This article was downloaded by: [Imperial College London Library]

On: 10 October 2014, At: 05:01

Publisher: Taylor & Francis
Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered
office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Biocontrol Science and Technology

Publication details, including instructions for authors and
subscription information:
http://www.tandfonline.com/loi/cbst20

Mechanisms of the biofungicide

Serenade (Bacillus subtilis QST713) in
suppressing clubroot
a a a a
R. Lahlali , G. Peng , L. McGregor , B.D. Gossen , S.F. Hwang
b c
& M. McDonald
a
Saskatoon Research Centre , Agriculture and Agri-Food Canada ,
Saskatoon , Saskatchewan , Canada
b
Crop Diversification Centre North , Alberta Agriculture and Rural
Development , Edmonton , Alberta , Canada
c
Department of Plant Agriculture , University of Guelph ,
Guelph , ON , Canada
Accepted author version posted online: 14 Sep 2011.Published
online: 21 Oct 2011.

To cite this article: R. Lahlali , G. Peng , L. McGregor , B.D. Gossen , S.F. Hwang & M. McDonald
(2011) Mechanisms of the biofungicide Serenade (Bacillus subtilis QST713) in suppressing clubroot,
Biocontrol Science and Technology, 21:11, 1351-1362, DOI: 10.1080/09583157.2011.618263

To link to this article: http://dx.doi.org/10.1080/09583157.2011.618263

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the
“Content”) contained in the publications on our platform. However, Taylor & Francis,
our agents, and our licensors make no representations or warranties whatsoever as to
the accuracy, completeness, or suitability for any purpose of the Content. Any opinions
and views expressed in this publication are the opinions and views of the authors,
and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content
should not be relied upon and should be independently verified with primary sources
of information. Taylor and Francis shall not be liable for any losses, actions, claims,
proceedings, demands, costs, expenses, damages, and other liabilities whatsoever
or howsoever caused arising directly or indirectly in connection with, in relation to or
arising out of the use of the Content.

This article may be used for research, teaching, and private study purposes. Any
substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,
systematic supply, or distribution in any form to anyone is expressly forbidden. Terms &
 Conditions of access and use can be found at http://www.tandfonline.com/page/terms-
and-conditions
Downloaded by [Imperial College London Library] at 05:01 10 October 2014
 Biocontrol Science and Technology,
Vol. 21, No. 11, November 2011, 1351
1362

RESEARCH ARTICLE
Mechanisms of the biofungicide Serenade (Bacillus subtilis QST713)
in suppressing clubroot
R. Lahlalia, G. Penga*, L. McGregora, B.D. Gossena, S.F. Hwangb and
M. McDonaldc
a
Saskatoon Research Centre, Agriculture and Agri-Food Canada, Saskatoon, Saskatchewan,
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Canada; bCrop Diversification Centre North, Alberta Agriculture and Rural Development,
Edmonton, Alberta, Canada; cDepartment of Plant Agriculture, University of Guelph, Guelph,
ON, Canada
(Received 17 March 2011; final version received 24 August 2011)
Clubroot is a serious threat to canola production in western Canada. The
biofungicide Serenade† (Bacillus subtilis QST713) reduced the disease substan-
tially in controlled environment, but showed variable efficacy in field trials. To
better understand how this biofungicide works, two of the product components,
i.e., B. subtilis and its metabolites (product filtrate), were assessed under
controlled conditions for their relative contribution to clubroot control. The
information may be used to optimize the product formulation. The bacterium or
product filtrate alone was only partially effective against clubroot, reducing
disease severity by about 60% relative to untreated controls. In contrast, Serenade
controlled the disease by over 90%. This pattern of response was mirrored in
quantitative PCR assessment on P. brassicae DNA within canola roots; the lowest
and highest amounts of pathogen DNA were found in roots of Serenade
treatment (0.02 and 0.01 ng/g) and controls (0.52 and 13.35 ng/g), respectively,
at 2 and 3 weeks after treatment. During this period, the amount of DNA
changed little in Serenade-treated roots but increased by almost 30-fold in the
control. The product filtrate or B. subtilis also reduced the pathogen DNA
substantially (0.03
1.16 ng/g). Serenade decreased the germination and viability
of P. brassicae resting spores only marginally. It is suggested that biofungicide
Serenade controls clubroot largely via suppressing root-hair and cortical infection
by P. brassicae zoospores. The bacterial metabolites in the product formulation
possibly assist B. subtilis in rhizosphere colonization and clubroot control by
minimizing the competition from other soil microbes.
Keywords: Plasmodiophora brassicae; Brassica napus; lipopeptide; surfactin;
iturin A; fengycins

Introduction
Clubroot, caused by the obligate pathogen Plasmodiophora brassicae Woronin, is a
serious disease on crucifer crops worldwide (Dixon 2009). In 2003, the disease was
reported for the first time on canola (Brassica napus L.) in central Alberta, Canada
(Tewari et al. 2004), and by 2009, clubroot had been found in more than 456 canola
fields in the province (Strelkov, Manolii, Zequera, Manolii, and Hwang 2010). There
are about 4.7 million hectares of canola in western Canada yearly, and clubroot has

*Corresponding author. Email: Gary.Peng@agr.gc.ca

ISSN 0958-3157 print/ISSN 1360-0478 online
# 2011 Taylor & Francis
http://dx.doi.org/10.1080/09583157.2011.618263
http://www.tandfonline.com
 1352 R. Lahlali et al.

now become a major threat to canola production in the region (Howard, Strelkov,
and Harding 2010).
The life cycle of P. brassicae can generally be divided into two stages: (i) a
primary stage consisting of germination of resting spores, infection of root hairs by
primary zoospores, and development of primary plasmodia and then secondary
zoospores; and (ii) a secondary phase consisting of cortical infection by secondary
zoospores, colonization of cortex, and development of secondary plasmodia that
stimulate root enlargement and gall formation (Ingram and Tommerup 1972). The
short interval between the emergence of primary zoospores and root-hair infection is
part of the life cycle where the pathogen is most vulnerable to adverse environmental
conditions (Dixon 2009).
Recommendations for managing clubroot include fungicide drenches (Naiki and
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Dixon 1987), soil liming (Webster and Dixon 1991), and use of resistant cultivars and
crop rotation (Donald and Porter 2009). Few fungicides are highly effective (Donald
and Porter 2009), and liming is impractical on a large acreage of canola in western
Canada. Most canola cultivars were highly susceptible (Strelkov, Tewari, and Smith-
Degenhardt 2006), but resistant cultivars are now available commercially although
their durability is unknown. The resistance to clubroot is generally race specific
(Diederichsen, Beckmann, Schondelmeier, and Dreyer 2006) and can be eroded when
pathogen race structure changes.
Microorganisms have been explored for biocontrol of clubroot, including the
fungi Phoma glomerata (Arie, Kobayashi, Kono, Gen, and Yamaguchi 1999),
Heteroconium chaetospira (Nairsawa, Tokumasu, and Hashiba 1998), and
Acremonium alternatum (Jaschke, Dugassa-Gobena, Karlovsky, Vidal, and Ludw-
ing-Muller 2010). None of these candidates has been registered for commercial uses.
Several biofungicides available in Canada were assessed recently for clubroot control,
and Serenade† ASO (Bacillus subtilis QST713) was highly effective under controlled-
environment conditions, but inconsistent in field trials (Peng et al. 2011). The
objective of this study was to better understand how this biofungicide worked by
assessing two of the components in the Serenade product for their relative
contribution to clubroot biocontrol, including the impact on resting spores and
suppression of pathogen infection and development in canola roots. The information
can be useful to improving product formulation and delivery for optimal efficacy.

Materials and methods

Preparation of Serenade components and pathogen inoculum
To prepare a biofungicide treatment, the Serenade† ASO formulation was diluted to
a 5% concentration (v/v) with sterile deionized water (SDW). The dilution had about
5107 colony forming units (CFU) mL 1 of B. subtilis cells plus other formulation
components at a 5% concentration. Product filtrates were prepared by filtering the
5% Serenade suspension through a 0.22-mm membrane (Millipore Corp, Billerica,
MA). The filtrate would include three classes of lipopeptides (surfactins, iturins, and
fengycins) based on the information provided by AgraQuest Inc. (manufacturer) and
was kept at 48C until use. Because it was impossible to separate bacterial cells from a
mixture of powdery additives in the Serenade formulation, the B. subtilis QST713
strain was isolated and its inoculum produced on a Bacillus medium (Philip,
 Biocontrol Science and Technology 1353

Lyengar, and Venkobachar 1998) agar at 258C for 48 h; bacterial cultures were
scraped off the medium agar and suspended in SDW to about 5 107 CFU mL 1
based on a plating method.
About 3 g of clubroot galls were cut into small pieces (0.50.5 0.5 cm),
immersed in 50 mL of SDW in a beaker for 2 h to soften the tissue, and homogenized
in a Waring blender for 1 min. The resulting slurry was filtered through eight layers
of 0.3-mm nylon cloth, centrifuged at 3500g for 10 min, and the supernatant was
discarded. This process was repeated, and resulting spore pellets were resuspended
with SDW and adjusted to 1 107 spores mL 1 using a haemocytometer.
Resting spores used for germination tests and viability staining were prepared
using the methods described by Strelkov et al. (2006) and Sundelin et al. (2010) with
slight modifications. Briefly, after centrifugation, the pellets of resting spores were
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

resuspended in 5 mL of a 50% sucrose solution and centrifuged at 3500 g for 10

min. The resulting supernatant was transferred into 30 mL of SDW in a 50-mL
centrifuge tube, and centrifuged again at 3500 g for 10 min. This time, the
supernatant was discarded and resting spores collected in the pellet. The pellet was
re-suspended in 5 mL of SDW and centrifuged at 3500 g for 10 min to remove the
sucrose. The extracted resting spores were washed three more times with streptomy-
cin (100 mg mL 1)-amended SDW plus 10 min of centrifugation at 3500 g with
each washing to minimize bacterial contamination. Pellets of the washed resting
spores were stored at 208C until use.

Effect of Serenade and its components on clubroot development

Plastic root trainers (3.520 cm, diameter depth), also called ‘conetainers’ (Stuewe
and Sons Inc., Corvallis, OR) were filled with Sunshine #3 soil-less planting mix (pH
5.8
6.2, SunGro Horticulture, Vancouver, BC) and placed on a plastic rack (14 rows
with 7 holes per row, holds a total of 98 conetainers). The mix was amended with 1% (v/
w) of 16:8:12 (N:P:K) control-released fertilizer, and soaked twice with water (pH 6.3)
prior to seeding for even water absorbance during treatment. Each conetainer was pre-
inoculated with 5 mL of a P. brassicae resting-spore suspension (1 107 mL 1).
Four treatments were applied as a soil drench (25 mL/plant) 2 days after the soil
infestation with P. brassicae resting spores: (i) Serenade product formulation, (ii) a
cultural suspension of B. subtilis QST713, (iii) Serenade product filtrate, and (iv) a
water control (untreated). Immediately after the treatment, two canola seeds (cv.
Fortune RR) were planted at 1 cm depth in each conetainer and subsequently
thinned to one seedling at the one true-leaf stage. The plants were maintained for 4
6
weeks in a growth cabinet with a 14-h daily photoperiod (500 mmol m 2 s 1) at 23/
188C (day/night), and watered daily to maintain a high level of soil moisture. Each
plant was assessed for clubroot severity using a 0 to 3 scale described by Strelkov
et al. (2006).The trial was laid out in a randomized complete block design and
replicated at three different times (blocks) with seven plants in each block. A disease
severity index (DSI) was calculated over the seven plants using the following
formula:
P
½ðrating classÞð# plants in the rating classÞ
DSIð%Þ ¼  100
ð#plants in treatmentÞð3Þ
 1354 R. Lahlali et al.

Effect on infection and development of P. brassicae in canola roots

The impact of the treatments on infection and early development of the pathogen
was examined using a Quantitative PCR (q-PCR) assay. Roots (including root hairs)
of three seedlings (about 0.2 g) were sampled from each treatment at 2 and 3 weeks
after treatment (WAT), washed repeatedly in tap water to remove debris and
pathogen propagules from the root surface, cut into 1-cm pieces, frozen in liquid
nitrogen, and stored at 208C until use. Roots from positive and negative control
plants (with and without the pathogen inoculation) were processed similarly for
comparisons. Genomic DNA of P. brassicae in the root samples was extracted using
a DNeasy Plant Mini Kit (Qiagen Canada, Inc., Montreal, QC) following
manufacturer’s protocols. The primers Pb4-1 (TACCATACCCAGGGCGATT)
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

and PbITS6 (CAACGAGTCAGCTTGAATGC) were used to amplify a product

of about 139 bp from the P. brassicae DNA (Sundelin et al. 2010). The DNA was also
extracted directly from P. brassicae resting spores and non-inoculated canola roots
using the same protocol, and amplifications were carried out in triplicates in a total
volume of 20 mL using a StepOne real-time thermocycler (ABI, Streets Ville, ON)
equipped with the StepOne v2.1 software as follows: 10 min at 958C (an initial
denaturation), followed by 50 cycles of 15 s at 958C, and 1 min at 608C. Each of the
20-mL reaction mixture included 2-mL genomic DNA template (20 ng ml 1), 0.1 mL
each of the primers (50 nM), 10 mL 2SYBR Green master mix (ABI), and 7.8 mL
SDW. Negative controls contained the same mixture with 2 mL canola root extract
(non-inoculated). A template control (water only) was included in every q-PCR
assay. A standard curve made with a serial dilution of P. brassicae DNA (from
resting spores) of known concentrations ranging from 1 to 1 10 3 ng/mL was
included for each run, with fluorescence checked after each thermo cycle. After the
amplification, a melting-curve analysis as well as electrophoresis (on a 2% gel) were
performed to ensure that only the target PCR product had been amplified.

Effect of the biofungicide Serenade on germination of P. brassicae resting spores

Preliminary results indicated that the product filtrate had no effect on germination of
resting spores (data not shown). This experiment was designed to assess if the
Serenade product would suppress the germination effectively. Because resting spores
require stimulation from host root exudates for germination (Suzuki, Matsumia,
Ueno, and Mizutani 1992; Kowalski and Bochow 1996), the protocol by Macfarlane
(1970) was adopted to produce canola root-exudate solutions for this study. Briefly,
canola seeds (cv. Fortune RR) were disinfected in 70% ethanol for 5 min, 0.6%
NaOCl for 30 min, rinsed in SDW, and 50 disinfested seeds were placed on a layer of
cheesecloth fixed to a styrofoam ring on the top of a glass Petri dish (10 7.5 cm,
diameter depth). The dish was filled with the Hoagland’s nutrient solution (pH 5.8)
to a level that almost touched the cheesecloth. Roots grew into the nutrient solution
within 2 days, and the seedlings were kept in a growth chamber at 258C with a 16-h
photoperiod (500 mmol m 2 s 1) for 7
14 days. The solution was then adjusted to
pH 6.0, filtered through a 0.22-mm membrane (Millipore Corp.) for sterilization, and
stored at 48C until use. From this point, the nutrient solution was called the root-
exudate solution (RES).
 Biocontrol Science and Technology 1355

Resting spores were added to RES amended with 5% of Serenade product, and to
a RES alone as controls. The fungicide fluazinam (Allegro 500F, ISK Biosciences
Corp., Concord, OH) at a 0.5-mL L 1 concentration was tested similarly for
comparisons. Resting spores were suspended (5 105 mL 1) in amended RES in 15-
mL Falcon tubes and incubated at 258C in darkness. The germination was examined
at 2-day intervals for up to 10 days over five replicates of each treatment or control.
Samples were stained with acetic-orcein (1%) or acetic-carmine (1%) (Sigma-Aldrich
Canada, Edmonton, AB) on glass slides, and the germination counted over 100
spores for each replicate using the protocol described by Naiki, Dixon, and Ikegami
(1987) at 1000 magnification using a light microscope. The empty or shrivelled
spores were considered as having germinated (Figure 1).
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Effect of the biofungicide Serenade on viability of P. brassicae resting spores

This experiment was designed to verify the germination observed in previous the
trial by suspending P. brassicae resting spores in SDW amended with the Serenade
product (5%) or in SDW alone (control) for 2
10 days. Unlike in the RES, the
resting spores could not germinate during the process and the viability was
assessed based on reactions to Evan’s blue (Sigma-Aldrich Canada). At 2-day
intervals, a 20-mL sample was taken from each of the three replicates, stained for
10 min on a glass slide, and examined at 400 using a light microscope. Evan’s
blue would only stain dead spores (Tanaka, Kochi, Kunita, Ito, and Kameya-Iwaki
1999); spores with a blue cell wall and reddish cytoplasm (Figure 2A) were
considered dead and those that did not take up the stain were counted as being
alive (Figure 2B).

Figure 1. Germinated and non-germinated resting spores of Plasmodiophora brassicae in a

canola root-exudate solution. Note that germinated spores are empty and often shrivelled
(arrows). Scale bars  5 mm.
 1356 R. Lahlali et al.
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Figure 2. Dead (A) and living (B) resting spores of Plasmodiophora brassicae stained with
Evan’s blue. Note that the cell wall and cytoplasm of dead spores were stained in blue and pale
red colours, respectively, whereas the living cells were not stained. Scale bars  5 mm.

Statistical analysis
Analysis of variance (ANOVA) was conducted to assess the impact of the
biofungicide Serenade and its components on DSI and resting spore germination
or viability using SAS (version 9.1, SAS Institute Inc. Cary, NC), a LSD test was
used to separate means when ANOVA was significant (P 50.05). All percentage data
were transformed with Arcsine Square Root prior to statistical analysis to obtain
normal distribution, but non-transformed means are reported in results for ease of
discussion.

Results
Effect of Serenade and its components on clubroot development
On average, the Serenade product formulation reduced clubroot by more than 90%
relative to the pathogen control (Table 1), whereas the product filtrate or B. subtilis
cultural suspension had only about 60% efficacy. At 4
6 WAT, root enlargement was
substantial in pathogen controls, noticeable in bacterial or product-filtrate treatment,
but generally absent in the Serenade treatment (Figure 3). No clubroot symptom was
seen on non-inoculated plants.
 Biocontrol Science and Technology 1357

Table 1. Effect of Serenade and its components on clubroot incidence (%) and disease severity
index (DSI) on canola (n 3).

Treatment Incidence (%) DSI (%)

Untreated control 100b 100c

B. subtilis (cultural suspension) 81b 40b
Product filtrate 71b 39b
Serenade 19a 6a
Means followed by the same letter do not differ based (Protected LSD, P 0.05).

Effect on infection and development of P. brassicae in canola roots

Downloaded by [Imperial College London Library] at 05:01 10 October 2014

P. brassicae DNA samples (1 10 3 ng mL 1) extracted from resting spores showed
a single PCR amplicon with 139 bp (data not shown). There was a strong linear
relationship between cycle threshold values and lg DNA concentrations in root
samples (y  5.41 lg [x]23.24; r2 0.997[0]). Threshold fluorescence signal for
the DNA from pure pathogen spores was 0.22 over the concentration range
examined.
The q-PCR assay also detected the single PCR amplicon in canola roots
inoculated with P. brassicae, but not in the non-inoculated roots. This confirmed the
presence of the pathogen in the roots or root hairs at 2 or 3 WAT. Additionally, a
melt-curve analysis showed only one peak in q-PCR results, confirming the
specificity of the primers used. The amount of pathogen DNA detected in inoculated
roots treated with Serenade or its components was substantially lower (P B0.0001)
than that in pathogen-inoculated roots (control) at 2 and 3 WAT (Table 2). The
amount of DNA increased substantially in roots of the pathogen control between 2
and 3 WAT, only slightly with B. subtilis, but not in roots treated with the Serenade
product or product filtrate.

Figure 3. Clubroot development on the susceptible canola cultivar Fortune RR received a

soil-drench treatment of (from left to right): Water (control), Bacillus subtilis QST713 cultural
suspension, Serenade product formulation, and product filtrate.
 1358 R. Lahlali et al.

Table 2. The amount of Plasmodiophora brassicae genomic DNA detected in roots treated
with Serenade and its components at 2 and 3 weeks after treatments (WAT) (n3).

P. brassicae DNA (ng/g of root)

Treatment 2 WAT 3 WAT

Control 0.52a 13.35a

B. subtilis (cultural suspension) 0.18b 1.16b
Product filtrate 0.04c 0.03c
Serenade 0.02c 0.01c
Means in a column with the same letters do not differ (Protected LSD, P 0.05).
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Effect of the biofungicide Serenade on germination of P. brassicae resting spores

Serenade reduced the germination only slightly relative to the water control, and the
germination reached over 80% after 10-day incubation in a RES amended with 5% of
the Serenade product (Figure 4). In contrast, the fungicide fluazinam was highly
effective, inhibiting the germination almost completely during the entire 10-day
period.

Effect of the biofungicide Serenade on viability of P. brassicae resting spores

The exposure to Serenade reduced the viability of P. brassicae resting spores slightly
(Table 3) relative to the water control, but increasing the exposure duration from 2 to
10 days did not affect the results substantially. With 10-day exposure, the
biofungicide decreased the viability by about 20% when compared to the water
control.

Discussion
Clubroot is a difficult disease to control due to the persistence of resting spores in
soil and a complex infection process with the pathogen (Dixon 2009). Biofungicides
can be reasonable candidates against clubroot because some of the agents can
competitively colonize the rhizosphere (Kinsinger, Shirk, and Fall 2003; Bais, Fall,
and Vivanco 2004), thus providing direct root protection. Previous studies have

100 Water (control)

Resting spore germination (%)

Serenade product
80
Fluazinam

60

40

20

0
1 2 3 4 5 6 7 8 9 10
Time (days)

Figure 4. Germination of Plasmodiophora brassicae resting spores in a canola root-exudate

solution amended with the biofungicide Serenade or fungicide fluazinam over a 10-day period.
 Biocontrol Science and Technology 1359

Table 3. The viability (%) of Plasmodiophora brassicae resting spores exposed to Serenade
(n  2).

Duration of exposure (days)

Treatment 2 4 6 8 10

Control 96b 91b 92b 87b 84b

Serenade 74a 77a 75a 72a 67a
Means in a column with the same letter do not differ (Protected LSD, P 0.05).

shown the potential of several soil microorganisms or their metabolites against

clubroot (Arie et al. 1999; Narisawa, Tokumasu, and Hashiba 1998; Joo et al. 2004),
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

and in a recent study, the commercial biofungicides Serenade† (B. subtilis QST713)
and Prestop† (Gliocladium catenulatum Gilman & Abbott.) were found promising
when applied as a soil drench in controlled environment (Peng, Gossen, Strelkov,
Hwang, and McDonald 2009). It has been known that B. subtilis produces
lipopeptides, including surfactin and iturin A (Romero et al. 2007; Ongena and
Jacques 2008) and these antibiotics were detected in the rhizosphere of cucumber
treated with the B. subtilis QST713 (Kinsella, Schulthess, Morris, and Stuart 2009).
However, it was not clear if these antibiotics in the Serenade formulation would be
sufficient for protecting canola roots or root hairs from infection by zoospores, and if
they are of any assistance to the B. subtilis inoculum in the biocontrol of clubroot.
This information can be useful to optimization of fermentation or formulation
processes for maximum efficacy.
Throughout the study, the product filtrate or B. subtilis alone was only partially
effective, and Serenade was consistently more effective than any of the components.
Possibly the secondary metabolites facilitated the performance of B. subtilis by
minimizing the competition from other soil microbes, thus enabling the bacterium
to establish rapidly on the root surface or in the rhizosphere (Kinsinger et al.
2003). The bacterial colonies may feed on root exudates in the rhizosphere
and continue producing lipopeptides (Kinsella et al. 2009), thus sustaining the root
protection. The lipopeptide surfactin produced by this B. subtilis QST713 can also
be a powerful surface-active agent (Peypoux, Bonmatin, and Wallach 1999),
potentially further adding in biocontrol of clubroot by interfering P. brassicae
zoospore activities (Hildebrand and McRae 1998). Therefore an enhanced amount
of lipopeptides in the Serenade formulation, possibly via an improved fermenta-
tion/formulation processes may increase efficacy of clubroot control by this
biofungicide.
The lipopeptides produced by B. subtilis QST713 are powerful antibiotics and
some B. subtilis strains may also produce fungal cell-wall degrading enzymes and
antifungal volatiles (Arrebola, Sivakumar, and Korsten 2009). However, the
Serenade biofungicide or product filtrate (data not shown) had only limited effect
on the germination of P. brassicae resting spores. In contrast, the fungicide
fluazinam inhibited the spore germination almost completely. In a previous study,
the fungicide calcium cyanamide also inhibited the germination of resting spores
completely (Naiki and Dixon 1987). These results suggest that, unlike these
fungicides, the lipopeptides and B. subtilis QST713 inoculum in the Serenade
product are not sufficiently effective against P. brassicae resting spores. The slightly
 1360 R. Lahlali et al.

reduced germination may be connected to the lower viability of resting spores

exposed to the product. The lipopeptides, however, may be more antagonistic
towards zoospores due to greater vulnerability (Dixon 2009). In a soil-drench
treatment as used in the current study, lipopeptides in Serenade or produced by B.
subtilis in the rhizosphere (Kinsella et al. 2009) can be directly toxic to zoospores.
In addition, the surfactant effect of surfactin may further add to the interference
with zoospore activities. Although the impact on zoospores is still a deduction
because direct assessment was not reliable due to unpredictability and swiftness of
zoospore release, the low effect on pathogen resting spores indicates additional
mechanisms are at works. In contrast, many fungicides inhibit or kill resting spores.
To target both primary and secondary zoospores, this biofungicide may need to
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

remain effective in the soil for some time, which may warrant further investigations
in product formulation and delivery timing in relation to duration of the product
activity in field soils.
The q-PCR assay adopted from Sundelin et al. (2010) provided rapid detection
and quantification of P. brassicae in early stages of root infection. A separate study
showed that the peak of canola root-hair infection would occur at about 2 WAT at
208C (Sharma, Gossen, and McDonald 2010). The significant less amounts of P.
brassicae DNA at 2 and 3 WAT in canola roots treated with Serenade or its
components, relative to the pathogen control, indicates that these treatments possibly
control clubroot via the reduction of root-hair and cortical infection. The amount of
P. brassicae DNA detected at this stage was correlated with the frequency of root-
hair infection (r 0.86) assessed microscopically (data not shown). At 3 WAT, the
amount of P. brassicae DNA in the pathogen control had increased substantially
from 2 WAT, which potentially reflected greater infection of cortical tissues and the
development of P. brassicae plasmodia in the cortex. In contrast, the DNA in roots
treated with Serenade or its components increased only slightly or not at all within
the period, indicating a lower level of infection and pathogen development. The
amount of P. brassicae DNA at 3 WAT was positively correlated with final clubroot
severity index (r0.99, P 50.001), confirming that the greater amount of infection
or pathogen development also contributed to the disease severity observed later. The
q-PCR technique provides an early assessment on P. brassicae infection and
development in response to biocontrol treatments.
To control clubroot, a treatment may be aimed at killing or inhibiting resting
spores, preventing infection from zoospores, or blocking pathogen development in
root hairs and cortical tissues (Naiki and Dixon 1987). Our results indicate that the
biofungicide Serenade has limited impact on P. brassicae resting spores and its
efficacy on clubroot is possibly due to the antibiotic and surfactant effects on highly
sensitive zoospores. The partial efficacy of the product filtrate or bacterial inoculum
towards clubroot may point to an additive effect between the two components; the
metabolites (lipopeptides) in the Serenade product, in addition to their direct impact
on zoospores, may also assist B. subtilis in colonizing the rhizosphere by minimizing
the competition from other soil microbes. It may be desirable to optimize lipopeptide
yields in the Serenade product by tweaking the fermentation process for maximum
efficacy against clubroot. Product formulation and delivery may also be investigated
for better targeting the peaks of zoospore releases.
 Biocontrol Science and Technology 1361

Acknowledgements
We thank Terry Tran and Jehn Francisco for technical assistance. We also acknowledge
Saskatchewan Agriculture Development Fund and SaskCanola for partial funding support to
this research.

References
Arie, T., Kobayashi, Y., Kono, Y., Gen, O., and Yamaguchi, I. (1999), ‘Control of Clubroot of
Crucifers by Phoma glomerata and Its Product Epoxydon’, Pesticide Science, 55, 602
604.
Arrebola, E., Sivakumar, D., and Korsten, K. (2009), ‘Effect of Volatile Compounds by
Bacillus Strains on Post-harvest Decay in Citrus’, Biological Control, 53, 122
128.
Bais, H.P., Fall, R., and Vivanco, J.M. (2004), ‘Biocontrol of Bacillus subtilis against Infection
of Arabidopsis Roots by Pseudomonas syringae is Facilitated by Biofilm Formation and
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Surfactin Production’, Plant Physiology, 134, 307
319.

Diederichsen, E., Beckmann, J., Schondelmeier, J., and Dreyer, F. (2006), ‘Genetics of
Clubroot Resistance in Brassica napus ‘‘Mendel’’’, Acta Horticulturae, 706, 307
311.
Dixon, G.R. (2009), ‘Plasmodiophora brassicae in Its Environment’, Journal of Plant Growth
Regulation, 28, 1
17.
Donald, C., and Porter, I. (2009), ‘Integrated Control of Clubroot’, Journal of Plant Growth
Regulation, 28, 289
303.
Hildebrand, P.D., and McRae, K.B. (1998), ‘Control of Clubroot Caused by Plasmodiophora
brassicae with Nonionic Surfactants’, Canadian Journal of Plant Pathology, 20, 1
11.
Howard, R.J., Strelkov, S.E., and Harding, M.W. (2010), ‘Clubroot of Cruciferous Crops

New Perspectives on an Old Disease’, Canadian Journal of Plant Pathology, 32, 43
57.
Ingram, D.S., and Tommerup, I.C. (1972), ‘The Life History of Plasmodiophora brassicae
Woron’, Proceeding of the Royal Society [Biol], 108, 103
112.
Jaschke, D., Dugassa-Gobena, D., Karlovsky, P., Vidal, S., and Ludwing-Muller, J. (2010),
‘Suppression of Clubroot (Plasmodiophora brassicae) Development in Arabidopsis thaliana
by the Endophytic Fungus Acremonium alternatum’, Plant Pathology, 59, 100
111.
Joo, G.J., Kim, Y.M., Kim, J.W., Kim, W.C., Rhee, I.K., Choi, Y.H., and Kim, J.H. (2004),
‘Biocontrol of Cabbage Clubroot by the Organic Fertilizer Using Streptomyces sp. AC-3’,
Korean Journal of Microbiology and Biotechnology, 32, 172
178.
Kinsella, K., Schulthess, C.P., Morris, T.M., and Stuart, J.D. (2009), ‘Rapid Quantification of
Bacillus Antibiotics in the Rhizosphere’, Soil Biology and Biochemistry, 41, 374
379.
Kinsinger, R.F., Shirk, M.C., and Fall, R. (2003), ‘Rapid Surface Motility and Biofilm
Formation in Bacillus subtilis is Dependent on Extracellular Surfactin and Potassium Ion’,
Journal of Bacteriology, 185, 5627
5631.
Kowalski, K., and Bochow, H. (1996), ‘Observations on the Behaviour of Resting Spores of
Plasmodiophora brassicae in the Presence of Cruciferous and Non-cruciferous Plant Roots’,
Acta Horticulturae, 407, 419
422.
Macfarlane, I. (1970), ‘Germination of Resting Spores of Plasmodiophora brassicae’,
Transaction British Mycological Society, 55, 97
112.
Naiki, T., and Dixon, G.R. (1987), ‘The Effects of Chemicals on Developmental Stages of
Plasmodiophora brassicae (clubroot)’, Plant Pathology, 36, 316
327.
Naiki, T., Dixon, G.R., and Ikegami, H. (1987), ‘Quantitative Estimation of Spore
Germination of Plasmodiophora brassicae’, Transaction British Mycological Society, 89,
569
609.
Narisawa, K., Tokumasu, S., and Hashiba, T. (1998), ‘Suppression of Clubroot Formation in
Chinese Cabbage by the Root Endophytic Fungus, Heteroconium chaetospira’, Plant
Pathology, 47, 206
210.
Ongena, M., and Jacques, P. (2008), ‘Bacillus Lipopeptides: Versatile Weapons for Plant
Disease Biocontrol’, Trends in Microbiology, 16, 115
125.
Peng, G., Gossen, B.D., Strelkov, S.E., Hwang, S.F., and McDonald, M.R. (2009), ‘Effect of
Selected Biofungicides for Control of Clubroot on Canola’, Canadian Journal of Plant
Pathology, 31, 145
146.
 1362 R. Lahlali et al.

Peng, G., McGregor, L., Lahlali, R., Gossen, B.D., Hwang, S.F., Adhikari, K.K., Strelkov,
S.E., and McDonald, M.R. (2011), ‘Potential Biological Control of Clubroot on Canola
and Crucifer Vegetable Crops’, Plant Pathology, 60, 566
574.
Peypoux, F., Bonmatin, J.M., and Wallach, J. (1999), ‘Recent Trend in the Biochemistry of
Surfactin’, Applied Microbiology and Biotechnology, 51, 553
563.
Philip, L., Lyengar, L., and Venkobachar, C. (1998), ‘Cr (VI) Reduction by Bacillus Coagulans
Isolated from Contaminated Soils’, Journal of Environmental Engineering, 124, 1165
1170.
Romero, D., De Vicente, A., Rakotoaly, R.H, Dufour, S.E., Veening, J.W., Arrebola, E.,
Cazorla, F.M., Kuipers, O.P., Paquot, M., and Perz-Garcia, A. (2007), ‘The Iturin and
Fengycin Families of Lipopeptides are Key Factors in Antagonism of Bacillus subtilis
toward Podosphaera fusca’, Molecular Plant-Microbe Interactions, 20, 430
440.
Sharma, K., Gossen, B.D., and McDonald, M.R. (2010), ‘Effect of Temperature on Clubroot
(Plasmodiophora brassicae) Symptom Initiation on Shanghai pak choy’, Phytopathology,,
100 S, S117.
Downloaded by [Imperial College London Library] at 05:01 10 October 2014

Strelkov, S.E., Tewari, J.P., and Smith-Degenhardt, E. (2006), ‘Characterization of

Plasmodiophora brassicae Populations from Alberta, Canada’, Canadian Journal of Plant
Pathology, 28, 467
474.
Strelkov, S.E., Manolii, V.P., Zequera, M., Manolii, E., and Hwang, S.F. (2010), ‘Incidence of
Clubroot on Canola in Alberta in 2009’, Canadian Plant Disease Survey, 90, 123
125.
Sundelin, T., Christensen, C.B., Larsen, J., Møller, K., Lübeck, M., Bødker, L., and Jensen, B.
(2010), ‘In planta Quantification of Plasmodiophora brassicae Using Signature Fatty Acids
and Real Time PCR’, Plant Disease, 94, 432
438.
Suzuki, K., Matsumia, E., Ueno, Y., and Mizutani, J. (1992), ‘Some Properties of
Germination-stimulating Factors from Plants for Resting Spores of Plasmodiophora
brassicae’, Annual Phytopathological Society of Japan, 58, 699
705.
Tanaka, S., Kochi, S., Kunita, H., Ito, S.I., and Kameya-Iwaki, M. (1999), ‘Biological Mode
of Action of the Fungicide, Flusulfamide, against Plasmodiophora brassicae (clubroot)’,
European Journal of Plant Pathology, 105, 577
584.
Tewari, J.P., Orchard, D., Hartman, M., Lange, R., Turkington, T.K., and Strelkov, S. (2004),
‘First Report of Clubroot of Canola Caused by Plasmodiophora brassicae in the Canadian
Prairies’, Canadian Journal of Plant Pathology, 26, 228
229.
Webster, M.A., and Dixon, G.R. (1991), ‘Calcium, pH and Inoculum Concentration
Influencing Colonisation by Plasmodiophora brassicae’, Mycological Research, 95, 65
73.