Crash Course 2024 Maths & Bio

KCET / NEET crash course
2024
Topic: Diversity in living organisms

1. Select correctly written scientific name of Mango which was first described by Carolus Linnaeus:
(A) Mangifera indica Car. Linn. (C) Mangifera indica Linn.
(B) Mangifera indica (D) Mangifera Indica
2. Which is not the correct hierarchical arrangement?
(A) Class --- Family --- Genus (C) Class --- Order --- Family
(B) Phylum ---- Order --- Family (D) Family --- Class --- Order
3. The most notable diseases caused by prions are
(A) Bovine serum encephalopathy in cattle (C) Creutzfeldt-Jacob disease in Cattle
(B) Creutzfeldt-Jacob disease in humans (D) Both A & B
4. Match the following
Column I Column I
i Morels P Deuteromycetes
ii Smut Q Basidiomysetes
iii Bread mold R Ascomycetes
iv Alternaria S Phycomycetes
(A) i-S, ii-Q, iii-R, iv-P (C) i-Q, ii-R, iii-S, iv-P
(B) i-R, ii-Q, iii-S, iv-P (D) i-P, ii-R, iii-S, iv-Q
5. Select the wrong statements.
(A) Stanley showed that viruses could be crystallized.
(B) The term Contagium vivum fluidum was given by Beijerinck.
(C) Mosaic disease in tobacco & AIDS in humans are caused by viruses.
(D) The viroids were discovered by Ivanowski.
6. Which organisms have silica in their cell wall?
(A) Dinoflagellates (B) Chrysophytes (C) Slime mold (D) Protozoa
7. Specialized cells called heterocysts are present in
(A) Dinoflagellates (B) Chrysophytes (C) Cyanobacteria (D) Archaebacteria
8. Red tides is caused by
(A) Dinoflagellates (B) Chrysophytes (C) Cyanobacteria (D) Archaebacteria
9. Agaricus belongs to
(A) Phycomycetes (B) Ascomycetes (C) Basidiomysetes (D) Deuteromycetes
Column I Column I
i Chlorophyceae P Floridean starch
ii Phaephyceae Q Starch
iii Rhodophyceae R Laminarin & mannitol
(A) i-P, ii-Q, iii-R (B) i-Q, ii-P, iii-R (C) i-Q, ii-R, iii-P (D) i-Q, ii-P, iii-R
11. Life cycle of Ectocarpus & Fucus are respectively:
(A) Haplontic, Diplontic (C) Haplo-diplontic, Diplontic
(B) Diplontic, Haplo-diplontic (D) Haplo-diplontic, Haplontic
12. Statement A: In Cycas, male cones & megasporophylls are borne on different plants.
Statement B: Cycas forms Coralloid roots.
(A) Both statements A & B are true (C) Statements A is true & B is false
(B) Both statements A & B are false (D) Statements A is false & B is true
13. Which of the following sponge is called Venus flower basket?
(A) Spongilla (B) Euplectella (C) Ascon (D) Euspongia
14. Bioluminescence is well marked in
(A) Coelenterates (B) Comb jellies (C) Sea urchins (D) Platyhelminthes
15. Malphigian tubules are
(A) Excretory organs in annelids (C) Excretory organs in molluscs
(B) Excretory organs in insects (D) Respiratory organs in insects
16. Assertion: The duck-billed platypus & the spiny ant eater, both are egg-laying animals yet they
are grouped under mammals.
Reason: Both of them have 7 cervical vertebrae & 12 pairs of cranial nerves.
(A) If Assertion and Reason are true and the reason is the correct explanation of the assertion.
(B) If Assertion and Reason are true but Reason is not an explanation to Assertion.
(C) If Assertion is true and Reason is false.
(D) If Assertion and Reason both are false.
17. Which of the following statements is/are incorrect about hemichordate?
Statement A: It was earlier considered as a subphylum of phylum chordata, now it is placed as a
separate phylum under invertebrates.
Statement B: They have a rudimentary structure in the collar region called stomochord, a
structure similar to notochord.
(A) Both statements A & B are true (C) Statements A is true & B is false
(B) Both statements A & B are false (D) Statements A is false & B is true
18. Which of these is not a characteristic feature of Aschelminthes
(A) Presence of pseudocoelom (B) They exhibit sexual dimorphism
(B) Digestive system is incomplete (D) Males are smaller than females
19. Metameric segmentation is the main feature of phylum
(A) Platyhelmithes (B) Annelida (C) Aschelminthes (D) Arthropoda
Latest NEET questions
20. Identify the pair of heterosporous pteridophytes among the following: (NEET 2023)
(A) Selaginella and Salvinia (C) Equisetum and Salvinia
(B) Psilotum and Salvinia (D) Lycopodium and Selaginella
21. Assertion A : The first stage of gametophyte in the life cycle of moss is protonema stage.
Reason R : Protonema develops directly from spores produced in capsule. (NEET 2023)
In the light of the above statements, choose the correct answer from the options given below:
(A) Both A and R are correct and R is the correct explanation of A.
(B) Both A and R are correct but R is NOT the correct explanation of A.
(C) A is correct but R is not correct.
(D) A is not correct but R is correct.
22. Assertion A : In gymnosperms the pollen grains are released from the microsporangium and
carried by air currents. (NEET 2023)
Reason R : Air currents carry the pollen grains to the mouth of the archegonia where the male
gametes are discharged and pollen tube is not formed.
23. Select the correct statements with reference to chordates. (NEET 2023)
a. Presence of mid-dorsal, solid and double nerve cord.
b. Presence of closed circulatory system
c. Presence of paired pharyngeal gillslits
d. Presence of dorsal heart
e. Triploblastic pseudocoelomate animals
Choose the correct answer from the options given below:
(A) b and c only (B) b, d and e only (C) c, d and e only (D) a, c and d only
24. The unique mammalian characteristics are: (NEET 2023)
(A) hairs, pinna and mammary glands (C) pinna, monocondylic skull and mammary glands
(B) hairs, pinna and indirect development (D) hairs, tympanic membrane and mammary glands
25. Match List - I with List – II (NEET 2023)
List I List II
a) Taenia i. Nephridia
b) Paramoecium ii. Contractile vacuole
c) Periplaneta iii. Flame cells
d) Pheretima iv. Uricose gland
Choose the correct answer from the options give below :
(A) A-I, B-II, C-IV, D-III (C) A-III, B-II, C-IV, D-I
(B) A-III, B-I, C-IV, D-III (D) A-I, B-II, C-III, D-IV
****
2024
Topic: Cell structure & Cell division

1. Which of the following statement with respect to endoplasmic reticulum is incorrect?
(A) SER is devoid of ribosomes (C) SER are the sites of lipid synthesis
(B) In prokaryotes only RER is present (D) RER has ribosomes attached to ER
2. When the centromere is situated in the middle of two equal arms of chromosomes, the
chromosome is referred as :
(A) Metacentric (B) Telocentric (C) Sub-metacentric (D) Acrocentric
3. The concept Omnis-cellula-e-cellula was given by
(A) Rudolf Virchow (B) Leewenhoek (C) Louis Pasteur (D) Robert Koch
4. Aleuroplasts are leucoplasts storing
(A) Lipids (B) Carbohydrates (C) Proteins (D) All
5. What is/are common to both mitochondria and chloroplasts
(A) Both are double membranous organelles (C) Both contain 70S ribosomes
(B) Both contain ds circular chromosomes (D) All
6. Which of the following arrangements of microtubules is correct for eukaryotic flagellum?
(A) 9 peripheral triplets + 2 central singlet (C) 9 peripheral singlet + 2 central doublets
(B) 9 peripheral doublets + 2 central doublets (D) 9 peripheral doublets + 2 central singlet
7. Which of the following differentiate plant cells from animal cells?
(A) Presence of large central vacuole, plastids & cell wall
(B) Presence of plastids & mitochondria
(C) Presence of large cell membrane, plastids & cell wall
(D) Presence of centrioles, plastids & cell wall
8. Phospholipids can assemble into a bilayer because of their
(A) Lack of fatty acids (C) dual solubility properties
(B) Ability to dissolve in water (D) inability to associate with other phospholipids
9. The golgi complex plays a major role
(A) In post translational modification of proteins & glycosylation of lipids
(B) As energy transferring organelles
(C) In trapping light & transforming into chemical energy
(D) In digesting proteins & carbohydrates
10. Tonoplast is the membrane surrounding
(A) Nucleolus (B) Vacuole (C) Chloroplast (D) Nucleus
11. Whi ch of the following statements about inclusion bodies is incorrect?
(A) These are involved in ingestion of food particles.
(B) They lie free in the cytoplasm.
(C) These are present reserve material in cytoplasm.
(D) They are not bound by any membrane
12. Of the total duration of cell cycle, the interphase lasts more than
(A) 50 % (B) 75 % (C) 95 % (D) 25 %
13. Synapsis occurs between
(A) Spindle fibres and centromere (C) mRNA and ribosomes
(B) A male and a female gamete (D) two homologous chromosomes
14. Statement A: Meiosis is also termed as reductional division.
Statement B: Non sister chromatids exchange segments during zygotene.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct
15. Statement A: Longest phase of meiosis is Prophase I.
Statement B: Crossing over requires an enzyme recombinase.
(B) Both statement A and B are incorrect. (D) Statement A is incorrect, B is correct.
16. X ensures the production of Y phase in the life cycle of sexually reproducing organisms whereas
fertilization restores the Z phase.
(A) X-Mitosis, Y- haploid, Z- haploid (C) X-Meiosis, Y- haploid, Z- haploid
(B) X-Mitosis, Y- diploid, Z- haploid (D) X-Meiosis, Y- haploid, Z- diploid
17. In meiosis, the separation of homologous chromosomes is seen during:
(A) Metaphase I (B) Metaphase II (C) Anaphase I (D) Anaphase II
18. The chromosomes appear like string of beads during
(A) Leptotene (B) Zygotene (C) Pachytene (D) Diplotene
19. Chiasma are seen during
(A) Leptotene (B) Zygotene (C) Pachytene (D) Diakinesis
20. Which of the following stage of cell cycle is known as quiescent stage?
(A) G1 phase (B) S phase (C) G2 phase (D) G0 phase
21. The process of appearance of recombination nodules occurs at which sub stage of prophase I in
meiosis? (NEET 2023)
(A) Pachytene (B) Diplotene (C) Diakinesis (D) Zygotene
22. Which of the following stages of meiosis involves division of centromere? (NEET 2023)
(A) Metaphase II (B) Anaphase II (C) Telophase (D) Metaphase I
23. Which of the following are NOT considered as the part of endomembrane system?
a. Mitochondria b. Endoplasmic Reticulum c. Chloroplasts (NEET 2023)
d. Golgi complex e. Peroxisomes
Choose the most appropriate answer from the options given below:
(A) a, c and e only (B) a and d only (C) a, d and e only (D) b and d only
24. Which of the following functions is carried out by cytoskeleton in a cell? (NEET 2023)
(A) Protein synthesis (B) Motility (C) Transportation (D) Nuclear division
25. Select the correct statements. (NEET 2023)
a. Tetrad formation is seen during Leptotene.
b. During Anaphase, the centromeres split and chromatids separate.
c. Terminalization takes place during Pachytene.
d. Nucleolus, Golgi complex and ER are reformed during Telophase.
e. Crossing over takes place between sister chromatids of homologous chromosome.
(1) b and d only (2) a, c and e only (3) b and e only (4) a and c only
****
2024
Topic: Biomolecules & Structural organization in animals

1. Match List - I with List - II.
Column A Column B
i Protein p C = C double bonds
ii Unsaturated fatty acid q Phosphodiester bonds
iii Nucleic acid r Glycosidic bonds
iv Polysaccharide s Peptide bonds
(A) i-p, ii-q, iii-r, iv-s (B) i-r, ii-p, iii-q, iv-s (C) i-s, ii-p, iii-q, iv-r (D) i-s, ii-q, iii-r, iv-p
2. Choose the correct match
Column A Column B
i Acidic amino acid p Alanine
ii Aromatic amino acid q Lysine
iii Basic amino acid r Glutamic acid
iv Neutral amino acid s Phenyl alanine
(A) i-p, ii-r, iii-q, iv-s (B) i-p, ii-s, iii-q, iv-r (C) i-r, ii-s, iii-q, iv-p (D) i-r, ii-s, iii-p, iv-q
3. In a polysaccharide, the individual monosaccharides are linked by
(A) Peptide bond (B) Ester bond (C) Phosphodiester bond (D) Glycosidic bond
4. An organic substance bound to an enzyme and essential for its activity is called
(A) Holoenzyme (B) Apoenzyme (C) Coenzyme (D) Isoenzyme
5. Statement A: Collagen is the most abundant protein in animal world.
Statement B: Ribulose bisphosphate Carboxylase-Oxygenase (RuBisCO) is the most abundant
protein in the whole of the biosphere
6. Statement A: Inulin is a polymer of fructose.
Statement B: Cellulose is a homopolymer.
7. Which of these act as a cofactor for the enzyme carboxypeptidase
(A) Mo (B) Zn (C) Mg (D) Haem
8. Which enables glucose transport into cells?
(A) GLUT – 1 (B) GLUT – 2 (C) GLUT – 3 (D) GLUT – 4
9. Enzymes speed up the rate of reaction by
(A) Combining with product (B) Lowering activation energy
(C) Forming reactant - product complex (D) Changing equilibrium of the reaction
10. The inhibitor which inhibits the enzyme activity by binding to the active site of enzyme due the
close resemblance to the substrate in its molecular structure is called
(A) Non-competitive inhibitor (C) Competitive inhibitor
(B) Allosteric modulator (D) Feedback inhibitor
11. Cloacal aperture of frog is used to pass out
(A) Sperm (B) faeces (C) urine (D) all of these.
12. On land, the respiratory organs (s) of frog is/are
(A) Skin (cutaneous respiration) (C) Lungs and buccal cavity
(B) Skin, lungs (pulmonary respiration) and buccal cavity (D) Skin and buccal cavity
13. In frogs, sexual dimorphism is shown by
(A) Presence of sound producing vocal sacs in male frogs which are absent in female frogs.
(B) Male frogs have a copulatory pad on the first digit of the hind limbs which are absent in
female frogs.
(C) Both A and B.
(D) None of the above.
14. Statement I: In male frogs, the ureters act as urinogenital duct which opens into the cloaca.
Statement II: In females the ureters and oviduct open separately in the cloaca.
(A) Both statement I and Statement II are true. (C) Statement I is true but Statement II is false.
(B) Both statement I and Statement II are false. (D) Statement I is false but Statement II is true.
15. The nervous system of frog is organised into
(A) Central nervous system and peripheral nervous system
(B) Central nervous system and autonomic nervous system
(C) Central nervous system, peripheral nervous system and autonomic nervous system
(D) Brain and spinal cord
16. Cellulose does not form blue colour with Iodine because (NEET 2023)
(A) It is a helical molecule.
(B) It does not contain complex helices and hence cannot hold iodine molecules.
(C) It breakes down when iodine reacts with it.
(D) It is a disaccharide.
17. Melonate inhibits the growth of pathogenic bacteria by inhibiting the activity of (NEET 2023)
(1) Amylase (2) Lipase (3) Dinitrogenase (4) Succinic dehydrogenase
18. Given below are two statements: (NEET 2023)
Statement I : A protein is imagined as a line, the left end represented by first amino acid (C-
terminal) and the right end represented by last amino acid (N-terminal).
Statement II : Adult human haemoglobin, consists of 4 subunits (two subunits of α type and two
subunits β type.)
In the light of the above statements, choose the correct answer from the options given below :
(A) Both statement I and Statement II are true. (C) Statement I is true but Statement II is false.
(B) Both statement I and Statement II are false. (D) Statement I is false but Statement II is true.
19. Primary proteins are also called as polypeptides because : (NEET 2022)
(A) They can assume many conformations (C) They are polymers of peptide monomers
(B) Successive amino acids are joined by peptide bonds (D) They are linear chains
20. Read the following statements on lipids and find out the correct set of statements. (NEET 2022)
(a) Lecithin found in the plasma membrane is a glycolipid.
(b) Saturated fatty acids possess one or more C=C bonds
(c) Gingelly oil has a lower melting point, hence remain as oil in winter
(d) Lipids are generally insoluble in water but are soluble in some organic solvents
(e) When fatty acid is esterifed with glycerol, monoglyceride is formed.
Choose the correct answer from the following
(A) (a) (d) & (e) only (C) (a) (b) & (d) only
(B) (c) (d) & (e) only (D) (a) (b) & (c) only
*****
2024
Topics: Morphology of flowering plants & Anatomy of flowering plants

1. Statement A: A typical leaf consists of three main parts: leaf base, petiole & leaf lamina.
Statement B: In some leguminous plants the leaf base may become swollen, which is called the
pulvinus.
2. Statement A: Whorled phyllotaxy is seen in case of Alstonia.
Statement B: Opposite phyllotaxy is seen in case of China rose.
3. Fill in the blanks:
I. In racemose type of inflorescence, the flowers are arranged in ____p______ succession.
II. In cymose type of inflorescence, the flowers are arranged in ______q____ succession.
(A) p - acropetalous, q - basipetalous (C) p - acropetalous, q - acropetalous
(B) p - basipetalous, q - acropetalous (D) p - basipetalous, q - basipetalous
4. In floral formula (K) denotes
(A) Polypetalous (B) Polysepalous (C) Gamopetalous (C) Gamosepalous
5. Individual components of perianth are called
(A) Sepals (B) Tepals (C) Stipules (D) Bracts
6. Perigynous flowers are found in
(A) China rose (B) Rose (C) Guava (D) Cucumber
7. The fleshy fruits with hard & stony endocarp are called
(A) Drupe (B) Berry (C) Pome (D) Hesperidium
8. Identify the type of petals in the given diagram (A, B and C).
(A) A-Wings, B-Keel, C-Standard
(B) A-Keel, B-Wings, C-Standard
(C) A-Standard, B-Wings, C-Keel
(D) A-Standard, B-Keel, C-Wings
9. Name the type of aestivation when sepals or petals in a whorl
just touch one another at the margin without overlapping.
(A) Twisted aestivation (B) Valvate aestivation
(C) Imbricate aestivation (D) Vexillary aestivation
10. Diadelphous stamens are found in:
(A) China rose (B) Citrus (C) Pea (D) China rose and citrus
11. Polyarch & exarch vascular bundles are the characteristics of
(A) Monocot root (B) Dicot root (C) Monocot stem (D) Dicot stem
12. Mesophyll is differentiated into palisade & spongy tissues in
(A) Monocot leaves (B) Dicot leaves (C) Hydrophytic leaves (D) All of these
13. Vascular bundles occur in a leaf in
(A) Entire lamina (B) Leaf margin (C) Veins & veinlets (D) All of these
14. Cell wall of sclerenchyma cells have large percentage of
(A) Pectin (B) Cellulose (C) Hemicellulose (D) Lignin
15. In monocot stem, the vascular bundles are
(A) Conjoint & open (C) Scattered throughout the ground tissue
(B) Conjoint & closed (D) Both B & C
16. U shaped casparian thickenings are present in
(A) Endodermis of dicot (C) Endodermis of monocot
(B) Epidermis of dicot (D) Epidermis of monocot
17. Which of these are true about monocot stem
(A) Atactostele arrangement of vascular bundles (C) Presence of 2 metaxylem & 1 protophloem
(B) Presence of Lysigenous cavity (D) All of the above
18. Eustele arrangement is seen in
(A) Dicot root (B) Monocot root (C) Dicot stem (D) Monocot stem
19. In monocot stem, the hypodermis is
(A) parenchymatous (B) sclerenchymatous (C) collenchymatous (D) meristematic
20. Bulliform cells takes part in
(A) Guttation (B) Transpiration (C) Inrolling (D) All of these
21. Axile placentation is observed in (NEET 2023)

(A) China rose, Beans and Lupin (C) China rose, Petunia and Lemon
(B) Tomato, Dianthus and Pea (D) Mustard, Cucumber and Primrose
Statement I : Endarch and exarch are the terms often used for describing the position of
secondary xylem in the plant body.
Statement II : Exarch condition is the most common feature of the root system.
In the light of the above statements, choose the correct answer from the options given below;
(A) Both statement I and II are correct. (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect. (D) Statement I is incorrect, II is correct.
23. The flowers are zygomorphic in (NEET 2022)
(a) Mustard (b) Gulmohar (c) Cassia (d) Datura (e) Chilly
Choose the correct answer from the options given below.
(A) b & c only (B) d & e only (C) c, d & e only (D) a, b & c only
24. Which of the following plants show vexillary aestivation & diadelphous stamens (NEET 2022)
(A) Pisum sativum (B) Allium cepa (C) Solanum nigrum (D) Colchicum autumnale
25. Match the following (NEET 2021)
Column A Column B
i Cells with active cell division capacity p Vascular tissues
ii Tissue having all cells similar in structure & function q Meristematic tissue
iii Tissue having different types of cells r Sclereids
iv Dead cells with highly thickened walls & narrow lumen s Simple tissue
(A) i-p, ii-q, iii-r, iv-s (B) i-q, ii-p, iii-r, iv-s (C) i-r, ii-q, iii-p, iv-s (D) i-q, ii-s, iii-p, iv-r
****
2024
Topic: Respiration in plants & Photosynthesis

1. Acceptor of Acetyl CoA in Kreb’s cycle is
(A) Citric acid (B) Succinic acid (C) Oxaloacetic acid (D) Malic acid
2. Statement A: Glycolysis takes place in cytoplasm.
Statement B: The net ATP gain in glycolysis is 8 ATPs.
(A) Both statements A and B are true (C) Statement A is true, Statement B is false
(B) Both statements A & B are false (D) Statement B is true, Statement A is false
3. Point out the correct sequence of intermediate organic acid occurring during Krebs cycle,
(A) Citrate  isocitrate  Alpha ketoglutarate  Succinate  Fumarate
(B) Isocitrate  Citrate  Alpha ketoglutarate  Fumarate  Succinate
(C) Alpha-ketoglutarate  Succinate  Citrate  Isocitrate  Fumarate
(D) Succinate  Fumarate  Isocitrate  Alpha-ketoglutarate  Citrate
4. Production of acetyl CoA from pyruvate
(A) Takes place in cytosol (C) takes place in inner membrane of mitochondria
(B) Takes place in mitochondrial matrix (D) takes place in endoplasmic reticulum
5. Which of the following is complex V of the electron transport system of inner mitochondrial
membrane?
(A) cytochrome bc1 complex (C) NADH dehydrogenase
(B) cytochrome oxidase complex (D) ATP synthase
6. Which of the following biomolecules is common to respiration-mediated breakdown of fats,
carbohydrates and proteins?
(A) Pyruvic acid (B) Acetyl CoA (C) Glucose-6-phosphate (D) Fructose 1,6-bisphosphate
7. Which of the following statements is incorrect?
(A) During aerobic respiration, role of oxygen is limited to the terminal stage.
(B) In ETC (Electron Transport Chain), one molecule of NADH + H+ gives rise to 2 ATP molecules,
and one FADH2 gives rise to 3 ATP molecules.
(C) ATP is synthesized through complex V.
(D) Oxidation-reduction reactions produce proton gradient in respiration
8. Respiratiory Quotient (RQ) value of tripalmitin is
(A) 0.9 (B) 0.7 (C) 0.07 (D) 0.09
9. RuBisCO is the most abundant enzyme in the world and present in very high concentration in
chloroplasts. It is required in very high concentration for Photosynthesis because it
(A) is a very slow acting enzyme (C) also acts as an oxygenase
(B) catalyzes a reversible reaction (D) is degraded very rapidly
10. Chloroplast dimorphism is a characteristic feature of
(A) plants with Calvin cycle (C) C4 plants
(B) all plants (D) only in algae
11. The reaction centre in PS II has an absorption maxima at
(A) 700 nm (B) 660 nm (C) 780 nm (D) 680 nm
12. Electrons passed out by PS II are replaced from
(A) H2O (B) O2 (C) CO2 (D) None of the above
13. Photosynthetically active radiation represents which of the following range of wavelength?
(A) 450-950nm (B) 400-700nm (C) 500-600nm (D) 350-450nm
14. Statement I : The primary CO2 aceptor in C4 plants is phosphoenolpyruvate and is found in the
mesophyll cells.
Statement II : Mesophyll cells of C4 plants lack RuBisCO enzyme.
In the light of the above statements, choose the correct answer from the options given below.
(A) Both I and II are correct (C) I is correct, II is incorrect
(B) Both I and II are incorrect (D) II is correct, I is the incorrect
Column I Column II
(A) A-s, B-q, C-r, D- p
A Blackmann p C3 cycle
(B) A-r, B-s, C-q, D-t
B Melvin Calvin q Red drop experiment
C Emerson r C4 cycle (C) A-t, B-q, C-p, D-r
D Hatch & Slack s Non-cyclic photophosphorylation (D) A-t, B-p, C-q, D-r
t Law of limiting factors
16. Photorespiration in C3 plants begins from
(A) glycerate (B) phosphoglycolate (C) phosphoglycerate (D) glycine
17. Plant growth hormones extracted from a fungus & a fish are respectively
(A) Gibberellin & Zeatin (C) Ethylene & cytokinin
(B) Auxin & 2,4-D (D) Gibberellin & Kinetin
18. Movement of auxin is
(A) Centripetal (B) Basipetal (C) Acropetal (D) Both B & C
19. Production of Cucumber has increased manifold in recent years. Application of which of the
following phytohormones has resulted in this increased yield as the hormone is known to
produce female flowers in the plants
(A) Cytokinin (B) ABA (C) Gibberellin (D) Ethylene
20. Which one of the following plants does not show plasticity?
(A) Maize (B) Cotton (C) Coriander (D) Buttercup
21. How many ATP and NADPH2 are required for the synthesis of one molecule of Glucose during
Calvin cycle? (NEET 2023)
(A) 18 ATP and 12 NADPH2 (C) 18 ATP and 16 NADPH2
(B) 12 ATP and 16 NADPH2 (D) 12 ATP and 12 NADPH2
22. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the
maturity period, that leads to early seed production? (NEET 2023)
(A) Gibberellic Acid (B) Zeatin (C) Abscisic Acid (D) Indole-3-butyric Acid
23. Which micronutrient is required for splitting of water molecule during photosynthesis?
(A) molybdenum (B) magnesium (C) copper (D) manganese (NEET 2023)
24. Which hormone promotes internode/petiole elongation in deep water rice? (NEET 2023)
(A) Kinetin (B) Ethylene (C) 2, 4–D (D) GA3
25. Assertion A : ATP is used at two steps in glycolysis. (NEET 2023)
Reason R : First ATP is used in converting glucose into glucose-6-phosphate and second ATP is
used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate.
*****
2024
Topic: Breathing & exchange of gases and Body fluids & circulation
1. In humans, exchange of gases occurs
(A) By diffusion (C) between alveoli & pulmonary blood capillary
(B) Between blood & tissue (D) all of these
2. Which portion of the human respiratory system is called sound box?
(A) Nasopharynx (B) Glottis (C) Larynx (D) Trachea
3. At which thoracic vertebrae does trachea divide into right & left pulmonary bronchi?
(A) 5th (B) 6th (C) 9th (D) 4th
4. Select the correct pair of muscles involved in the normal breathing in humans.
(A) External & internal intercostal muscles (C) Diaphragm & internal intercostal muscles
(B) Diaphragm & external intercostal muscles (D) Diaphragm & abdominal muscles
5. Which of the following statements are true?
(A) 70 % of it is carried as bicarbonate
(B) 20-25 % of CO2 is transported by RBCs
(C) About 7 % of CO2 is carried in a dissolved state through plasma
(D) All of these
6. Select the favourable conditions required for the formation of oxyhaemoglobin at the alveoli.
(A) High pO2, low pCO2, less H+, lower temperature (NEET 2021)
(B) Low pO2, high pCO2, more H+, higher temperature
(C) High pO2, high pCO2, less H+, higher temperature
(D) Low pO2, low pCO2, more H+, higher temperature
7. The partial pressure of CO2 (pCO2) is the highest in
(A) Trachea (B) alveoli (C) tissues (D) bronchi
8. How many molecules of oxygen are carried by one molecule of haemoglobin?
(A) 6 (B) 8 (C) 2 (D) 4
9. One of the major cause of emphysema is
(A) Smog (B) Pollution (C) Cigarette smoking (D) Allergy
10. Blood analysis of a patient reveals an unusually high quantity of carboxyhaemoglobin content.
Which of the following conclusions is most likely to be correct? The patient has been inhaling
polluted air containing unusually high content of
(A) Carbon disulphide (B) chloroform (C) carbon dioxide (D) carbon monoxide.
11. The first heart sound is
(A) Lub sound during closure of semi-lunar valves
(B) Dub sound during closure of semi-lunar valves
(C) Lub sound during closure of atrio-ventricular valves
(D) Dub sound during closure of atrio-ventricular valves
12. Bicuspid valve is found between
(A) right atrium and right ventricle (C) left atrium and left ventricle
(B) right and left ventricle (D) left ventricle and aorta.
13. Continuous bleeding from an injured part of body is due to deficiency of
(A) Vitamin-A (B) Vitamin-B (C) Vitamin-K (D) Vitamin-E
14. Bundle of His is a network of
(A) Nerve fibres distributed in ventricles (C) Muscle fibres distributed throughout the heart walls
(B) Nerve fibres found throughout the heart (D) Muscle fibres found only in the ventricle wall
15. Circulatory system does not help in
(A) Transport of hormones (B) Transport of gases (C) Transport of nutrients (D) Passage of impulses
16. Which would be the heart rate of a person if the cardiac output is 5L, blood volume in the
ventricles at the end of diastole is 100 mL and at the end of ventricular systole is 50 mL?
(A) 50 beats per min (B) 75 beats per min (C) 100 beats per min (D) 125 beats per min
17. Foramen ovale
(A) Connects the two atria in the foetal heart
(B) Connects pulmonary trunk & aorta in foetal heart
(C) Is a shallow depression in the inter-ventricular septum
(D) Is condition in which heart valves do not completely close
18. Statement A: Arteries & veins are made up of three layers: Tunica externa, tunica media &
tunica intima
Statement B: The tunica media is comparatively thin in the veins than in arteries.
(A) Both statement A and B are correct (C) Statement A is correct, B is incorrect
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct
19. A healthy individual has ___ gms of haemoglobin in every 100 ml of blood.
(A) 50 - 55 gm (B) 12 – 16 gm (C) 5 – 6 gm (D) 70 – 80 gm
20. Arrange the following formed elements in the decreasing order of their abundance in blood in
humans: (a) Platelets (b) Neutrophils (c) Erythrocytes (d) Eosinophils (e) Monocytes
(A) (c), (a), (b), (e), (d) (B) (d), (e), (b), (a), (c) (C) (c), (b), (a), (e), (d) (D) (a), (c), (b), (d), (e)
21. Match List - I with List - II. (NEET 2023)

Column A Column B
i P - wave p Beginning of systole
ii Q - wave q Repolarisation of ventricles
iii QRS complex r Depolarisation of atria
iv T - wave s Depolarisation of ventricles
(A) i-p, ii-q, iii-r, iv-s (B) i-r, ii-p, iii-q, iv-s (C) i-s, ii-p, iii-q, iv-r (D) i-r, ii-p, iii-s, iv-q
22. Vital capacity of lung is______. (NEET 2023)
(A) IRV + ERV + TV + RV (B) IRV + ERV + TV – RV (C) IRV + ERV + TV (D) IRV + ERV
23. Under normal physiological conditions in human being every 100 ml of oxygenated blood can
deliver _____ ml of O2 to the tissues. (NEET 2022)
(A) 10 ml (B) 2 ml (C) 5 ml (D) 4 ml
24. Which of the following statements is correct? (NEET 2022)
(A) The tricuspid & bicuspid valves open due to pressure exerted by simultaneous contraction of
atria
(B) blood moves freely from atrium to ventricle during joint diastole
(C) Increased ventricular pressure causes closing of the semilunar valves
(D) Increased ventricular pressure causes closing of the semilunar valves
25. The partial pressures (in mm Hg) of oxygen (O2) and carbon dioxide (CO2) at alveoli (the site of
diffusion) are (NEET 2021)
(A) pO2 = 104 and pCO2 = 40 (C) pO2 = 95 and pCO2 = 40
(B) pO2 = 40 and pCO2 = 45 (D) pO2 = 159 and pCO2 = 0.3
2024
Topic: Breathing & exchange of gases and Body fluids & circulation
1. In medullary nephrons,
(A) Loop of Henle is short (C) The PCT is very long
(B) loop of Henle is long (D) the DCT is short
2. Length, width and thickness of the adult human kidney are approximately
(A) 12-16 cm, 10-12 cm and 4-6 cm respectively (C) 10-12 cm, 2-3 cm and 5-7 cm respectively
(B) 10-12 cm, 5-7 cm and 2-3 cm respectively (D) 12-16 cm, 5-7 cm and 2-3 cm respectively
3. Many collecting ducts converge and through medullary pyramids in the calyces open into the
(A) Renal pelvis (B) Columns of Bertini (C) Collecting duct (D) Malpighian corpuscle
4. The amount of urine released by a normal man per day is
(A) 1-5 gm (B) 12-20 gm (C) 1-1.5 litres (D) 80 gm
5. Which part of nephron is impermeable to water? (AIIMS 15)
(A) Proximal convoluted tubule (C) Ascending loop of Henle
(B) Distal convoluted tubule (D) Descending loop of Henle
6. Angiotensin-II stimulates
(A) Vasoconstriction (C) Vasodilation (AIPMT 15)
(B) Adrenal cortex to release glucocorticoids (D) The secretion of ADH
7. Kidney functioning is efficiently monitored and regulated by hormonal feedback mechanisms.
Which of the following is/are involved in it?
a. Heart b. Hypothalamus c. Juxta glomerular apparatus
(A) only a (B) only a and b (C) only a and c (D) a, b and c
8. Which of the following statements is/are true?
a. ANF can cause dilation of blood vessels and thus, increase the blood pressure.
b. Presence of Glycosuria and Ketonuria in urine are indicative of diabetes mellitus.
(A) Only a (B) Only a and b (C) Only b (D) both are false
9. Podocytes are present on the
(A) Endothelial cells of glomerulus (C) Epithelial cells of glomerulus
(B) Endothelial cells of Bowman’s capsule (D) Epithelial cells of Bowman’s capsule
10. Renal calculi is
(A) Soluble mass of crystallized salts in kidney (C) Insoluble mass of proteins in kidney
(B) Soluble mass of proteins in kidney (D) Insoluble mass of crystallized salts in kidney
11. Which one of the following statements is incorrect?
(A) Heart muscles are striated and involuntary
(B) The muscles of hands and legs are striated and voluntary
(C) The muscles located in the inner walls of alimentary canal are striated and involuntary
(D) Muscles located in the reproductive tracts are unstriated and involuntary
12. Which muscle band remains unchanged during the contraction & relaxation of skeletal muscle?
(A) I (B) H (C) A (D) E
13. The globular head of heavy meromyosin is an active ATPase enzyme and has
a. ATP binding sites b. Actin binding sites c. Myosin binding sites
d. Troponin binding sites e. Calcium binding sites
(A) a and b (B) a and c (C) a, c and d (D) a, c and e
14. Action potential in sarcolemma of muscles causes the release of
(A) Na2+ (B) Ca2+ (C) Cl- (D) Mg2+
15. Statement A: Contraction of muscles takes place by the sliding of thin filament over thick filament.
Statement B: In the centre of each I-band there is an elastic fibre called Z line.
16. The store house of calcium ions in the muscle fibre is
(A) Golgi body (B) Lysosomes (C) Nucleus (D) Sarcoplasmic reticulum
17. Neural canal is
(A) Solid portion of vertebrae through which the spinal cord passes (C) Both A & B
(B) Hollow portion of vertebrae through which the spinal cord passes (D) None of these
18. Statement A: The first vertebrae in human is called axis.
Statement B: The second vertebrae in human is called atlas.
19. Cartilaginous joints in humans
(A) Permit no movement (B) Permit little movement (C) Permit any movement (D) All of these
20. The correct sequential order of vertebrae in the vertebral column of humans is
(A) Cervical Lumbar Thoracic Coccygeal Sacrum
(B) Cervical Thoracic Lumbar Coccygeal Sacrum
(C) Cervical Lumbar Thoracic Sacrum Coccygeal
(D) Cervical Thoracic Lumbar Sacrum Coccygeal

Column A (Type of Joint) Column B (Found between)
i Cartilaginous Joint p Between flat skull bones
ii Ball and Socket Joint q Between adjacent vertebrae in vertebral column
iii Fibrous Joint r Between carpal and metacarpal of thumb
iv Saddle Joint s Between Humerus and Pectoral girdle
(A) i-p, ii-q, iii-r, iv-s (B) i-q, ii-s, iii-p, iv-r (C) i-s, ii-p, iii-q, iv-r (D) i-q, ii-p, iii-s, iv-r
22. Which of the following statements are correct regarding skeletal muscle? (NEET 2023)
a. Muscle bundles are held together by collagenous connective tissue layer called fascicle.
b. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions.
c. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin
proteins.
d. M line is considered as functional unit of contraction called sarcomere.
(A) b and c only (B) a, c and d only (C) c and d only (D) a, b and c only
23. Assertion A : Nephrons are of two types : Cortical & Juxta medullary, based on their relative
position in cortex and medulla. (NEET 2023)
Reason R : Juxta medullary nephrons have short loop of Henle whereas, cortical nephrons have
longer loop of Henle.
(A) Both A and R are true but R is NOT the correct explanation of A.
(B) A is true but R is false.
(C) A is false but R is true.
(D) Both A and R are true and R is the correct explanation of A.
24. Select the correct statements. (NEET 2022)
(a) Angiotensin II activates the cortex of adrenal gland to release aldosterone.
(b) Aldosterone leads to increase in blood pressure.
(c) ANF acts as a check on renin-angiotensin mechanism.
(d) ADH causes vasodilation.
(e) Vasopressin is released from adenohypophysis.
(A) (a), (b) and (e) only (C) (b), (c) and (d) only
(B) (c), (d) and (e) only (D) (a), (b) and (c) only
25. Which of the following is correct match for disease and its symptoms? (NEET 2022)
(A) Muscular dystrophy – An auto immune disorder causing progressive degeneration of
skeletal muscle
(B) Myasthenia gravis – Genetic disorder resulting in weakening and paralysis of skelatal muscle
(C) Arthritis– Inflammed joints
(D) Tetany - high Ca2+ level causing rapid spasms
*****
2024
Topic: Neural control & coordination and Chemical coordination & integration
1. Which of the following is a neuroglial cell?
(A) Astrocytes (B) Oligodendrocytes (C) Microglia (D) All of these
2. For the maintenance of ionic gradients across the resting membrane, the sodium-potassium
pump transports
(A) 3Na+ outwards for 2K+ into the cell (C) 2Na+ outwards for 2K+ into the cell
+ +
(B) 3Na inwards for 2K out the cell (D) 2Na+ inwards for 2K+ out the cell
3. Statement A: Myelinated nerve fibres are found in spinal and cranial nerves.
Statement B: Unmyelinated nerve fibres are commonly found in autonomous and the somatic
neural systems.
4. Select the correct sequence of meninges from outer to inner side.
(A) Duramater  Piamater  Arachnoid (C) Piamater  Arachnoid  Duramater
(B) Duramater  Arachnoid  Piamater (D) Piamater  Duramater  Arachnoid
5. Statement A: A synapse is formed by the membranes of a pre-synaptic neuron and a post-synaptic
neuron, which may or may not be separated by a gap called synaptic cleft.
Statement B: There are two types of synapses: electrical synapses & chemical synapses.
6. Which part of the brain is responsible for thermoregulation?
(A) Cerebrum (B) Hypothalamus (C) Corpus callosum (D) Medulla oblongata
7. A gymnast is able to balance his body upside down even in the total darkness because of
(A) Tectorial membrane (B) Organ of corti (C) Cochlea (D) Vestibular apparatus
8. Which one ofthe following statements is not correct?
(A) Rhodopsin is the purplish red protein presents in rods only.
(B) Retinal is the light absorbing portion of visual photo pigments
(C) In retina the rods have the photopigment rhodopsin while cones have three different
photopigments.
(D) Retinal is a derivative of Vitamin C.
9. In mammalian eye, the fovea' is the center of the visual field, where
(A) The optic nerve leaves the eye (C) More rods than cones are found
(B) Only rods are present (D) High density of cones occur, but has no rods
10. Statement A: The cerebral cortex is referred to as grey matter of the brain.
Statement B: It is due to the high concentrations of neuronal axons in it.
11. Deficiency of thyroxine in adults will cause
(A) myxedema (B) cretinism (C) both (A) and (B) (D) exophthalmic goiter
12. The pineal gland secretes
(A) Vasopressin (B) Melanin (C) Melatonin (D) MSH
13. Select the correct statement.
(A) Glucagon is associated with hypoglycemia (C) Insulin acts on pancreatic cells and adipocytes
(B) Insulin is associated with hyperglycemia (D) Glucocorticoids stimulate gluconeogenesis
14. Flight or fight reactions cause activation of
(A) The kidney, leading to suppression of renin-angiotensin-aldosterone pathway
(B) The pancreas leading to a reduction in blood glucose level
(C) The adrenal medulla, leading to increased secretion of epinephrine & norepinephrine
(D) The parathyroid glands leading to increased metabolic rate
15. Ca2+ level is maintained by
(A) PTH (B) TCT (C) Thymosin (D) Both A & B
16. Hyposecrection of corticoids leads to
(A) Addison’s disease (C) Diabetes mellitus
(B) Cushing’s disease (D) Diabetes insipidus
17. Steroid hormones typically alters the activity of target cells by
(A) Activating primary messenger (C) interacting with intracellular receptors
(B) Activating secondary messenger (D) all of these
18. Chemical nature of hormones secreted by α and β cells of Islets of Langerhans of pancreas is
(A) Glycoprotein (B) Steroid (C) Polypeptide (D) Glycolipid
19. Trophic hormones are produced by
(A) Anterior pituitary (B) Middle pituitary (C) Posterior pituitary (D) Thyroid
20. Thyrotrophic releasing factor (TRF) is secreted by
(A) Hypothalamus (B) Adenohypophysis (C) Pars intermedia (D) Neurohypophysis

List - I List - II
i CCK p Kidney
ii GIP q Heart
iii ANF r Gastric gland
iv ADH s Pancreas
(A) i-s, ii-q, iii-r, iv-p (B) i-q, ii-s, iii-p, iv-r (C) i-s, ii-r, iii-q, iv-p (D) i-q, ii-p, iii-s, iv-r
22. The parts of human brain that helps in regulation of sexual behaviour, expression of excitement,
pleasure, rage, fear etc. are: (NEET 2023)
(A) Corpora quadrigemina & hippocampus (C) Corpus callosum and thalamus
(B) Brain stem & epithalamus (D) Limbic system & hypothalamus
23. Which of the following statements are correct? (NEET 2023)
a. An excessive loss of body fluid from the body switches off osmoreceptors.
b. ADH facilitates water reabsorption to prevent diuresis.
c. ANF causes vasodilation.
d. ADH causes increase in blood pressure.
e. ADH is responsible for decrease in GFR.
(A) b, c and d only (B) a, b and e only (C) c, d and e only (D) a and b only
24. Which of the following are NOT under the control of thyroid hormone? (NEET 2023)
a. Maintenance of water and electrolyte balance
b. Regulation of basal metabolic rate
c. Normal rhythm of sleep-wake cycle
d. Development of immune system
e. Support the process of R.B.Cs formation
(A) b and c only (B) c and d only (C) d and e only (D) a and d only
25. Match List - I with List – II (NEET 2022)
List I List II
a) Multipolar neuron i. Somatic neural system
b) Bipolar neuron ii. Cerebral cortex
c) Myelinated nerve fibre iii. Retina of Eye
d) Unmyelinated nerve fibre iv. Spinal nerves
Select the correct option
(A) (a) – (iii), (b) – (i), (c) – (iv), (d) – (ii)
(B) (a) – (ii), (b) – (iv), (c) – (iii), (d) – (i)
(C) (a) – (ii), (b) – (iii), (c) – (i). (d) – (iv)
(D) (a) – (ii), (b) – (iii), (c) – (iv), (d) – (i)
*****
2024
Topic: Sexual reproduction in flowering plants

1. In some members of which of the following pairs of families, pollen grains retain their viability
for months after release?
(A) Poaceae ; Rosaceae (C) Poaceae; Leguminosae
(B) Poaceae; Solanaceae (D) Rosaceae ; Leguminosae
2. The term used for transfer of pollen grains from anthers of one plant to stigma of a different
plant which, during pollination, brings genetically different types of pollen grains to stigma, is
(A) Xenogamy (B) Geitonogamy (C) Chasmogamy (D) Cleistogamy
3. In a flower, if the megaspore mother cell forms megaspores without undergoing meiosis & if
one of the megaspores develop into embryo sac, its nuclei would be
(A) Haploid (B) Diploid (C) with varying ploidy (D) a few haploid & a few diploid
4. Species that provide floral rewards in the form of providing safe area to lay eggs for insects are
(A) Amorphophallus (B) Yucca (C) Fig (D) All of these
5. Polygonum type of embryo sac is:
(A) 8-nucleate, 7-celled (B) 8-nucleate, 8-celled (C) 7-nucleate, 7-celled (D) 4-nucleate, 3-celled
6. When micropyle, chalaza and hilum lie in a straight line, the ovule is said to be:
(A) anatropous (B) orthotropous (C) amphitropous (D) campylotropous
7. Protandry is a condition in which:
(A) anthers mature after stigma (C) anthers and stigmas mature at the same time
(B) anthers mature earlier than the stigma (D) pollens of the same flowers pollinates stigmas
8. Which of the following floral parts form pericarp after fertilization?
(A) Nucellus (B) wall of ovary (C) Outer integument of ovule (D) Inner integument of ovule
9. Which of the following is correct?
(A) Proembryo  Heart shaped embryo  Globular embryo  mature embryo
(B) Heart shaped embryo  Proembryo  Globular embryo  mature embryo
(C) Proembryo  Globular embryo  Heart shaped embryo  mature embryo
(D) Globular embryo  Heart shaped embryo  Proembryo  mature embryo
10. Apomixis is seen in some species of
(A) Asteraceae (B) Grasses (C) Both A & B (D) Neither A nor B
11. How many meiotic divisions are necessary for the formation of 100 grains of wheat?
(A) 100 (B) 125 (C) 25 (D) 50
12. Even in absence of pollinating agents seed setting is assured in
(A) Commelina (B) Zostera (C) Salvia (D) Fig
13. Which of the following is true?
(A) Banana is an example for parthenocarpic fruit (C) Apple is an example for false fruit
(B) Outer integument of ovule forms testa of the seed (D) All of these
14. Assertion: Wind pollinated plant have large feathery stigma
Reason: Feathery stigma easily traps air-borne pollen grains
(D) Both Assertion and Reason are false.
15. Statement A: In plants like water hyacinth and water lily, pollination takes place by water.
Statement B: In most of the water-pollinated species, pollen grains are protected from wetting
by a mucilaginous covering.
(A) Both statement A and B are correct. (C) Statement A is correct, B is incorrect.
16. What is the function of tassels in the corn cob? (NEET 2023)
(A) To trap pollen grains (C) To protect seeds
(B) To disperse pollen grains (D) To attract insects
17. Large, colourful, fragrant flowers with nectar are seen in: (NEET 2023)
(A) bird pollinated plants (C) bat pollinated plants
(B) wind pollinated plants (D) insect pollinated plants
18. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially
are: (NEET 2023)
(A) Antipodals, synergids, and primary endosperm nucleus
(B) Synergids, Zygote and Primary endosperm nucleus
(C) Synergids, antipodals and Polar nuclei
(D) Synergids, Primary endosperm nucleus and zygote
19. Statement I : Cleistogamous flowers are invariably autogamous. (NEET 2022)
Statement II : Cleistogamy is disadvantageous as there is no chance for cross pollination.
(A) Both statement I and II are correct (C) Statement I is correct, II is incorrect
(B) Both statement I and II are incorrect (D) Statement I is incorrect, II is correct
20. Identify incorrect statement related to Pollination : (NEET 2022)
(A) Moths and butterflies are the most dominant pollinating agents among insects
(B) Pollination by water is quite rate in flowering plants
(C) Pollination by wind is more common amongst abiotic pollination
(D) Flowers produce foul odours to attract flies and beetles to get pollinated
*****
2024
Topic: Human reproduction & reproductive health

1. Sertoli cells are found
(A) Between the seminiferous tubules (C) in the upper part of fallopian tube
(B) In the germinal epithelium of ovary (D) In the germinal epithelium of seminiferous tubules
2. At which stage of life the oogenesis process is initiated?
(A) Adult (B) Puberty (C) Embryonic development stage (D) Birth
3. Assertion: testis originate in the abdomen but later descend into scrotum under the influence of
testosterone.
Reason: Leydig cells of the testis secrete male sex hormone inhibin.
4. Match the following:
Column I Column II
a Parturition 1 Attachment of zygote to endometrium
b Gestation 2 Release of egg
c Ovulation 3 Delivery of baby
d Implantation 4 Period between fertilization & the birth
e Conception 5 Formation of zygote by fusion
6 Stoppage of ovulation
(A) a – 4, b – 3, c – 1, d – 5, e – 2 (C) a – 3, b – 4, c – 2, d – 1, e - 5
(B) a – 3, b – 4, c – 1, d – 5, e – 2 (D) a – 3, b – 4, c – 2, d – 1, e – 6
5. Which event of fertilization involves the presence of hyaluronidase enzyme?
(A) Acrosomal reaction (B) Cortical reaction (C) Amphimixis (D) Activation of egg
6. Acrosomal reaction of the sperm occurs due to:
(A) Its contact with zona pellucida of the ova
(B) Reactions within the uterine environment of the female
(C) Reactions within the epididymal environment of the male
(D) Androgens produced in the uterus
7. Morula is a developmental stage:
(A) Between the zygote and blastocyst (C) After the implantation
(B) Between the blastocyst and gastrula (D) Between implantation and parturition
8. The first movements of the foetus and appearance of hair on the head are usually observed
during the _______ month.
(A) 2nd (B) 3rd (C) 4th (D) 5th
9. The female structures that corresponds (homologous) to the scrotum of the male are
(A) Labia minora (B) Labia majora (C) Clitoris (D) Urethral folds
10. Identical twins are
(A) Monozygotic (B) isozygotic (C) bizygotic (D) All
11. Extrusion of second polar body from egg nucleus occurs
(A) after entry of sperm before completion of fertilization (C) before entry of sperm
(B) after completion of fertilization (D) without any relation of sperm entry
12. If for some reason, the vasa efferentia in the human reproductive system gets blocked, the
gametes will not be transported from
(A) Epididymis to Vas deferens (C) Vagina to uterus
(B) Testis to epididymis (D) Epididymis to rete testis
13. All these are male accessory glands except
(A) Cowper’s gland (B) Prostate gland (C) Bartholin’s gland (D) Seminal vesicles
14. Which of the following has 23 chromosomes
(A) Spermatogonia (B) 1⁰ Spermatocyte (C) 1⁰ Oocyte (D) Spermatid
15. Which of the following is a hormone releasing IUD?
(A) Vault (B) Multiload 375 (C) Cervical cap (D) LNG – 20
16. Which of the following statements are correct regarding female reproductive cycle?
a. In non-primate mammals cyclical changes during reproduction are called oestrus cycle.
b. First menstrual cycle begins at puberty and is called menopause. (NEET 2023)
c. Lack of menstruation may be indicative of pregnancy.
d. Cyclic menstruation extends between menarche and menopause.
(A) a and b only (B) a, b and c only (C) a, c and d only (D) a and d only
17. Assertion A : Endometrium is necessary for implantation of blastocyst. (NEET 2023)
Reason R : In the absence of fertilization, the corpus luteum degenerates that causes
disintegration of endometrium.
(A) Both A and R are true but R is NOT the correct explanation of A.
(B) A is true but R is false.
(C) A is false but R is true.
(D) Both A and R are true and R is the correct explanation of A.
Statement I : Vas deferens receives a duct from seminal vesicle and opens into urethra as the
ejaculatory duct.
Statement II : The cavity of the cervix is called cervical canal which along with vagina forms birth
canal.
(A) Both statement I and II are correct. (C) Statement I is correct, II is incorrect
19. Which of the following statements are true for spermatogenesis but do not hold for oogenesis?
(a) It results in the formation of haploid gametes (NEET 2022)
(b) Differetiation of gamete occurs after the completion of meiosis
(c) Meiosis occurs continuously in a mitotically dividing stem cell population
(d) It is controlled by the LH and FSH secreted by the anterior pituitary
(e) It is initiated at puberty
Choose the most appropriate answer from the options given below.
(A) (b) and (c) and (e) only (B) (c) and (e) only (C) (b) and (c) only (D) (b) , (d) and (e) only
20. Lippe’s loop is a type of contraceptive used as: (NEET 2022)
(A) Copper releasing IUD (B) Cervical barrier (C) Vault barrier (D) Non-Medicated IUD
2024
Topic: Principles of inheritance & variations

1. In a dihybrid cross AABB x aabb, F2 generation of AABB, AABb, AaBb & AaBB occurs in the ratio
(A) 1:2:2:1 (B) 1:2:4:2 (C) 9:3:3:1 (D) 1:1:1:1
2. Statement I: The ratio of 3:1 in F2 generation is explained by law of independent assortment.
Statement II: In incomplete dominance the genotypic & phenotypic ratios are same in F2
generation.
3. Two genes A and B are linked in a dihybrid cross involving these two genes, the F1 heterozygote
is crossed with homozygous recessive parental type (aabb). What would be the ratio of offspring
in the next generation
(A) 1:1 (B) 1:1:1 (C) 1:1:1:1 (D) 1:1:1:1:1:1
4. How many are recombinants in Mendelian dihybrid cross?
(A) 25% (B) 62.8% (C) 37.5% (D) 50%
5. Select the incorrect statement about thalassemia.
(A) α-thalassemia is controlled by two closely linked genes HBA1 and HBA2
(B) α-thalassemia is controlled by genes present on chromosome 16
(C) β-thalassemia is controlled by a single gene HBB present on chromosome number 11
(D) Thalassemia is a qualitative problem of synthesizing an incorrectly functioning globin
6. A diseased man marries a normal woman. The couple has 3 daughters & 5 sons. All the
daughters are diseased while the sons are normal. The disease is
(A) Autosomal dominant (B) Autosomal recessive (C) X-linked dominant (D) X-linked recessive
7. Genotype that shows the diseased condition in sickle cell anaemia is
(A) HbA HbA (B) HbA HbS (C) HbS HbS (D) All of these
8. Sickle-cell anaemia happens due to ...A... mutation in which...B... of haemoglobin is affected.
Fill the correct option for A and B.
(A) A-point; B-B-chain (C) A-allele; B-a chain
(B) A-chromosomal; B-a-chain (D) A-non-allele; B-chain
9. Phenylalanine does not changed to tyrosine. This condition is seen in
(A) sickle-cell anaemia (B) phenylketonuria (C) thalassaemia (D) Haemophilia
Column I Column I
i Chromosomal theory of inheritance P Henking
ii X-body Q T H Morgan
iii 21st trisomy R Sutton and Boveri
iv Linkage S Langdon Down
(A) i-S, ii-Q, iii-R, iv-P (B) i-R, ii-P, iii-S, iv-Q (C) i-Q, ii-R, iii-S, iv-P (D) i-R, ii-Q, iii-S, iv-P
11. In β-thalassaemia, the affected chromosome is
(A) 16th (B) 14th (C) 13th (D) 11th
12. Heterozygous pea plant for the flower colour gene produces gametes. What is the probability
that one of its gametes consist of recessive white allele for flower colour?
(A) 25% (B) 50% (C) 75% (D) 0%
13. How many different types of gametes can be formed by F1 progeny resulting from the cross
AABBCC X aabbcc
(A) 3 (B) 8 (C) 27 (D) 64
14. A marriage between a colourblind man and a
normal woman results in
(A) 50% colourblind sons, 50% normal sons
(B) 100% colourblind sons, 100% carrier daughters
(C) 100% carrier daughters, 100% normal sons
(D) 100% colourblind daughters, 100% normal sons
15. Given below is a pedigree chart showing the
inheritance of certain sex linked trait in humans.
The trait traced in the above pedigree chart is
(A) X-linked dominant (C) Y-linked dominant
(B) X-linked recessive (D) Y-linked recessive
16. Frequency of recombination between gene pairs on same chromosome as a measure of the
distance between genes to map their position on chromosome, was used for the first time by
(A) Sutton and Boveri (C) Alfred Sturtevant (NEET 2023)
(B) Henking (D) Thomas Hunt Morgan
17. The phenomenon of pleiotropism refers to (NEET 2023)
(A) presence of two alleles, each of the two genes controlling a single trait.
(B) a single gene affecting multiple phenotypic expression.
(C) more than two genes affecting a single character.
(D) presence of several alleles of a single gene controlling a single crossover.
18. Which of the following statements are correct about Klinefelter's Syndrome? (NEET 2023)
A. This disorder was first described by Langdon Down (1866).
B. Such an individual has overall masculine development. However, the feminine development is
also expressed.
C. The affected individual is short statured.
D. Physical, psychomotor and mental development is retarded.
E. Such individuals are sterile.
(A) C and D only (B) B and E only (C) A and E only (D) A and B only
19. The recombination frequency between the genes a & c is 5%, b & c is 15%, b & d is 9%, a & b is
20%, c & d is 24% and a & d is 29%. What will be the sequence of these genes on a linear
chromosome? (NEET 2022)
(A) a, c, b, d (B) a, d, b, c (C) d, b, a, c (D) a, b, c, d
20. Assertion (A): Mendel’s law of Independent assortment does not hold good for the genes that
are located closely on the same chromosome. (NEET 2022)
Reason (R): Closely located genes assort independently.
(C) If Assertion is true and Reason is false. (D) If Assertion and Reason both are false.
2024
Topic: Molecular basis of inheritance

1. In sea urchin DNA, which is double stranded, 17% of the bases were shown to be cytosine. The
percentages of the other three bases expected to be present in this DNA are :-
(A) G 17%, A 16.5%, T 32.5% (C) G 17%, A 33%, T 33%
(B) G 8.5%, A 50%, T 24.5% (D) G 34%, A 24.5%, T 24.5%
2. Total number of amino acids present in a polypeptide chain is 200. How many mRNA bases will
be required?
(A) 200 (B) 400 (C) 600 (D) 800
3. Capping is the process in transcription of eukaryotes where
(A) Methyl guanosine triphosphate is added at 3' end
(B) Methyl guanosine triphosphate is added at 5' end
(C) 200-300 adenylate residues are added at 3' end
(D) 200-300 adenylate residues are added at 5' end
4. Escherichia coli with completely radioactive DNA was allowed to multiply in non-radioactive
medium for three generations. What will be the percentage of bacteria with radioactive DNA?
(A) 100 % (B) 75 % (C) 50 % (D) 25 %
5. In 3-D view the molecule of tRNA looks
(A) Y shaped (B) L shaped (C) T shaped (D) Z shaped
6. Which of these are involved in the synthesis of mRNA in prokaryotes
(A) RNA polymerase (B) σ factor (C) ρ factor (D) All of the above
st
7. Statement A: According to Wobble hypothesis, degeneracy occurs at 1 base of genetic code.
Statement B: Wobble hypothesis was proposed by Francis Crick
(A) Both statements A & B are correct (C) Both statements A & B are wrong
(B) A is correct, B is wrong (D) A is wrong, B is correct
8. Which of these are salient features of human genome
(A) < 2% of human genome codes for proteins (C) presence of repetitive sequences
(B) The average gene consists of 3000 base (D) All
9. Reverse transcriptase is
(A) DNA dependent DNA polymerase (C) DNA dependent RNA polymerase
(B) RNA dependent DNA polymerase (D) RNA dependent RNA polymerase
10. Under which of the following conditions will there be no change in the reading frame of
following mRNA? 5'AACAGCGGUGCUAUU3'
(A) Insertion of G at 5th position (C) Insertion of A at G at 4th and 5th positions respectively
(B) Deletion of G from 5th position (D) Deletion of GGU from 7th, 8th and 9th positions
11. tRNA attaches amino acid at its:
(A) 3’ end (B) 5’ end (C) Anticodon (D) Loop.
12. The bacteria grown in the medium S35 as lone source of Sulphur show its incorporation into:
(A) DNA (B) Protein (C) RNA (D) None of these
13. If a geneticist uses the blind approach for sequencing whose genome of an organism, followed
by assignment of function to different segments, the methodology adopted by him is called as
(A) Bioinformatics (B) Sequence annotation (C) Gene mapping (D) Expressed sequence tags
14. In an E.coli strain i gene gets mutated and its product cannot bind the inducer molecule If
growth medium is provided with lactose what will be the outcome? (NEET 2022)
(A) RNA polymerase will bind the promoter region (C) Only z gene will get transcribed
(B) z, y, a genes will be transcribed (D) z, y, a genes will not be translated
15. The process of translation of mRNA to proteins begins as soon as
(A) The tRNA is activated and the larger subunit of ribosome encounters mRNA
(B) The small subunit of ribosome encounters mRNA
(C) The larger subunit of ribosome encounters mRNA
(D) Both the subunits join together to bind with mRNA
16. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
(A) Transcription of tRNA, 5 srRNA and snRNA (C) Transcription of only snRNAs (NEET 2023)
(B) Transcription of precursor of mRNA (D) Transcription of rRNAs (28S, 18S and 5.8S)
17. Expressed Sequence Tags (ESTs) refers to (NEET 2023)
(A) All genes that are expressed as proteins. (C) Certain important expressed genes.
(B) All genes whether expressed or unexpressed. (D) All genes that are expressed as RNA.
Statement I : In prokaryotes, the positively charged DNA is held with some negatively charged
proteins in a region called nucleoid.
Statement II : In eukaryotes, the negatively charged DNA is wrapped around the positively
charged histone octamer to form nucleosome.
In the light of the above statements, choose the correct answer from the options given below :
(A) Both Statement I and Statement II are true.
(B) Both Statement I and Statement II are false.
(C) Statement I is correct but Statement II is false.
(D) Statement I incorrect but Statement II is true.
19. Which one of the following is the sequence on corresponding coding strand, if the sequence on
mRNA formed is as follows: 5' AUCGAUCGAUCGAUCGAUCG AUCG AUCG 3'? (NEET 2023)
(A) 3' UAGCUAGCUAGCUAGCUA GCUAGCUAGC 5'
(B) 5' ATCGATCGATCGATCGATCG ATCGATCG 3'
(C) 3' ATCGATCGATCGATCGATCG ATCGATCG 5'
(D) 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
20. Read the following statements and choose the set of correct statements (NEET 2022)
(a) Euchromatin is loosely packed chromatin
(b) Heterochromatin is transcriptionally active
(c) Histone octomer is wrapped by negatively charged DNA in nucleosome
(d) Histones are rich in lysine and arginine
(e) A typical nucleosome contains 400 bp of DNA helix
(A) (a), (c), (e) only (B) (b), (d), (e) only (C) (a), (c), (d) only (D) (b), (e) only
*****
2024
Topic: Evolution
1. Weismann cut off tails of mice generation after generation but tails neither disappeared nor
shortened showing that
(A) Darwin’s theory was wrong (C) Mutation theory was wrong
(B) Lamarck’s theory was wrong (D) Synthetic theory was wrong
2. Evolutionary convergence is the development of
(A) Common set of characters in a groups of different ancestry
(B) Common set of characters in closely related groups
(C) Development of characters by random mating
(D) Dissimilar characters in closely related groups
3. What can you infer about the structures shown in figure?
(A) Homologous organs
(B) Analogous organs
(C) Divergent evolution
(D) Both A & C
4. Stabilizing selection favours
(A) both extreme forms of a tract.
(B) intermediate forms of a tract.
(C) environmental differences.
(D) one extreme form over the other extreme form and over intermediates forms of a tract.
5. Statement A: Interbreeding between one population to another is called gene flow.
Statement B: The sum total of all the genes of a population is known as genetic drift.
(B) Both statement A and B are incorrect (D) Statement A is incorrect, B is correct.
6. Statement A: Lamarck’s theory of evolution is also known as theory of acquired inheritance.
Statement B: Lamarck theory of evolution also explained use and disuse of organs.
7. Jurassic period of the Mesozoic era is characterized by
(A) Gymnosperms are dominant plants & first birds appear
(B) Radiation of reptiles & origin of mammal like reptiles
(C) Dinosaurs become extinct & angiosperms appear
(D) Flowering plants & first dinosaurs appear
8. Hardy-Weinberg principle can be expressed as
(A) (p + q)2 = 1 (B) (p + q)3 = 1 (C) (p + q)2 > 1 (D) (p + q)2 < 1
9. Factors affecting Hardy-Weinberg equilibrium are
(a) Gene flow (b) Genetic drift (c) Mutation (d) Genetic recombination (e) Natural selection
(A) a & b (B) a, b & c (C) b, c & d (D) a, b, c, d & e
10. The chronological order of human evolution from early to the recent is:
(A) Ramapithecus ----- Homo habilis ------- Australopithecus ----- Homo erectus
(B) Australopithecus ----- Homo habilis----- Ramapithecus ----- Homo erectus
(C) Australopithecus ----- Ramapithecus ----- Homo habilis ----- Homo erectus
(D) Ramapithecus ----- Australopithecus ----- Homo habilis ----- Homo erectus
11. Who proposed the concept of intraspecific and interspecific struggle?
(A) de Vries (B) Malthus (C) Cuvier (D) Darwin
12. Which one cannot be explained by Darwinism?
(A) Over-specialisation (C) Occurrence of unchanged forms
(B) Persistence of vestigial organs (D) All the above
13. A population exhibiting Hardy-Weinbeg equilibrium possesses 25% recessive traits. Find out the
frequency of recessive alleles in the gene pool of the same population.
(A) 0.3 (B) 0.25 (C) 0.75 (D) 0.5
14. Single step large mutation leading to speciation is also called
(A) Founder effect (B) saltation (C) branching descent (D) natural selection
15. At a particular locus, frequency of A allele is 0.6 & that of a is 0.4. what would be the frequency
of heterozygotes in a randomly mating population of equilibrium?
(A) 0.16 (B) 0.36 (C) 0.48 (D) 0.24
16. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation. (NEET 2023)
(A) Numbat, Spotted cuscus, Flying phalanger (C) Lemur, Anteater, Wolf
(B) Mole, Flying squirrel, Tasmanian tiger cat (D) Tasmanian wolf, Bobcat, Marsupial mole
17. Natural selection where more individuals acquire specific character value other than the mean
character value, leads to: (NEET 2022)
(A) Random change (B) Stabilising change (C) Directional change (D) Disruptive change
18. Which of the following statements is not true? (NEET 2022)
(A) Flippers of penguins and dolphins are a pair of homologous organs
(B) Analogous structures are a result of convergent evolution
(C) Sweet potato and potato is an example of analogy
(D) Homology indicates common ancestry
19. The factor that leads to Founder effect in a population is: (NEET 2021)
(A) Natural selection (B) Genetic recombination (C) Mutation (D) Genetic drift
20. Match the following: (NEET 2021)
Column I Column II
a) Adaptive radiation i. Selection of resistant varieties due to
excessive use of herbicides and pesticides
b) Convergent evolution ii. Bones of forelimbs in Man and Whale
c) Divergent evolution iii. Wings of Butterfly and Bird
d) Evolution by anthropogenic action iv. Darwin’s finches
(A) a-iii, b-iv, c-ii, d-i (B) a-i, b-iv, c-ii, d-iii (C) a-iv, b-iii, c-ii, d-i (D) a-i, b-iii, c-ii, d-iv
****
2024
Topic: Human health & diseases

1. Which class of antibodies is abundant in body secretions?
(A) Ig G (B) Ig A (C) Ig M (D) IgE
2. Each immunoglobulin has two heavy chains & two light chains, the antigen binding site is present in
(A) variable region of light chain (C) variable region of heavy chain
(B) variable region of both heavy and light chain (D) constant region of both light and heavy chain.
3. Select the incorrect statement with respect to acquired immunity.
(A) Acquired immunity is non-specific type of defense present at the time of birth.
(B) Primary response is produced when our body encounters a pathogen for the first time.
(C) Anamnestic response is elicited on subsequent encounters with the same pathogen.
(D) Anamnestic response is due to memory of first encounter.
4. Inflammatory response in allergy is due to the release of ________ from mast cells.
(A) Antibody (B) Anti histamines (C) Histamines (D) Antigen
5. Damage of thymus in a child may lead to
(A) Reduction in haemoglobin content in blood (C) loss of antibody mediated immunity
(B) Reduction in amount of plasma proteins (D) loss of cell mediated immunity
6. Colostrum provides the infant with
(A) Autoimmunity (B) Passive immunity (C) Active immunity (D) Innate immunity
7. Assertion (A): Interferons are a type of antibodies produced by body cells infected by bacteria.
Reason (R): Interferons stimulates inflammation at the site of injury.
8. Statement I: HIV is un-enveloped retrovirus
Statement II: HIV contains one molecule of ss RNA and one molecule of reverse transcriptase.
9. Drug called 'Heroin' is synthesized by:
(A) methylation of morphine (C) acetylation of morphine
(B) glycosylation of morphine (D) nitration of morphine
10. Statement I: Heroin is commonly called as Smack.
Statement II: Cocaine is commonly called as crack.
11. Antivenom injection contains preformed antibodies while polio drops that are administered into
the body contain
(A) Activated pathogens (B) Harvested antibodies (C) γ globulin (D) Attenuated pathogens
12. Chronic auto immune disorder affecting neuro-muscular junction leading to fatigue, weakening
and paralysis of skeletal muscle is called as:
(A) Arthritis (B) Muscular dystrophy (C) Myasthenia gravis (D) Gout
13. Transplantation of tissues/organs fails often due to non-acceptance by the patient's body.
Which type of immune-response is responsible for such rejections?
(A) Cell - mediated immune response (C) Hormonal immune response
(B) Physiological immune response (D) Autoimmune response
14. Cancerous cells spread through
(A) lymph (C) secondary growth of malignant tumour
(B) blood (D) All of the above
15. Which one of the following is the correct statement regarding the particular psychotropic
drug specified?
(A) Hashish causes alteration in thought, perceptions and hallucinations
(B) Opium stimulates nervous system and causes hallucinations
(C) Morphine leads to delusions and disturbed emotions
(D) Barbiturates causes relaxation and temporary euphoria
16. Which one of the following common sexually transmitted diseases is completely curable when
detected early and treated properly? (NEET 2023)
(A) Gonorrhoea (B) Hepatitis-B (C) HIV Infection (D) Genital herpes
17. Which one of the following techniques does not serve the purpose of early diagnosis of a
disease for its early treatment? (NEET 2023)
(A) Serum and Urine analysis
(B) Polymerase Chain Reaction (PCR) technique
(C) Enzyme Linked Immuno-Sorbent Assay (ELISA) technique
(D) Recombinant DNA Technology
18. Match List I with List II. (NEET 2023)
List I List II
a. Heroin I. Effect on cardiovascular system
b. Marijuana II. Slow down body function
c. Cocaine III. Painkiller
d. Morphine IV. Interfere with transport of dopamine
(A) a-I, b-II, c-III, d-IV (C) a-IV, b-III, c-II, d-I
(B) a-III, b-IV, c-I, d-II (D) a-II, b-I, c-IV, d-III
19. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
(A) B-lymphocytes (B) Basophils (C) Eosinophils (D) TH cells (NEET 2023)
20. Statements I: Autoimmune disorder is a condition where body defense mechanism recognizes
its own cells as foreign bodies. (NEET 2022)
Statements II: Rheumatoid arthritis is a condition where body does not attack self-cells.
*****
2024
Topic: Microbes in human welfare
1. Which of the following is not used as biopesticide?

(A) Bacillus thuringiensis (C) Nuclear Polyhedrosis Virus (NPV)
(B) Xanthomonas campestris (D) Trichoderma harzianum
2. Azolla is used as biofertilizer because it
(A) Has association of mycorrhiza (C) Multiplies at faster rate to produce massive biomass
(B) Has association of nitrogen fixing Rhizobium (D) Has association of nitrogen fixing Cyanobacteria
3. Assertion: Nitrogen fixing bacteria of legume root nodules survive in oxygen depleted cells.
Reason: Leghaemoglobin completely removes oxygen from nodule cells.
(C) If Assertion is true and Reason is false. (D) Both Assertion and Reason are false
4. The domestic sewage in large cities
(A) Has a high BOD as it contains both aerobic & anaerobic bacteria
(B) Is processed by aerobic & then anaerobic bacteria in the secondary treatment in sewage
treatment plants (STPs)
(C) When treated in STPs doesn’t require aeration step as sewage contains adequate oxygen
(D) Has very high amounts of suspended solids & dissolved salts
5. Methanogenic bacteria are not found in
(A) Activated sludge (C) bottom of water logged paddy fields
(B) Rumen of cattle (D) gobar gas plant
6. Which of the following is wrongly matched?
Microbe Product Application
(A) Trichoderma polysporum Cyclosporin A Immunosuppressive drug
(B) Monascus purpureus Statins Lowering of blood cholesterol
(C) Streptococcus Streptokinase Removal of clot from blood vessel
(D) Clostridium butylicum Lipase Removal of oil stains
7. Trichoderma harzianum is useful for
(A) Biological control of soil borne plant pathogens (C) Reclamation of waste lands
(B) Bioremediation (D) Gene transfer
8. Match the following:
Column I Column II options
(a) Lady bird beetle 1 Methano bacterium (A) a – 2, b – 4, c – 3, d – 1
(B) a – 3, b – 4, c – 2, d – 1
(b) Mycorrhiza 2 Trichoderma
(C) a – 4, b – 1, c – 2, d – 3
(c) Biological control 3 Aphids
(D) a – 3, b – 2, c – 1, d – 4
(d) Biogas 4 Glomus
9. Conversion of milk to curd improves its nutritional value by increasing the amount of
(A) Vitamin D (B) Vitamin A (C) Vitamin B12 (D) Vitamin E
10. Roquefort cheese is formed by ripening with the fungi for a particular
(A) Colour (B) Flavour (C) Shape (D) Taste
11. What gases are produced in anaerobic sludge digestors? (AIPMT 2014)
(A) Methane, hydrogen sulphide & carbon dioxide (C) M ethane, hydrogen sulphide & oxygen
(B) Hydrogen sulphide & carbon dioxide (D) Methane & carbon dioxide only
12. In gobar gas, the maximum amount is that of : (AIPMT 2012)
(A) Methane (B) Propane (C) Carbon dioxide (D) Butane
13. The antibiotic Streptomycin is obtained from
(A) Streptomyces griseus (C) Streptococcus pyogenes
(B) Lactobacillus lactis (D) Streptococcus thermophllus
14. The most common fungal partners of mycorrhiza are ______ species.
(A) Azotobacter (B) Glomus (C) Azolla (D) Frankia
15. Biochemical Oxygen Demand (BOD) may not be a good index for pollution for water bodies
receiving effluents from
(A) Petroleum industry (B) Sugar industry (C) Domestic sewage (D) Dairy industry
16. Identify the microorganism which is responsible for the production of an immunosuppressive
molecule cyclosporin A: (NEET 2022)
(A) Streptococcus cerevisiae (B) Trichoderma polysporum (C) Clostridium butylicum (D) Aspergillus niger
17. Which one of the following produces nitrogen fixing nodules on the roots of Alnus? (NEET 2022)
(A) Beijernickia (B) Rhizobium (C) Frankia (D) Rhodospirillum
List I List II
a. Aspergillus niger I. Acetic Acid
b. Acetobacter aceti II. Lactic Acid
c. Clostridium butylicum III. Citric Acid
d. Lactobacillus IV. Butyric Acid
(A) a-I, b-II, c-III, d-IV (C) a-III, b-I, c-IV, d-II
(B) a-III, b-IV, c-I, d-II (D) a-II, b-I, c-IV, d-III
19. Which of the following is put into Anaerobic sludge digester for further sewage treatment?
(A) Floating debris (C) Effluents of primary treatment (NEET 2020)
(B) Activated sludge (D) Primary sludge
20. Pinus seed cannot germinate and establish without fungal association. This is because
(A) its embryo is immature (NEET 2019)
(B) it has very hard seed coat.
(C) it has obligate association with mycorrhizae.
(D) its seeds contain inhibitors that prevent germination
*****
2024
Topic: Biotechnology: Principles & processes

1. In the following palindromic base sequences of DNA, which one can be cut easily by particular
restriction enzyme?
(A) 5' GTATTC 3' ; 3' CATAAG 5' (C) 5' GAATTC 3' ; 5' CTTAAG 3'
(B) 5' GATACT 3' ; 3' CTATGA 5' (D) 5' CTCAGT 3' ; 5' GAGTCA 3'
2. Statement I: Restriction endonucleases recognize specific sequence to cut DNA known as
palindromic nucleotide sequence.
Statement II: Restriction endonucleases cut the DNA strand a little away from the centre of the
palindromic site.
3. In gel electrophoresis, the separated bands of DNA are cut out and extracted from the gel piece.
This step is called.
(A) Elution (B) Competency (C) Origin of replication (D) Transformation
4. The first restriction endonuclease to be discovered was
(A) EcoRI (B) BamHI (C) Hind II (D) Hind I
5. The first recombinant DNA was constructed by
(A) Arber, Nathans & Smith (B) Stanley Cohen & Herbert Boyer (C) Karl Ereky (D) Paul Berg
6. Polymerase chain reaction requires
(A) DNA template (B) primers (C) Taq DNA polymerase (D) All of these
7. Taq DNA polymerase is used in PCR because
(A) It is obtained from thermostable virus (C) It becomes inactive at high temperature
(B) It remains active at high temperature (D) all of these
8. Statement A: DNA fragments generated by the restriction endonucleases can be separated by
agarose gel electrophoresis
Statement B: Transfer of DNA from gel to nitrocellulose membrane is called western blotting.
9. In gel electrophoresis, the differential mobility of DNA depends on
(A) helical nature of DNA (C) double stranded nature of DNA
(B) charge and size of DNA (D) hydrogen bonding between bases
10. Statement A: RENs are synthesized by bacteria as part of their defence mechanism.
Statement B: An enzyme that joins the ends of two strands of nucleic acid is called ligase.
11. While isolating DNA from bacteria, which of the following enzymes is not used?
(A) Lysozyme (B) Ribonuclease (C) Deoxyribonuclease (D) Protease
12. The process of separation and purification of expressed protein before marketing is called :
(A) Postproduction processing (B) Upstream processing
(C) Downstream processing (D) Bioprocessing
13. In the vector pBR322 there is
(A) One selectable marker (C) Two selectable markers
(B) Three selectable markers (D) None of these
14. Primers are
(A) small chemically synthesised oligonucleotides of about 10-18 nucleotides that are complementary
to the region of template DNA
(B) chemically synthesised oligonucleotides of about 10-18 nucleotides that are not complementary
to the region of template DNA
(C) the double-stranded DNA that need to be amplified
(D) specific sequences present on recombinant DNA
15. Consider the following statement about PCR.
I. Polymerase Chain Reaction (PCR) is a technique of synthesising multiple copies of the desired
gene in vitro.
II. This technique was developed by Kary Mullis.
III. A single PCR amplification cycle involves three basic steps; denaturation, annealing and
extension.
Which of the statement given above are correct?
(A) I and II (B) I and III (C) II and III (D) I, II and III
16. In gene gun method used to introduce alien DNA into host cells, microparticles of _______
metal are used. (NEET 2023)
(A) Zinc (B) Tungsten or gold (C) Silver (D) Copper
17. During the purification process for recombinant DNA technology, addition of chilled ethanol
precipitates out (NEET 2023)
(A) DNA (B) Histones (C) Polysaccharides (D) RNA
18. Upon exposure to UV radiation, DNA stained with ethidium bromide will show (NEET 2023)
(A) Bright blue colour (C) Bright yellow colour
(B) Bright orange colour (D) Bright red colour
19. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a
correct sequence. (NEET 2023)
a. Insertion of recombinant DNA into the host cell.
b. Cutting of DNA at specific location by restriction enzyme.
c. Isolation of desired DNA fragment.
d. Amplification of gene of interest using PCR.
(A) c, a, b, d (B) c, b, d, a (C) b, d, a, c (D) b, c, d, a
20. Which of the following is not a cloning vector? (NEET 2023)
(A) YAC (B) pBR322 (C) Probe (D) BAC
*****
2024
Topic: Biotechnology & its applications

1. Which of the following genes were introduced in cotton to protect it from cotton bollworms?
(A) cry Ac & cry Ab (B) cry I Ac& cry II Ab (C) cry I Ab & cry II Ab (D) Bt Ac & Bt Ab
2. cryIAb and cryIIAb produces toxins that controls __________ & __________ respectively.
(A) cotton bollworm & corn borer (C) cotton bollworm & tobacco budworm
(B) corn borer & cotton bollworm (D) tobacco budworm & cotton bollworm
3. What triggers activation of protoxin to active Bt toxin of Bacillus thuringiensis in boll worm?
(A) Body temperature (B) Alkaline pH of gut
(C) Moist surface of midgut (D) Acidic pH of stomach
4. Golden rice
I. It is a transgenic variety of rice.
II. It contains a goods quality of ß-carotene.
III. ß-carotene is a principal source of vitamin-A.
IV. The grains of the rice are yellow in colour due to ß-carotene. The rice is commonly called golden
rice.
Which of the above statements are correct?
(A) I, II & III (B) II, III & IV (C) I, III & IV (D) I, II, III & IV
5. Statement I: 95 per cent of all existing transgenic animals are mice.
Statement II: Transgenic mice are being used to test the safety of the polio vaccine.
6. Which gene was introduced in the first transgenic cow?
(A) α -1-antitrypsin (B) Human α lactalbumin (C) Human β lactalbumin (D) cry I Ac
7. Which of the following statements are true about PCR?
(A) It is used to detect HIV in suspected AIDS patients.
(B) It is being used to detect mutations in genes in suspected cancer patients.
(C) It is used to identify many genetic disorders.
(D) All of these
8. α -1-antitrypsin is
(A) an enzyme (B) used to treat arthritis (C) used in treatment of emphysema (D) All of these
9. Kohler and Milstein developed biotechnology for the production of
(A) Myelomas (B) Monoclonal antibodies (C) Steroid conversion (D) Immobilised enzymes
10. The plasmid generally used for the production of recombinant insulin is
(A) RK 646 (B) Ti plasmid (C) ACY 17 (D) pUC 18
11. During recombinant insulin synthesis, the bond between insulin polypeptide and galactosidase
can be removed by using
(A) cyanogen bromide (B) chymotrypsin (C) carboxypeptidase (D) amylase
12. A ‘new variety of rice was patented by a foreign company though such varieties have been
present in India for a long time. This is related to
(A) Co-667 (B) Sharbati Sonora (C) Lerma Rojo (D) Basmati
13. Use of bioresources by multinational companies and organisations without authorisation from
the concerned country and its people is called
(A) Bio-infringement (B) Biopiracy (C) Biodegradation (D) Bioexploitation
14. In RNAi, the genes are silenced using
(A) ssRNA (B) ds RNA (C) ss DNA (D) ds DNA
15. The process of RNA interference has been used in the development of plant resistant to:
(A) Nematodes (B) Fungi (C) Viruses (D) Insects
16. Statements related to human Insulin are given below. Which statement(s)/are correct about
genetically engineered Insulin? (NEET 2022)
(a) Pro-hormone insulin contain extra stretch of C-peptide
(b) A- peptide and B-peptide chains of insulin were produced separately in E.coli, extracted and
combined by creating disulphide bond between them.
(c) Insulin used for treating Diabetes was extracted from Cattles and Pigs.
(d) Prohormone Insulin needs to be processed for converting into a mature & functional hormone.
(e) Some patients develop allergic reactions to the foreign insulin.
Choose the most appropriate answer from the options given below.
(A) (c), (d) and (e) only (B) (a), (b) and (d) only (C) (b) only (D) (c) and (d) only
17. In gene therapy of Adenosine Deaminase (ADA) deficiency, the patient requires periodic
infusion of genetically engineered lymphocytes because: (NEET 2022)
(A) Genetically engineered lymphocytes are not immortal cells
(B) Retroviral vector is introduced into these lymphocytes.
(C) Gene isolated from marrow cells producing ADA is introduced into cells at embryonic stages
(D) Lymphocytes from patient’s blood are grown in culture, outside the body.
18. When gene targetting involving gene amplification is attempted in an individual's tissue to treat
disease, it is known as : (NEET 2021)
(A) Biopiracy (B) Gene therapy (C) Molecular diagnosis (D) Safety testing
19. For effective treatment of the disease, early diagnosis and understanding its pathophysiology is
very important. Which of the following molecular diagnostic techniques is very useful for early
detection? (NEET 2021)
(A) Western Blotting (B) Southern Blotting (C) ELISA (D) Hybridization Technique
20. Bt cotton variety that was developed by the introduction of toxin gene of Bacillus thuringiensis
(Bt) is resistant to: (NEET 2020)
(A) Fungal diseases (B) Plant nematodes (C) Insect predators (D) Insect pests
*****
2024
Topics: Ecology: Organisms & populations, Ecosystem, Biodiversity & conservation
1. Who has proposed the term Ecosystem?

(A) Calvin (B) Odum (C) Tansley (D) Gardner
2. The formula for exponential growth is
(A) dt/dN (B) dN/rN = dt (C) rN/dN = dt (D) dN/dt = rN.
3. Female mosquitoes sucking human blood at intervals are
(A) Permanent parasites (B) Endoparasites (C) Hemiparasites (D) Intermittent parasites
4. Which of the following equations is correct for Verhulst-Pearl logistic growth?
𝑑𝑁 𝑑𝑁 𝑟−𝑁 𝑑𝑁 𝐾−𝑁
(A) = 𝑟𝑁 (B) = 𝐾𝑁 ( ) (C) = 𝑟𝑁 ( ) (D) None of these
𝑑𝑇 𝑑𝑇 𝑟 𝑑𝑇 𝐾
5. A logistic growth curve depicting a population that is limited by a definite carrying capacity is
shaped like the letter
(A) L (B) J (C) S (D) M
rt
6. In the exponential growth equation Nt = N0e , e represents (NEET 2021)
(A) The base of number logarithms
(B) The base of exponential logarithms
(C) The base of natural logarithms
(D) The base of geometric logarithms
7. Interaction of population with the environment is known as
(A) Ecosystem (B) Autecology (C) Synecology (D) Community
8. Assertion: Removal of keystone species cause serious disruption in functioning of community.
Reason: Keystone species are low in abundance (or biomass) than the dominant species.
(D) Both Assertion and Reason are false
9. Alexander Von Humbolt described for the first time
(A) Laws of limiting factor (C) Species area relationships
(B) Population Growth equation (D) Ecological Biodiversity
10. Which one of the following is related to Ex-situ conservation of threatened animals and plants?
(A) Biodiversity hot spots (B) Himalayan region (C) Amazon rainforest (D) Wildlife safari parks
11. Detritivores breakdown detritus into smaller particles. This process is called:
(A) Decomposition (B) Catabolism (C) Fragmentation (D) Humification
12. In-situ conservation refers to:
(A) Conserve only extinct species (C) Conserve only high risk species
(B) Protect and conserve the whole ecosystem (D) Conserve only endangered species
13. The sacred groves in India are related with
(A) cultural tradition
(B) the place where threatened species are protected
(C) the place where only artificial animal breeding is allowed
(D) forest patches around the places of worship
14. Rivet popper hypothesis explains the importance of
(A) species in an ecosystem (B) population (C) genetic variability (D) none of these
15. In grass-deer-tiger food chain, grass biomass is one tonne. The tiger biomass shall be
(A) 100 kgs (B) 10 kgs (C) 200 kgs (D) 1 kg.
16. Match the following: (NEET 2023)

Column I (Interaction) Column II(Species A and B)
a) Mutualism i. +(A), O(B)
b) Commensalism ii. –(A), O(B)
c) Amensalism iii. +(A), –(B)
d) Parasitism iv. +(A), +(B)
(A) a-iv, b-i, c-iv, d-ii (B) a-i, b-iv, c-ii, d-iii (C) a-iv, b-ii, c-i, d-iii (D) a-iv, b-i, c-ii, d-iii
17. Identify the correct statements : (NEET 2023)
a. Detrivores perform fragmentation.
b. The humus is further degraded by some microbes during mineralization.
c. Water soluble inorganic nutrients go down into the soil and get precipitated by a process
called leaching.
d. The detritus food chain begins with living organisms.
e. Earthworms break down detritus into smaller particles by a process called catabolism.
Choose the correct answer from the option given below :
(A) b, c, d only (B) c, d, e only (C) d, e, a only (D) a, b, c only
18. Among ‘The Evil Quartet’, which one is considered the most important cause driving extinction
of species? (NEET 2023)
(A) Over exploitation for economic gain (C) Co-extinctions
(B) Alien species invasions (D) Habitat loss and fragmentation
19. In the equation “GPP – R = NPP” (NEET 2023)
GPP is Gross Primary Productivity , NPP is Net Primary Productivity
R here is ____.
(A) Respiratory quotient (C) Reproductive allocation
(B) Respiratory loss (D) Photosynthetically active radiation
20. Which of the following statements is correct? (NEET 2023)
(A) Biomagnification refers to increase in concentration of the toxicant at successive trophic
levels.
(B) Presence of large amount of nutrients in water restricts 'Algal Bloom'
(C) Algal Bloom decreases fish mortality
(D) Eutrophication refers to increase in domestic sewage and waste water in lakes.
****

Crash Course 2024 Maths &amp; Bio

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Crash Course 2024 Maths &amp; Bio

Uploaded by

Copyright:

Available Formats

KCET / NEET crash course

Topic: Diversity in living organisms

Latest NEET questions

Topic: Cell structure & Cell division

Latest NEET questions

Topic: Biomolecules & Structural organization in animals

Latest NEET questions

Topics: Morphology of flowering plants & Anatomy of flowering plants

Latest NEET questions

21. Axile placentation is observed in (NEET 2023)

Topic: Respiration in plants & Photosynthesis

Latest NEET questions

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

Latest NEET questions

21. Match List - I with List - II. (NEET 2023)

Topic: Sexual reproduction in flowering plants

Latest NEET questions

Topic: Human reproduction & reproductive health

Latest NEET questions

Topic: Principles of inheritance & variations

Latest NEET questions

Topic: Molecular basis of inheritance

Latest NEET questions

Latest NEET questions

Topic: Human health & diseases

Latest NEET questions

Topic: Microbes in human welfare

1. Which of the following is not used as biopesticide?

Latest NEET questions

Topic: Biotechnology: Principles & processes

Latest NEET questions

Topic: Biotechnology & its applications

Latest NEET questions

Topics: Ecology: Organisms & populations, Ecosystem, Biodiversity & conservation

1. Who has proposed the term Ecosystem?

Latest NEET questions

16. Match the following: (NEET 2023)

You might also like

Crash Course 2024 Maths & Bio

Crash Course 2024 Maths & Bio