-ring structures (Shaner 2014).
Investigations of resistance mechanisms in our surveyed populations have been relatively
narrow. Nie et al. (2018) sequenced the R128 region of multiple populations and confirmed the
absence of any mutations in that region of the PPX2 gene. Mansfield (2021) investigated the
potential for ROS scavenging as a potential contributor to PPO-inhibitor resistance and did not
151
observe any consistent trends. However, given the low frequency of these anomalous resistant
individuals, it is possible that a measurable effect was diluted with susceptible or ΔG210
individuals. The objectives of this research are to isolate and confirm PPO-resistant individuals in
select populations of waterhemp from the 2016 survey, confirm the presence or absence of
potential resistance conferring target-site mutations, perform a purifying selection, and
characterize the resistance response in a more purified population.
5.3.1 Preliminary Purifying Screen
A greenhouse experiment was conducted in the spring of 2022 to investigate anomalous
resistant individuals in select populations of waterhemp sourced from a 2016 survey of PPO-
inhibitor resistance and an Indiana field population with suspected multiple resistance to several
herbicide groups. The populations from the survey were sourced from Cerro Gordo (IA-340)
(43.17.122, -93.20.368), Chickasaw (IA-369) (43.04.682, -92.38.010), and Wayne (IA-358)
(40.754844, -93.286675) Counties in Iowa, USA. The Indiana field population was sourced from
near Francesville, IN (Fran) (40.91, -86.89). The four subject populations were compared to a
known PPO-inhibitor susceptible population sourced from near Desoto, IL (Des) and a known
resistant population with nearly 100% frequency of the ΔG210 mutation sourced from near Carlyle,
IL (Car).
Seeds of each population were treated with 20% sodium hypochlorite solution for 10
minutes and sown for germination in flats containing a peat moss-based potting mix (Sunshine®
Mix#5; Sun Gro Horticulture, Agawa, MA). Approximately 1 week after sowing, seedlings at the
1 leaf stage were transplanted into 10 cm square pots filled with a mixture of two parts peatmoss-
152
based potting mix and one part sand. Pots were watered as needed and fertilized weekly with a
micro- and macronutrient fertilizer (Jack’s Classic Professional 20-20-20, JR Peters Inc.,
Allentown PA) throughout the course of the experiments. Greenhouse environmental conditions
included 16:8 light/dark photoperiods, where natural light was supplemented with high-pressure
sodium bulbs delivering 1100 μmol m-2 s-1 photon flux during daylight hours, and day/night
temperatures of 30 and 25C, respectively.
Plants were grown until the 7 to 9 leaf stage, at which point, plants from each population
were treated with one of four rates of fomesafen (Flexstar®, Syngenta Crop Protection, LLC,
Greensboro, NC) with crop oil concentrate (Prime Oil®, Winfield Solutions, LLC, St. Paul, MN)
at 1% v/v. Herbicide treatments were applied using a track-mounted research sprayer (Generation
III Research Sprayer, DeVries Manufacturing, Hollandale, MN) calibrated to deliver 140 L ha-1 at
207 kPa via an even flat fan XR8002E (TeeJet Technologies, Glendale Heights, IL) nozzle. Rates
of fomesafen were 0, 20, 60, or 100 g ai ha-1 in the first experimental run. Due to greater than
desired phytotoxicity, the 100 g ha-1 rate was replaced with 40 g ha-1 in the second run. Each
treatment had 10 replications in each experimental run.
Visual estimates of waterhemp control were recorded as well as a qualitative assignment
of a resistant (R) or susceptible (S) phenotype at 7 and 14 days after treatment. At 14 days after
treatment, leaf tissue from all surviving plants was collected for DNA extraction and qPCR assays
for the ΔG210 mutation. Based on phenotypic assignment, (R or S) as well as PCR genotype data,
plants were separated into 3 groups of susceptible (ΔG210 absent and S phenotype), ΔG210
resistant (ΔG210 present), and putative novel R mechanism (ΔG210 absent and R phenotype).
Data were subjected to ANOVA and control means were separated using Tukey’s HSD (α=0.05).
153
DNA was extracted using a modified cetyltrimethylammonium bromide (CTAB) protocol
originally designed by Saghai-Maroof et al. (1984). A TaqMan® SNP genotyping assay developed
by Wuerffel et al. (2015a), modified by Giacomini et al. (2017), and sourced from ABI (Applied
Biosystems Inc. Grand Island, NY) was used to genotype each sample as homozygous susceptible,
homozygous resistant, or heterozygous based on fluorescence of specific fluorophores in the
presence of a PCR product generated with forward primer (5′- TGATTATGTT
ATTGACCCTTTTGTTGCG) and reverse primer (5′ GAGGGAGTATAATTTATTTA
CAACCTCCAGAA). For each sample, a 10 µl reaction was prepared with 4.8 µl of nuclease free
nano-pure water, 2 µl of GoTaq Flexi buffer, 1.2 µl of 25 mM MgCl2, 0.4 µl of 10 mM dNTP, 0.5
µl of 20X primers and TaqMan® probes, 0.1 µl of GoTaq Flexi polymerase (5 U µl−1), and 1 µl
of genomic DNA. Reactions were amplified using a CFX384 RT-PCR detection system (Bio-Rad
Laboratories, Hercules, CA) with the following cycle conditions: 2 min at 95 C; 39 cycles of 95 C
for 15 s and 60 C for 1 min; followed by a plate read after every cycle.
All plants with the putative novel R mechanism as well as two non-treated plants from each
population were repotted into four-liter pots filled with the same 2:1 potting mixture. Each
population was isolated to its own greenhouse room with no other flowering stage Amaranthus
plants. Plants were fertilized to encourage growth and allowed to randomly mate with plants of the
same population. If any of the non-treated plants were male, they were discarded, but females were
allowed to be pollinated and produce seed. By chance, only female plants were acquired from the
IA-358 population that had no ΔG210 alleles and had the putative novel R mechanism, so those
plants were pollinated by the IA-340 population. Therefore, all progeny of the IA-358 population
are actually a one-way cross of IA-340 males and IA-358 females. At seed maturity, plants were
harvested, dried, threshed, and sieved to obtain seed from each plant. The same quantity of seed
154
from each plant (excluding non-treated) was blended to create the progeny populations used for
subsequent experiments.
5.3.2 Gene Sequencing and PCR Reactions
Prior to fomesafen application, an immature leaf was collected from each plant and placed
into a 1.5ml tube, flash frozen in liquid N2 and stored at -80C until RNA extraction was performed.
Total RNA was extracted from all plants having the putative novel R mechanism as well as one
known resistant plant from the Car population, one known susceptible plant from each subject
population and the known S population, and the female untreated plants from each subject
population. RNA was extracted using the RNeasy plant mini kit (Qiagen, Hilden, Germany) then
cleaned using RNA Clean and Concentrator kit (Zymo Research, Irvine, CA). A cDNA library for
each plant was created using Protoscript® First Strand cDNA Synthesis kit (New England Biolabs,
Ipswich, MA). Each cDNA library was used as a template for PCR reactions to amplify the coding
sequence for the PPX1 and PPX2 genes. Each reaction consisted of 25 µl Q5® Hot Start High-
Fidelity 2X Master Mix (New England Biolabs, Ipswich, MA), 19 µl of nuclease free water, 1 ul
of template cDNA, and 2.5 µl each of forward and reverse primers diluted to 10 µM (Integrated
DNA Technologies, Skokie, IL). Primer sequences are as follows: PPX1 (forward, 5′-
ATGAGTGCGATGGCGTTATCGAGC-3′; and reverse, 5′- CTACTTATCTTTGTACTGTG
AGAGGAAATCC-3′); PPX2 (forward, 5′- ATGGTAATTCAATCCATTACCCACCTT
TCACC-3′; and reverse, 5′- TTACGCGGTCTTCTCATCCATCTTCACG-3′). PCR reactions
were performed in a SimpliAmp thermal cycler (Applied Biosystems, Waltham, MA) with the
following conditions: 95 C for 30 s; 30 cycles of 98 C for 10 s, 60 C for 30 s, and 72 C for 50s;
and 72 C for 2 min. A sample of each PCR product was placed on a gel and confirmed to have a
single product of between 1600 and 1700bp. The PCR product was purified using Wizard® SV
155
gel and PCR Clean-Up System (Promega, Madison, WI). Purified PCR products were submitted
to Purdue Genomics core for sequencing using Illumina MiSeq system (Illumina, San Diego, CA).
WideSeq libraries were constructed using the Illumina DNA Prep Kit, followed by sequencing on
a 500 cycle MiSeq cassette. Obtained sequences were aligned in Benchling (https://benchling.com)
with previously submitted waterhemp and Palmer amaranth PPX1 and PPX2 sequences to identify
any amino acid codon polymorphisms.
5.3.3 Dose-Response Assays
Dose-response experiments were conducted in the fall of 2022 on the progeny populations
and compared to the same known R and S populations described previously, as well as a second
known PPO-inhibitor resistant population sourced from Washington County, IL (Was) (38.432254,
-89.628843). Seeds were grown as described previously with the exception of being transplanted
into 164 ml cone-tainers (Ray Leach SC-10 Super Cell Cone-tainers; Stuewe & Sons, Tangent,
OR) rather than 10 cm square pots. Fomesafen was applied as described previously at the 5 to 7
leaf stage at one of seven fomesafen rates in addition to a nontreated treatment in a half-log dose
structure. The S (Des) population received rates from 0.2 to 200 g ha-1 while all other populations
received 0.63 to 632 g ha-1. Visual assessment of waterhemp control was taken at 3, 7, and 14 days
after treatment. Also, at 14 days after treatment, aboveground tissue was clipped at the soil surface
and dried at 60C for dry biomass measurement. Biomass data were converted to a % of the non-
treated control for model fitting. Control data were used to assign a binary value of 0 or 1 for alive
or dead to model lethal dose. Data were used to fit 3 parameter log logistic models (Equation I):
𝑑−𝑐
𝑓(𝑥) = [1]
1+exp (𝑏(log(𝑥)−log (𝑒)))
156
where b is the slope of the curve, c is the lower asymptote, d is the upper asymptote, and e is the
herbicide rate required to produce 50% effective dose, which were GR50 or LD50 values. Models
were fitted using the drc package in R 3.5.2 (Knezevic et al. 2007, Ritz et al. 2015). Data were
pooled over experimental runs after validating lack of run interactions with ANOVA (α = 0.05).
Calculated GR50 and LD50 values were used to quantify resistance for each population. Statistical
comparisons were made using the compParm function within the drc package.
5.3.4 Gene Expression Assay
To test for expression differences of target-site genes between populations, qPCR assays
were conducted similar to Montgomery et al. (2020). Young leaf tissue was collected from 12
plants of each population utilized in the dose-response experiments. After tissue collection,
waterhemp plants were sprayed with fomesafen at 20 g ha-1 and assigned control ratings at 14 days
after treatment. Tissue was used for RNA extraction and creation of cDNA libraries as described
previously. The cDNA was used as template for qPCR gene expression assays. Primer sequences
utilized were identical to Montgomery et al. (2020) and were as follows: PPX1 (forward, 5’ -
TGCTTACTATGGCGGTTGAC-3’ ; and reverse, 5’ -CCGTAGGTTTGGAAGGAACA-3’ );
PPX2 (forward, 5’ -TGTGGTTGTCACTGCTCCA-3’ ; and reverse, 5’ -GGGGATAAG
AACTCCGAAGC-3’); EF1-alpha (forward, 5’ -CACGCTTTGCTTGCTTTCACTCT TG-3’ ;
and reverse, 5’ - CGATTTCATCGTACCTAGCCTTGGAGTAC -3’). The primers were designed
for Palmer amaranth, but all three primer sets were confirmed to also be an exact match for
waterhemp based on the obtained PPX1 and PPX2 sequences as well as the publicly available
waterhemp reference genomes. Each qPCR reaction consisted of 5 μl iTaq Universal SYBR Green
Supermix (Bio-Rad, Hercules, CA), 1 μl forward primer and 1 μl reverse primer, diluted to 10 μM
(Integrated DNA Technologies), 1 μl template cDNA, and 2 μl water. Assays were conducted with
157
a Quant Studio 6 flex real time PCR system with the following thermoprofile: 95 C for 30 s, 35
cycles of 95C for 15 s and 60C for 30 s followed by a melt curve analysis. The experiment utilized
6 biological replicates and 3 technical replicates. Relative expression was calculated using the
ΔΔCT method. Expression of each target-site gene was normalized to the S population and mean
fold expression differences were calculated. Data were subjected to ANOVA and means were
separated using Tukey’s HSD (α=0.05).
5.3.5 Lipid Peroxidation Assay
To quantify lipid peroxidation, an assay of malondialdehyde, a byproduct of lipid
peroxidation, was conducted based on methods described by Harre et al. (2018) and Mansfield
(2021), which were adapted from methods by Zhang and Kirkham (1996). Waterhemp plants from
Fran, IA-369, Des, and Car were grown as described previously. Plants were sprayed at the 5 to 7
leaf stage with fomesafen at 20 g ai ha-1. At 0, 12, 24, and 48h after fomesafen treatment, plants
were segmented into three component tissue types of stem, mature leaf, and meristem/immature
leaf. Each tissue type was placed in an aluminum foil envelope, flash frozen in liquid N2 and stored
at -80C until MDA assay was conducted.
Trichloroacetic acid (TCA) solution (0.1%) was added to fresh waterhemp tissue ground in
liquid N2 with a mortar and pestle at approximately 1 ml per 0.1 g of tissue. Stem and leaf samples
typically had a mass of approximately 0.1 g whereas meristem samples only had mass of
approximately 0.05g. Therefore, stem and leaf sample vials received 1 ml of TCA solution and
meristem sample vials received 0.5 ml of TCA solution. Exact mass of tissue in each sample was
recorded for later calculations. Tissue-TCA mixture was vortexed vigorously and centrifuged at
10,000 g for 10 minutes at room temperature. The supernatant was collected and 200 µl was added
to 800 µl of 0.5% thiobarbituic acid dissolved in 20% TCA solution. Samples were placed in a
158
95C water bath for 30 minutes, then rapidly chilled in an ice bath for 5 minutes. After cooling,
samples were centrifuged at 10,000 g for 10 minutes. Supernatant was placed in a 350 µl
polypropylene 96 well plate. Absorbance at 532 and 600 nm was recorded with a Multiscan™ Sky
spectrophotometer (Thermo Scientific, Waltham, MA). Nonspecific absorption at 600 nm was
subtracted from the reading at 532 nm and the MDA concentration was calculated using an
extinction coefficient of 155 mM-1 cm-1. The experiment was repeated twice and utilized a split
plot design where main plot was collection timing and sub plot was population. Each tissue type
and herbicide rate were analyzed separately as a two-way ANOVA with population and harvest
timing as main effects and replication nested within experimental run as a random effect. Means
were separated using Fishers protected LSD (α = 0.05).
5.4.1 Preliminary Purifying Screen
To identify resistant individuals, waterhemp was treated with one of four fomesafen rates.
After assigning each plant to a resistance group of ΔG210, putative novel R mechanism, and
susceptible, waterhemp population was not a significant term in the model, so waterhemp control
is pooled across populations. The number of waterhemp assigned to each group from each
population is shown in Table 5.1. Control increased with increasing herbicide rates (Figure 5.1).
At the 20 and 40 g ha-1 fomesafen rates, individuals with putative novel R mechanism were
controlled less than susceptible individuals, but more than ΔG210 individuals indicating an
intermediate resistance phenotype. At higher herbicide rates, high levels of control and waterhemp
lethality resulted in fewer differences between treatments.
159
5.4.2 Target-Site Gene Sequencing
From the individuals with putative novel R mechanism in the screening, a number of the
most resistant plants were kept for seed production and gene sequencing. The sequences used for
basis of comparison were from a number of published sequences from Palmer amaranth and
waterhemp (Giacomini et al. 2017, Patzoldt et al. 2006, Rangani et al. 2019, Varanasi et al. 2018),
as well as a known susceptible and known ΔG210 from the Des and Car populations. From the
nearly full-length target gene sequences obtained, a number of deduced amino acid polymorphisms
were observed (Table 5.2, Table 5.3). However, none of the polymorphisms explained the resistant
phenotype in either PPX1 or PPX2 genes. Special attention was given to the R128, and G398
(equivalent to Palmer amaranth G399) regions of PPX2 as well as the A235 region (equivalent to
A212 in goosegrass) of PPX1. All of the observed amino acid polymorphisms were present in
known susceptible plants from the current experiment, present in a previous sequence submission,
or the mutation was an extremely similar functioning residue which is less likely to cause
alterations to the protein.
An interesting observation was made regarding the sequence conservation of the PPX2 gene.
Similar to the findings of Nie et al. (2019), there were distinct types of PPX2 alleles that had a
specific subset of mutations that were also present in other Amaranthus species, but not other
waterhemp accessions (Figure 5.2). In fact, many of the observed mutations recorded in Table 5.2
are actually wild-type Palmer amaranth amino acid residues. The most conserved feature of the
novel waterhemp allele is a glycine insertion at position 251. This glycine insertion was apparently
a prerequisite to the majority of the other observed mutations. The same pattern was not observed
with PPX1. There were drastically fewer mutated positions overall compared to PPX2, and very
few of those mutations matched Palmer amaranth or other Amaranthus species’ PPX1 sequences.
Additionally, nearly all of the plants with Palmer amaranth-type alleles were heterozygous for the
160
wild-type allele and the Palmer amaranth allele. Presence of the Palmer amaranth allele did not
appear to be related to our putative novel R phenotype. There were several resistant individuals
that were homozygous wild type and several known susceptible plants that were heterozygous.
This observation indicates a recent invasion of the novel genotype that may not be related to PPO-
inhibitor resistance. The different alleles could be from the recent hybridization between common
and tall waterhemp subspecies (Kreiner et al. 2021, Waselkov et al. 2020, Waselkov and Olsen
2014). Another potential contributor may be spread of resistant ALS alleles which are linked to the
PPX2 gene (Tranel et al. 2017). An experiment utilizing bioinformatics such as a genome wide
associative study could reveal a broader invasion and evolutionary picture related to the spread of
herbicide resistance.
5.4.3 Dose-Response Assays
A dose-response assay of the progeny generation of the four putative novel R mechanism
populations compared to a known susceptible and two known resistant populations was conducted.
At 24 hours after application, there was an apparent absence of a resistant phenotype in the four
subject populations whereas the two known resistant populations displayed the characteristic lack
of immediate phytotoxicity (Figure 5.3). The subject populations incurred an equal amount of
initial phytotoxicity as the susceptible population and that lasted 5 to 7 days after treatment (Figure
5.4). However, by 14 days after treatment, substantial regrowth occurred in the subject populations,
but not the susceptible population, particularly at the 20 and 60 g ha-1 dose (Figure 5.5). The initial
phytotoxicity followed by regrowth resulted in an insignificant R/S ratio for the three IA
populations when fitted with biomass data (0.6- to 1.2- fold) (Figure 5.6, Table 5.4). Only the
Francesville population had a significant R/S ratio of 1.8- fold while the known resistant
populations were 4.9- and 9.7- fold resistant. Even though Francesville R/S ratio rose to statistical
161
significance, this observed resistance phenotype may not necessarily be meaningful in a field
setting. However, with models fitted using survival data, there is a drastic increase in the observed
R/S ratio for all populations, particularly the four subject populations (Figure 5.7, Table 5.4). R/S
ratios ranged from 1.9- to 8.6- fold in the subject populations while known resistant populations
were 19- and 27- fold resistant. Francesville had the greatest resistance of subject populations in
the waterhemp survival model as well.
With the unique phenotype of the subject populations, the insignificant R/S ratios are not
entirely unexpected. First, these populations are known to have a resistant phenotype that is less
robust than the ΔG210, so the maximum R/S ratio we could have observed was less than what was
observed in the known resistant population (4.9-fold). Secondly, the experiment was not designed
to capture the observed differences. The regrowth phenotype that we observed in the dose-response
experiment was not an expected response. Target-site resistance mutations cause a noticeable lack
of phytotoxicity (under our treatment conditions) that allows them to keep growing while
susceptible individuals suffer growth reduction. Unlike target-site resistant populations, the subject
populations suffered the same initial growth reduction as susceptible plants and only had 7 to 10
days to regenerate biomass. Biomass accumulation can be affected by many factors including
experimental design choices and growing conditions (Burgos et al. 2013, Schafer et al. 2012).
Perhaps a superior design for the dose-response experiment could have implemented a longer
evaluation window.
Even though GR50 is the preferred resistance metric for POST herbicide dose responses, it
does not adequately capture the resistance that we observed (Burgos et al. 2013). On the other
hand, LD50 is another common metric for quantifying resistance and arguably the most important.
In a field setting, surviving the herbicide application is the most important objective because weeds
162
have the ability to recover from defoliation and phytotoxicity in order to produce seed (Baysinger
and Sims 1992, Hartzler and Battles 2001, Mager et al. 2006). In these same populations, plants
that incurred 85 to 90% injury were observed to grow to 1 meter or more and produce large
quantities of seed. One of the mechanisms of glyphosate resistance in giant ragweed (Ambrosia
trifida L.) is a triggered rapid necrosis response (RR) where ROS generation causes defoliation
and prevents glyphosate translocation (Van Horn et al. 2018). Harre et al. (2017) observed that
R/S ratios of RR giant ragweed were greater than non-RR giant ragweed in a 21 day experiment.
Presumably, the observed magnitude of resistance would have been smaller if plants were not
given enough time to recover from the defoliation.
Out of the four populations, Fran, followed by IA-369, had the most robust resistance,
whereas IA-358 barely showed any resistance. The differences in populations are impossible to
know without further studies, but we speculate that genetic background is contributing to our
results. Fran is a population that is currently being investigated for resistance to multiple sites of
action, including HPPD inhibitors, dicamba, and atrazine (Bland et al. 2022). Perhaps genes
implicated in resistance to other chemistries are playing a role in the resistance observed in the
Fran population. Field histories of the IA populations are unknown, so we have less insight into
those populations. However, since the IA-358 is not a pure population, but rather a hybrid of IA-
358 and IA-340, perhaps the outcross with another population disrupted the resistance phenotype
because the trait is potentially recessive, less dominant, or multigenic.
Even with the more robust quantification of resistance with LD50 values, the magnitude of
resistance is still relatively weak. It is possible that the resistance trait is part of a multigenic
resistance complex or is a precursor to a more robust resistance mechanism. Secondary partial
resistance to PPO inhibitors in Amaranthus species has been theorized by several authors
163
(Montgomery et al. 2020, Noguera et al. 2021, Wuerffel et al. 2015b) and multiple mechanisms of
resistance have been documented in the same redroot pigweed individuals (Cao et al. 2022). The
ΔG210 mutation was present in 3 of the 4 populations during the initial screening experiment and
PPX2 sequence data indicates high heterozygosity and recent invasion. Perhaps these populations
were recently invaded by a multigenetic PPO-resistant biotype. As a select few plants reproduce,
the ΔG210 and secondary resistance mechanism would segregate producing the few individual
resistant plants observed in these populations.
5.4.4 Gene-Expression Assay
A constitutive gene expression assay of PPX1 and PPX2 genes was conducted to rule out
potential target-site resistance not caused by a target-site mutation. There were no differences in
expression of PPX2 between the susceptible population and any other population (Figure 5.8).
However, the IL-WAS population, previously characterized as being highly resistant in
comparison to other populations with ΔG210, had significantly greater expression than IA-358 by
2.2 fold.
The F test for PPX1 expression was not significant at the typical α of 0.05 (P=0.0771).
However, there is some indication of increased PPX1 expression in the IA-369 population.
Expression of IA-369 ranged from 0.7 to 4 fold relative to Des population with an average of 2.0
fold. The other subject populations had an average PPX1 expression of 1.1- to 1.2- fold. Other
groups that have assayed PPX1 and PPX2 gene expression have reported a high variance similar
to the current experiment, but no others have reported any remote indication of increased
expression (Borgato 2022, Montgomery et al. 2020, Varanasi et al. 2018). Both glyphosate and
glufosinate resistance in Amaranthus species is caused by increased expression of the respective
target-site genes of EPSPS and GS2 (Carvalho-Moore et al. 2022, Chatham et al. 2015, Gaines et
164
al. 2010). The increased expression of each respective target-site in resistant plants is upwards of
10-fold or greater. In the case of glyphosate, there is also a strong linear relationship between
EPSPS expression and resistance phenotype (Gaines et al. 2010). In the present study, we observed
only a 2-fold increase in one of the target-site genes, which did not have a linear relationship with
waterhemp control (data not shown). Also, there was no evidence of increased expression in the
other three populations with a similar phenotype. Despite these inconsistencies, there could be
multigenic factors that are contributing to the resistance phenotype. For instance, the total target
enzyme content is not necessarily the same as expression. Secondly, the interaction of PPX1 and
PPX2 at the subcellular level is not fully characterized, especially in the context of herbicide action
(Dayan et al. 2018). We find that this experiment is inconclusive and further studies should
investigate the potential contribution of increased PPX1 expression in IA-369 population toward
PPO-inhibitor resistance.
5.4.5 Lipid-Peroxidation Assay
A malondialdehyde (MDA) assay was conducted as an objective measure of phytotoxicity
in the period after fomesafen application. Malondialdehyde is a byproduct of lipid peroxidation
and can be used as a direct measure of damage from PPO-inhibitor activity. Mature leaf tissue
accumulated more MDA than meristem and young leaf tissue (Figure 5.9). There was no
meaningful change in the detected level of stem MDA content, so that data is excluded from
analysis. Des and Car MDA contents were different at all treatment collection timings. At 12 hours
after treatment, IA-369 and Fran had more MDA content than Car by 23 to 37%, but less MDA
than Des by 26 to 32% in both tissue types. Later collection timings indicated MDA content in
Fran and IA-369 approaching that of Des by 24 HAT in meristem tissue and by 48 HAT in leaf
tissue. Overall, results indicate less rapid lipid peroxidation as shown by MDA content in
165
Francesville and IA-369 populations in the first 12 to 24 hours after fomesafen application, but the
phytotoxicity eventually reaches similar levels as Des. This less rapid MDA accumulation is a new
finding that was not noticeable by visual assessment. The delayed lipid peroxidation relative to the
susceptible may allow the plants time to induce a survival response that allows for survival and
regrowth. Results indicate that despite having a similar appearance in the first hours after
fomesafen treatment, there is a difference in physiological response.
Further research is required to determine the cause of these observations, but some
inferences can be drawn from the pattern of MDA accumulation. First, fomesafen metabolism is
likely not contributing to the resistance phenotype. If herbicide metabolism were occurring, then
the reduced MDA content would have persisted through the entire evaluation period, rather than
eventually rising to similar levels as the susceptible. Second, the mechanism must be a process
that delays phototoxicity. Delayed phytotoxicity is consistent with increased expression of a
susceptible target enzyme. Given that there was some evidence of increased expression in one of
the tested populations (IA-369), this hypothesis merits further investigation. ROS scavenging
could also contribute to less rapid phytotoxicity. Antioxidant enzymes are part of plants’ normal
metabolism (Gill and Tuteja 2010). Dayan et al. (2019) demonstrated that increased antioxidant
activity in plants can confer PPO-inhibitor resistance. Mansfield (2021) investigated increased
antioxidant activity in several populations, including the parent generations of the IA-369, IA-340,
and IA-358 populations. Results indicated no evidence of antioxidant activity contributing to PPO
resistance. However, given the number of populations tested and the low frequency of the resistant
phenotype in the subject populations, the experiment was likely not adequately designed to identify
and quantify differences in ROS in segregating populations. Experiments would have been better
suited for the progeny generation such as we described previously.
166
In this manuscript, we present a report of multiple waterhemp populations with a
significant but low-level fomesafen resistance phenotype. We found no evidence of causal target-
site mutations in either the PPX1 or PPX2 genes, but observed inconclusive evidence of increased
expression of PPX1 in one of the subject populations that warrants further investigation. A lipid
peroxidation assay indicated that Francesville and IA-369 populations incurred less lipid
peroxidation within the first 24 hours after treatment but eventually reached similar levels as the
susceptible population. Future experiments should utilize omics approaches, such as RNA seq, to
develop leads for further physiological experiments.
5.5 Acknowledgements
We want to thank Purdue Genomics core for target gene sequencing.
Baysinger JA, Sims BD (1992) Giant Ragweed (Ambrosia trifida) control in soybean (Glycine
max). Weed Technol 6:13–18
A novel mutation A212T in chloroplast protoporphyrinogen oxidase (PPO1) confers
resistance to PPO inhibitor oxadiazon in Eleusine indica. Pest Manag Sci 76:1786–1794
Bland CR, Young BG, Johnson WG, (2022) Characterization of six herbicide resistance traits in
an Indiana waterhemp population. Proceedings of the 2022 North Central Weed Science
Society Annual Meeting. St.Louis, MO: North Central Weed Science Society
Borgato EA (2022) Exploring the mechanisms of Palmer amaranth resistance to
protoporphyrinogen oxidase-inhibitor herbicides, dynamics of gender, and management
strategies. PhD dissertation. Manhattan KS: Kansas State University
20
167
Cao Y, Huang H, Wei S, Lan Y, Li W, Sun Y, Wang R, Huang Z (2022) Target gene mutation and
enhanced metabolism confer fomesafen resistance in an Amaranthus retroflexus L.
population from China. Pestic Biochem Physiol 188:105256
Carvalho-Moore P, Norsworthy JK, González-Torralva F, Hwang JI, Patel JD, Barber LT, Butts
TR, McElroy JS (2022) Unraveling the mechanism of resistance in a glufosinate-resistant
Palmer amaranth (Amaranthus palmeri) accession. Weed Sci 70:370–379
Chatham LA, Wu C, Riggins CW, Hager AG, Young BG, Roskamp GK, Tranel PJ (2015) EPSPS
gene amplification is present in the majority of glyphosate-resistant Illinois waterhemp
(Amaranthus tuberculatus) populations. Weed Technol 29:48–55
Dayan FE, Barker A, Dayan L, Ravet K (2019) The role of antioxidants in the protection of plants
against inhibitors of protoporphyrinogen oxidase. React Oxyg Species 7:55–63
Dimaano NG, Iwakami S (2021) Cytochrome P450-mediated herbicide metabolism in plants:

current understanding and prospects. Pest Manag Sci 77:22–32

Gaines TA, Duke SO, Morran S, Rigon CAG, Tranel PJ, Küpper A, Dayan FE (2020) Mechanisms
of evolved herbicide resistance. J Biol Chem 295:10307–10330
Gaines TA, Zhang W, Wang D, Bukun B, Chisholm ST, Shaner DL, Nissen SJ, Patzoldt WL,
Tranel PJ, Culpepper AS, Grey TL, Webster TM, Vencill WK, Sammons RD, Jiang J, Preston
C, Leach JE, Westra P (2010) Gene amplification confers glyphosate resistance in
Amaranthus palmeri. Proc Natl Acad Sci U S A 107:1029–1034
168
Gill SS, Tuteja N (2010) Reactive oxygen species and antioxidant machinery in abiotic stress
tolerance in crop plants. Plant Physiol Biochem 48:909–930
Harre NT, Nie H, Jiang Y, Young BG (2018) Differential antioxidant enzyme activity in rapid-
response glyphosate-resistant Ambrosia trifida. Pest Manag Sci 74:2125–2132
Harre NT, Nie H, Robertson RR, Johnson WG, Weller SC, Young BG (2017) Distribution of
herbicide-resistant giant ragweed (Ambrosia trifida) in Indiana and characterization of
distinct glyphosate-resistant biotypes. Weed Sci 65:699–709
Hartzler RG, Battles BA (2001) Reduced fitness of velvetleaf (Abutilon theophrasti) surviving
glyphosate. Weed Technol 15:492–496

Heneghan JM, Johnson WG (2017) The growth and development of five waterhemp (Amaranthus
tuberculatus) populations in a common garden. Weed Sci 65:247–255
Jiang X, Ju Q, Guo W, Li L, Qu C, Qu M (2021) Target-site basis for fomesafen resistance in

redroot pigweed (Amaranthus retroflexus) from China. Weed Sci 69:290–299

8:417
Knezevic SZ, Streibig JC, Ritz C (2007) Utilizing R software package for dose-response studies:
The concept and data analysis. Weed Technol 21:840–848
Kreiner JM, Tranel PJ, Weigel D, Stinchcombe JR, Wright SI (2021) The genetic architecture and
population genomic signatures of glyphosate resistance in Amaranthus tuberculatus. Mol
Ecol 30: 5373-5389
169
23:54–61
U S A 94:8895–8900
Mager HJ, Young BG, Preece JE (2006) Characterization of compensatory weed growth. Weed
Sci 54:274–281

University. 158 p
Mendes RR, Takano HK, Adegas FS, Oliveira RS, Gaines TA, Dayan FE (2020) Arg-128-Leu
target-site mutation in PPO2 evolves in wild poinsettia (Euphorbia heterophylla) with cross-
resistance to PPO-inhibiting herbicides. Weed Sci 68:437–444
Montgomery JS, Giacomini DA, Tranel PJ (2020) Molecular confirmation of resistance to PPO
inhibitors in Amaranthus tuberculatus and Amaranthus palmeri, and isolation of the G399A
PPO2 substitution in A. palmeri. Weed Technol:35:99–105
Manag Sci 75:3235–3244
occurrence in one plant or the same PPO2 allele of herbicide-resistant Amaranthus palmeri
in the US mid-south. Pest Manag Sci 77:1001–1012
170
Lerchl J (2022) Inhibition profile of trifludimoxazin towards PPO2 target site mutations. Pest
Plant Sci 10:568
Ritz C, Baty F, Streibig JC, Gerhard D (2015) Dose-Response Analysis Using R. PLoS One 10(12):
e0146021. https://doi.org/10.1371/journal.pone.0146021
Saghai-Maroof MA, Soliman KM, Jorgensen RA, Allard RW (1984) Ribosomal DNA spacer-
length polymorphisms in barley: mendelian inheritance, chromosomal location, and
population dynamics. Proc Natl Acad Sci U S A 81:8014–8018
Schafer JR, Hallett SG, Johnson WG (2012) Response of giant ragweed (Ambrosia trifida),
horseweed (Conyza canadensis), and common lambsquarters (Chenopodium album)
biotypes to glyphosate in the presence and absence of soil microorganisms. Weed Sci
60:641–649
America. 513 p
171
Tranel PJ, Wu C, Sadeque A (2017) Target-site resistances to ALS and PPO inhibitors are linked
in waterhemp (Amaranthus tuberculatus). Weed Sci 65:4–8

Agricultural chemical use program.
May 15, 2022
Van Horn CR, Moretti ML, Robertson RR, Segobye K, Weller SC, Young BG, Johnson WG,
Schulz B, Green AC, Jeffery T, Lespérance MA, Tardif FJ, Sikkema PH, Hall JC, McLean
MD, Lawton MB, Sammons RD, Wang D, Westra P, Gaines TA (2018) Glyphosate
resistance in Ambrosia trifida: Part 1. Novel rapid cell death response to glyphosate. Pest
Manag Sci 74:1071–1078

709
Waselkov KE, Olsen KM (2014) Population genetics and origin of the native North American
agricultural weed waterhemp (Amaranthus tuberculatus; Amaranthaceae). Am J Bot
101:1726–1736
Waselkov KE, Regenold ND, Lum RC, Olsen KM (2020) Agricultural adaptation in the native
North American weed waterhemp, Amaranthus tuberculatus (Amaranthaceae). PLoS ONE
15(9): e0238861. https://doi.org/10.1371/journal.pone.0238861
172
Zhang J, Kirkham MB (1996) Antioxidant responses to drought in sunflower and sorghum

seedlings. New Phytol 132:361–373
173
Table 5.1. Phenotypic assignment for each plant sprayed with fomesafen at 14 days after treatment.
Waterhemp Resistance Group Assignments After Treatment With Four Rates of Fomesafen
ΔG210a Unknownb Susceptiblec
20 g 40 ga 60 g 100 g 20 g 40 g 60 g 100 g 20 g 40 g 60 g 100 g
Population ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1 ha-1
------------------------------------------------No. of plants---------------------------------------------------------
Car 17 10 18 10 0 0 0 0 3 0 2 0
Des 0 0 0 0 0 0 0 0 20 10 20 10
174
Fran 13 9 14 7 3 1 2 0 4 0 4 3
IA-340 0 0 0 0 3 3 0 0 17 7 20 10
IA-358 2 1 0 0 3 0 1 0 15 9 19 10
IA-369 1 1 0 0 9 4 5 1 10 5 15 9
a
Presence of ΔG210 was confirmed by qPCR assay of leaf tissue collected after waterhemp survival.
b
Assignment to putative novel R mechanism group was made if the plant was controlled less than susceptible plants and
was confirmed as being absent of the ΔG210 mutation via qPCR assay of leaf tissue collected after waterhemp survival
c
Assignment to susceptible group was made at waterhemp death or individual waterhemp control was similar to the
susceptible waterhemp population and was confirmed as being absent of the ΔG210 mutation via qPCR assay of leaf
tissue collected after waterhemp survival.
Table 5.2. Amino acid polymorphisms observed in isolated waterhemp PPX2 genes that survived a dose of fomesafen.
previous
a
Position IA-369 (16) IA-358 (2) IA-340 (5) Fran (5) Known S Total submissions similar residue
----------------------% of individuals---------------------- -------No.-----
G251 insb 75 100 60 80 3 29 present
H170R 68.8 100 40 60 3 25 present yes
T358S 62.5 0 40 40 3 21 present
Q269H 56.3 100 20 60 2 21 present
E38D 43.8 100 40 40 1 17 present yes
M279I 25 100 0 80 1 15 present yes
A172V 37.5 50 20 40 2 15
D453E 43.8 100 0 20 0 10 yes
T358N 25 100 0 60 0 9
R261H 12.5 100 0 40 1 9 yes
N431K 25 100 0 40 1 9 present
175
K194R 12.5 100 0 40 0 7 yes

T41S 18.8 0 20 0 1 5
S42T 18.8 0 20 0 1 5
K258N 18.8 0 20 0 1 5
I257V 18.8 0 20 0 1 5 yes
S68N 6.3 50 0 20 0 4 present
N473K 0 50 40 0 1 4
S476C 6.3 50 0 20 0 3 yes
P260T 12.5 0 0 20 0 3
L307S 18.8 0 0 0 0 3
L166F 0 0 20 20 1 3
I304T 6.3 0 20 0 1 3
E249D 12.5 0 0 20 0 3 yes
a
Number in parentheses indicates total number of resistant individuals sequenced for that population.
b
Abbreviation: ins, insertion
Table 5.3. Amino acid polymorphisms observed in isolated waterhemp PPX1 genes that
survived a dose of fomesafen.
IA-369 IA-358
a
Position (16) (2) IA-340 (5) Fran (5) Known S Total
-------------------------%------------------------ -------No.-------
V498L 56.3 50 60 100 3 25
P338L 18.8 50 60 60 1 11
L196I 18.8 0 60 0 1 7
D67E 0 0 0 20 2 3
N55D 0 0 0 20 1 2
R107C 12.5 0 0 0 0 2
P172T 0 0 40 0 0 2
S202P 6.3 0 0 20 0 2
K254R 12.5 0 0 0 0 2
P279L 0 50 0 0 0 2
N325D 12.5 0 0 0 0 2
G36R 0 50 0 0 0 1
T48S 6.3 0 0 0 0 1
S52A 0 0 20 0 0 1
A54T 0 0 0 0 1 1
T61K 0 0 0 0 1 1
S62N 0 0 20 0 0 1
K68T 0 0 20 0 0 1
R107H 6.3 0 0 0 0 1
D141Y 0 0 0 0 0 1
L144I 6.3 0 0 0 0 1
P172I 0 0 20 0 0 1
D179Y 0 0 0 0 0 1
F183I 0 0 0 20 0 1
G195R 0 50 0 0 0 1
P274L 0 0 0 0 0 1
V350I 6.3 0 0 0 0 1
a
Number in parentheses indicates total number of resistant individuals sequenced
for that population.
176
Table 5.4. Comparison of GR50 and LD50 values and R:S ratios calculated from waterhemp
biomass and survival at 14 days after fomesafen treatment for one susceptible population
(Des), two resistant populations with ΔG210 (Car and Was), and four populations displaying
a delayed regrowth resistance phenotype (Fran, IA-340, IA-358, and IA-369).
Population GR50 (Std err) R/S ratioa LD 50 (Std err) R/S ratio
g ai ha-1 g ai ha-1
Des 3.0 (0.4) - 20.7 (2.4) -
Fran 5.3 (1.1) 1.8* 177.5 (37.6) 8.6*
IA-340 3.6 (0.6) 1.2 75.5 (13.5) 3.6*
IA-358b 1.9 (0.4) 0.6 39.2 (5.0) 1.9*
IA-369 3.2 (0.6) 1.1 98.6 (16.3) 4.8*
Car 14.8 (3.2) 4.9* 403.9 (103.1) 19.5*
Was 29.5 (7.4) 9.7* 562.1 (139.5) 27.1*

a
Ratios with a * indicate ratio is different than 1 at α=0.05.
b
IA-358 population is actually a single cross hybrid of IA-358 and IA-340 due to lack of males
that were selected as resistant.
177
ΔG210 Unknown Resistance Susceptible
a a
100 bc ab acb
c
90 c
cd
Waterhemp Control 14 DAT (%)
de
80
ef
f
70
g
60
50
40
30
20
10
0
20 40 60 100
Fomesafen Rate (g ai ha-1)
Figure 5.1. Waterhemp control 14 days after fomesafen application for susceptible, ΔG210
resistant, and unknown cause resistant waterhemp from 6 populations. Populations are pooled due
to lack of significance in ANOVA. Means were separated using Tukeys HSD at α=0.05. Presence
of ΔG210 was confirmed by qPCR assay of leaf tissue collected after waterhemp survival.
Assignment to putative novel resistance mechanism group was made if the plant was controlled
less than susceptible plants and was confirmed as being absent of the ΔG210 mutation via qPCR
assay of leaf tissue collected after waterhemp survival. Assignment to susceptible group was made
at waterhemp death or individual waterhemp control was similar to the susceptible waterhemp
population and was confirmed as being absent of the ΔG210 mutation via qPCR assay of leaf tissue
collected after waterhemp survival.
178
Figure 5.2. Phylogenetic tree of selected Miseq PPX2 sequences and multiple Genbank
accessions of waterhemp and closely related species. Accessions shown in red are more closely
related to Palmer amaranth and redroot pigweed than wild type waterhemp accessions.
179
180
Figure 5.3. Comparison of plant symptomatology at 24 hours after treatment with fomesafen at 20 g ha-1. Colored boxes represent
different types of populations with red indicating ΔG210 resistant, yellow indicating susceptible, and blue indicating delayed regrowth
phenotype populations.
181
Figure 5.4. Comparison of plant symptomology between populations at 3d after treatment with 7 rates of fomesafen. Red arrows in each
frame point to the 20 g ha-1 and 63 g ha-1 rate of fomesafen treatments.
182
Figure 5.5. Comparison of plant symptomology between populations at 14d after treatment with 8 rates of fomesafen. Red arrows in
each frame point to the 20 g ha-1 and 63 g ha-1 rate of fomesafen treatments.
Fomesafen rate (g ai ha-1)
Figure 5.6. Dose-response curves of susceptible (Des) ΔG210 resistant (Car and Was), and
putative novel R mechanism populations (Fran, IA-340, IA-358, and IA-369) to fomesafen.
Aboveground biomass was harvested 14 days after fomesafen treatment and normalized to a
percentage of the untreated for each population
183
Waterhemp Survival (%)
Fomesafen rate (g ai ha-1)
Figure 5.7. Dose-response curves of susceptible (Des) ΔG210 resistant (Car and Was), and
putative novel R mechanism populations (Fran, IA-340, IA-358, and IA-369) to fomesafen.
Waterhemp survival was assessed 14 days after fomesafen treatment.
184
Figure 5.8. Mean gene expression of protoporphyrinogen oxidase 1 (PPX1) and 2 (PPX2) in
susceptible (Des) ΔG210 resistant (Car and Was), and four resistant populations with a putative
novel mechanism (Fran, IA-340, IA-358, and IA-369) prior to fomesafen treatment as
determined by qPCR assays. Expression values for each target are normalized to that of
elongation factor-1 alpha and are expressed as percentages of the susceptible population. Means
of each population are indicated by X symbol. Overall F test P values were 0.077 and 0.0438 for
PPX1 and PPX2 respectively. Expression differences between Was and IA-358 PPX2 were the
only mean differences using Tukey’s HSD (α = 0.05).
185
180
160
†
MDA Content (nmol g-1 tissue) 140
120
*
100 †*
80
60
40
Car Des
20
Fran IA-369
0
0 10 20 30 40 50 60
Hours After Treatment
180
Car
160 Des
Fran
140
MDA Content (nmo g-1 tissue)
IA-369
120
100 †
80 †* †
60
40
20
0
0 10 20 30 40 50 60
Hours After Treatment
Figure 5.9. Lipid peroxidation as indicated by MDA content of mature leaf tissue (top) and
meristem/young leaf tissue (bottom) in known susceptible (Des), ΔG210 resistant (Car) and two resistant
populations with putative novel mechanism (Fran and IA-369) following treatment with fomesafen at 20
g ha-1. Significant differences of Fran and IA-369 populations compared to Des and Car populations are
denoted by * and † symbols respectively using Fishers protected LSD (α = 0.05).
186
VITA
Jesse A. Haarmann
EDUCATION
Doctor of Philosophy in Weed Science — Purdue University May 2023
Dissertation: Influence of Application Placement, Resistance Genotype, and PPO-
Inhibiting Herbicide on the PPO-Resistance Phenotype in Waterhemp
Advisor: William G. Johnson, Ph.D. GPA:3.81
Master of Science in Weed Science – Purdue University May 2019

Thesis: The Effect of Herbicide Respray Treatments and Timings on Regrowth of Four
Weed Species.
Advisor: William G. Johnson, Ph.D. GPA:3.96
Bachelor of Science– University of Illinois Urbana-Champaign May 2017

Major: Crop Sciences GPA:3.70
RELAVENT SKILLS
Technical
• Field site management for trial initiation, implementation, and maintenance of desired
pest populations
• Knowledge of Midwest agricultural practices and industry wide product offerings
• Use of pesticide research application equipment including hand boom and ATV
sprayer
• Operation of agronomic research and large-scale machinery including planters,
combines, sprayers, and tillage equipment
• Greenhouse research and plant production methods including use of track-mounted
research sprayer, plant propagation, seed germination, pollination, and seed
production.
• Laboratory techniques including nucleic acid extraction, confocal microscopy, gel
electrophoresis, and PCR
• Experimental design and data analysis using SAS and R statistical software
• Research software and equipment including ARM and Harvest Master Weigh Bucket
System
• Technical writing for academic and extension publications
• Cooperation with faculty, graduate students, undergraduate workers, and industry
cooperators
• Experience conducting research in a variety of agronomic disciplines including: weed
science, plant pathology, soil fertility, and corn and soybean variety trials
• Obtained an Indiana Pesticide Applicator License.
187
Communication
• Published research in peer-reviewed academic journals
• Collaboration with individuals internal and external to Purdue: university faculty,
industry representatives, graduate students, and interns for the design and implementation
of research trials and demonstrations
• Presented research findings via oral and poster presentations at scientific meetings
• Presented research findings at grower extension meetings
• Demonstrated ability to work in a team environment
Leadership and Management
• Management of off-site research locations for Purdue Herbicide Evaluation Program and
student projects
• Responsible for field site harvest, trial termination, and data reports for primary field sites
• Decision making regarding protocol design, trial implementation, and data collection in
order to balance workload, optimize weed density, and effectively navigate space
limitations
• Lead plot tours for academic and industry cooperators
• Mentoring of new graduate students and interns on weed science research, writing, and
statistical analysis
PROFESSIONAL EXPERIENCE
Purdue University, West Lafayette, IN

Graduate Research Associate Aug. 2019 - Present
• Manage over 40 field trials at 5 Indiana field locations.
• Prepare, organize, and maintain field sites.
• Establish field experiments and apply treatments in a timely manner.
• Coordinate logistics for labor and equipment transport.
• Collect and compile experimental data for data reports to clients.
Purdue University, West Lafayette, IN

Graduate Research Assistant May 2017 - Aug. 2019
• Conduct field, greenhouse, and laboratory research related to herbicide efficacy and weed
control.
• Analyze data using SAS and R statistical software.
• Organize and present research project data for professional society meetings and
scientific journals.
• Make applications and collect data for industry contract research trials.
BASF, Seymour, IL
Midwest Research Farm Intern Apr. 2016 - Nov. 2016
188
• Manage applications and data collection for ten agronomic research trials.
• Assist in management of various field research trials.
• Guide customers through plot tours.
• Perform site maintenance and upkeep.
Becks Superior Hybrids, Effingham, IL

Practical Farm Research Intern May 2015 - Aug. 2015
• Assist in the management of agronomic research trials.
• Ensure proper timing of applications for intern projects.
• Assist with location establishment and maintenance.
AgriGold, Fairfield, IL
Sales Intern May 2014 - Aug. 2014
• Complete seed returns for all customers of two district sales managers.
• Erect plot and field signs for brand promotion in the area.
• Generate sales leads for DSMs by building relationships with area farmers.
Haarmann Family Farm, Effingham, IL

Farm Assistant 2004-2018
• Learn basic farm operation and economics.
• Assist in the decision making of agronomic related decisions.
• Operate and maintain large-scale farm equipment.
TEACHING EXPERIENCE
Teaching Assistant, BTNY 304 – Introductory Weed Science (Fall 2018 and Fall 2021)
• Prepare and present lab demonstrations for spray application technology, herbicide
movement in soil, and herbicide symptomology.
• Plant and maintain weed specimens for identification quizzes.
• Grade exams and assignments.
REFEREED JOURNAL ARTICLES

Haarmann JA, Young BG, Johnson WG (2021) Control of Palmer amaranth (Amaranthus
palmeri) regrowth following failed applications of glufosinate and fomesafen. Weed Technology.
35: 464–470. doi: 10.1017/wet.2021.16 (Citations:3)
Haarmann JA, Young BG, Johnson WG (2020) Control of waterhemp (Amaranthus

tuberculatus) regrowth after failed applications of glufosinate or fomesafen. Weed Technology.
34: 794–800. doi: 10.1017/wet.2020.58 (Citations:3)
EXTENSION PUBLICATION
Haarmann JA, Whitford F, Johnson WG, Delucchi TF, Zimmer M, Young BG, Steckel L,
Davis V. (2022) A Soybean Postemergence Herbicide Failed to Perform; Is Retreatment
Warranted? Purdue Extension WS-57.
189
EXTENSION AND OUTREACH PRESENTATIONS
• Throckmorton Purdue Agricultural Center – Corteva Field Day July 11th, 2022
• Throckmorton Purdue Agricultural Center – Weed Science Field Day June 30th, 2022
• Purdue 3 Minute Thesis Competition Mar. 4th, 2022
• Botany Research Showcase – Grad Student Lightning Talk Nov. 13th, 2019
• Feldun Purdue Agricultural Center – Pasture and Forage Field Day Aug. 7th, 2019
• Graduate Thesis Defense Seminar Apr. 10th, 2019
• Throckmorton Purdue Agricultural Center – Weed Science Field Day July 2nd, 2018
CONFERENCE PROCEEDINGS
Haarmann, J., Young, B., Johnson, W. (2022, December) Confirmation of PPO-Inhibitor
Resistant Waterhemp (Amaranthus tuberculatus) That Does Not Have Resistance-
Conferring Target-Site Mutations. Paper presented at the annual meeting of the North Central
Weed Science Society, St. Louis, Missouri.
Haarmann, J., Young, B., Johnson, W. (2022, December) Is Detoxification Contributing to PPO-
inhibitor Resistance in Waterhemp (Amaranthus tuberculatus)? Poster presented at the
annual meeting of the North Central Weed Science Society, St. Louis, Missouri.
Haarmann, J., Young, B., Johnson, W. (2022, February) Investigating the Potential Co-
Occurrence of Target-Site and Non-Target-Site Resistance to PPO Inhibitors in the Same
Populations of Waterhemp (Amaranthus tuberculatus). Poster presented at the annual
meeting of the Weed Science Society of America, Vancouver, Canada.
Haarmann, J., Young, B., Johnson, W. (2021, December) The Effect of ΔG210 and R128G
Mutations in Waterhemp (Amaranthus tuberculatus) on the Resistance Phenotype for Soil-
Applied PPO Inhibitors. Paper presented at the annual meeting of the North Central Weed
Science Society, Grand Rapids, Michigan
Haarmann, J., Young, B., Johnson, W. (2021, December) Soil-Applied PPO Inhibitors Select for
Fewer Resistant Individuals than Foliar Applications. Poster presented at the annual meeting
of the North Central Weed Science Society, Grand Rapids, Michigan
Haarmann, J., Young, B., Johnson, W. (2020, December) The Effect of Trifludimoxazin on the
Frequency of the ΔG210 Target-Site Mutation in Field Populations of Waterhemp. Poster
presented at the annual meeting of the North Central Weed Science Society, Virtual meeting.
Haarmann, J., Young, B., Johnson, W. (2019, December) Is Waterhemp More Difficult to
Control Following a Sublethal Glufosinate Application? Paper presented at the annual
meeting of the North Central Weed Science Society, Columbus, Ohio.
Haarmann, J., Young, B., Johnson, W. (2018, December) Efficacy of Soybean Herbicide Respray
Applications on Palmer amaranth and Waterhemp. Paper presented at the annual meeting of
the North Central Weed Science Society, Milwaukee, Wisconsin.
Haarmann, J., Young, B., Johnson, W. (2018, December) POST Herbicide Respray Efficacy as
Influenced by Severity of Waterhemp Injury from Prior Herbicide Applications. Poster
presented at the annual meeting of the North Central Weed Science Society, Milwaukee
Wisconsin.
190
Haarmann, J., Young, B., Johnson, W. (2017, December) Strategies for Control of Waterhemp
that Survived a Post Contact Herbicide. Paper presented at the annual meeting of the North
Central Weed Science Society, St. Louis, Missouri.
Haarmann, J., Young, B., Johnson, W. (2017, December) Strategies for Control of Palmer
Amaranth That Survived a Post Contact Herbicide. Poster presented at the annual meeting
of the North Central Weed Science Society, St. Louis, Missouri.
Petersen, W., Haarmann, J., Johnson, W. (2017, December) Methods to Control Giant Ragweed
Populations Following Survival of a POST Herbicide Treatment. Paper presented at the
annual meeting of the North Central Weed Science Society, St. Louis, Missouri.
Haarmann, J. Marshal, J. (2016, November) Evaluating the Visual Effects of Oxidative Stress on
Strobilurin Fungicide Treated Soybeans. Poster presented at the annual meeting of the
Students in Agronomy, Soil, and Environmental Sciences, Phoenix, Arizona.
HONORS AND AWARDS

• Purdue College of Agriculture Graduate Student Spotlight 2022
• 2nd place – Poster Contest, WSSA meetings 2022
• 1st place – Graduate Team, NCWSS Weeds Contest 2018, 2019, 2021, 2022
• 1 place – Graduate Individual, NCWSS Weeds Contest
st
2022
• 3rd place – Graduate Individual, NCWSS Weeds Contest 2018, 2019, 2021
• 2nd place – Poster Contest, NCWSS meetings 2017, 2021
• University of Illinois Dean’s List Fall 2015, Spring 2016, Fall 2016
PROFESSIONAL INVOLVEMENT
• North Central Weed Science Society 2017 – Present
• Weed Science Society of America 2020 – Present
• Purdue Botany and Plant Pathology Graduate Student Organization 2017 – Present
• IlliDell of Alpha Gamma Sigma Professional Agriculture Fraternity 2013 – 2017
• University of Illinois Field and Furrow Club 2013 – 2017
191

Haarmann Full Dissertation 4-19-1

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Haarmann Full Dissertation 4-19-1

Uploaded by

Copyright:

Available Formats

INFLUENCE OF APPLICATION PLACEMENT, RESISTANCE

GENOTYPE, AND PPO-INHIBITING HERBICIDE ON THE PPO-

Department of Botany and Plant Pathology

Dr. William G. Johnson, Chair

Dr. Bryan G. Young

Dr. Joshua R. Widhalm

Dr. Robert E Pruitt

Dr. Patrick J. Tranel

LIST OF TABLES .......................................................................................................................... 8

commonly used active ingredients.

fold, similar to other PPO inhibitors applied to foliage.

to address our hypothesis.

inconclusive, but provided some evidence of increased target-site expression or increased

will likely increase also.

1.1 PPO is an Important Herbicide Target

Protoporphyrinogen IX oxidase (PPO)-inhibiting herbicides are an important class of

include diphenylethers, N-Phenyl-imides, N-Phenyl-triazolinones, and N-Phenyl-oxadiazolones,

and thiadiazoles (Hao et al. 2011) (Figure 1.1).

Deficiencies in PPO enzyme activity in humans result in a pathological condition known as

appear to be analogous to phytotoxic herbicide symptoms (Ramanujam and Anderson 2015).

plastid where it is enzymatically oxidized to protoporphyrin (Proto) by non-specific oxidases

can be found later in this review.

1.2 Trifludimoxazin, a New PPO-Inhibiting Herbicide

solution to glyphosate resistance in horseweed (Conyza canadensis) (Grossmann et al. 2010,

Kraehmer et al. 2014).

Newer PPO-inhibiting compounds are currently in development. These new PPO-

applications of trifludimoxazin to PPO-inhibitor resistant waterhemp and Palmer amaranth does

not result in a dose-response shift compared to a susceptible, that is typical of fomesafen or

affinity between susceptible and resistant PPO2 enzymes.

It remains unclear how PRE applications of trifludimoxazin will influence emergence of

PPO-inhibiting herbicides PRE to a PPO-inhibitor resistant waterhemp population still provided

trifludimoxazin formulation currently under development is a premix with saflufenacil in a 2:1

PPO inhibitors and the resulting genotypes of emerging plants is unknown.

Resistance to PPO-inhibiting herbicides was first identified in a Kansas waterhemp

al. 2006, Rousonelos et al. 2012, Salas et al. 2016).

resistance in waterhemp in a bacterial functional complementation assay. This mutation was an

for PPO inhibitors without a loss of affinity for protogen.

resistance SNP causes stearic hindrance of PPO-inhibitor binding.

and does not have any target-site mutations.

unknown if this PPX1 mutation is a result of goosegrass biology, oxadiazon/target-site interactions,

or a combination of the two factors.

1.4 Herbicide Resistance Genotyping Assays

Rapid identification of resistance is critical for effective weed management decisions

suspected resistance to confirmation can take as much as 9 months to a year.

deletion/insertion mutations. A general method known as PCR-RFLP is the most broadly

mutants (Wuerffel et al. 2015a).

binding of a fluorescent probe to a PCR-amplified product. The fluorescence of the probe is

a phenotype. The presence of a novel resistance mechanism, such as enhanced detoxification or

simultaneously detect multiple mutations would be beneficial to laboratories and diagnosticians

1.5 Herbicide Dose Responses

al. 2011, Wichert et al. 1992).

1.6 Biologically Effective Dose

bind to the enzyme through a combination of hydrogen bonds, hydrophilic or hydrophobic

waterhemp are well-known examples of herbicide resistance through target-site abundance

herbicide resistance through altered substrate or product abundances.

Herbicide detoxification is another critical aspect of herbicide action, particularly for

effective control while using a minimum amount of product.

1.7 Herbicide Effectiveness PRE vs POST

Modern agricultural practices place immense selection pressure on herbicide resistance

possible, especially in Amaranthus species.

Previously, triazine resistance in waterhemp was identified as being caused by a target-site

resistance mutation or mechanism is likely not the end of resistance evolution.

pressure of PRE vs POST applications on different resistance genotypes is widely understudied.