Food Control 65 (2016) 152e159

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

Identification of Salmonella enterica Typhimurium and variants using a

novel multiplex PCR assay
Xiaohua He a, Xuebin Xu b, Ke Li c, Bin Liu d, *, Tianli Yue d
a
College of Plant Protection, Northwest A&F University, Yangling 712100, China
b
Shanghai Municipal Center for Disease Control & Prevention, Shanghai 200336, China
c
Zhejiang Academy of Science & Technology for Inspection & Quarantine, Hangzhou 310016, China
d
College of Food Science and Engineering, Northwest A&F University, Yangling 712100, China

a r t i c l e i n f o a b s t r a c t

Article history: Salmonella Typhimurium is one of the most common Salmonella serovars and possesses many variants.
Received 23 October 2015 The detection of this pathogen and its variants is imperative to trace the source of infection, to explore
Received in revised form the transmission, and to prevent the spread of disease. A PCR assay was used and primers were designed
8 January 2016
against the gene STM4495 specific for S. Typhimurium, and oafA, fliC, and fljB encoding the O5, H1 and
Accepted 9 January 2016
Available online 12 January 2016
H2 antigens of S. Typhimurium. A novel multiplex PCR method was developed to detect S. Typhimurium
and its variants, including Copenhagen, 1,4,12:-:1,2, 1,4,[5],12:i:- and 1,4,5,12:-:-. The detection limit of
this method was found to be as low as 1.1pg/PCR for S. Typhimurium DNA template. S. Typhimurium and
Keywords:
Salmonella Typhimurium
its variants were detected rapidly and accurately. Of 2350 isolates, 294 strains of S. Typhimurium, 13
Variant strains of 1,4,[5],12:i:- and 1 strain of Copenhagen variant, were identified, consistent with serological
MLST testing. Thus, this multiplex PCR assay complements the serological method and enhances detection
Antibiotic resistance accuracy. All 1,4,[5],12:i:- strains were identified as ST34 by MLST analysis, which carried multidrug
Multiplex PCR resistances. The expansion of multidrug-resistant S. Typhimurium variant strains must be controlled to
limit further transmission from animal food to humans.
© 2016 Elsevier Ltd. All rights reserved.

1. Introduction prevalent worldwide. S. Typhimurium var. Copenhagen, an O5-

Salmonella Typhimurium, one of the most important serovars in
Salmonella enterica, is capable of infecting a variety of animal hosts,
humans, and plants due to its excellent viability under various
nutrition conditions (Jawale & Lee, 2014). Epidemiological in-
vestigations of S. Typhimurium have relied on serotyping, using
specific agglutination reactions with adsorbed antisera specific for
epitopes within either lipopolysaccharide (O antigen) or flagellar
antigens (phases 1 and 2 of H antigen), encoded by rfb, fliC and fljB
genes (Achtman et al., 2012). On the basis of the antigenic formula
(1,4,[5],12:i:1,2), this organism can be distinguished from other
serovars. However, classical Salmonella serotyping methods may
not be sufficient to distinguish variants of S. Typhimurium.
In recent years, the epidemiological importance of variants of S.
Typhimurium has increased as these strains have become more
* Corresponding author. College of Food Science and Engineering, Northwest A&F
University, 22 Xinong Rd, Yangling 712100, PR China.
E-mail address: liubin7723@nwsuaf.edu.cn (B. Liu).
minus variant, is the most common variant isolated from pigeons,
which has been reported to allow transmission to humans or other
animals (Teske et al., 2013). Other variants, referred to as “Salmo-
nella Typhimurium-like”, have been reported as threats by the
European Food Safety Authority (EFSA) (EFSA., 2010; Bugarel et al.,
2012). Particularly, the strain 1,4,[5],12:i:-, lacking the second
flagellar phase, has emerged as a pandemic monophasic variant of
S. Typhimurium (Amavisit, Boonyawiwat, & Bangtrakulnont, 2005;
Seixas, Machado, Bernardo, Vilela, & Oliveira, 2014; Switt, Soyer,
Warnick, & Wiedmann, 2009). Another monophasic variant
(1,4,[5],12:-:1,2), lacking the first flagellar phase, was isolated from
perished wild birds and found to allow transmission to humans
(Hauser et al., 2009). In addition, in France in 2009, a non-motile
1,4,5,12:-:- variant of S. Typhimurium was reported as the first
outbreak of human salmonellosis (Bugarel et al., 2012). For iden-
tification of these variants, it is advised to proceed with serotyping
but if agglutination indicates one or both of flagellar antigens are
absent, PCR can be used to confirm the lack of O-antigens or H-
antigens (EFSA., 2010).
A PCR assay was recommended by the EFSA and has been

http://dx.doi.org/10.1016/j.foodcont.2016.01.015
0956-7135/© 2016 Elsevier Ltd. All rights reserved.
 X. He et al. / Food Control 65 (2016) 152e159 153

extensively used to identify the strain 1,4,[5],12:i:- (Prendergast Table 1

et al., 2013; Tennant et al., 2010). However, this method is unable Salmonella and non- Salmonella strains used in this study.

to detect other variants of S. Typhimurium. For identification of Salmonella strains Strain code Non-Salmonella strains Strain code
variants 1,4,[5],12:i:-, 1,4,[5],12:-:1,2 and 1,4,[5],12:-:-, four primer S. Abony NCTC 6017 Bacillus cereus ATCC1220
sets were applied, one set targeted to the fliC gene encoding the S. Anatum ATCC9270 Bacillus subtilis ATCC6633
gene required for the first flagellar phase, two sets targeted to the S. Choleraesuis AS1.1190 Citrobacter freundii ATCC8090
fljB gene required for the second flagellar phase, and a primer set S. Enteritidis ATCC13076 Enterobacter cloacae ATCC13047
S. Gallinarum CMCC50770 Enterobacter sakazakii ATCC29544
targeting the mdh gene as a marker of S. Typhimurium (Amavisit
S. Paratyphi A ATCC 9150 Enterococcus avium ATCC14025
et al., 2005; Bugarel et al., 2012). However, the mdh gene is not S. Paratyphi B CMCC50004 Escherichia coli ATCC25922
specific for S. Typhimurium and was later found to be present in S. Paratyphi C CMCC50017 Klebsiella peneumoniae ATCC27336
other serovars, such as S. Paratyphi A, S. Newport, S. Enteritidis and S. Poona NCTC 4840 Listeria monocytogenes ATCC27708
S. Tallahassee ATCC 12002 Proteus mirabilis ATCC12453
S. Choleraesuis. Additionally, those four primer sets are unlikely to
S. Typhi CMCC50180 Proteus vulgaris ATCC33420
work together in multiplex PCR due to a large variation in the Tm of S. Typhimurium AS1.1174 Pseudomonas aeruginosa CDC B32116
primers and overlap in the length of products. Therefore, these four S. Typhimurium ATCC14028 Pseudomonas putida ATCC17485
primer sets were tested in 4 independent PCR reactions (Bugarel S. Typhimurium ATCC13311 Serratia marcescens ATCC27592
et al., 2012). S. Typhimurium ATCC51812 Shigella dysenteriae CMCC51335
S. Typhimurium CMCC50115 Staphylococcus aureaus ATCC6538
Accurate characterization of variants of S. Typhimurium is quite
S. Vellore ATCC 15611 Vibrio parahaemolyticus ATCC17802
important, since failure to confirm identity of a variant organism S. Aberdeen
could have significant public health consequences (EFSA., 2010). S. Adelaide
Strain variants can emerge with different phage types, genotypes, S. Agona
and antimicrobial resistance profiles. Certain variant isolates S. Amager
S. Babelsberg
belong to multiple clones or clonal lines which have emerged S. Braenderup
through independent deletion events. In China, however, there are S. Chailey
few reports of isolating and identifying the variants of S. Typhi- S. Chester
murium from food and clinic samples. Additionally, the trans- S. Clackamas
S. Derby
mission of route for these bacteria and their characteristics, such as
S. Galiema
antibiotic resistance, have not been studied. The inability to S. Give
determine the identity of S. Typhimurium variants could cause S. Havana
significant public health consequences. Moreover, the misidentifi- S. Indiana
cation of a non-S. Typhimurium-related strain could result in un- S. Infantis
S. Kaapstad
necessary regulatory action (EFSA., 2010). To allow the rapid and S. Kande
accurate detection of the variants of S. Typhimurium in China, a S. Kentucky
novel multiplex PCR has been developed as a supplementary S. Livingstone
method of serological diagnosis. Furthermore, we investigated the S. Lomita
S. London
correlation of the variant isolates from food and clinic samples
S. Mbandaka
using analysis of their antibiotic resistances and MLST types. The S. Montevideo
methods and results reported here will be important to monitor S. Muenchen
transmission and determine sources of contamination and infec- S. Muenster
tion during future outbreaks. S. Nchanga
S. Newport
S. New-rochelle
2. Materials and methods S. Nola
S. Ohio
2.1. Bacterial strains S. Oranienburg
S. Pakistan
S. Richmond
A total of 17 standard strains and 44 isolates of S. enterica, and 17 S. Rissen
non-Salmonella standard strains were used to determine the S. Saintpaul
specificity and sensitivity of the PCR assay in this study (Table 1). S. Sanjuan
The standard strains were purchased from the Institute of Micro- S. Schwarzengrund
S. Senftenberg
biology, Chinese Academy of Sciences, while 44 isolates (44 sero- S. Siegburg
vars) were collected from food, poultry feces and clinic samples. S. Stanley
Additionally, 2350 isolated strains were identified, including 1800 S. Tennessee
clinical strains and 550 strains from food. All clinical strains were S. Thompson
S. Uganda
collected from swab samples of 25 hospitals, a quarter of which
S. Virchow
were child samples (less than 10 years old). The food strains were
isolated from 150 pork samples, 150 chicken samples, 100 duck
samples, 50 fish samples, 50 beef samples and 50 mutton samples.

2.2. Primer design and selection
The fragment (1800e2930 bp) of the gene STM4495 (S. Typhi-
murium str. LT2) was selected as a specific target for S. Typhimu-
rium using a comparative genomic method (Liu et al., 2012). The
oafA, fliC and fljB genes were selected to identify S. Typhimurium
variants via detecting absence of these genes, which encode the
antigens O5, H1 and H2 of S. Typhimurium, respectively.
The primers based on the sequences of target genes were
designed by Primer Premier 5.0 software (PREMIER Biosoft. Inter-
national, Palo Alto, CA, USA) and synthesized by Sangon Bioltech
(Shanghai) Co., Ltd., China. The sensitivity tests were performed
using the 10-fold serial diluted DNA of S. Typhimurium ATCC 14028.
The most sensitive primer sets were selected for use in the multi-
plex PCR.
154 X. He et al. / Food Control 65 (2016) 152e159

2.3. Multiplex PCR conditions
All bacterial strains were grown in LB broth overnight at 37
C
and DNA was extracted using the method described by Kalia,
Rattan, and Chopra (1999). The DNA from each strain was stored
at 20
C before being used as PCR template.
Each 25 mL PCR reaction mixture contained 10  buffer (free
Mg2þ), 2 mM MgCl2, 0.2 mM dNTP, 0.2 mM each primer set, 1U Taq
DNA polymerase (Fermentas, Thermo Fisher Scientific (China) Co.,
Ltd) and 2.0 mL of template DNA.
PCR amplification was performed in a PTC-200 thermal cycler
(BIO-RAD, USA) with an initial denaturation of 94
C for 5.0 min,
followed by 35 cycles of 94
C for 30 s, 55
C for 30 s and 72
C for
60 s, then a final extension at 72
C for 10 min, followed by a final
hold at 4
C. An aliquot (5 mL) from the PCR products of each re-
action was analyzed by gel electrophoresis in 2% agarose gels,
stained with ethidium bromide, and then visualized under UV light.
2.4. Specificity and sensitivity of multiplex PCR
The specificity of the multiplex PCR was tested against a total of
61 strains of Salmonella and 17 non-Salmonella strains from 15
other genera (Table 1). To determine the sensitivity, genomic DNAs
extracted by the phenol/chloroform method from S. Typhimurium
(ATCC 14028) were serially diluted ten-fold with sterile ddH2O
(Kalia et al., 1999; Liu et al., 2011a). DNA concentrations were
quantified by measuring the OD260 nm and OD280 nm using a
spectrophotometer (DU-800 spectrophotometer, Beckman
Instruments).
2.5. Identification of isolated strains
After the DNA of 2350 isolated strains were extracted, the uni-
versal primer set for the16s rDNA gene (De Lillo et al., 2006;
Fredriksson, Hermansson, & Wilen, 2013) (Table 2) was used to
identify these strains. Next, the multiplex PCR assay was applied to
identify S. Typhimurium and its variants. To evaluate the multiplex
PCR assay, the PCR assay, which targeted to fliA-B, fljB, fliC and mdh
genes described by Bugarel et al. (2012), was also used in this study
(Table 2). The results of these PCRs were compared to serological
analysis.
2.6. Multilocus sequence typing (MLST)
Isolated S. Typhimurium variants were then subjected to
amplification and sequencing according to the MLST method
developed by Kidgell et al. (2002) (www.mlst.warwick.ac.uk/mlst/
dbs/Senterica). Seven housekeeping genes (aroC, dnaN, hemD,
hisD, purE, sucA and thrA) of each isolate were amplified by PCR
using the previously described protocols (Liu, Liu, Zhu, Yu, & Shi,
2011b). Sequencing reactions of PCR products were completed by
Beijing Genomics Institute, China. Allele numbers were assigned a
sequence type (ST) after the distinct allele sequences were sub-
mitted, via the Internet, to the dedicated database (www.mlst.
warwick.ac.uk/mlst/dbs/Senterica).
2.7. Antimicrobial susceptibility testing
Antimicrobial susceptibility testing was determined using a
VITEK 32 GNS-143 card (bioMerieux, Marcy l’Etoile, France) ac-
cording to the manufacturer's instructions. The antimicrobials
tested included Amikacin, Ampicillin, Ampicillin/Sulbactam,
Aztreonam, Cefazolin, Cefepime, Cefotetan, Ceftazidime, Ceftriax-
one, Ciprofloxacin, Ertapenem, Gentamicin, Imipenem, Levo-
floxacin, Nitrofurantoin, Piperacillin/Tazobactam, Tobramycin and
Trimethoprim/Sulfamethoxazole. As control organisms, Escherichia
coli ATCC 35218 and Enterococcus faecalis ATCC 29212 were used to
ensure activity of the antimicrobial agents (Zhao et al., 2003).
Finally, the antimicrobial resistance of Salmonella strains were
definite on the basis of the 2014 CLSI M100-S24 breakpoints.
3. Results
3.1. Primer set selection of each target gene
At least five primer sets for each target gene were designed (data
not shown) and the sensitivity of these primer sets was tested in
PCR. For each target gene, a primer set was found that allowed
detection of S. Typhimurium ATCC 14028 at only 110 fg of DNA per
reaction (Fig. 1), and this set was selected for use in multiplex PCR.
The selected primer sets were listed in Table 2.
3.2. Detection limit of multiplex PCR
S. Typhimurium ATCC14028 genomic DNA was 10-fold serial
diluted and used to test the sensitivity of the multiplex PCR assay.
Results demonstrated that multiplex PCR was capable of detecting
as low as 1.1 pg of S. Typhimurium genomic DNA per assay.

Table 2
Primer sets used in this study.

Primer Sequence Product (bp) Target gene Reference

27F AGAGTTTGATC[A/C]TGGCTCAG 1500 16s rDNA De Lillo et al., 2006; Fredriksson et al., 2013
1492R TACGG[C/T]TACCTTGTTACGACTT
stm4495-2f AAAAGCAGGCATGTCCACCG 413 STM4495 This study
stm4495-2r ATCCCGCAGCGTAAAGCAAC
O5-3f CAGACAACAAGCCTACTACGGTA 195 oafA This study
O5-3r CGGTCCTTCCGGAATTAATC
Flic-2f GGCTACGGGCAGAAGTCA 963 fliC This study
Flic-2r TCAACGGCGTGAAAGTCC
Fljb-4f ACAGATTGTTTACGGTATTGC 789 fljB This study
Fljb-4r CTACACTGGATGTATCGGGTC
FFLIB CTGGCGACGATCTGTCGATG 1000 fliA-B Bugarel et al., 2012
RFLIA GCGGTATACAGTGAATTCAC
Sense59 CAACAACAACCTGCAGCGTGTGCG 1389 fljB Bugarel et al., 2012
Antisense83 GCCATATTTCAGCCTCTCGCCCG
Sense60 GCAGATCAACTCTCAGACCCTGGG 550 fliC Bugarel et al., 2012
Antisense-fliC ACTTCGGTTTTGCCGTCTGCGCC
MDH-F TGCCAACGGAAGTTGAAGTG 250 mdh Bugarel et al., 2012
MDH-R CGCATTCCACCACGCCCTTC
 X. He et al. / Food Control 65 (2016) 152e159 155

Fig. 1. Sensitivity of the primer sets and multiplex PCR for detection of genomic DNA from Salmonella Typhimurium ATCC 14028 A: Primer set stm4495e2 B: Primer set O5-3 C:
Primer set Flic-2 D: Primer set Fljb-4 E: Multiplex PCR From lane 1 to 10, the DNA concentration per assay, respectively: 11 ng/PCR, 1.1 ng/PCR, 110 pg/PCR, 11 pg/PCR, 1.1 pg/PCR, 110
fg/PCR, 11 fg/PCR, 1.1 fg/PCR, 0.11 fg/PCR, ddH2O. Lane M: 200 bp marker.
156 X. He et al. / Food Control 65 (2016) 152e159

3.3. Specificity of multiplex PCR
Thirty-four Salmonella and non-Salmonella standard strains and
44 isolates were used to test the specificity of the multiplex PCR
assay (Table 1). The results showed that DNA templates from all S.
Typhimurium strains yielded the four amplicons, including 195-bp,
413-bp, 789-bp and 963-bp fragments of oafA, STM4495, fljB and
fliC genes, respectively. Other Salmonella strains did not generate
the 413-bp amplification products, whereas the non- Salmonella
strains did not produce any product for these four genes (Fig. 2).
3.4. Identification of isolated strains
In order to identify the S. Typhimurium and variants efficiently,
the 4 selected primer sets were employed simultaneously in a
multiplex PCR system and evaluated against 2350 isolated strains.
As expected, the primer set stm4495-2 was able to accurately
identify S. Typhimurium. The S. Typhimurium var. Copenhagen was
identified by the absence of oafA gene product. Similarly, 1,4,12:-
:1,2, 1,4,[5],12:i:- and 1,4,12:-:- strains were recognized by the lack
of fliC and fljB gene products. The results indicated that the multi-
plex PCR was successful in identifying S. Typhimurium and its
variants. Of the tested strains, 294 strains were identified as S.
Typhimurium, 13 strains were 1,4,[5],12:i:-, and 1 strain was S.
Typhimurium var. Copenhagen. The 1,4,12:-:1,2 and 1,4,12:-:-
strains were not found in this study. Among the S. Typhimurium
isolates, 84 isolates originated from pork (n ¼ 39), chicken (n ¼ 25),
duck (n ¼ 14), fish (n ¼ 4), beef (n ¼ 1), and mutton (n ¼ 1). The
remaining isolates of S. Typhimurium were from clinical samples,
including 20 isolates from swab samples of children less than 5
years old. Out of these variants, 10 strains were isolated from
clinical samples, including 8 adult swab and 2 child swab samples;
while 4 strains were isolated from food products, including chicken,
fish, pork chop and pork liver samples (Table 3). All the assays were
validated by the traditional immunologic serotyping method and
Bugarel's PCRs method (Bugarel et al., 2012).
3.5. MLST profiles and antimicrobial susceptibility phenotypes
To compare these isolates with the S. enterica MLST database,
seven genes (aroC, dnaN, hemD, hisD, purE, sucA, and thrA) were
amplified by PCR. This sequence data was entered into the MLST
database. Except for S. Typhimurium var. Copenhagen strain
(10419), the other 1,4,[5],12:i:- strains were identified as ST 34
(Table 3).
In this study, only one variant strain (10419) did not exhibit
resistance, while other S. Typhimurium variant strains exhibited
multidrug resistance (Table 3). All of these antibiotic-resistant
strains were resistant to Ampicillin, Ampicillin/Sulbactam and
Tobramycin. Out of the resistant strains, 7 isolates were resistant to
six antibiotic drugs, 3 isolates were resistant to five antibiotic drugs,
and 3 isolates were resistant to four antibiotic drugs. Significantly,
there was one isolate resistant to Cefazolin, Ceftazidime and
Ceftriaoxone.
4. Discussion
Variants of S. Typhimurium exhibit differences in antigen

Fig. 2. The results of multiplex PCR detection for Salmonella and non-Salmonella standard strains A: From lane 1 to 17, the DNA templates are the Salmonella strains: AS1.1174,
ATCC14028, ATCC13311, ATCC51812, CMCC50115, ATCC 9150, CMCC50004, CMCC50017, AS1.1190, CMCC50180, ATCC13076, CMCC50770, ATCC9270, ATCC 15611, ATCC 12002, NCTC
4840, NCTC 6017. Lane M: 200 bp marker. B: From lane 1 to 17, the DNA templates are the non-Salmonella strains: ATCC17802, ATCC27708, ATCC6538, ATCC29544, ATCC13047,
ATCC12453, ATCC33420, ATCC27336, CMCC51335, ATCC14025, CDC B32116, ATCC17485, ATCC27592, ATCC6633, ATCC25922, ATCC8090, ATCC1220. Lane M: 200 bp marker.
 X. He et al. / Food Control 65 (2016) 152e159 157

expression because they lack certain genes. These S. Typhimurium

Sulfamethoxazole
variants have presented problems for identification, particularly

Trimethoprim/
strains 1,4,[5],12:i:-, 1,4,[5],12:-:1,2 and 1,4,[5],12:-:-, because con-
ventional serotyping is difficult to unequivocally identify mono-
phasic and non-motile variants. These variants usually infect
certain animals or contaminate food, and misclassification of these
R

R
R
R
R

R
R
strains may increase human health risks.
Although serological testing allows detection of S. Typhimu-
Nitrofurantoin

rium and variant strains, this method is labor-intensive, expen-

sive, complicated, and time-consuming as it requires the phase-
inversion method to verify the absence of one H-phase, or to
inoculate strains on a swarming agar medium to determine the
R

R
R
R

R
lack of the motility (both H-phases). Consequently, EFSA advised
Tobramycin

use of a PCR protocol to confirm the lack of the second phase

antigen. This PCR method used two sets of primers (primers
FFLIB, RFLIA and primers Sense-59, Antisense-83) to discriminate
between S. Typhimurium and 1,4,[5],12:i:-. The first set of
R

R
R
R
R
R
R
R
R
R
R
R
R
primers FFLIB and RFLIA could amplify a 1000-bp product from
Gentamicin

the fliB-fliA intergenic region of the flagellin gene cluster of S.

Typhimurium and 1,4,[5],12:i:- strains, while products of other
serovars sharing the ‘i’ antigen were 250-bp fragments. The
R
R
R
R
R
R
R

R
R
R
R

amplicon of another set of primers, Sense-59 and Antisense-83,

could generate a 1389-bp fragment from the fljB allele of S.
Ceftriaoxone

Typhimurium strains, which was able to distinguish 1,4,[5],12:i:-

from S. Typhimurium because no product was generated from
1,4,[5],12:i:- strains (Prendergast et al., 2013; Tennant et al.,
R

2010). However, the multiplex PCR couldn't detect other vari-

ants of S. Typhimurium but 1,4,[5],12:i:- strains. To identify more
Ceftazidime

variants, such as 1,4,[5],12:i:-, 1,4,[5],12:-:1,2 and 1,4,[5],12:-:-,

Bugarel et al. (2012) adopted four sets of primer to amplify three
genes (fliC, fljB and mdh) of these variant strains, respectively.
R

Nevertheless, this method did not simultaneously distinguish

variants from S. Typhimurium. Moreover, the mdh gene was not
Cefazolin

specific for S. Typhimurium and could not discriminate this

serovar from other Salmonella strain.
The results of Salmonella Typhimurium variant isolates by MLST and antimicrobial susceptibility testing.

R
R

To resolve this issue, therefore, we developed a novel multiplex

PCR to simultaneously detect 1,4,[5],12:i:-, 1,4,[5],12:-:1,2 and
/Sulbactam

1,4,[5],12:-:-, as well as S. Typhimurium var. Copenhagen, from S.

Ampicillin

Typhimurium. This assay allows easy confirmation of the PCR re-

sults, which relied on only one or two specific bands. The gene
R

R
R
R
R
R
R
R
R
R
R
R
R

STM4495 served as a target for identifying S. Typhimurium instead

of mdh gene. The fragment (1800e2930 bp) of the gene STM4495 is
Ampicillin

a highly specific target for the detection of S. Typhimurium (Liu

et al., 2012). Based on the presence of this gene amplicon, S.
Typhimurium variants could be identified by observing the pres-
R

R
R
R
R
R
R
R
R
R
R
R
R

ence or absence of the oafA, fliC or fljB products, encoding the O5,
34
19
34
34
34
34
34
34
34
34
34
34
34
34
ST

H1 and H2 antigens. To optimize the assay, the most sensitive

primer sets were selected from at least 5 primer sets designed
against one of these four genes. These primer sets all worked at a
adult swab
adult swab
adult swab

adult swab
adult swab

adult swab

adult swab
adult swab
child swab

child swab
pork chop
pork liver

very low concentration of DNA (22 fg/mL). Finding primers that

Sources

chicken

worked at relatively equal levels of sensitivity was critical to the

fish

function of the assay to avoid false negative results.

This multiplex PCR was evaluated using Salmonella and non-
2007
2007
2007
2007
2008
2009
2010
2010
2010
2010
2011
2011
2012
2012
Year

Salmonella strains, including 34 standard strains and 44 isolates

belonging to various serovars. The assay was then applied to 2350
isolated strains of food and clinic samples, and 294 strains S.
Copenhagen

Typhimurium, 13 strains 1,4,[5],12:i:-, and one strain var. Copen-

4,[5],12:i:-

4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
4,[5],12:i:-
Serotype

hagen were identified, in agreement with results using Bugarel's

PCRs method and the serological test (Bugarel et al., 2012). Out of
these variant strains, 10 isolates were from clinical samples,
including samples from two children less than 3 years old, others
Strain code

were from food samples, containing pork liver, pork chop, chicken
and fish, which indicated the potential for human health threat.
11 042
10,236
10,419
10,421
10,565
11,013

11,078
11,080
11,084
11,089
11,093
11,102
11,129
11,140
Table 3

Despite its obvious presence, there have been few reports about S.
Typhimurium variants, and the potential risks have been mostly
158 X. He et al. / Food Control 65 (2016) 152e159
ignored in China.
After serotyping, molecular procedures are available to test
for the genotypic characteristics of Salmonella strains within
serovars. Genotyping Salmonella is important to provide more
information for the determination of the sources of infection
during outbreak investigations. Molecular methods enable
discrimination of the outbreak strain from other molecular types.
One of the most commonly used methods for molecular typing is
Multilocus Sequence Typing (MLST). According to MLST data,
within the EU, the predominant MLST types of the 1,4,[5],12:i:-
strains were distributed in 2 STs (ST19 and ST34). The ST34
strains could cause human infections transmitted by the food
chain because food animals, particularly pigs, serve as a reservoir
and their derived products are the main infection vehicles
(Hauser et al., 2010; Mulvey et al., 2013). In this study, all
1,4,[5],12:i:- strains were characterized as ST34, which agreed
with the results of Yang et al. (2015). They collected 2800 food
samples from retail markets in China, and found 13 isolates
1,4,[5],12:i:- confirmed as ST34. These results suggested that the
1,4,[5],12:i:- strains of ST34 were predominant in China, which is
worthy of future attention because this MLST type is frequently
associated with multidrug resistant S. Typhimurium (Mourao,
Machado, Novais, Antunes, & Peixe, 2014).
The antimicrobial resistance is an important characteristic of the
1,4,[5],12:i:- strains, and is used to identify certain monophasic S.
Typhimurium isolates. In Europe, the two major circulating STs
(ST19 and ST34) showed multidrug resistance to four or more un-
related classes of antimicrobials (Garcia et al., 2014; Mourao et al.,
2014). ST34 had previously been associated with R-type ASSuT
1,4,[5],12:i:- strains belonging to the European clone. In this study,
accordingly, the 1,4,[5],12:i:- isolates were also determined by their
antimicrobial resistance. The results showed that all 1,4,[5],12:i:-
isolates exhibited multidrug resistance, and over a half of strains
were resistant to six antibiotic drugs. Out of these strains, 3 clinic
isolates (10421, 11013 and 11042) exhibited identical multidrug-
resistant profiles with 2 food isolates (11078 and 11129), suggest-
ing that clinical patients were possibly infected from consumption
of contaminated food. Moreover, 2 clinic isolates were resistant to
Cefazolin, a very common antibiotic used in clinical treatment in
China. The antimicrobial resistance results demonstrate that the
monophasic variant had good adaptability to different environ-
mental conditions and was able to colonize or infect a wide range of
animals and humans, and is more difficult to treat using common
antibiotics.
Although only one isolate was identified as S. Typhimurium var.
Copenhagen and it did not exhibit any resistance against antibiotics
in this study, this strain was isolated from a clinical sample,
underscoring the potential threat for human health. In this study,
the 1,4,[5],12:-:1,2 and 1,4,[5],12:-:- strains were not found, though
were detected in subsequent studies. The significant risk of
antibiotic-resistant variant strains make continued surveillance of
their emergence and spread crucial.
In this study, new specific targets were utilized in a multiplex
PCR, which proved to be a more rapid, convenient, and accurate
method of identification of S. Typhimurium and its variants than
previous methods. The quick expansion of the multidrug-resistant
S. Typhimurium variant strains could pose a notable threat to
clinical Salmonella infection control. Improved methods of identi-
fication are crucial to effective treatment and blocking transmission
from animal food to humans.
Acknowledgments
This work was supported by grants No.31471638 from Na-
tional Natural Science Foundation of China, No.2014IK123 from
the General Administration of Quality Supervision, and
No.Z109021426 from the Fundamental Research Funds for the
Central Universities.
References
Achtman, M., Wain, J., Weill, F. X., Nair, S., Zhou, Z. M., Sangal, V., et al. (2012).
Multilocus sequence typing as a replacement for serotyping in Salmonella
enterica. Plos Pathogens, 8(6). http://dx.doi.org/10.1371/journal.ppat.1002776.
Amavisit, P., Boonyawiwat, W., & Bangtrakulnont, A. (2005). Characterization of
Salmonella enterica serovar Typhimurium and monophasic Salmonella serovar
1,4,[5],12 : i : - isolates in Thailand. Journal of Clinical Microbiology, 43(6),
2736e2740.
Bugarel, M., Granier, S. A., Bonin, E., Vignaud, M. L., Roussel, S., Fach, P., et al. (2012).
Genetic diversity in monophasic (1,4,[5],12:i:- and 1,4,[5],12:-:1,2) and in non-
motile (1,4,[5],12:-:-) variants of Salmonella enterica S. Typhimurium. Food
Research International, 45(2), 1016e1024.
De Lillo, A., Ashley, F. P., Palmer, R. M., Munson, M. A., Kyriacou, L., Weightman, A. J.,
et al. (2006). Novel subgingival bacterial phylotypes detected using multiple
universal polymerase chain reaction primer sets. Oral Microbiology And Immu-
nology, 21, 61e68.
EFSA.. (2010). Scientific opinion on monitoring and assessment of the public health
risk of “Salmonella Typhimurium-like” strains. EFSA Journal, 8(10), 48.
Fredriksson, N. J., Hermansson, M., & Wilen, B. M. (2013). The choice of PCR primers
has great impact on assessments of bacterial community diversity and dy-
namics in a wastewater treatment plant. Plos One, 8.
Garcia, P., Hopkins, K. L., Garcia, V., Beutlich, J., Mendoza, M. C., Threlfall, J., et al., , on
behalf of the Med-Vet-Net WP21 Project Group. (2014). Diversity of plasmids
encoding virulence and resistance functions in Salmonella enterica subsp
enterica serovar typhimurium monophasic variant 4,[5],12:i:- strains circulating
in europe. Plos One, 9(2). http://dx.doi.org/10.1371/journal.pone.0089635.
Hauser, E., Hühn, S., Junker, E., Jaber, M., Schroeter, A., Helmuth, R., et al. (2009).
Characterisation of a phenotypic monophasic variant belonging to Salmonella
enterica subsp. enterica serovar Typhimurium from wild birds and its possible
transmission to cats and humans. Berl Munch Tierarztl Wochenschr, 122(5e6),
169e177.
Hauser, E., Tietze, E., Helmuth, R., Junker, E., Blank, K., Prager, R., et al. (2010). Pork
contaminated with Salmonella enterica serovar 4,[5],12:i:-, an emerging health
risk for humans. Applied and Environmental Microbiology, 76(14), 4601e4610.
Jawale, C. V., & Lee, J. H. (2014). Characterization of a Salmonella Typhimurium ghost
carrying an adjuvant protein as a vaccine candidate for the protection of
chickens against virulent challenge. Avian Pathology, 1e32.
Kalia, A., Rattan, A., & Chopra, P. (1999). A method for extraction of high-quality and
high-quantity genomic DNA generally applicable to pathogenic bacteria.
Analytical Biochemistry, 275(1), 1e5.
Kidgell, C., Reichard, U., Wain, J., Linz, B., Torpdahl, M., Dougan, G., et al. (2002).
Salmonella typhi, the causative agent of typhoid fever, is approximately 50,000
years old. Infection, Genetics and Evolution, 2(1), 39e45.
Liu, W. B., Liu, B., Zhu, X. N., Yu, S. J., & Shi, X. M. (2011b). Diversity of Salmonella
isolates using serotyping and multilocus sequence typing. Food Microbiology,
28(6), 1182e1189.
Liu, B., Zhang, L., Zhu, X., Shi, C., Chen, J., Liu, W., et al. (2011a). PCR identification of
Salmonella serogroups based on specific targets obtained by comparative ge-
nomics. International Journal of Food Microbiology, 144(3), 511e518.
Liu, B., Zhou, X., Zhang, L., Liu, W., Dan, X., Shi, C., et al. (2012). Development of a
novel multiplex PCR assay for the identification of Salmonella enterica Typhi-
murium and Enteritidis. Food Control, 27(1), 87e93.
Mourao, J., Machado, J., Novais, C., Antunes, P., & Peixe, L. (2014). Characterization of
the emerging clinically-relevant multidrug-resistant Salmonella enterica sero-
type 4,[5],12:i:- (monophasic variant of S. Typhimurium) clones. European
Journal of Clinical Microbiology & Infectious Diseases, 33(12), 2249e2257.
Mulvey, M. R., Finley, R., Allen, V., Ang, L., Bekal, S., El Bailey, S., et al. (2013).
Emergence of multidrug-resistant Salmonella enterica serotype 4,[5],12:i:-
involving human cases in Canada: results from the Canadian integrated pro-
gram on antimicrobial resistance surveillance (CIPARS), 2003-10. Journal of
Antimicrobial Chemotherapy, 68(9), 1982e1986.
Prendergast, D. M., Hand, D., Niota Ghallchoir, E., McCabe, E., Fanning, S., Griffin, M.,
et al. (2013). A multiplex real-time PCR assay for the identification and differ-
entiation of Salmonella enterica serovar Typhimurium and monophasic serovar
4,[5],12:i. International Journal of Food Microbiology, 166(1), 48e53.
Seixas, R., Machado, J., Bernardo, F., Vilela, C., & Oliveira, M. (2014). Biofilm for-
mation by Salmonella Enterica serovar 1,4,[5],12:i:- Portuguese isolates: a
phenotypic, genotypic, and socio-geographic analysis. Current Microbiology,
68(5), 670e677.
Switt, A. I., Soyer, Y., Warnick, L. D., & Wiedmann, M. (2009). Emergence, distri-
bution, and molecular and phenotypic characteristics of Salmonella enterica
serotype 4,5,12:i. Foodborne Pathogens and Disease, 6, 407e415.
Tennant, S. M., Diallo, S., Levy, H., Livio, S., Sow, S. O., Tapia, M., et al. (2010).
Identification by PCR of non-typhoidal Salmonella enterica serovars associated
with invasive infections among febrile patients in Mali. Plos Neglected Tropical
Diseases, 4(3). http://dx.doi.org/10.1371/journal.pntd.0000621.
Teske, L., Ryll, M., Rubbenstroth, D., Hanel, I., Hartmann, M., Kreienbrock, L., et al.
(2013). Epidemiological investigations on the possible risk of distribution of
 X. He et al. / Food Control 65 (2016) 152e159 159

zoonotic bacteria through apparently healthy homing pigeons. Avian Pathology, China. PLoS One, 10, e0137967.
42(5), 397e407. Zhao, S., Qaiyumi, S., Friedman, S., Singh, R., Foley, S. L., White, D. G., et al. (2003).
Yang, X., Wu, Q., Zhang, J., Huang, J., Guo, W., & Cai, S. (2015). Prevalence and Characterization of Salmonella enterica serotype newport isolated from humans
characterization of monophasic Salmonella serovar 1,4,[5],12:i:- of food origin in and food animals. Journal of Clinical Microbiology, 41(12), 5366e5371.