Biomedicine & Pharmacotherapy 134 (2021) 111140

Contents lists available at ScienceDirect

Biomedicine & Pharmacotherapy

journal homepage: www.elsevier.com/locate/biopha

Oncopreventive effects of theanine and theobromine on

dimethylhydrazine-induced colon cancer model
Sara Shojaei-Zarghani a, b, Ahmad Yari Khosroushahi c, d, *, Maryam Rafraf b, **
a
Student Research Committee, Faculty of Nutrition and Food Science, Tabriz University of Medical Sciences, Tabriz, Iran
b
Nutrition Research Center, Department of Community Nutrition, Faculty of Nutrition and Food Science, Tabriz University of Medical Sciences, Tabriz, Iran
c
Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran
d
Department of Medical Nanotechnology, Faculty of Advanced Medical Sciences, Tabriz University of Medical Sciences, Tabriz, Iran

A R T I C L E I N F O A B S T R A C T

Keywords: Theanine and theobromine are abundantly present in tea and cocoa, respectively. This study was performed to
Colon cancer assess the chemopreventive effects of these phytochemicals, alone or together, on dimethylhydrazine (DMH)-
Theanine induced colon cancer. Thirty male Wistar rats were divided into five groups and subcutaneously injected with
Theobromine
saline (negative control group) or 30 mg/kg DMH (the other groups) two times/week for 12 weeks. The negative
Akt
mTOR
and positive control animals were orally treated with drinking water, and the other groups were gavaged with
JAK2 theanine (400 mg/kg), theobromine (100 mg/kg), or their mixture for two weeks before and throughout the
STAT3 injection period. At the end of the study, the morphological and histopathological features, Ki-67 proliferation
marker, and the expression of Akt/mTOR, JAK2/STAT3, MAPK/ERK, and TGF-β/Smad pathways were investi­
gated. Theanine and theobromine, alone or together, reduced the number of cancerous and precancerous lesions,
the volume of tumors, the Ki-67 immunostaining, and the expression of Akt/mTOR and JAK2/STAT3 oncogenic
pathways. The simultaneous treatment was more effective in the down-regulation of Akt and mTOR compared to
either theanine or theobromine alone. Theobromine administration also caused more inhibitory effects on the Ki-
67 and Akt/mTOR expression than theanine. Besides, all dietary interventions increased the mRNA and protein
expression of Smad2. In conclusion, theanine and theobromine, alone and in combination, inhibited tumori­
genesis through down-regulation of the Akt/mTOR and JAK2/STAT3 pathways and an increment of the Smad2
tumor suppressor. The inhibition of the Akt/mTOR pathway was more pronounced by simultaneous treatment.

1. Introduction
Colon cancer, which arises from the inner wall of the large intestine,
has led to 551 269 deaths in 2018 and was considered the fourth most
common cancer worldwide [1,2]. The accumulation of multiple risk
factors such as genetic, epigenetic, environmental, lifestyle, and dietary
habits causes an imbalance between proto-oncogenes and tumor sup­
pressor genes, and subsequently, colon cancer development [1,3].
Despite recent advances in therapeutic strategies, prevention is still the
first line of defense against cancer. It is estimated that up to 90 % of
colorectal cancer can be prevented by modifying the diet and lifestyle
habits [4]. Therefore, the identification of natural agents for colon
cancer prevention is an attractive target in scientific investigations.
L-theanine (γ-glutamilethylamid) is a non-protein derivative amino
acid special to tea and a non-edible mushroom (Xerocomus badius) [5].
Currently, there is considerable interest in several health benefits of this
phytochemical on obesity, diabetes, cardiovascular diseases, learning,
cognitive performance, relaxing, sleep quality, emotional status, and
immune function [5,6]. Besides, recent studies have demonstrated the
anticancer effects of theanine on lung [7,8], breast [9], prostate [9],
cervical [10], ovarian [11], hepatocellular [12], neuroblastoma [13],
and colon [9] cancer cells. Theanine also suppressed the

Abbreviations: ACF, aberrant crypt foci; Akt, protein kinase B; ANOVA, one-way analysis of variance; DMH, dimethylhydrazine; ERK, extracellular signal-
regulated kinases; H&E, hematoxylin and eosin; IHC, immunohistochemical; JAK, Janus kinase; MAPK, mitogen-activated protein kinase; mTOR, mammalian
target of rapamycin; PCR, polymerase chain reaction; SD, standard deviation; Smad, small mothers against decapentaplegic; STAT, signal transducer and activator of
transcription; TB, theobromine; TE, theanine; TGF-β, transforming growth factor β.
* Corresponding author at: Faculty of Advanced Medical Science, Tabriz University of Medical Sciences, Tabriz, Iran.
** Corresponding author.
E-mail addresses: yarikhosroushahia@tbzmed.ac.ir (A. Yari Khosroushahi), rafrafm@tbzmed.ac.ir (M. Rafraf).

https://doi.org/10.1016/j.biopha.2020.111140
Received 14 September 2020; Received in revised form 23 November 2020; Accepted 10 December 2020
Available online 24 December 2020
0753-3322/© 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
S. Shojaei-Zarghani et al.
survival-promoting pathways of protein kinase B (Akt)/nuclear
factor-κB, in the lung and hepatocellular carcinoma [8,12], and Janus
kinase (JAK)/signal transducer and activator of transcription (STAT)
signaling pathway, in the vascular smooth muscle cells [14]. However, it
is unclear whether such effects can be generalized to colon cancer,
especially in the in-vivo condition.
It is stated that modulation of a particular pathway to inhibit cancer
development may activate other signaling pathways through in­
teractions, and therefore, resume the growth and proliferation of cancer
cells. Thus, targeting multiple oncogenic pathways simultaneously by a
combination of agents sounds to be the most promising avenue to pre­
vent or manage cancer [15–17].
Theobromine belongs to the methylxanthines family and is mainly
present in cocoa and chocolate [18]. This phytochemical can enhance
the sensitivity of colon cancer cells to chemotherapeutic drugs [19],
induce apoptosis, and inhibit DNA synthesis and proliferation [19,20].
Theobromine also triggered pro-apoptotic pathways and inhibited
Akt/mammalian target of rapamycin (mTOR) and extracellular
signal-regulated kinases (ERK), as proliferative and anti-apoptotic
pathways, in glioblastoma cells [21]. Moreover, evidence suggesting
the synergistic effect of theanine with caffeine (another methylxanthine)
[22] raises the hypothesis of an interaction between theanine with
theobromine. However, to the best of our knowledge, no study has
revealed the effects of theanine alone or along with theobromine on the
prevention of colon cancer in-vivo. Therefore, the present study was
aimed to investigate the chemopreventive effect of theanine and theo­
bromine, alone or together, on 1,2-dimethylhydrazine (DMH)-induced
colon cancer in male Wistar rats with focusing on their impacts on
Akt/mTOR, JAK2/STAT3, and transforming growth factor β
(TGF-β)/small mothers against decapentaplegic (Smad) signaling
pathways.
2. Materials and methods
2.1. Chemicals
Theanine and theobromine were purchased from BulkSupplements
(BulkSupplements, Henderson, Nevada, USA) with 95 % purity, and
DMH was from Sigma-Aldrich (St. Louis, Missouri, USA). Trisol reagent
was also acquired from GeneAll (GeneAll Biotechnology, South Korea).
PrimeScript cDNA synthesis kit and SYBR Green polymerase chain re­
action (PCR) master mix were obtained from Takara (Takara Bio Inc.,
Otsu, Japan). The chemiluminescence detection kit was purchased from
BioRad (Bio-Rad Laboratories, Hercules, CA, USA), and HRP/3,3′ -Dia­
minobenzidine (DAB) detection immunohistochemistry kit was from
Abcam (Abcam Inc., Cambridge, MA, USA). The antibodies were
sourced from Santa Cruz Biotechnology (Santa Cruz Biotechnology,
Dallas, TX, USA). All other used reagents were of analytical grade from
Sigma-Aldrich (St. Louis, Missouri, USA) and Merck (Merck, Darmstadt,
Germany).
2.2. Experimental animals and ethical clearance
Thirty 8-weeks-old male Wistar rats with an initial body weight of
165.76 ± 10.37 g were purchased from the Faculty of Veterinary Med­
icine, University of Tabriz, Iran. Rats were housed two per cage at a
standard laboratory condition (temperature 23 ± 2 ◦ C and 12-h light-
dark cycle) and were acclimatized for one week before starting the
experimental study. They had free access to a standard pellet diet and
drinking water, and their food and water intakes were assessed daily
during the treatment period. The body weights of rats were also
measured once a week until the end of the study. All experimental
protocols were conducted according to the principles of the National
Institutes of Health Guide for the Care and Use of Laboratory Animals
[23] and were approved by the Ethics Committee of Tabriz University of
Medical Sciences (IR.TBZMED.VCR.REC.1398.018).
2
Biomedicine & Pharmacotherapy 134 (2021) 111140
2.3. Experimental design
After acclimation, animals were randomly divided into five groups
(negative control, DMH-treated as a positive control, DMH plus theo­
bromine, theanine, or a combination of theobromine and theanine) with
six rats in each group. The rats of the control groups were treated by
daily gavage of drinking water, while others were gavaged with 100 mg/
kg theobromine (TB), 400 mg/kg theanine (TE), or a combination of
both (TB + TE) for two weeks. The doses were selected with consider­
ation of previous studies [24–26]. After that, animals of the negative
control group were subcutaneously injected with normal saline, and the
others were treated with 30 mg/kg DMH, two times a week for 12 weeks
[27–29]. The daily gavage was continued during this period, according
to the prior administrations (Fig. 1). At the end of the 14th week, rats
were food-deprived for 18 h and anesthetized with inhalation of sevo­
flurane combined with an intramuscular injection of ketamine.
2.4. Macroscopic evaluation and sample collection
After complete anesthetization of animals, colons were dissected,
opened longitudinally, washed with normal saline, and their morpho­
logical features were assessed. Tumor incidence was defined as the
percentage of animals with visible tumors in each group. Following
measurements of the length (l), width (w), and height (h) of each tumor
using a digital caliper, tumor volume was calculated (l × w × h × π/6)
[30]. Then, half of each colon was flattened and fixed in 10 % formalin
for assessment of aberrant crypt foci (ACF). The other half of the tissue
was either kept in formalin for histopathological and immunohisto­
chemical (IHC) examinations or placed at − 80 ◦ C for mRNA and protein
expression analysis. All laboratory measurements were performed by
individuals blinded to the treatment groups.
2.5. Analysis of ACF
ACF are preneoplastic lesions in the colonic mucosa of either human
or animal models of colon cancer [31]. In the current study, ACF were
identified and quantified according to the method of Bird [32]. The
segments of the fixed flatten colons were stained with 0.2 % methylene
blue solution for 4 min and then rinsed with distilled water. The stained
sections were assessed using a stereomicroscope (Olympus SZ40,
Olympus Optical, Tokyo, Japan) to count the total number of ACFs per
colon and also the aberrant crypts per focus in all experimental groups.
Fig. 1. A: Experimental design.
S. Shojaei-Zarghani et al. Biomedicine & Pharmacotherapy 134 (2021) 111140

2.6. Histopathological analysis Table 1

Sequence of the primers for Real-time quantitative reverse transcriptase PCR.
The formalin-fixed tissue specimens were embedded in paraffin, Product size (bp) Primer sequence Gene
sectioned with a microtome, and stained with hematoxylin and eosin
Forward: GCCACGGATACCATGAACGAC
(H&E). Stained sections were assessed by a blinded pathologist and 86
Reverse: CGTGGCCGCCAGGTTTTAATA
Akt
photographed under a Lambomed light microscope (Labomed Inc., Forward: GGGAAGGCCGATGTTCTGAAA
90 JAK2
Culver City, CA, USA) equipped with a digital camera (LaboAmerica, Reverse: TGTGCAGGAGATGTGGAGGTT
Fremont, CA, USA) at 100× magnification. Forward: TCAGGGCAAGATGCTTGGGAC
86 mTOR
Reverse: CGAACTGCTGCAGAACGCTCA
Forward: GCCCACTGAATGGCTTCACAA
2.7. IHC analysis 97 S6K
Reverse: GCTTAAGCTCAATGCGTCTGC
Forward: TACCTTTCCTTGGGAGACCCC
175 TGF-β
Formalin-fixed and paraffin-embedded colon tissue sections were de- Reverse: CCCTCTGTCTCTCGCTGGAAT
Forward: TAAAGCTACACCCGACTTGCC
paraffinized, rehydrated, and heated in citrate buffer for antigen 218 TGFβRII
Reverse: CAGAACGGTGAAGCTCTCCAT
retrieval. The slides were blocked with 1 % bovine serum albumin (BSA) Forward: ACCTTAATGTGTCCAGTGGGT
110 Smad2
in tris buffered saline (TBS) for 2 h at room temperature to avoid non- Reverse: ACAGAAATGGCACAAAGAGC
specific binding. After that, the sections were incubated with 3 % 129
Forward: TTGGCCATTGGTTTTCACTGC
Smad4
hydrogen peroxide to inhibit the endogenous peroxidase activity, fol­ Reverse: GCGTCATTGCTTGTCGGTGTA
Forward: GTTTCCGGAGCTGCAGTTTAG
lowed by incubation with Ki-67 primary antibody at 4 ◦ C overnight. 100
Reverse: GCGGGATTGTACCTCAGCGAT
STAT3
Then, goat biotinylated polyvalent secondary antibody was added to the Forward: GCACCACACCTTCTACAATG
187
sections, and after 10 min incubation, they were incubated again with
β-actin
Reverse: TGCTTGCTGATCCACATCTG
streptavidin-biotin-horseradish peroxidase complex. Appropriate Akt: protein kinase B, bp: base pair, JAK2: janus kinase 2, mTOR: mammalian
washing with TBS plus 0.03 % Triton X-100 was performed between the target of rapamycin, PCR: qualitative real-time polymerase chain reaction,
incubations. The slides were developed with DAB solution in a dark STAT3: signal transducer and activator of transcription 3, S6K: ribosomal pro­
room for 10 min and counterstained with hematoxylin, followed by tein S6 kinase, Smad: small mothers against decapentaplegic, TGF-β: trans­
dehydration and mounting with DPX. Finally, the slides were visualized forming growth factor-beta, TGFβR: TGF-β receptor.
and imaged with a Lambomed light microscope (Labomed Inc., Culver
City, CA, USA) equipped with a digital camera (LaboAmerica, Fremont, saline (TBS) containing 2 % nonfat milk followed by incubation with
CA, USA) at 100× magnification. Semi-quantitative analysis was done the primary antibodies of Akt, p-Akt, mTOR, p-mTOR, ribosomal protein
by calculating the average pixel intensity of 10 different and randomly S6 kinase beta (S6K), p-S6K, JAK2, p-JAK2, STAT3, p-STAT3, TGF-β,
selected fields per slide using Image J Fiji software, as described by Smad2, p-Smad2, and β-actin (as a reference standard) at 4 ◦ C for 18 h.
Crowe and Yue [33]. Sequentially, the unconnected primary antibodies were washed with
TBS containing 0.5 % Tween-20 (TBST) and incubated with anti-rabbit
2.8. Real-time quantitative reverse transcriptase PCR secondary antibodies (1:1000) at room temperature. The bound anti­
bodies were visualized using a chemiluminescence kit and were quan­
Real-time quantitative reverse transcriptase PCR was performed tified by densitometric analysis using Image J Fiji software.
using an Applied Biosystems instrument (Applied Biosystems, Life
Technologies Corp., CA, USA) to measure the relative mRNA expression
2.10. Statistical analysis
levels of target genes in the colon tissue segments. Total RNA was iso­
lated from 100 mg of each colon tissue segment using Trizol reagent,
Data were analyzed using the SPSS statistics software ver. 19.0. The
followed by assessing its quality and quantity by agarose gel (1 %)
tumor incidence was evaluated by the fisher’s exact test. The normality
electrophoresis and Nanodrop spectrophotometer (Thermo Scientific,
of the other data was assessed using the Kolmogorov-Smirnov test. Then,
Rockford, IL, USA), respectively. For the generation of first-strand
data were analyzed by one-way analysis of variance (ANOVA) and
complementary DNA (cDNA), 1 μg of the isolated RNA was used ac­
Tukey post hoc test to compare different groups. The tumor incidence is
cording to the manufacturer’s instructions of the PrimeScript cDNA
presented as a percentage, and the other data are expressed as mean ±
synthesis kit. The synthesized cDNAs were subjected to real-time PCR
standard deviation (SD). The results were considered statistically sig­
using primers listed in Table 1. The reaction mixture (10 μl) was pre­
nificant at “p-value” < 0.05.
pared using cDNA (1 μg/μl), forward and reverse primers (4 pM, 0.3 μL),
SYBR Green PCR master mix Taq polymerase (5 μl), and DEPC-treated
Water (3.7 μl). The amplification was carried out with an initial dena­ 3. Results
turation step at 94 ◦ C for 3 min, followed by 45 repeated thermal cycles
(94 ◦ C for 10 s, 59 ◦ C for 30 s, 72 ◦ C for 20 s). The expression of each 3.1. Body weight
target gene was normalized using β-actin, as a reference gene, and the
relative levels of genes were quantified by measuring the 2− ΔΔCt method The initial body weight was similar in all groups of rats (p-value =
[34]. 0.85). At the end of the experimental duration, the final body weight (p-
value < 0.001) and weight gain (p-value = 0.001) were significantly
lower in the DMH-treated control than the negative control group. Other
2.9. Western blotting
interventions caused no significant change in the final body weight and
weight gain compared to the DMH-treated control and negative control
The colon segments were homogenized in 1 mL lysis buffer (con­
groups (Table 2).
taining 10 mM EDTA, 10 mM Tris-HCL (PH = 8), 150 mM NaCl, 0.5 %
sodium deoxycholate, 0.2 % SDS, 0.01 % protease inhibitor cocktail, and
0.15 % Triton X-100). The lysates were centrifuged at 12,000 rpm for 10 3.2. Colonic tumors and ACF
min at 4 ◦ C, and the total protein concentration of each supernatant
sample was measured using the Bradford protein assay. Then, the There was no tumor or ACF in the colon tissue of the negative control
cleared lysates were electrophoresed on SDS-page, and separated pro­ group (Figs. 2& 3 A). As expected, DMH led to the colonic tumor and
teins were immediately transferred to a polyvinylidene fluoride (PVDF) ACF formation in all rats of the positive control group. However, the
membrane. After that, the membranes were blocked by tris-buffered administration of TE, TB, and TE + TB significantly and similarly

3
S. Shojaei-Zarghani et al. Biomedicine & Pharmacotherapy 134 (2021) 111140

Table 2 abnormality in the colonic tissue of the negative control rats. However,
Body weight of rats. DMH administration resulted in the development of moderate hyper­
Groups Initial Body Weight Final Body Weight Weight gain plasia, marked goblet cell loss, tubular adenoma, and also disruption
(g) (g) (g) and dilatation of crypts in the DMH-treated control group. The admin­
Negative control 11.21a±186.5 9.74a±273.25 14.17a±86.75 istration of TB, either alone or along with TE, largely prevented the
DMH-treated 9.02a±180.17 15.56b±218.8 16.34b±40.2 DMH-induced colonic changes. The TE treatment had only a moderate
control protective effect on the hyperplasia, adenoma formation, and loss of
DMH + TE 12.19a±180.17 22.06a,b±234 17.93a, goblet cells.
b
Ki-67 is a nuclear non-histone protein and a cell proliferation
±53.83
DMH + TB 7.19a±183.17 20.85a,b±221.2 18.29a,b±39.2
DMH + TB + TE 14.81a±180.5 16.28a,b±232.33 17.87a, marker, which its overexpression is linked to poor prognosis in colo­
b
±51.83 rectal cancer [35]. In the current study, the immunostaining revealed
DMH: Dimethylhydrazine, TB: 100 mg/kg Theobromine, TE: 400 mg/kg the­
more Ki-67 expression in the colonic tissue of the DMH-treated control
anine. Data are expressed as mean ± SD and were analyzed using one way compared to the negative control rats (p-value < 0.001) (Fig. 4). The
ANOVA and Turkey’s post-test. Different letters show statistically significant administration of TE (p-value = 0.005), TB (p-value < 0.001), and TE +
differences. TB (p-value < 0.001) significantly attenuated the Ki-67 immunopositive
staining (as indicated by brown color). Besides, the expression of Ki-67
was significantly more reduced by TB and TE + TB compared to the TE
treatment.

3.4. Akt/mTOR signaling pathway

DMH increased the mRNA expression of Akt (~ 4.42 fold, p-value <
0.001) and mTOR (~ 1.24 fold, p-value = 0.005), and also their
downstream effector, S6K (~ 1.9 fold, p-value < 0.029), in the positive
compared to the negative control group (Fig. 5A). Moreover, the phos­
phorylation states of Akt (p-value < 0.001), mTOR (p-value < 0.001),
and S6K (p-value < 0.001) were significantly augmented in this group
(Fig. 6). The administration of TE, TB, and TE + TB significantly down-
regulated the mRNA and protein expression levels of these oncogenic
markers compared to the DMH-treated control rats. Notably, the co-
administration of TE and TB resulted in the lowest mRNA expression
levels and phosphorylation states of Akt and mTOR than the other
groups. Besides, TB significantly down-regulated the mRNA expression
levels of Akt (p-value = 0.003) as well as the ratios of p-Akt/Akt (p-value
= 0.013) and p-mTOR/mTOR (p-value < 0.001), compared to the TE
treatment. The p-S6K/S6K ratio was also significantly lower in the TE +
TB compared to the TE group (p-value = 0.049).
Fig. 2. Representative pictures of colon tumors in the different groups.

3.5. JAK2/STAT3 and mitogen-activated protein kinase (MAPK)/ERK

reduced the total number and volume of tumors, the number of large
tumors as well as the number of ACF and AC per focus compared to the
DMH-treated control group (Table 3).
3.3. Histopathological and IHC analysis
According to Fig. 3B, histologic examination revealed no
signaling pathways
The animals of the DMH-treated control group exhibited the incre­
ment of the mRNA expression of JAK2 (p-value < 0.001), STAT3 (p-
value = 0.003), and ERK1/2 (p-value = 0.001) as well as the phos­
phorylation states of JAK2 (p-value = 0.008) and STAT3 (p-value =
0.01) compared to the negative control (Figs. 5B & 6). While, TE, TB,

Fig. 3. Morphological appearance of aberrant crypt foci in rats of the different groups (black arrows) (A); Histopathology of colonic mucosa by H&E staining (B). The
images indicate normal histopathological features in the negative control group; tubular adenoma (black arrows), epithelial dysplasia, and loss of goblet cells in the
DMH-treated control group, the reduction in the DMH-induced histopathological changes in the DMH + TE, and especially, in the DMH + TB and DMH + TE + TB
groups; DMH: dimethylhydrazine, TB: 100 mg/kg Theobromine, TE: 400 mg/kg theanine.

4
S. Shojaei-Zarghani et al. Biomedicine & Pharmacotherapy 134 (2021) 111140

Table 3
Colonic tumors and ACF in rats.
Tumor volume distribution
Tumor incidence Number of tumors (n/ (n/rat) Total tumor volume Number of ACFs/ Number of ACs/
Groups
(%) rat) (mm3) rat ACF
3 3
<16mm >16mm

Negative control 0 – – – – – –
DMH-treated 100 4.17±1.17a 1.2±0.84a 3±0.71a 39.91±20.42a 64.5±4.3a 4.24±0.79a
control
DMH + TE 50 1.17±1.33b 0.83±0.98a 0.33±0.52b 13.79±6.96b 39.33±3.05b 2.62±0.21b
DMH + TB 50 0.83±0.98b 0.83±0.98a 0.0±0.0b 11.1±3.61b 35.67±8.14b 2.56±0.66b
DMH + TB + TE 33.3 0.5±0.84b 0.5±0.84a 0.0±0.0b 3.53b±9.83 31.8±13.16b 1.52±0.47b

ACF: aberrant crypt foci, DMH: Dimethylhydrazine, TB: 100 mg/kg Theobromine, TE: 400 mg/kg theanine. Tumor incidence is presented as a percentage of animals
having tumors and was statistically analyzed by exact Fisher’s test. Other data are expressed as mean ± SD and were analyzed using one way ANOVA and Turkey’s
post-test. Different letters show statistically significant differences.

Fig. 4. Immunochemical analysis of Ki-67 expression (A). Positive staining appeared by brown color under light microscopy. The negative control group showed a
standard expression of Ki-67; the DMH-treated control group showed a robust expression of Ki-67; the DMH + TE group showed moderate, and the other two groups
showed mild expression of Ki-67. Magnification 100×; Relative content of Ki-67 in the immunochemical slides of colon tissue of the different experimental groups
(B); DMH: dimethylhydrazine, TB: 100 mg/kg Theobromine, TE: 400 mg/kg theanine. Data are mean ± SD and were analyzed using one way ANOVA and Turkey’s
post-test. Different letters show statistically significant differences.

and TE + TB significantly and similarly reduced the mRNA expression
and phosphorylation states of JAK2 and STAT3 than the DMH-treated
control group. However, these dietary interventions did not signifi­
cantly change the levels of ERK1/2 mRNA expression than the DMH-
treated control group.
3.6. TGF-β/Smad signaling pathway
The TGF-β/Smad signaling pathway is responsible for multiple
cellular processes, including proliferation, differentiation, apoptosis,
and also cancer initiation and progression [36]. The mRNA expression
levels of TGF-β, but not TGF-βRII, Smad2, and Smad4, were significantly
down-regulated in the DMH-treated compared to the negative control
group (p-value = 0.02) (Fig. 5C). The protein expression levels of TGF-β

5
S. Shojaei-Zarghani et al.
(p-value = 0.03) and p-Smad2/Smad2 (p-value = 0.02) were also
reduced in the DMH-treated control group (Fig. 6B & C). The adminis­
tration of TE, TB, and TE + TB similarly enhanced the mRNA levels of
Smad2 and also its phosphorylation state. However, the mRNA expres­
sion levels of Smad4 and TGF-β were augmented only by TB and TE + TB
treatments. None of the dietary interventions changed the protein levels
of TGF-β in the colonic tissue.
4. Discussion
The prevention of colon cancer using plant-derived natural com­
pounds has gained much attention because of their inherently safe and
cost-eff ;ectiveness features. Current evidence supports the anticancer
properties of theanine and theobromine [8,9,19,37], and accordingly,
their crucial roles in the observed anticancer effects of tea and cocoa
[38,39]. Nonetheless, limited studies have evaluated the possible che­
mopreventive effects of these phytochemicals on colon cancer.
In the current study, both theanine and theobromine interventions
reduced the number of cancerous and precancerous lesions, the volume
of tumors, cellular proliferation, and also histopathological abnormal­
ities compared to the positive control group. However, the Ki-67
expression and epithelial lesions were inhibited stronger by
6
Biomedicine & Pharmacotherapy 134 (2021) 111140
Fig. 5. Relative mRNA expression levels of the AKT/mTOR
(A), JAK2/STAT3 and ERK (B), and TGFβ/Smad (C) signaling
pathways-related genes in the colon of the DMH-treated groups
than the negative control. β-actin was used as a housekeeping
gene; Akt (PKB): protein kinase B, DMH: dimethylhydrazine,
ERK: extracellular signal-regulated kinases, JAK: Janus kinase,
mTOR: mammalian target of rapamycin, Smad: small mothers
against decapentaplegic, STAT: signal transducer and activator
of transcription, TB: 100 mg/kg Theobromine, TE: 400 mg/kg
theanine, TGF-β: transforming growth factor-beta. Data are
mean ± SD and were analyzed using one way ANOVA and
Turkey’s post-test. Different letters show statistically signifi­
cant differences.
theobromine than the theanine treatment. In line with our results, the
anti-proliferative effects of either theanine or theobromine have been
reported in previous studies. In the study by Fujii and Inai, the admin­
istration of a diet containing 2.5 and 5 % theanine for 78 weeks dose-
dependently decreased the total number of tumors in the male
B6C3F1 mice [40]. It is demonstrated that theanine can also suppress the
lung [7], hepatocellular [12], and cervical [10] tumor growth in
tumor-bearing animals. Besides, Balan et al. indicated that the oral
administration of 0.5 mg theobromine for 13 days significantly reduced
the tumor weight and angiogenesis in the syngeneic Balb/c mice
transplanted with L-1 sarcoma cells [37]. Upon our findings,
co-administration of both theanine and theobromine exhibited no more
inhibitory effect on the colonic morphological features compared to
either of them alone. However, the Ki-67 expression and epithelial ab­
normalities were more effectively inhibited by the concurrent treatment
compared to the theanine group, which might be related to
theobromine.
In the present study, the effects of theanine, theobromine, and their
combination on the regulation of the Akt/mTOR, JAK2/STAT3, MAPK/
ERK, and TGF-β/Smad pathways were investigated to clarify mecha­
nisms underlying the observed chemopreventive activities. It is docu­
mented that DMH imitates human colonic neoplasms and is associated
S. Shojaei-Zarghani et al. Biomedicine & Pharmacotherapy 134 (2021) 111140

Fig. 6. Densitometric analysis of the p-Akt/Akt, p-mTOR/mTOR, p-S6K/S6K, (A) p-JAK2/JAK2, P-STAT3/STAT3, TGF-β/β-actin, and p-Smad2/Smad2 (B) in the
colon of the DMH-treated groups than the negative control; Western blot analysis of p-Akt, Akt, p-mTOR, mTOR, p-S6K, S6K, p-JAK2, JAK2, p-STAT3, STAT3, TGF-β,
β-actin (loading control), p-Smad2, and Smad2 expression (C); Akt (PKB): protein kinase B, DMH: dimethylhydrazine, JAK: Janus kinase, mTOR: mammalian target
of rapamycin, S6K: ribosomal protein S6 kinase, Smad: small mothers against decapentaplegic, STAT: signal transducer and activator of transcription, TB: 100 mg/kg
Theobromine, TE: 400 mg/kg theanine, TGF-β: transforming growth factor-beta. Data are mean ± SD and were analyzed using one way ANOVA and Turkey’s post-
test. Different letters show statistically significant differences.

with various alterations in the oncogenic signaling pathways [41–44].
Akt is a serine-threonine protein kinase with various downstream me­
diators related to metabolism, proliferation, differentiation, survival,
angiogenesis, invasion, and migration. mTOR, as a downstream target of
Akt, also plays a critical role in the stimulation of cell proliferation and
survival by activation of S6K [45]. Therefore, targeting the Akt/mTOR
signaling pathway can be a promising strategy for the prevention or
treatment of cancer. In our study, the expression of the key genes
involved in the Akt/mTOR signaling pathway was reduced by theo­
bromine, and to a significantly lower extent, by theanine. These findings
are almost consistent with previous studies, which demonstrated a
reduction in the Akt/nuclear factor-κB pathway in hepatocellular car­
cinoma [12], human cervical cancer [10], and highly metastatic mouse
lung cancer cells [7] by the administration of theanine and its de­
rivatives. Another study also demonstrated the inhibitory effects of
theobromine on the Akt/mTOR and ERK pathways in the glioblastoma
cells [21]. In the present study, the concurrent treatment of theanine and
theobromine exerted an additive inhibitory effect on the expression
levels of Akt and mTOR in the colon tissue.
The JAK/STAT and MAPK/ERK are two other oncogenic pathways
that play central roles in cell proliferation, differentiation, and survival
[46]. Based on our results, the expression levels of JAK2 and STAT3, but
not ERK, were down-regulated after theanine and theobromine treat­
ments. In this line, Ben et al. demonstrated the suppression effects of
theanine on the JAK/STAT pathway in the vascular smooth muscle cells
[14]. Contrary to our results, theanine decreased the MAPK/ERK
phosphorylation in cadmium-treated pheochromocytoma (PC12) cells
[47] and also a mouse model of liver injury [48]. Moreover, theobro­
mine reduced the phosphorylation of ERK in the 3T3-L1 preadipocytes
[49]. Based on the literature, this is the first study investigating the ef­
fects of theanine and theobromine on the expression of JAK/STAT and
MAPK/ERK pathways in an animal model of colon cancer. So, the
observed discrepancy between our results with previous studies is
partially due to the differences in the regulation of signaling pathways of
normal and cancer cells and the in-vivo/in-vitro experimental designs. In
the present study, the combination treatment did not induce additional
suppression of the JAK/STAT and MAPK/ERK pathways than either
theanine or theobromine alone.
The TGF-β/Smad signaling, which is usually defective in colon can­
cer [50,51], can be regulated extensively by the mentioned classical
pathways, such as phosphoinositide3-kinase/Akt, MAPK, and JAK/­
STAT [52]. The TGF-β/Smad pathway initiates from the binding of
TGF-β, a polypeptide growth factor, to the type I and II TGF-β receptors,
and subsequently phosphorylation of SMAD2/3. The phosphorylated
SMAD2/3 builds a complex with SMAD4 and translocates to the nucleus
to target genes involved in the growth arrest and apoptosis [36].
Therefore, the inhibition of the TGF-β signaling pathway stimulates
human colon cancer development. In this regard, intraperitoneal im­
plantation of TGF-β in rats markedly inhibited colonic ACF and tumor
formation in the DMH model of colon cancer [53]. In the present study,
the DMH administration significantly down-regulated the expression of
TGF-β and p-Smad2 but caused no significant change in the TGFβRII and
Smad4 mRNA expression. Compared to the DMH-treated control rats, all
dietary interventions enhanced the phosphorylation state of Smad2.

7
S. Shojaei-Zarghani et al.
Besides, theobromine alone or simultaneously with theanine augmented
the mRNA expression levels of TGF-β and Smad4. However, the alter­
ations at the mRNA levels of TGF-β were not translated to the protein
levels, possibly because of its post-transcriptional regulation by various
factors such as microRNAs [54]. The existing literature suggests that
theobromine exerts part of its anticancer effects by inhibiting the
phosphodiesterase enzyme, and subsequently, increasing the intracel­
lular concentration of cAMP [21]. In a previous study, an analog of
cAMP increased TGF-β gene expression and growth arrest in the human
prostate carcinoma cell line PC-3 [55]. Thus, the cAMP-increasing ac­
tivity of theobromine can partially elucidate its observed effects on the
enhancement of the TGF-β and Smad expression.
In the current study, some potential target genes were assessed only
at the mRNA, but not protein expression levels due to our financial
limitations. Moreover, we could not investigate the effects of theobro­
mine on DMH metabolism and also DMH-induced DNA methylations.
More studies are warranted to explore other mechanisms involved in the
chemopreventive actions of theanine and theobromine and their mo­
lecular interactions.
5. Conclusion
The findings of this study indicated that theanine, theobromine, and
their co-administration prevented DMH-induced colon carcinogenesis,
as evidenced by their effects on reducing the number of ACF, the number
and volume of tumors, immunostaining of Ki-67, and the expression of
the Akt/mTOR and JAK2/STAT3 oncogenic pathways. It is worth
mentioning that the mRNA and protein expression levels of Akt and
mTOR were more profoundly reduced following the simultaneous
administration of theanine and theobromine compared to each of them
alone. Furthermore, the inhibition of the Ki-67 and Akt/mTOR expres­
sion was more pronounced by the theobromine treatment than theanine.
In our study, all dietary interventions increased the expression of Smad2
in the colonic tissue of animals. However, the mRNA level of Smad4 was
up-regulated only by theobromine alone or along with the theanine. The
expression of ERK, a signaling component of the MAPK pathway, was
not influenced by theanine, theobromine, or their combination.
Financial support
This work was supported by the Nutrition Research Center of Tabriz
University of Medical Sciences (grant number 62437), the Student
Research Committee of Tabriz University of Medical Sciences (grant
number 65443), and the Iran national science foundation (grant number
98001753). Funders had no role in the design, analysis, or writing of this
article.
Declaration of Competing Interest
The authors declare that they have no conflict of interest.
Acknowledgments
We thank the Nutrition Research Center and Student Research
Committee of Tabriz University of Medical Sciences, Tabriz, Iran, and
the Iran national science foundation. This article has been written based
on a data set of Ph.D. thesis registered at Tabriz University of Medical
Sciences, Iran.
References
[1] J.M. Carethers, Risk factors for colon location of cancer, Transl. Gastroenterol.
Hepatol. 76 (2018) 3, https://doi.org/10.21037/tgh.2018.09.15.
[2] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer
statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36
cancers in 185 countries, CA Cancer J. Clin. 68 (2018) 394–424, https://doi.org/
10.3322/caac.21492.
8
Biomedicine & Pharmacotherapy 134 (2021) 111140
[3] L.H. Wang, C.F. Wu, N. Rajasekaran, Y.X. Shin, Loss of tumor suppressor gene
function in human cancer: an overview, Cell. Physiol. Biochem. 51 (2018)
2647–2693, https://doi.org/10.1159/000495956.
[4] B. Sunil Kumar, S. Singh, R. Verma, Anticancer potential of dietary vitamin D and
ascorbic acid: a review, Crit. Rev. Food Sci. Nutr. 57 (2017) 2623–2635, https://
doi.org/10.1080/10408398.2015.1064086.
[5] D. Türközü, N. Şanlier, L-theanine, unique amino acid of tea, and its metabolism,
health effects, and safety, Crit. Rev. Food Sci. Nutr. 57 (2017) 1681–1687, https://
doi.org/10.1080/10408398.2015.1016141.
[6] J. Williams, J. Kellett, P.D. Roach, A. McKune, D. Mellor, J. Thomas,
N. Naumovski, L-theanine as a functional food additive: its role in disease
prevention and health promotion, Beverages 2 (2016) 13.
[7] D. Ji, Y. Wang, H. Zhang, L. Chen, X. Liu, F. Sun, K. Liu, J. Yao, G. Zhang,
Suppression of proliferation and migration in highly-metastatic lung cancer cells as
well as tumor growth by a new synthesized compound TBrC and its molecular
mechanisms of action, Cytotechnology 66 (2014) 899–911, https://doi.org/
10.1007/s10616-013-9641-8.
[8] G. Zhang, X. Ye, D. Ji, H. Zhang, F. Sun, C. Shang, Y. Zhang, E. Wu, F. Wang, F. Wu,
H. Tian, X. Liu, L. Chen, K. Liu, Y. Wang, H. Liu, W. Zhang, Y. Guan, Q. Wang,
X. Zhao, X. Wan, Inhibition of lung tumor growth by targeting EGFR/VEGFR-Akt/
NF-κB pathways with novel theanine derivatives, Oncotarget 5 (2014) 8528,
https://doi.org/10.18632/oncotarget.2336.
[9] M. Friedman, B.E. Mackey, H.-J. Kim, I.-S. Lee, K.-R. Lee, S.-U. Lee, E. Kozukue,
N. Kozukue, Structure− activity relationships of tea compounds against human
cancer cells, J. Agric. Food Chem. 55 (2007) 243–253, https://doi.org/10.1021/
jf062276h.
[10] J. Liu, Y. Sun, H. Zhang, D. Ji, F. Wu, H. Tian, K. Liu, Y. Zhang, B. Wu, G. Zhang,
Theanine from tea and its semi-synthetic derivative TBrC suppress human cervical
cancer growth and migration by inhibiting EGFR/Met-Akt/NF-κB signaling, Eur. J.
Pharmacol. 791 (2016) 297–307, https://doi.org/10.1016/j.ejphar.2016.09.007.
[11] T. Sugiyama, Y. Sadzuka, Enhancing effects of green tea components on the
antitumor activity of adriamycin against M5076 ovarian sarcoma, Cancer Lett. 133
(1998) 19–26, https://doi.org/10.1016/s0304-3835(98)00185-2.
[12] G. Zhang, Z. Li, X. Wan, Y. Zhang, R. Zhu, Z. Liu, D. Ji, H. Zhang, F. Wu, H. Tian,
Repression of human hepatocellular carcinoma growth by regulating Met/EGFR/
VEGFR-Akt/NF-κB pathways with theanine and its derivative,(R)-2-(6, 8-Dibromo-
2-oxo-2 H-chromene-3-carboxamido)-5-(ethylamino)-5-oxopentanoic ethyl ester
(DTBrC), J. Agric. Food Chem. 64 (2016) 7002–7013, https://doi.org/10.1021/
acs.jafc.6b02509.
[13] S. Ayoub, M.F. Melzig, Induction of neutral endopeptidase (NEP) activity of SK-N-
SH cells by natural compounds from green tea, J. Pharm. Pharmacol. 58 (2006)
495–501, https://doi.org/10.1211/jpp.58.4.0009.
[14] P. Ben, M. Hu, H. Wu, Z. Zhang, Y. Gao, L. Luo, Z. Yin, L-theanine down-regulates
the JAK/STAT3 pathway to attenuate the proliferation and migration of vascular
smooth muscle cells induced by angiotensin II, Biol. Pharm. Bull. 41 (2018)
1678–1684, https://doi.org/10.1248/bpb.b18-00387.
[15] L. Gossage, T. Eisen, Targeting multiple kinase pathways: a change in paradigm,
Clin. Cancer Res. 16 (2010) 1973–1978, https://doi.org/10.1158/1078-0432.CCR-
09-3182.
[16] F. Conciatori, L. Ciuffreda, C. Bazzichetto, I. Falcone, S. Pilotto, E. Bria, F. Cognetti,
M. Milella, mTOR cross-talk in cancer and potential for combination therapy,
Cancers 10 (2018) 23, https://doi.org/10.3390/cancers10010023.
[17] M.C. Mendoza, E.E. Er, J. Blenis, The Ras-ERK and PI3K-mTOR pathways: cross-
talk and compensation, Trends Biochem. Sci. 36 (2011) 320–328, https://doi.org/
10.1016/j.tibs.2011.03.006.
[18] J. Monteiro, M.G. Alves, P.F. Oliveira, B.M. Silva, Pharmacological potential of
methylxanthines: retrospective analysis and future expectations, Crit. Rev. Food
Sci. Nutr. 59 (2019) 2597–2625, https://doi.org/10.1080/
10408398.2018.1461607.
[19] F. Carla Cadoná, A. Kolinski Machado, V. Farina Azzolin, F. Barbisan, E. Bortoluzzi
Dornelles, W. Glanzner, P.B. Dias Gonçalves, C. Elias Assmann, C. Esteves Ribeiro,
I. Beatrice Mânica da Cruz, Guaraná a caffeine-rich food increases oxaliplatin
sensitivity of colorectal HT-29 cells by apoptosis pathway modulation, Anticancer
Agents Med. Chem. 16 (2016) 1055–1065, https://doi.org/10.2174/
1871520616666151217121138.
[20] HJ. Lee, KW. Lee, KS. Kang, DY. Kim, HH. Park, MJ.Lee, HS. Kim, IB. Kwon,
Theobromine with an anti-carcinogenic activity, 2002 [patent].
[21] N. Sugimoto, S. Miwa, Y. Hitomi, H. Nakamura, H. Tsuchiya, A. Yachie,
Theobromine, the primary methylxanthine found in Theobroma cacao, prevents
malignant glioblastoma proliferation by negatively regulating phosphodiesterase-
4, extracellular signal-regulated kinase, Akt/mammalian target of rapamycin
kinase, and nuclear factor-kappa B, Nutr. Cancer 66 (2014) 419–423, https://doi.
org/10.1080/01635581.2013.877497.
[22] C.N. Kahathuduwa, T.L. Dassanayake, A.T. Amarakoon, V.S. Weerasinghe, Acute
effects of theanine, caffeine and theanine–caffeine combination on attention, Nutr.
Neurosci. 20 (2017) 369–377, https://doi.org/10.1080/1028415X.2016.1144845.
[23] National Institutes of Health (NIH). Guide for the Care and Use of Laboratory
Animals. Available from: https://olaw.nih.gov/.
[24] M. Camps-Bossacoma, F.J. Pérez-Cano, À. Franch, M. Castell, Theobromine is
responsible for the effects of cocoa on the antibody immune status of rats, J. Nutr.
148 (2018) 464–471, https://doi.org/10.1093/jn/nxx056.
[25] C. Li, H. Tong, Q. Yan, S. Tang, X. Han, W. Xiao, Z. Tan, L-theanine improves
immunity by altering TH2/TH1 cytokine balance, brain neurotransmitters, and
expression of phospholipase C in rat hearts, Med. Sci. Monit. 22 (2016) 662,
https://doi.org/10.12659/msm.897077.
S. Shojaei-Zarghani et al.
[26] N. Sugimoto, M. Katakura, K. Matsuzaki, E. Sumiyoshi, A. Yachie, O. Shido,
Chronic administration of theobromine inhibits mTOR signal in rats, Basic Clin.
Pharmacol. Toxicol. 124 (2019) 575–581, https://doi.org/10.1111/bcpt.13175.
[27] H. Gungor, N. Ilhan, H. Eroksuz, The effectiveness of cyclooxygenase-2 inhibitors
and evaluation of angiogenesis in the model of experimental colorectal cancer,
Biomed. Pharmacother. 102 (2018) 221–229, https://doi.org/10.1016/j.
biopha.2018.03.066.
[28] S.A.M. Jam, A. Yari Khosroushahi, M. Alipour, B. Alipour, Possible correlation
between Lactobacillus paracasei X12 intake and tumor characteristics in the rat
model of colorectal cancer, J. Res. Clin. Med 8 (2020) 8, https://doi.org/
10.34172/jrcm.2020.008.
[29] J. Zhu, C. Zhu, S. Ge, M. Zhang, L. Jiang, J. Cui, F. Ren, L actobacillus salivarius R
en prevent the early colorectal carcinogenesis in 1, 2-dimethylhydrazine-induced
rat model, J. Appl. Microbiol. 117 (2014) 208–216, https://doi.org/10.1111/
jam.12499.
[30] M.M. Tomayko, C.P. Reynolds, Determination of subcutaneous tumor size in
athymic (nude) mice, Cancer Chemother. Pharmacol. 24 (1989) 148–154, https://
doi.org/10.1007/BF00300234.
[31] S.J. Alrawi, M. Schiff, R.E. Carroll, M. Dayton, J.F. Gibbs, M. Kulavlat, D. Tan,
K. Berman, D.L. Stoler, G.R. Anderson, Aberrant crypt foci, Anticancer Res. 26
(2006) 107–119.
[32] R.P. Bird, Observation and quantification of aberrant crypts in the murine colon
treated with a colon carcinogen: preliminary findings, Cancer Lett. 37 (1987)
147–151, https://doi.org/10.1016/0304-3835(87)90157-1.
[33] A.R. Crowe, W. Yue, Semi-quantitative determination of protein expression using
immunohistochemistry staining and analysis: an integrated protocol, Bio. Protoc. 9
(2019), https://doi.org/10.21769/BioProtoc.3465.
[34] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using real-
time quantitative PCR and the 2− ΔΔCT method, Methods 25 (2001) 402–408,
https://doi.org/10.1006/meth.2001.1262.
[35] Z.-W. Luo, M.-G. Zhu, Z.-Q. Zhang, F.-J. Ye, W.-H. Huang, X.-Z. Luo, Increased
expression of Ki-67 is a poor prognostic marker for colorectal cancer patients: a
meta analysis, BMC Cancer 19 (2019) 123, https://doi.org/10.1186/s12885-019-
5324-y.
[36] M. Zhao, L. Mishra, C.-X. Deng, The role of TGF-β/SMAD4 signaling in cancer, Int.
J. Biol. Sci. 14 (2018) 111, https://doi.org/10.7150/ijbs.23230.
[37] B.J. Bałan, A.K. Siwicki, K. Pastewka, U. Demkow, P. Skopiński, E. Skopińska-
Różewska, S. Lewicki, R. Zdanowski, Synergistic activity for natural and synthetic
inhibitors of angiogenesis induced by murine sarcoma L-1 and human kidney
cancer cells, Adv. Exp. Med. Biol. 1020 (2017) 91–104, https://doi.org/10.1007/
5584_2017_17.
[38] S. Dutta, S. Ray, K. Nagarajan, Glutamic acid as anticancer agent: an overview,
Saudi Pharm. J. 21 (2013) 337–343, https://doi.org/10.1016/j.jsps.2012.12.007.
[39] M. Massot-Cladera, M. Abril-Gil, A. Torres, S. Franch, F.J. Castell, M. Pérez-Cano,
Impact of cocoa polyphenol extracts on the immune system and microbiota in two
strains of young rats, Br. J. Nutr. 112 (2014) 1944–1954, https://doi.org/10.1017/
S0007114514003080.
[40] S. Fujii, K. Inai, Tumorigenicity study of L-theanine administrated orally to mice,
Food Chem. 110 (2008) 643–646.
[41] J. Štofilová, V. Szabadosová, G. Hrčková, R. Salaj, I. Bertková, E. Hijová, L. Strojný,
A. Bomba, Co-administration of a probiotic strain Lactobacillus plantarum LS/07
CCM7766 with prebiotic inulin alleviates the intestinal inflammation in rats
exposed to N, N-dimethylhydrazine, Int. Immunopharmacol. 24 (2015) 361–368,
https://doi.org/10.1016/j.intimp.2014.12.022.
Biomedicine & Pharmacotherapy 134 (2021) 111140
[42] A. Rai, U. Kumar, V. Raj, A.K. Singh, P. Kumar, A.K. Keshari, D. Kumar, B. Maity,
A. De, A. Samanta, Novel 1, 4-benzothazines obliterate COX-2 mediated JAK-2/
STAT-3 signals with potential regulation of oxidative and metabolic stress during
colorectal cancer, Pharmacol. Res. 132 (2018) 188–203, https://doi.org/10.1016/
j.phrs.2017.12.010.
[43] S. Kumar, N. Agnihotri, Piperlongumine, a piper alkaloid targets Ras/PI3K/Akt/
mTOR signaling axis to inhibit tumor cell growth and proliferation in DMH/DSS
induced experimental colon cancer, Biomed. Pharmacother. 109 (2019)
1462–1477, https://doi.org/10.1016/j.biopha.2018.10.182.
[44] J. Swenberg, H. Cooper, J. Bücheler, P. Kleihues, 1, 2-Dimethylhydrazine-induced
methylation of DNA bases in various rat organs and the effect of pretreatment with
disulfiram, Cancer Res. 39 (1979) 465–467.
[45] E. Tokunaga, A. Oki, E. Egashira, N. Sadanaga, M. Morita, Y. Kakeji, Y. Maehara,
Deregulation of the Akt pathway in human cancer, Curr. Cancer Drug Targets 8
(2008) 27–36, https://doi.org/10.2174/156800908783497140.
[46] O. Dreesen, A.H. Brivanlou, Signaling pathways in cancer and embryonic stem
cells, Stem Cell Rev. 3 (2007) 7–17, https://doi.org/10.1007/s12015-007-0004-8.
[47] P. Ben, Z. Zhang, C. Xuan, S. Sun, L. Shen, Y. Gao, X. Cao, Y. Zhou, L. Lan, Z. Yin, et
al., Protective effect of L-theanine on cadmium-induced apoptosis in PC12 cells by
inhibiting the mitochondria-mediated pathway, Neurochem. Res. 40 (2015)
1661–1670, https://doi.org/10.1007/s11064-015-1648-4.
[48] Z. Gong, Q. Liu, L. Lin, Y. Deng, S. Cai, Z. Liu, S. Zhang, W. Xiao, S. Xiong, D. Chen,
l-Theanine prevents ETEC-induced liver damage by reducing intrinsic apoptotic
response and inhibiting ERK1/2 and JNK1/2 signaling pathways, Eur. J.
Pharmacol. (2018) 184–190, https://doi.org/10.1016/j.ejphar.2017.10.050.
[49] Y.J. Jang, H.J. Koo, E.-H. Sohn, S.C. Kang, D.-K. Rhee, S. Pyo, Theobromine inhibits
differentiation of 3T3-L1 cells during the early stage of adipogenesis via AMPK and
MAPK signaling pathways, Food Funct. 6 (2015) 2365–2374, https://doi.org/
10.1039/c5fo00397k.
[50] S. Biswas, P. Trobridge, J. Romero-Gallo, D. Billheimer, L.L. Myeroff, J.K. Willson,
S.D. Markowitz, W.M. Grady, Mutational inactivation of TGFBR2 in microsatellite
unstable colon cancer arises from the cooperation of genomic instability and the
clonal outgrowth of transforming growth factor β resistant cells, Genes
Chromosomes Cancer 47 (2008) 95–106, https://doi.org/10.1002/gcc.20511.
[51] X.-l. Chen, Z.-q. Chen, S.-l. Zhu, T.-w. Liu, Y. Wen, Y.-s. Su, X.J. Xi, Y. Hu, L. Lian, F.
B. Liu, Prognostic value of transforming growth factor-beta in patients with
colorectal cancer who undergo surgery: a meta-analysis, BMC Cancer 17 (2017)
240, https://doi.org/10.1186/s12885-017-3215-7.
[52] K. Luo, Signaling cross talk between TGF-β/Smad and other signaling pathways,
Cold Spring Harb. Perspect. Biol. 9 (2017) a022137, https://doi.org/10.1101/
cshperspect.a022137.
[53] R. Mikhailowski, B. Shpitz, S. Polak-Charcon, Y. Kost, C. Segal, A. Fich, S.
A. Lamprecht, Controlled release of TGF-β1 impedes rat colon carcinogenesis in
vivo, Int. J. Cancer 78 (1998) 618–623, https://doi.org/10.1002/(sici)1097-0215
(19981123)78:5<618::aid-ijc15>3.0.co;2-i.
[54] J. Martin, R.H. Jenkins, R. Bennagi, A. Krupa, A.O. Phillips, T. Bowen, D.J. Fraser,
Post-transcriptional regulation of transforming growth factor beta-1 by microRNA-
744, PLoS One 6 (2011) e25044, https://doi.org/10.1371/journal.pone.0025044.
[55] Y.-J. Bang, S.-J. Kim, D. Danielpour, M.A. O’Reilly, K.Y. Kim, C.E. Myers, J.
B. Trepel, Cyclic AMP induces transforming growth factor beta 2 gene expression
and growth arrest in the human androgen-independent prostate carcinoma cell line
PC-3, Proc. Natl. Acad. Sci 89 (1992) 3556–3560, https://doi.org/10.1073/
pnas.89.8.3556.