222 Send Orders for Reprints to reprints@benthamscience.

net

Current Pharmaceutical Analysis, 2023, 19, 222-234

RESEARCH ARTICLE
ISSN: 1573-4129 Volume 19, Number 1
eISSN: 1875-676X

Metabolomics-based Approach to Analyze the Therapeutic Targets and

Metabolites of a Synovitis Ointment for Knee Osteoarthritis
Impact
Factor:
0.743

BENTHAM
SCIENCE

Lei Zhang1,#, Huan Yang1,#, Jing Liu2, Ke Wang1, Xiang Cai3, Wei Xiao1, Le Wang2, Mang Wang2,
Chi Zhang1,* and Jin Zhang1,*
1
Department of Orthopedic, Wuhan Hospital of Traditional Chinese Medicine, Wuhan-430014, China; 2Department of
Acupuncture, Wuhan Hospital of Traditional Chinese Medicine, Wuhan-430014, China; 3Department of Surgery, Wu-
han Hospital of Traditional Chinese Medicine, Wuhan-430014, China
© 2023 The Author(s). Published by Bentham Science Publisher. This is an open access article published under CC BY 4.0 https://creativecommons.org/licenses/by/4.0/legalcode

Abstract: Background: Knee osteoarthritis (KOA) is a clinically common degenerative joint disease
that is not fatal but has a high prevalence. Synovitis ointment (HMYG) is a traditional Chinese medi-
cine formula that has been clinically proven to treat KOA; however, its therapeutic targets remain un-
known.
Objective: This study aimed to identify metabolites and potential targets of synovitis ointment allevia-
tion in rats with KOA using ultra-high-performance liquid-chromatography–mass spectrometry
(UHPLC-MS) metabolomics.
Current Pharmaceutical Analysis

ARTICLE HISTORY
Received: May 05, 2022
Revised: November 08, 2022
Accepted: November 15, 2022
DOI:
10.2174/1573412919666221223152915
Methods: The meniscus on each side of the knee was removed to model KOA in rats. The synovitis
ointment treatment was provided for 4 weeks. The lateral diameter of the knee was measured once a
week, and after 4 weeks, serum was collected to observe changes in the knee through a metabolomic
analysis.
Results: Synovitis ointment reduced the lateral diameter of the knee joint, relieved knee swelling, and
improved knee volume. In total, 28 differential metabolites, which were mainly involved in arginine
and proline metabolism and apoptosis, were identified in the Con and HMYG groups. 15-Deoxy-d-12,
14-PGJ2 and fomepizole were found to be the key metabolites after the HMYG treatment of KOA.
Compared with known drugs (diclofenac diethylamine emulsion and Jin Huang San), 2-(S-
Glutathionyl) acetyl glutathione, daidzein, pelargonic acid, and sulfamethoxazole increased in the
HMYG, and the metabolic pathways included the oxytocin signaling pathway, platelet activation, ol-
factory transduction, phototransduction, and cGMP-PKG signaling pathway. The expression levels of
cleaved-caspase-3, Bcl-2, PIK3a, TP53, TGFB1, and NFKB1 were reversed after HMYG treatment.
Conclusion: It has been observed that synovitis ointment relieves KOA. UHPLC-MS can analyze the
potential mechanism of action of the herbal compound of the synovitis ointment.

Keywords: Synovitis ointment, KOA, metabolomics, target, knee, osteoarthritis, HMYG, UHPLC-MS.

1. INTRODUCTION However, the current methods of treating KOA cannot

Knee osteoarthritis (KOA) is a common degenerative
disease that causes disability in the elderly [1]. The increas-
ing incidence of osteoarthritis (OA) is a serious threat to
human health and quality of life [2]. Studies have demon-
strated that the prevalence of KOA increases annually [3].
During the occurrence and development of OA, the articular
cartilage is the most likely to be affected, and damage and
degeneration of the cartilage are important signs of OA.
*Address correspondence to these authors at Department of Orthopedic,
Wuhan Hospital of Traditional Chinese Medicine, Wuhan-430014, China;
E-mail: 13098836766@163.com
#
These authors contributed equally to this work.
achieve radical healing, and most of them focus on relieving
pain and improving function [4]. Drug-free treatments in-
clude weight loss [5], physiotherapy [6, 7], orthotics [8],
therapeutic exercises [9, 10], and acupuncture [11]. Medica-
tions also include oral administration (acetaminophen, non-
steroidal anti-inflammatory drugs, and opioid analgesics)
[12], topical administration (hot pressing and herbal fumiga-
tion) [13], and intra-articular injection (stem cell, hyaluronic
acid, and glucocorticoids) [14]. Surgical interventions, such
as arthroscopy [15, 16] and total knee arthroplasty [16], are
commonly used to treat moderate-to-severe KOA. Remark-
ably traditional Chinese medicine may reduce the risk of
complete knee arthroplasty [17].

17-;/23 2023 Bentham Science Publishers

Metabolomics-based Approach to Analyze the Therapeutic Targets
Synovitis ointment comprises Aconiti Kusnezoffii Ra-
dix, Aconiti Radix, Arisaematis Rhizoma, Nardostachyos
Radix Et Rhizoma, Rhizoma Kaempferiae, Corydalis Rhi-
zoma, and Asari Radix Et Rhizoma, which are powdered
and made into a paste with white wine. The synovitis oint-
ment has anti-inflammatory and analgesic effects, dispelling
wind and dispersing cold as well as promoting blood circu-
lation and dehumidification. Its external application can
directly act on the affected part of cartilage tissue in synovi-
tis as an analgesic. Compared to oral administration, tradi-
tional Chinese medicine is made into powder, transferred
into a paste, and applied to diseased joints; thus, the oint-
ment can improve local blood concentration as the treatment
is more targeted. Additionally, the curative effect is signifi-
cant, with no systemic adverse reactions. However, the spe-
cific mechanism underlying the effects of the synovitis
ointment on KOA remains unclear. Currently, herbal formu-
lations use a multi-component, multi-target approach in the
treatment of diseases; they concur with the overall philoso-
phy of systems biology [18]. Metabolomics uses a top–
down” strategy to reflect the function of an organism from
the end symptoms of the metabolic network, which will be
beneficial for drug discovery and development in Chinese
medicine research [19]. Recently, UPLC-MS/MS has been
used for the separation and determination of drugs and their
metabolites [20]. Among these studies, Cai et al. [21] ob-
served the effect of mitiglinide on streptozotocin-induced
type 2 diabetes mellitus (T2DM) utilizing ultra-performance
liquid chromatography–tandem mass spectrometry (UPLC-
MS). These results identified some significantly altered me-
tabolites used to explain these mechanisms. Guo et al. [22]
reported that Astragalus Radix and Dioscoreae Rhizoma
affected four target proteins in T2DM, and the results sug-
gested that these four targets might be the most relevant
targets for the treatment of T2DM.
This study aimed to investigate the potential targets of
the synovitis ointment for the treatment of KOA. The main
active components of synovitis ointment were analyzed and
screened using metabolomics, and the mechanism of action
of the synovitis ointment was preliminarily elucidated by
bioassay combined with the drug target data of OA.
2. MATERIALS AND METHODS
2.1. Reagents
All the Traditional Chinese medicines were purchased
from Wuhan Traditional Chinese Medicine Hospital (Wu-
han, China). The following materials were also used: protein
markers (Helix, P12103), sodium dodecyl sulfate (Solarbio,
S8010), 1,2-Bis(dimethylamino)ethane (Solarbio, T8090),
ammonium persulfate (Solarbio, A1030-1), polyvinylidene
fluoride transfer membrane (Millipore, I PVH00010), radio-
immunoprecipitation assay (RIPA) lysate (Solarbio, R0010),
bicinchoninic acid (BCA) kit (Solarbio, PC0020), electro-
phoresis instrument (BIO-RAD, Mini PROTEAN 3 cell),
enzyme labeling instrument (Reb, MK3), methanol (Ther-
mo, 67-56-1), acetonitrile (Thermo, 75-05-8), 2-chlorophen
ylalanine (Aladdin, 103616-89-3), formic acid (TCI, 64-18-
6), ammonium formate (Sigma, 540-69-2); high-speed
freezing centrifuge (Hangzhou Ausheng, iCEN-24R), mi-
crotransfer gun (Rainin PiPet-Lite, various models), water
Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 223
bath pot (Leica, HI1210), refrigerator (Haier, BCD-
196TMZL), freezing centrifuge (Cence, H1850-R), mixer
(Vortex Mixer, QL-866), vacuum concentrator (Eppendorf,
5305), and filter membrane (Jin Teng, 0.22 µm).
2.2. Synovitis Ointment (HMYG)
The synovitis ointment was prepared from 50 g of Aco-
niti Kusnezoffii Radix, 50 g of Aconiti Radix, 50 g of
Arisaematis Rhizoma, 50 g of Nardostachyos Radix Et Rhi-
zoma, 50 g Rhizoma Kaempferiae, 50 g Corydalis Rhizoma,
and 20 g AsariRadix Et Rhizoma. The uniform powder was
collected, and the powder: liquor ratio was adjusted to 3:1.
To make a paste, 42% of alcohol was added. For treatment,
an appropriate amount was applied to the gauze and the af-
fected area.
2.3. Jin Huang San (JHSRG)
According to the Chinese Pharmacopoeia, Radix Tricho-
santhis (320 g), Angelicae Dahuricae Radix (160 g), Cur-
cumae Longae Rhizoma (160 g), Et Rhizoma Rhei Radix
(160 g), Phellodendri Chinensis Cortex (160 g), Atractylodis
Rhizoma (64 g), Magnoliae Officinalis Cortex (64 g), Citrus
reticulata Blanco (64 g), Radix Rhizoma Glycyrrhizae (64
g), and Arisaematis Rhizoma (64 g) were ground into a fine
powder and prepared into a paste with honey. The ratio of
JHSRG to honey was 3:1. For treatment, an appropriate
amount was applied to the gauze and the affected area.
2.4. Animals and Treatment
Sprague–Dawley rats were obtained from the China
Three Gorges University (Wuhan, China; Certificate of
Conformity: SYXK (Hubei) 2018-0104). Six-week-old male
rats with a body weight of 200 ± 10 g were fed without a
specific pathogen. Experiments were conducted in accord-
ance with the guidelines of the Hubei Provincial Animal
Management Commission (permit no. 42010200004453).
The rats were acclimated for 7 days and then fasted without
water. On day 8, the rats were anesthetized with an intra-
peritoneal injection of 3% pentobarbital (40 mg/kg). The
knee joints were peeled; a 2-cm longitudinal skin incision
was made to expose the knee. The meniscus on each side of
the knee was removed, a cotton ball was used to stop the
bleeding in time, and the incision was sutured with a 5-0
silk thread. After 6 weeks, the rats were randomly divided
into five groups as follows: control, model (Mod), synovitis
ointment (HMYG), diclofenac diethylamine emulsion (Pos),
and Jin Huang San (JHSRG, Chinese patent medicine)
groups (n = 6 per group). The rats in the HMYG group were
treated with the synovitis ointment, with 5 g per rat per day
applied to the knee; the rats in the Pos group were treated
with diclofenac diethylamine emulsion, with 0.4 g per rat
per day applied to the knee; and the rats in the JHSRG
group were treated with Jin Huang San, with 5 g per rat per
day applied to the knee. All these rats were treated once a
day with dressing for 6 h and continuous treatment for 4
weeks. After 4 weeks, the rats were anesthetized by intrap-
ulmonary injection of 3% pentobarbital sodium (40 mg/kg).
The blood was collected from the abdominal aorta, and the
serum was separated. The left and right knee joints of the
rats were maintained. If the rats did not die, animal death
was determined after anesthesia with 100 mg/kg pentobarbi-
224 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3
tal sodium until no heartbeat or breath was observed. The
entire process is illustrated in the graphical abstract.
2.5. Measurement of Knee Swelling
The transverse diameter of the knee was measured using
a Vernier caliper at 0 week, 1 week, 2 weeks, 3 weeks, and
4 weeks of treatment. The knee joints of the rats were bent
90° to quantify the degree of knee swelling. The left and
right knees of the rats were evaluated three times.
2.6. Sample Preprocessing
All the samples were thawed at 4°C; 100 µL of each
sample was transferred into 2-mL centrifuge tubes; 400 µL
of methanol (-20°C) was added to each tube, vortexed for 60
s, and centrifuged at 4°C for 10 min at 12000 g. All super-
natants from each sample were transferred into another 2-
mL centrifuge tube. The samples were concentrated to dry
in a vacuum and dissolved with 150 µL 2-chlorobenzalanine
(4 ppm) 80% methanol solution. The supernatant was fil-
tered through a 0.22-µm membrane to obtain the prepared
samples for LC-MS; 20 µL from each sample was used for
quality control (QC) samples, which were then used for LC-
MS detection [23-25].
2.7. Chromatographic Conditions
Chromatographic separation was accomplished in a
Thermo Vanquish system equipped with an ACQUITY
UPLC® HSS T3 (150×2.1 mm, 1.8 µm, Waters) column
maintained at 40°C. The temperature of the autosampler was
8°C. Gradient elution of analytes was performed with 0.1%
formic acid in water (A2) and 0.1% formic acid in acetoni-
trile (B2) or 5 mM ammonium formate in water (A3) and
acetonitrile (B3) at a flow rate of 0.25 mL/min. Each sample
(2 μL) was injected after equilibration. An increasing linear
gradient of solvent B2/B3 (v/v) was used as follows: 0~1
min, 2% B2/B3; 1~9 min, 2%~50% B2/B3; 9~12 min,
50%~98% B2/B3; 12~13.5 min, 98% B2/B3; 13.5~14 min,
98%~2% B2/B3; and 14~20 min, 2% B2-positive model
(14~17 min, 2% B3-negative model).
2.8. Mass Spectrometry Condition
Electrospray ionization mass spectrometry experiments
were performed on a Thermo Q Exactive HF-X mass spec-
trometer with a spray voltage of 3.5 kV and -2.5 kV in posi-
tive and negative modes, respectively. The sheath and auxil-
iary gases were set at 30 and 10 arbitrary units, respectively.
The capillary temperature was 325°C. The analyzer scanned
over a mass range of 81-1000 m/z for a full scan at a mass
resolution of 60,000. Data-dependent acquisition MS/MS
experiments were performed using a higher-energy C-trap
dissociation scan. The normalized collision energy was set
to 30 eV. Dynamic exclusion was performed to remove un-
necessary information from the MS/MS spectra.
2.9. Data Preprocessing
The original data obtained were converted into the
mzXML format (xcms input file format) report [26] using
the ProteoWizard software (v3.0.8789). Using the XCMS
package of the R software (v3.3.2) for peak identification
(peaks identification), peak filtering (peaks filtration), and
Zhang et al.
peak alignment (peaks alignment), the main parameters
were as follows: bw = 5, ppm = 15, peak width = c (5, 30),
mzwid = 0.015, mzdiff = 0.01, and method =: “centWave”.
2.10. Western Blotting
The protein levels of TGFB1 and NFKB1 in the synovial
fluid of the joints were analyzed by western blotting. Tissue
samples were homogenized in a RIPA lysate containing
protease inhibitors at 4°C and centrifuged at 12,000 g for 15
min. The protein concentration was measured using the BCA
protein assay kit. Proteins (20 μg) were separated using 12%
sodium dodecyl sulfate-polyacrylamide gel electrophoresis
and transferred onto polyvinylidene fluoride membranes
(IPVH00010, Millipore). The membranes were blocked with
5% skim milk for 2 h at room temperature in Tris-buffered
saline and incubated with primary antibodies against TGFB1
(PAB45878)), NFKB1 (PAB47874), and GAPDH
(PAB36269) (Bioswamp, China) overnight at 4°C. GAPDH
antibody (PAB36269, Bioswamp) was used as the internal
reference. The primary antibody dilution ratio was 1:1000.
The membranes were then washed with Tris-buffered saline
and incubated with goat anti-rabbit IgG secondary antibody
(SAB43714, Bioswamp, 1:20000) for 2 h at room tempera-
ture. Immunoreactivity was visualized by colorimetric reac-
tion using Immobilon Western HRP (WBKLS0500, Milli-
pore). The membranes were scanned using an automatic
chemiluminescence analyzer (Tanon-5200, Tanon).
2.11. Quantitative Reverse Transcription Polymerase
Chain Reaction (qRT-PCR)
Cartilage tissue was homogenized with 1 mL of TRIzol
reagent for RNA extraction. cDNA was synthesized by re-
verse transcription of the extracted RNA using the Ad-
vantage® RT-for-PCR Kit (Takara, Kyoto, Japan), and
qRT-PCR was performed using the SYBR Green PCR kit
(KAPA Biosystems, Wilmington, MA) on a CFX-Connect
96 system (Bio-Rad, Hercules, CA). The mRNA expression
of genes of interest (primers are presented in Table 1) was
normalized to that of GAPDH and presented as fold change
using the 2-ΔΔCt method. Reaction conditions were as fol-
lows: initial denaturation at 95°C for 3 min; 39 cycles of
denaturation at 95°C for 5 s; annealing at 56°C for 10 s and
extension at 72°C for 25 s; and final extension at 65°C for 5
s and 95°C for 50 s.
2.12. Statistical Analysis
Statistical analyses were performed using the SPSS23.0
software. All data are presented as mean ± standard devia-
tion. A one-way analysis of variance (ANOVA) was per-
formed to compare differences among three or more groups,
and post-hoc Fisher’s least significant difference test was
used for individual group comparisons. Statistical signifi-
cance was set at p < 0.05.
3. RESULTS
3.1. Effects of the Synovitis Ointment on the Knee of the
Rats with KOA
During the treatment of the left knee of the rats with
KOA, the lateral diameter of the knee increased significantly
Metabolomics-based Approach to Analyze the Therapeutic Targets Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 225

Table 1. Genes primers.

Primer Name Sequence Amplified Fragment Size

Tp53-F AAATCCGTATGCTGAGTATCTG 235 bp

Tp53-R ACAGGCACAAACACGAACC -
Bcl2-F TGGGATACTGGAGATGAAGACT 233 bp
Bcl2-R CGACGGTAGCGACGAGA -
CASP3-F ATTTTTGGAACGAACGGAC 211 bp
CASP3-R AAGCATACAGGAAGTCGGC -
Pik3ca-F ATCTCAACTCGCCTCATAGC 149 bp
Pik3ca-R CTTGTCGTTGTTTGGAGAGA -
GAPDH-F ACCCACTCCTCTACCTTCG 108 bp
GAPDH-R CACCACCCTGTTGCTGT -

Fig. (1). Effect of synovitis ointment on the knee of rats with knee osteoarthritis. (A) Left knee lateral diameter (Pre-treatment). (B) Left
knee lateral diameter (In treatment). (C) Left knee lateral diameter (Post-treatment). (D) Right knee lateral diameter (Pre-treatment). (E)
Right knee lateral diameter (In treatment). (F) Right knee lateral diameter (Post-treatment). (G) Knee size after treatment. Data are shown as
mean ± SD (n = 6). * p < 0.05. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

in the Mod group and decreased significantly in the drug-
treated rats after 4 weeks (Figs. 1A-C). The same effect was
observed in the right knee (Figs. 1D-F), and their knee volumes
were all larger than those in the Mod group (Fig. 1G). This
result suggested that synovitis ointment reduced swelling.
3.2. Identification of Serum Metabolites in Rats with
KOA
A data matrix was obtained, which included information,
such as mass-to-core ratio (mass-to-charge ratio), retention
time (retention time), and peak area (intensity). In total,
226 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3
Fig. (2). Identification of serum metabolites in rats with knee osteoarthritis. (A) The base peak chromatogram (BPC) in positive ion mode.
(B) The base peak chromatogram (BPC) in negative ion mode. (C) QA result diagram in positive ion mode. (D) QA result diagram in ne-
gative ion mode. (A higher resolution / colour version of this figure is available in the electronic copy of the article).
17,710 precursor molecules were obtained in a positive-ion
mode; 14,416 precursor molecules were obtained in a nega-
tive-ion mode (Tables S1 and S2). To compare data of dif-
ferent orders of magnitude, the peak area of the data was
normalized in batches. The ionic strength and time were
considered the ordinate and abscissa, respectively. The base
peak chromatogram (BPC) in the positive-ion (Fig. 2A) and
negative-ion (Fig. 2B) modes was obtained. Differences in
rat serum metabolites, both in positive and negative ions,
were identified in the different treatment groups. The ionic
force allows observing the change of the type and quantity
of metabolites with detection time. To obtain reliable and
high-quality metabonomic data, QC samples were used dur-
ing testing. In Figs. (2C and 2D), QC sample aggregation
was observed in the positive- and negative-ion modes, and
in the QC samples, the proportion of characteristic peaks
with relative standard deviation (RSD) < 30% can reach
approximately 70%, indicating that the data are good.
3.3. Hierarchical Cluster Analysis of Metabolites
All the samples and related data were calculated using a
distance matrix. All the samples were grouped by hierar-
chical clustering. The clusters were merged from the bottom
to the top. The distance between the samples was calculated.
After hierarchical clustering of all the assay samples from
the five treatment groups, the Con3 and HMYG1 samples
were closer in the cationic mode (Fig. 3A). In Fig. (3B),
several highly expressed metabolites can be observed in the
Mod group, and the JHSRG and Pos groups have the same
highly expressed metabolites, although the highly expressed
metabolites in the HMYG group were different. Interesting-
Zhang et al.
ly, the similarity between the JHSRG3 and HMYG1 sam-
ples was higher in the negative-ion mode (Fig. 3C). The
same highly expressed metabolites were present in the
JHSRG and Pos groups, whereas the highly expressed me-
tabolites in the Mod group were different from those in the
HMYG group (Fig. 3D). Subsequently, a two-by-two com-
parison of each of the five groups was conducted to observe
changes in the differential metabolites. Due to the presence
of highly expressed single metabolites in the HMYG group,
we considered HMYG metabolites, which are highly ex-
pressed in both positive- and negative-ion modes.
3.4. Multivariate Statistical Analysis
Orthogonal projections to latent structures discriminant
analysis (OPLS-DA) is a method that can effectively reduce
the complexity of the model and enhance the interpretation
ability of the model without reducing its prediction ability to
maximize the differences between groups. OPLS-DA uses
orthogonal signal correction technology to decompose the
X-matrix information into Y-related and unrelated infor-
mation and then filter out the information that is irrelevant
to classification. The related information is mainly concen-
trated in the first prediction component. According to the
value of variable importance for projection (VIP), the varia-
ble (metabolites) can explain the importance of the X da-
taset and the associated Y dataset. The sum of the squares of
all the VIP values is equal to the total number of variables in
the model; therefore, the average value is 1. Metabolites
with VIP > 1 were selected as differential metabolites in the
positive- and negative-ion modes. As shown in Fig. (4),
differences in metabolites were observed between the
Metabolomics-based Approach to Analyze the Therapeutic Targets Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 227

Fig. (3). Hierarchical cluster analysis of metabolites. (A) Tree analysis of population sample in positive ion mode. (B) Total metabolite heat
map in positive ion mode. (C) Tree analysis of population sample in negative ion mode. (D) Total metabolite heat map in negative ion
mode. (A higher resolution / colour version of this figure is available in the electronic copy of the article).

Fig. (4). Multivariate statistical analysis. (A) OPLS-DA in positive ion mode. (B) OPLS-DA in negative ion mode. (A higher resolution /
colour version of this figure is available in the electronic copy of the article).

groups and among the HMYG group. The greatest differ-
ences were observed between the Con and Mod groups, and
the differences in metabolites between the HMYG and Mod
groups were not significant compared to those in the other
groups.
3.5. Detection and Identification of Differential Metabo-
lites
Through screening, we examined differential metabo-
lites. The screening conditions were as follows: p-value ≤
0.05 + VIP ≥ 1 [27] and p-value ≤ 0.05 (multiple groups)
[28]. The variation in the differential metabolites is present-
ed in Fig. (5). In the positive-ion mode, more metabolites
were increased and lowered in the Pos and JHSRG groups,
respectively, compared to the Con and HMYG groups. In
total, 1035 metabolites were increased in the Pos group rela-
tive to the HMYG group, while only 311 metabolites were
decreased. A total of 1562 metabolites were increased, and
271 metabolites were lower in the JHSRG group than in the
HMYG group. As can be observed in the figure, the use of
both Pos and JHSRG resulted in numerous alterations in
serum metabolites in rats. However, the HMYG group did
not demonstrate a significant difference in the number of
upregulated and downregulated metabolites compared to the
Con group, even though the HMYG group was compared to
the Mod group (Fig. 5A). The same tendency was observed
in the negative-ion mode (Fig. 5B). According to the precise
molecular weight (molecular weight error < 30 ppm), the
metabolites were subsequently obtained according to the
annotations of Metlin (http://metlin.scripps.edu) Mona (http
s:/mona.fiehnlab.ucdavis.edu//)) and the self-built standard
228 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3
Fig. (5). Detection and identification of differential metabolites. (A) Statistical histogram of differential metabolites in positive ion mode.
(B) Statistical histogram of differential metabolites in negative ion mode. Red for the up-regulation of metabolites and blue for the down-
regulation of metabolites. (A higher resolution / colour version of this figure is available in the electronic copy of the article).
database according to the MS/MS fragment pattern. In total,
345 metabolites were identified (Table S3). In total, 182
metabolites with differences were identified using two-by-
two comparisons and five mixed groups Table S4.
3.6. Differential Analysis of Metabolites
The results of previous experiments demonstrated that
rats with KOA had a smaller lateral diameter of the knee
and a larger knee joint after 4 weeks of dressing. Thus,
HMYG may have a biological process similar to that of Pos
or JHSRG. Among the differential metabolites between the
HMYG and JHSRG groups, nine had higher relative levels
in the HMYG group than in the JHSRG group (Fig. 6A).
Among the differential metabolites between the HMYG and
Pos groups, 13 had higher relative levels in the HMYG
group than in the JHSRG group (Fig. 6B). Additionally, the
analysis revealed that the metabolites with relatively high
levels were the same in both groups: 2-(S-glutathionyl) ace-
tyl glutathione, daidzein, pelargonic acid, and sulfamethox-
azole. Relative metabolite content was assessed by calculat-
ing the Z-score (standard score). This formula is expressed
as Z = (x - μ)/σ, where x is the specific score, μ is the aver-
age, and σ is the standard deviation. The cluster analysis
revealed that the metabolites with relatively high levels were
the same in both groups (Figs. 6C and D). We identified no
direct similarity between the four shared metabolites com-
pared with the two groups, with pelargonic acid and sulfa-
methoxazole having the highest direct similarity, followed
by daidzein and 2-(S-glutathionyl) acetyl glutathione. Eight
differential metabolites were highly expressed, which be-
longed to one category, and 20 differential metabolites were
lowly expressed, which belonged to another category in the
HMYG group, compared to that in the Con group (Fig. 7).
Interestingly, 15-deoxy-d-12,14-PGJ2 and fomepizole were
detected simultaneously when comparing differential me-
tabolites between the Con and Mod groups (Fig. 7A). 15-
Deoxy-d-12,14-PGJ2 and fomepizole were significantly
decreased, and fomepizole was significantly increased in the
Zhang et al.
Con and HMYG groups compared to those in the Mod
group (Figs. 7C-F).
3.7. Metabolic Pathway Analysis
The MetPA database was used to analyze the related
metabolic pathways of the two groups of differential metab-
olites. The data analysis algorithm is a hypergeometric test,
and the topology of the pathway is the relative betweenness
centrality. Considering the −log(p) size and size of the im-
pact, the pathway with the strongest influence of the
abovementioned two factors was selected as the possible
metabolic pathway involved in HMYG (Fig. 8). Compared
to the Pos group, the differential metabolites of HMYG
were mainly involved in the oxytocin signaling pathway and
platelet activation. Compared to the JHSRG group, the
differential metabolites of HMYG were mainly involved in
olfactory transduction, phototransduction, and the cGMP–
PKG signaling pathway. Compared to the Mod group, the
differential metabolites of HMYG were mainly involved in
arginine and proline metabolism and apoptosis.
3.8. Predicted Target Analysis
As presented in Fig. (9), the expression of cleaved-
caspase-3 mRNA was higher than that in the control group,
and after HMYG treatment, the expression level of cleaved-
caspase-3 mRNA was reduced. The expression levels of
Bcl-2, PIK3ca, and TP53 mRNAs in the HMYG group were
lower than those in the Con group; after the HMYG treat-
ment, all of these mRNAs were found to be higher. Addi-
tionally, the expression levels of TGFB1 and NFKB1 pro-
teins were higher than those in the control group, and after
HMYG treatment, the protein expression levels were re-
duced.
4. DISCUSSION
In this study, we focused on identifying the key metabo-
lites of the synovitis ointment and the biological processes
Metabolomics-based Approach to Analyze the Therapeutic Targets Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 229

Fig. (6). Differential analysis of metabolites. (A) HMYG vs. JHSRG Z-score, (B) HMYG vs. Pos Z-score, (C) HMYG vs. JHSRG thermo-
graphic analysis of differential metabolites, (D) HMYG vs. Pos thermographic analysis of differential metabolites. (A higher resolution /
colour version of this figure is available in the electronic copy of the article).

Fig. (7). Differential analysis of metabolites. (A) Con vs. Mod thermographic analysis of differential metabolites. (B) HMYG vs. Mod ther-
mographic analysis of differential metabolites. (C-F) The normalized intensity of 15-Deoxy-d-12,14-PGJ2 and Fomepizole in Con vs. Mod
and HMYG vs. Mod. (A higher resolution / colour version of this figure is available in the electronic copy of the article).
230 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 Zhang et al.

Fig. (8). Map of influencing factors of the metabolic pathway. (A) HMYG vs. Pos. (B) HMYG vs. JHSRG. (C) HMYG vs. Mod. (A higher
resolution / colour version of this figure is available in the electronic copy of the article).

Fig. (9). Western blot and qRT-PCR analysis of predicted targets. (A) The mRNA expression of cleaved-caspase-3, Bcl-2, PIK3ca, and
TP53 in different groups; (B) The proteins expression of TGFB1 and NFKB1 in different groups. (A higher resolution / colour version of
this figure is available in the electronic copy of the article).

Metabolomics-based Approach to Analyze the Therapeutic Targets
involved. We created a synovitis ointment, which is a
homemade cream containing alcohol and comprising seven
kinds of herbs. Moreover, the application of the synovitis
cream is reported in this study for the first time. Synovitis is
a common manifestation of rheumatic diseases and plays an
important role in their pathophysiology [29]. Intra-articular
lesions may cause elevated levels of synovitis [30]. In this
study, the meniscus was removed from each side of the knee
in the rats, and after 6 weeks, the lateral diameter of the left
knee increased in both the model groups of rats (p<0.05).
Interestingly, the diameter of the left leg of the rat knee in-
creased to a greater extent than that of the right leg; during
the first week of synovitis ointment treatment, no significant
difference was observed in the knee diameter in the right
legs of the rats in the HMYG group compared to those in
the Con group. Additionally, the amount of knee diameter
growth in the right leg was overall lower than that in the left
leg in the Pos and JHERG groups, which may be due to a
correlation between the degree of knee use in the right and
left legs of the rats during treatment. One study has reported
differences between the right and left sciatic nerves of naive
rats and cats [31]. The increase in the lateral diameter of the
knee due to the flexion and extension of the joint can be
interpreted as swelling of the knee joint. During the 4-week
treatment, the best treatment effect on knee swelling was
observed in the Pos group, and the degree of knee swelling
in the rats in the HMYG group decreased with increasing
administration time. After the fourth week, the knee joints
of the rats in the Pos and HMYG groups returned to the
normal level as that of the normal rats 4 weeks earlier. Ad-
ditionally, the final treatment effect of the synovitis oint-
ment was better than that of Jin Huang San (p < 0.05). Jin
Huang San is recorded in the Chinese Pharmacopoeia as a
proprietary Chinese medicine, and its composition is differ-
ent from that of the synovitis ointment. Although both have
certain therapeutic effects, the unique composition of the
synovitis ointment needs to be further analyzed through
metabolomics.
OA is the most common type of arthritis. It is a degener-
ative joint disease that seriously affects the quality of life of
patients. KOA is the most common clinical condition, main-
ly manifested by knee joint pain and restricted mobility. OA
is the most common joint disease worldwide, and its inci-
dence is the highest in the human body. It mainly affects
people aged >45 years. This study recorded more women
with KOA than men. Joint changes in OA are irreversible,
and no reversible treatment for OA damage is currently
available. Although KOA is not fatal, and the disability rate
is lower than that of rheumatoid or rheumatoid arthritis, it
has the greatest impact on the quality of life of the elderly
due to its higher prevalence. According to the 2018 edition
of the Osteoarthritis Diagnosis and Treatment Guidelines,
the prevalence of symptomatic KOA in China is 8.1%, and
the incidence of KOA in China is significantly higher than
that of hip OA. From the perspective of regional characteris-
tics, the prevalence of symptomatic KOA in rural areas is
higher than that in urban areas. Furthermore, it is suggested
that medication should be initiated early in the course of
KOA.
Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 231
After UHPLC-MS treatment, the serum of rats revealed
significant differences in ionic intensities among the five
groups, with variability in both number and size. To identify
biomarkers, the RSD of the potential characteristic peak in
the QC sample, that is, the coefficient of variation, must not
exceed 30%. If it exceeds, the relevant characteristic peak is
deleted. Therefore, based on QC, quality assurance (QA) is
generally performed to delete the characteristic peak (fea-
tures) with poor repeatability in QC samples to obtain high-
er-quality datasets and be more conducive to the detection
of biomarkers [23]. In QC samples, the proportion of char-
acteristic peaks with RSD <30% can reach approximately
70%, indicating that the data are good [32]. During QA and
QC, no discrete samples with poorly reproducible character-
istic peaks were included, and the percentage of characteris-
tic peaks with RSD <30% in the samples reached 80%;
therefore, the experimental data were considered good and
could be analyzed in the next step (Fig. 2). The process of
overall sample dendrogram analysis is the distance matrix
calculation of all samples and related data and the clustering
of all samples using hierarchical clustering [33]. In this
study, the clustering method used was average linkage (cal-
culate the average distance between two cluster data points).
Summarizing the degree of sample similarity in positive-
and negative-ion modes, the group with the greatest sample
similarity originated from multiple samples of the same
group, after which the sample HMYG1 was highly similar
to the samples Con3 and JHSRG3 in the positive- and nega-
tive-ion modes, respectively (Figs. 3A and C). At this point,
the overall metabolite heat map revealed differences in the
content of the same metabolites in different groups after
intergroup clustering. The metabolites highly expressed in
the HMYG1 samples in both the positive- and negative-ion
modes were consistent with those present in the Mod group.
Thus, the therapeutic effect of HMYG1 as a sample might
not be exerted (Figs. 3B and D). The levels of metabolites
that were highly expressed in the HMYG2 and HMYG3
samples were always minimal.
The multivariate statistical analysis software package
SIMCA-P (v13.0) and the R language ropls package were
used in this analysis [34]. The analysis method was OPLS-
DA. Research on osteopenia-osteoporosis discrimination in
postmenopausal women by 1H nuclear magnetic resonance
(NMR)-based metabolomics indicated that the OPLS-DA-
based model is better as it identifies and distinguishes the
important spectral regions, thus distributing metabolites
involved in the dynamic balance of the skeletal system pos-
sible [35]. OPLS-DA is also used for metabolomics in NMR
to reveal potential inflammatory pathology studies and iden-
tify metabolites in synovial joints with reactive arthritis [36,
37]. In this study, our results indicated some differences
between the groups, although the samples were relatively
aggregated. Moreover, a few differences were also observed
within the HMYG group (Fig. 4). The screening values for
differential metabolites included the p-value, VIP, fold-
change, one-way ANOVA p-value, and two-way ANOVA
p-value. This study identified 345 metabolites with p-values
≤ 0.05 and VIP ≥ 1 as conditions, and these metabolites
were differentially expressed in different groups; however,
232 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3
the variation in metabolites in the HMYG group was mini-
mal, both in the upregulated and downregulated fractions.
However, by comparing the metabolites in the HMYG
group with those in the Pos and JHSRG groups, four com-
mon metabolites in the HMYG group were identified; thus,
we tentatively proposed these four metabolites as possible
metabolites of synovitis ointment (Figs. 6A-E).
Ultimately, clustering analysis of the differential metab-
olites in the HMYG and Mod groups revealed that the eight
metabolites with higher levels in the HMYG group were not
duplicated by the four previously identified metabolites. As
the composition of the synovitis ointment is different, its
metabolites will also exist differently; however, no new
pathway has been identified for the current pharmacological
treatment of KOA. Therefore, the analysis of metabolic
pathways involved in synovitis ointment treatment was used
as the main reference to determ relationship between syno-
vitis ointment by linking the 12 ointment metabolites and
targets.
CONCLUSION
We compared the metabolites of HMYG-, Pos-, and
JHSRG-treated KOA rats after serum analysis by UHPLC–
MS. Four metabolites similar to metabolites in Pos and
JHSRG were identified by Z-score and agglomerate hierar-
chical clustering analysis: 2-(S-Glutathionyl) acetyl gluta-
thione, daidzein, pelargonic acid, and sulfamethoxazole,
which were associated with the oxytocin signaling pathway,
platelet activation, olfactory transduction, phototrans
duction, and cGMP-PKG signaling pathways. Altogether,
28 differential metabolites were identified in the Con and
HMYG groups, which mainly participated in arginine and
proline metabolism and apoptosis. It has been reported that
15-Deoxy-d-12,14-PGJ2 and fomepizole are key metabo-
lites after HMYG treatment of KOA.
LIST OF ABBREVIATIONS
KOA = Knee osteoarthritis
UHPLC-MS = Ultra-High-Performance Liquid-Chro-
matography-Mass Spectrometry
OA = Osteoarthritis
T2DM = Type 2 Diabetes Mellitus
QC = Quality Control
ETHICS APPROVAL AND CONSENT TO PARTICI-
PATE
All animal experiments are in line with the relevant pro-
visions of the Ethical Certificate of Experimental Animals
of the Animal Administration Commission of Hubei Prov-
ince. The license number for laboratory animals is SYXK
(E) 2018-0104.
HUMAN AND ANIMAL RIGHTS
No humans were used in this study. All the reported ex-
periments were in accordance with The US National Re-
Zhang et al.
search Council's "Guide for the Care and Use of Laboratory
Animals".
CONSENT FOR PUBLICATION
Not applicable.
AVAILABILITY OF DATA AND MATERIALS
The data used to support the findings of this study are
available from the corresponding authors [CZ, JZ] upon
request.
FUNDING
This work was financially supported by the Key Scien-
tific Research projects of traditional Chinese Medicine of
the Hubei Provincial Health Commission in 2019 (Grant
number ZY2019Z009) and the Wuhan Municipal Health
Commission's Scientific Research Project of Traditional
Chinese Medicine in 2021 (Grant number WZ20Z01).
CONFLICT OF INTEREST
The authors declare no conflict of interest, financial or
otherwise.
ACKNOWLEDGEMENTS
Declared none.
SUPPLEMENTARY MATERIAL
Supplementary material is available on the publisher’s
website along with the published article.
REFERENCES
[1] Kan, H.S.; Chan, P.K.; Chiu, K.Y.; Yan, C.H.; Yeung, S.S.; Ng,
Y.L.; Shiu, K.W.; Ho, T. Non-surgical treatment of knee osteoar-
thritis. Hong Kong Med. J., 2019, 25(2), 127-133.
PMID: 30919810
[2] Hunter, D.J.; Bierma-Zeinstra, S. Osteoarthritis. Lancet, 2019,
393(10182), 1745-1759.
http://dx.doi.org/10.1016/S0140-6736(19)30417-9 PMID:
31034380
[3] Spitaels, D.; Mamouris, P.; Vaes, B.; Smeets, M.; Luyten, F.;
Hermens, R.; Vankrunkelsven, P. Epidemiology of knee osteoar-
thritis in general practice: a registry-based study. BMJ Open, 2020,
10(1), e031734.
http://dx.doi.org/10.1136/bmjopen-2019-031734 PMID: 31964664
[4] Filardo, G.; Kon, E.; Longo, U.G.; Madry, H.; Marchettini, P.;
Marmotti, A.; Van Assche, D.; Zanon, G.; Peretti, G.M. Non-
surgical treatments for the management of early osteoarthritis.
Knee Surg. Sports Traumatol. Arthrosc., 2016, 24(6), 1775-1785.
http://dx.doi.org/10.1007/s00167-016-4089-y PMID: 27043347
[5] Yázigi, F.; Espanha, M.; Vieira, F.; Messier, S.P.; Monteiro, C.;
Veloso, A.P. The PICO project: aquatic exercise for knee osteoar-
thritis in overweight and obese individuals. BMC Musculoskelet.
Disord., 2013, 14(1), 320.
http://dx.doi.org/10.1186/1471-2474-14-320 PMID: 24219758
[6] Deyle, G.D.; Allen, C.S.; Allison, S.C.; Gill, N.W.; Hando, B.R.;
Petersen, E.J.; Dusenberry, D.I.; Rhon, D.I. Physical therapy ver-
sus glucocorticoid injection for osteoarthritis of the knee. N. Engl.
J. Med., 2020, 382(15), 1420-1429.
http://dx.doi.org/10.1056/NEJMoa1905877 PMID: 32268027
Metabolomics-based Approach to Analyze the Therapeutic Targets
[7] Richardson, C.; Plaas, A.; Block, J.A. Intra-articular hyaluronan
therapy for symptomatic knee osteoarthritis. Rheum. Dis. Clin.
North Am., 2019, 45(3), 439-451.
http://dx.doi.org/10.1016/j.rdc.2019.04.011 PMID: 31277754
[8] Georgiev, T.; Angelov, A.K. Modifiable risk factors in knee
osteoarthritis: treatment implications. Rheumatol. Int., 2019, 39(7),
1145-1157.
http://dx.doi.org/10.1007/s00296-019-04290-z PMID: 30911813
[9] Zafar, A.Q.; Zamani, R.; Akrami, M. The effectiveness of foot
orthoses in the treatment of medial knee osteoarthritis: A systema-
tic review. Gait Posture, 2020, 76, 238-251.
http://dx.doi.org/10.1016/j.gaitpost.2019.12.016 PMID: 31874456
[10] Jeong, H.S.; Lee, S.C.; Jee, H.; Song, J.B.; Chang, H.S.; Lee, S.Y.
Proprioceptive training and outcomes of patients with knee
osteoarthritis: A Meta-Analysis of Randomized Controlled Trials.
J. Athl. Train., 2019, 54(4), 418-428.
http://dx.doi.org/10.4085/1062-6050-329-17 PMID: 30995119
[11] Skou, S. T.; Roos, E. M. Physical therapy for patients with knee
and hip osteoarthritis: supervised, active treatment is current best
practice. Clinical and experimental rheumatology 2019, 37 (Suppl)
120(5), 112-117.
[12] Li, J.; Li, Y.X.; Luo, L.J.; Ye, J.; Zhong, D.L.; Xiao, Q.W.; Zheng,
H.; Geng, C.M.; Jin, R.J.; Liang, F.R. The effectiveness and safety
of acupuncture for knee osteoarthritis. Medicine (Baltimore),
2019, 98(28), e16301.
http://dx.doi.org/10.1097/MD.0000000000016301 PMID:
31305415
[13] Eymard, F.; Chevalier, X. Pharmacological treatments of knee
osteoarthritis. Rev. Prat., 2019, 69(5), 515-519.
PMID: 31626455
[14] Zhou, X.; Xiang, K.; Yuan, X.; Wang, Z.; Li, K. A comparison of
the effects of acupoint injection combined with hyaluronic acid
versus isolated hyaluronic acid for knee osteoarthritis. Medicine
(Baltimore), 2020, 99(47), e23262.
http://dx.doi.org/10.1097/MD.0000000000023262 PMID:
33217849
[15] Delanois, R.E.; Etcheson, J.I.; Sodhi, N.; Henn, R.F., III; Gwam,
C.U.; George, N.E.; Mont, M.A. Biologic therapies for the treat-
ment of knee osteoarthritis. J. Arthroplasty, 2019, 34(4), 801-813.
http://dx.doi.org/10.1016/j.arth.2018.12.001 PMID: 30612835
[16] Palmer, J.S.; Monk, A.P.; Hopewell, S.; Bayliss, L.E.; Jackson,
W.; Beard, D.J.; Price, A.J. Surgical interventions for symptomatic
mild to moderate knee osteoarthritis. Cochrane Libr., 2019,
2019(7), CD012128.
http://dx.doi.org/10.1002/14651858.CD012128.pub2 PMID:
31322289
[17] Skou, S.T.; Roos, E.M.; Laursen, M.B.; Rathleff, M.S.; Arendt-
Nielsen, L.; Rasmussen, S.; Simonsen, O. Total knee replacement
and non-surgical treatment of knee osteoarthritis: 2-year outcome
from two parallel randomized controlled trials. Osteoarthritis Car-
tilage, 2018, 26(9), 1170-1180.
http://dx.doi.org/10.1016/j.joca.2018.04.014 PMID: 29723634
[18] Zhang, A.; Sun, H.; Wang, P.; Han, Y.; Wang, X. Future perspec-
tives of personalized medicine in traditional Chinese medicine: A
systems biology approach. Complement. Ther. Med., 2012, 20(1-
2), 93-99.
http://dx.doi.org/10.1016/j.ctim.2011.10.007 PMID: 22305254
[19] Zhang, A.; Sun, H.; Wang, X. Recent highlights of metabolomics
for traditional Chinese medicine. Pharmazie, 2012, 67(8), 667-
675.
PMID: 22957430
[20] Husain, A.; Iram, F.; Siddiqui, A.A.; Almutairi, S.M.; Mohammed,
O.B.; Khan, S.A.; Azmi, S.N.H.; Rahman, N. Identification of me-
tabolic pathways involved in the biotransformation of eslicarbaze-
pine acetate using UPLC-MS/MS, human microsomal enzymes
and in silico studies. J. King Saud Univ. Sci., 2021, 33(2), 101281.
http://dx.doi.org/10.1016/j.jksus.2020.101281
[21] Cai, S.; Huo, T.; Xu, J.; Lu, X.; Zheng, S.; Li, F. Effect of mitigli-
nide on Streptozotocin-induced experimental type 2 diabetic rats:
A urinary metabonomics study based on ultra-performance liquid
chromatography–tandem mass spectrometry. J. Chromatogr. B
Analyt. Technol. Biomed. Life Sci., 2009, 877(29), 3619-3624.
Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3 233
http://dx.doi.org/10.1016/j.jchromb.2009.08.044 PMID: 19748326
[22] Guo, Q.; Niu, W.; Li, X.; Guo, H.; Zhang, N.; Wang, X.; Wu, L.
Study on Hypoglycemic Effect of the Drug Pair of Astragalus Ra-
dix and Dioscoreae Rhizoma in T2DM Rats by Network Pharma-
cology and Metabonomics. Molecules, 2019, 24(22), 4050.
http://dx.doi.org/10.3390/molecules24224050 PMID: 31717456
[23] Dunn, W.B.; Broadhurst, D.; Begley, P.; Zelena, E.; Francis-
McIntyre, S.; Anderson, N.; Brown, M.; Knowles, J.D.; Halsall,
A.; Haselden, J.N.; Nicholls, A.W.; Wilson, I.D.; Kell, D.B.;
Goodacre, R. Procedures for large-scale metabolic profiling of se-
rum and plasma using gas chromatography and liquid chromato-
graphy coupled to mass spectrometry. Nat. Protoc., 2011, 6(7),
1060-1083.
http://dx.doi.org/10.1038/nprot.2011.335 PMID: 21720319
[24] Zelena, E.; Dunn, W.B.; Broadhurst, D.; Francis-McIntyre, S.;
Carroll, K.M.; Begley, P.; O’Hagan, S.; Knowles, J.D.; Halsall,
A.; Wilson, I.D.; Kell, D.B. Development of a robust and repeata-
ble UPLC-MS method for the long-term metabolomic study of
human serum. Anal. Chem., 2009, 81(4), 1357-1364.
http://dx.doi.org/10.1021/ac8019366 PMID: 19170513
[25] Sangster, T.; Major, H.; Plumb, R.; Wilson, A.J.; Wilson, I.D. A
pragmatic and readily implemented quality control strategy for
HPLC-MS and GC-MS-based metabonomic analysis. Analyst
(Lond.), 2006, 131(10), 1075-1078.
http://dx.doi.org/10.1039/b604498k PMID: 17003852
[26] Smith, C.A.; Want, E.J.; O’Maille, G.; Abagyan, R.; Siuzdak, G.
XCMS: processing mass spectrometry data for metabolite profi-
ling using nonlinear peak alignment, matching, and identification.
Anal. Chem., 2006, 78(3), 779-787.
http://dx.doi.org/10.1021/ac051437y PMID: 16448051
[27] Ni Q.; Ye Z.; Wang Y.; Chen J.; Zhang W.; Ma C.; Li K.; Liu Y.;
Liu L.; Han Z.; Gao T.; Jian Z.; Li S.; Li C. Gut Microbial
Dysbiosis and Plasma Metabolic Profile in Individuals With Viti-
ligo. Front Microbiol, 2020, 11: 592248.
http://dx.doi.org/10.3389/fmicb.2020. 592248 PMID: 33381090
[28] Wang, J.; Pu, S.; Sun, Y.; Li, Z.; Niu, M.; Yan, X.; Zhao, Y.;
Wang, L.; Qin, X.; Ma, Z.; Zhang, Y.; Li, B.; Luo, S.; Gong, M.;
Sun, Y.; Zou, Z.; Xiao, X. Metabolomic profiling of autoimmune
hepatitis: The diagnostic utility of nuclear magnetic resonance
spectroscopy. J. Proteome Res., 2014, 13(8), 3792-3801.
http://dx.doi.org/10.1021/pr500462f PMID: 24940827
[29] Burke, C.J.; Alizai, H.; Beltran, L.S.; Regatte, R.R. MRI of syno-
vitis and joint fluid. J. Magn. Reson. Imaging, 2019, 49(6), 1512-
1527.
http://dx.doi.org/10.1002/jmri.26618 PMID: 30618151
[30] Stahnke, K.; Morawietz, L.; Moroder, P.; Scheibel, M. Synovitis
as a concomitant disease in shoulder pathologies. Arch. Orthop.
Trauma Surg., 2019, 139(8), 1111-1116.
http://dx.doi.org/10.1007/s00402-019-03152-4 PMID: 30820695
[31] Christensen, M. B.; Tresco, P. A. Differences exist in the left and
right sciatic nerves of naïve rats and cats. Anatomical record
(Hoboken, N.J. : 2007), 2015, 298(8), 1492-501.
[32] Want, E.J.; Wilson, I.D.; Gika, H.; Theodoridis, G.; Plumb, R.S.;
Shockcor, J.; Holmes, E.; Nicholson, J.K. Global metabolic profi-
ling procedures for urine using UPLC–MS. Nat. Protoc., 2010,
5(6), 1005-1018.
http://dx.doi.org/10.1038/nprot.2010.50 PMID: 20448546
[33] Yuan, M.; Breitkopf, S.B.; Yang, X.; Asara, J.M. A positi-
ve/negative ion–switching, targeted mass spectrometry–based me-
tabolomics platform for bodily fluids, cells, and fresh and fixed
tissue. Nat. Protoc., 2012, 7(5), 872-881.
http://dx.doi.org/10.1038/nprot.2012.024 PMID: 22498707
[34] Thévenot, E.A.; Roux, A.; Xu, Y.; Ezan, E.; Junot, C. Analysis of
the human adult urinary metabolome variations with age, body
mass index, and gender by implementing a comprehensive
workflow for univariate and opls statistical analyses. J. Proteome
Res., 2015, 14(8), 3322-3335.
http://dx.doi.org/10.1021/acs.jproteome.5b00354 PMID:
26088811
[35] Pontes, T.A.; Barbosa, A.D.; Silva, R.D.; Melo-Junior, M.R.;
Silva, R.O. Osteopenia-osteoporosis discrimination in postmeno-
pausal women by 1H NMR-based metabonomics. PLoS One,
2019, 14(5), e0217348.
234 Current Pharmaceutical Analysis, 2023, Vol. 19, No. 3
http://dx.doi.org/10.1371/journal.pone.0217348 PMID: 31141566
[36] Dubey, D.; Kumar, S.; Rawat, A.; Guleria, A.; Kumari, R.; Ah-
med, S.; Singh, R.; Misra, R.; Kumar, D. NMR-based metabolo-
mics revealed the underlying inflammatory pathology in reactive
arthritis synovial joints. J. Proteome Res., 2021, 20(11), 5088-
5102.
Zhang et al.
http://dx.doi.org/10.1021/acs.jproteome.1c00620 PMID: 34661415
[37] Kim, S.; Hwang, J.; Kim, J.; Ahn, J.K.; Cha, H.S.; Kim, K.H.
Metabolite profiles of synovial fluid change with the radiographic
severity of knee osteoarthritis. Joint Bone Spine, 2017, 84(5), 605-
610.
http://dx.doi.org/10.1016/j.jbspin.2016.05.018 PMID: 27461192