Research Communication
Role of MicroRNA 126 in Screening, Diagnosis,
and Prognosis of Diabetic Patients in Egypt
1
Faculty of Medicine, Medical Biochemistry Department, Zagazig University,
Egypt
2
Faculty of Medicine, Internal Medicine Department, Zagazig University,
Egypt
Abstract
MicroRNAs (miRNAs), family of non-coding small RNAs, play a
vital role in the regulation of blood glucose level. We aimed to
investigate the relation of serum miRNA-126 expression with
impaired glucose tolerance as well as type 2 diabetes mellitus
(T2DM) patients with and without complications. One hundred
healthy controls, eighty-six patients with IGT, and one hundred
patients with T2DM were recruited in this study. Serum miRNA-
126 expression was assessed by quantitative real-time polymer-
ase chain reaction. We found a significant decrease of serum
miRNA-126 expression between IGT patients as well as diabetic
Keywords: MicroRNA 126; qRT-PCR; diabetes mellitus;
complications
Introduction
Diabetes is increasing in epidemic proportions globally, exhibit-
ing the most striking increase in the third world countries with
emerging economies. This phenomenon is particularly evident
in Middle East and North Africa regions, which has the highest
prevalence of diabetes in adults. The most concerning indirect
cost of diabetes is the missed work by the adult population
coupled with the economic burden of loss of productivity. In
Egypt alone, 2,623,000 people are already affected, with the
expectation of increase this number to 6,726,000 in 2030. As
many as half of all diabetic patients remain undiagnosed, these
already sizable figures are likely gross underestimations (1).
C 2016 International Union of Biochemistry and Molecular Biology
V
Volume 68, Number 6, June 2016, Pages 452–458
*Address correspondence to: Noha Rezk, Lecturer of medical biochemistry,
Zagazig University, Zagazig, Egypt 002. Tel: 12010000 89372.
E-mail: nonnarezk@yahoo.com
Received 10 March 2016; Accepted 30 March 2016
DOI 10.1002/iub.1502
Published online 26 April 2016 in Wiley Online Library
(wileyonlinelibrary.com)
452
Noha A. Rezk1*
Norhan A. Sabbah1
Mohamed S.S. Saad2
patients when both compared with controls and between dia-
betic patients compared to IGT patients. A significant decrease
of serum miRNA-126 expression was detected in diabetic
patients with complications compared to those without evident
complications especially those with diabetic macrovascular
complications and diabetic retinopathy. Serum microRNA-126
expression could be a good marker for diagnosis of IGT and
T2DM as well as for monitoring the outcomes of such disease.
C 2016 IUBMB Life, 68(6):452–458, 2016
V
IGT;
Reliable biological tests are used for screening and diagno-
sis of diabetes based on blood glucose levels, however there
are no means of detecting at-risk patients or of following dia-
betic complications.
MicroRNAs (miRNAs) are a family of small (about 22
nucleotides), noncoding single-strand RNA molecules, their
transcription occurs through RNA polymerase II (2) and subse-
quent processing is mediated by the nuclear ribonuclease III
(RNase III) enzyme, Drosha, to form precursor miRNAs (70–100
nucleotides), further cleavage occurs via another RNase III
enzyme, Dicer, to form the mature miRNA (3). MiRNAs modu-
late both physiological and pathological pathways by post-
transcriptionally inhibiting the expression of a plethora of target
genes (3).
It has been demonstrated that miRNAs are not only intra-
cellular molecules, since they were also detected outside the
cells in body fluids (e.g., In serum, plasma, saliva, urine, and
milk; (4))
Human serum miRNAs levels had been shown to be stable,
reproducible, and consistent amongst healthy individuals, allow-
ing them to be of potential value as biomarkers of disease (5).
The stability of circulating miRNAs may be explained by their
being carried in membrane-bound vesicles or transported by
IUBMB Life
high-density lipoproteins (6). It has been suggested that extra-
cellular miRNAs have specific physiological functions, regulating
immune function, cell migration, differentiation, and other
aspects of cell-to-cell communication depending on their cellular
origin (6).
MiR-126 is highly enriched in endothelial cells, and con-
tributes to the maintenance and repair of vascular integrity,
angiogenesis, and wound repair; it also facilitates vascular
endothelial growth factor- A (VEGF-A) signaling. Differentially
expressed circulatory miRNA signature characteristic of type 2
diabetes mellitus (T2DM) have been reported from recent stud-
ies outside Middle East (7–9).
From these studies, it is expected that the identification of
potential-specific miRNAs biomarkers may help predict or
detect the development and the progression of diabetes and its
complications at an early stage, and therefore allow well timed
intervention.
So, in the present study, we aimed to investigate whether
MiR-126 is considered a potential-specific biomarker which
can predict or detect the development as well as the progres-
sion of diabetes and its complications, especially (macrovascu-
lar complications, retinopathy, neuropathy, and nephropathy)
in diabetic Egyptian patients.
Subjects and Methods
This study was conducted in Medical Biochemistry and Inter-
nal Medicine Departments of Zagazig University Hospitals
and included 100 subjects suffering from type II diabetes mel-
litus and 86 subjects with impaired glucose tolerance (IGT),
recruited from patients admitted to the Internal Medicine
Outpatients Clinics. They were diagnosed according to Ameri-
can Diabetes Association diagnostic criteria 2015 (10). In long
standing diabetics, the duration of their diabetes ranged from
6 to 12 years.
Diabetic patients were divided into 5 subgroups: Those
with newly diagnosed type 2 diabetes mellitus without evident
complication (n 5 14); those with evident macrovascular com-
plications (n 5 26), assessed by using ECG, duplex US mainly
for coronary artery disease and premature coronary artery
disease; those with diabetic neuropathy (n 5 17), diagnosed by
full neurological examination; those with diabetic nephropathy
(n 5 24), assessed by using albumin to creatinine ratio in spot
urine sample and finally those with diabetic retinopathy
(n 5 19), diagnosed by the best corrected visual acuity, slit-
lamp biomicroscopy, and indirect ophthalmoscopy.
Exclusion Criteria
Patients with a history of liver cirrhosis, malignancy, infection,
inflammation, bronchial asthma, or heart failure, were
excluded from this study.
One hundred healthy subjects with no family history of dia-
betes mellitus as well as age, sex, and ethnic origin matched to
the patients, were served as a control group.
Rezk et al.
The ethical committee of Zagazig University approved this
study and a written informed consent was obtained from all
subjects prior to their inclusion in this work.
Anthropometric Measurement
Body mass index (BMI) was calculated by dividing the weight
(kg) by the squared value of height in meters.
Biochemical Analysis
Blood samples were taken from all studied subjects after 8 H
fast as follows: 2 mL blood was taken on fluoride containing
tubes, another 2 mL was taken on EDTA containing tubes, and
the remaining part was left for 10 min to clot and then was
centrifuged at 1,000 3 g for 5 min. Another blood sample was
taken after 12 H fast and on fluoride containing tubes 2 H
after meal (2hpp). The serum and plasma samples were sepa-
rated and stored at 2208C till the time of use.
Fasting, 2hpp blood glucose, total cholesterol, and triglyc-
erides were measured by routine enzymatic methods (Spin-
react). HDLc was determined after precipitation of the apo
B-containing lipoproteins. LDLc was calculated using Friede-
wald formula (11). Glycated hemoglobin (HbAlc) was estimated
colorimetrically by using (Biosystems, Barcelona, Spain). Serum
insulin and lipoprotein a (LPa) was measured by ELISA using
the Quantikine human insulin and LPa assay kits (R and D Sys-
tems, Minneapolis, MN). HOMA-IR was calculated using the
following formula: [fasting insulin (lIU/mL) 3 fasting glucose
(mmol/L)]/22.5.
Serum miRNA Assay
Total RNA was isolated from 250 lL serum according to the
manufacturer’s instructions of the miRNeasy extraction kit
(Qiagen, Valencia, CA) by adding QIAzol lysis reagent (1 mL)
then it was left for 5 min at room temperature. This was fol-
lowed by adding 200 lL of chloroform and vortexing for 15 sec,
the samples were incubated for 3 min at room temperature fol-
lowed by centrifugation at 14,000 3 g at 48C for 15 min. An
equal volume of 100% ethanol was added after removing the
upper watery phase. Six hundred microliters of the solution
were pipetted in miRNeasy Mini spin column and centrifuged at
8000 3 g for 60 sec. Then 600 lL of buffer RWT was added,
followed by another centrifugation at 8000 3 g for another 60
sec. Then, 500 lL of buffer RPE was added prior to centrifuga-
tion at 8000 3 g for 2 min. The columns were placed in new
collection tubes and centrifuged at full speed for 2 min. Fifty
microliters of RNase-free water was placed directly into the col-
umns followed by centrifugation for 1 min at 8000 3 g for RNA
elution. Twenty microliters of eluted miRNA was reverse tran-
scribed by incubation for 1 H at 428C, 3 min at 938C, and then
maintained at 48C using the miRNeasy serum/plasma Reverse
Transcription Kit (Qiagen, Valencia, CA) according to the man-
ufacturer’s instructions (12).
Real Time-PCR Quantification of Serum miRNA-126
Quantification of miRNA-126 was carried out by SYBR green
quantitative real-time polymerase chain reaction assay using
miScript SYBR Green PCR kit (Qiagen, Hilden, Germany) on
453
 IUBMB LIFE

Clinical and demographic characteristics of the studied groups

TABLE 1

Healthy IGT Diabetic

controls patients patients
(N 5 100) (N 5 86) (N 5 100) P

Age (years) 45.7 6 8.4 46.3 6 7.9 48.2 6 7 8.2 0.43

Sex (male/female) 46/54 40/46 49/51 0.64
Fasting blood glucose (mg/dl) 87 6 13.4 115 6 18.5 154 6 23 <0.001
2 hpp blood glucose (mg/dL) 90 6 17 171 6 28 246 6 32 <0.001
HbA1C (%) 5.4 6 0.6 6.6 6 0.72 8.7 6 1.9 <0.001
2
BMI (kg/m ) 23 6 3.1 21.6 6 3.8 22.9 6 5.1 0.59
Fasting insulin (lIU/mL) 9.2 6 2.87 9.6 6 3.5 10.3 6 4.5 0.149
Total cholesterol (mg/dL) 187 6 41.7 196 6 50.4 211 6 48 0.143
Triglycerides (mg/dL) 106 6 29.4 112 6 35.7 119 6 37.8 0.05
HDL-c (mg/dL) 41 6 9.4 40 6 8.7 38 6 8.1 0.078
LDL-c (mg/dL) 130 6 29.4 128 6 32.1 139 6 35.2 0.069
LP (a) (ng/mL) 13.4 6 5.6 15.2 6 6.1 14.5 6 6.8 0.177
HOMA IR 2.54 6 0.51 3.5 6 0.7 5.0 6 0.98 <0.001
Serum miRNA-126 expression 0.9 6 0.21 0.5 6 0.18 0.3 6 0.15 <0.001

IGT, impaired glucose tolerance; 2 hpp, 2 hours postprandial; BMI, body mass index; HbAlc, glycosylated hemoglobin; HDLc, high density lipo-
protein cholesterol; LDLc, low density lipoprotein cholesterol; LPa, lipoprotein (a); HOMA IR, homeostatic model assessment insulin resistance.

ABI PRISM 7500 Fast real-time PCR system (Applied Biosys-
tems, Foster City, CA). The procedure was performed on 20 mL
final volume containing [2 mL of cDNA, 0.5 mM of hsa-miR-126-
specific primers (Applied Biosystems), and 13 QuantiTect
SYBR Green PCR Master mix] (Qiagen, Hilden, Germany).
Primers sequence used was mature miRNA sequence
(50 CATTATTACTTTTGGTACGCG 30 ) and specific forward PCR
primer (50 GGGGCATTATTACTTTTGG30 ).
Cycling condition was denaturation at 958C for 2 min, fol-
lowed by 35 cycles of 958C for 10 Sec, 578C for 20 sec, and
708C for 10 sec. Then, analysis of melting curve was per-
formed and PCR products were electrophoresed on 2% agarose
gels to validate the specific generation of the expected PCR
product.
The cycle threshold (Ct) value for the genes was deter-
mined by SDS software v1.2 (Applied Biosystems, Foster City,
CA). Ct is the threshold cycle, the cycle number at which fluo-
rescence is generated in a reaction crossing the threshold.
MiRNA expression level was normalized by calculating the DCt
value based on subtracting its Ct value from that of the inter-
nal control RNU1A. The amplitude of miRNA expression
change, observed in patients in relation to control group, was
analyzed by the 22DDCt method (13).
Statistical Analysis
Data were analyzed with SPSS version 15.0 (statistical package for
the Social Science, Chicago, IL). Differences of the frequencies in
the studied groups were analyzed using chi square (v2) test. Levels
of serum miRNA-126 expression were expressed as mean 6 SD.
Significant differences between the groups were determined using
Student’s t test and one-way analysis of variance. Pearson correla-
tion analysis was employed to assess the correlation between
plasma miRNA-126 expression and metabolic parameters in the
studied subjects. The ability of miRNA-126 expression to discrimi-
nate between case and control samples was assessed by plotting
the receiver operating characteristics curve, which associates
the true positive rate (sensitivity) to the false positive rate (1-speci-
ficity) and by computing area under the curve (AUC). A difference
was considered significant at the P value <0.05.
Results
Demographic Characteristics of Control, IGT Patients,
and Diabetic Patients Groups
There was a significant difference of fasting blood glucose,
2hpp blood glucose, HbA1C, HOMA IR, and serum miRNA-126

454 MicroRNA 126 in Diabetes

 Clinical and demographic characteristics of diabetic patients with and without complications
TABLE 2

Newly
diagnosed
type 2 diabetes Diabetic
mellitus without macrovascular Diabetic Diabetic Diabetic
evident complicated nephropathy retinopathy neuropathy
complications patients patients patients patients Adjusted
(N 5 14) (N 5 26) (N 5 24) (N 5 19) (N 5 17) P value

Age (years) 45.2 6 7.3 48.6 6 9.5 49.4 6 10.6 50.1 6 10.3 46.2 6 11.6 0.52
Sex (male/female) (6/8) (12/14) (13/11) (10/9) (8/9) 0.71
Onset of disease (years) 1.7 6 0.5 6.2 6 1.0 5.9 6 0.9 6.12 6 1.1 6.3 6 0.95 <0.001
Fasting blood glucose (mg/dl) 137.4 6 17.5 160.4 6 22.7 145.6 6 21.4 151.0 6 19.5 139.7 6 24.7 0.07
2hpp blood glucose (mg/dL) 236.3 6 28.4 247.4 6 30.1 234.5 6 29.2 240.0 6 32.5 229.9 6 34 0.55
HbA1C (%) 8.2 6 1.4 8.8 6 1.2 9.1 6 1.6 9.0 6 1.35 8.7 6 1.24 0.192
BMI (kg/m2) 22.2 6 5.1 25.6 6 7.3 26.0 6 8.7 20.1 6 8.1 23.2 6 9.4 0.189
Fasting insulin (lIU/mL) 9.5 6 3.4 12.5 6 4.5 13.2 6 6.6 8.6 6 4.4 10.2 6 3.7 0.10
Total cholesterol (mg/dL) 201 6 41 234 6 40 217 6 47 228 6 52 231 6 50 0.20
Triglycerides (mg/dL) 103.7 6 57.6 114 6 29.9 119 6 35.8 131.8 6 29.5 125.5 6 37.5 0.223
HDL-c (mg/dL) 40.6 6 9.7 39.3 6 9.6 36.4 6 8.3 35.2 6 5.3 35.4 6 6.3 0.07
LDL-c (mg/dL) 130 6 31 154 6 29 141 6 37 150 6 42 134 6 40 0.201
LP (a) (ng/mL) 13.1 6 3.2 15.2 6 3.5 14 6 4.1 15 6 4.5 13.4 6 4.0 0.34
HOMA IR 4.3 6 0.6 5.6 6 0.71 6.1 6 0.8 5.1 6 0.45 4.9 6 0.69 0.002
Serum miRNA-126 expression 0.84 6 0.23 0.56 6 0.18 0.75 6 0.21 0.6 6 0.24 0.73 6 0.27 0.004

2hpp, 2 hours postprandial; BMI, body mass index; HbAlc, glycosylated hemoglobin; HDLc, high density lipoprotein cholesterol; LDLc, low den-
sity lipoprotein cholesterol; LPa, lipoprotein (a); HOMA IR, homeostatic model assessment insulin resistance.
Adjusted P: multivariate analysis; P adjusted for disease onset.

expression levels between IGT patients as well as diabetic
patients when both compared with control group. However,
there was no significant difference between them regarding age,
sex, BMI, fasting insulin, lipoid profile, and LP (a) (Table 1).
Demographic Characteristics of Diabetic Patients’
Subgroups with and without Evident Complications
There was a significant difference between diabetic patients
with complications compared to newly diagnosed type 2 diabe-
tes mellitus without evident complications regarding serum
miRNA-126 expression levels (adjusted P 5 0.002) and HOMA-
IR (adjusted P 5 0.004) (Table 2).
Comparison of Serum miRNA-126 Expression Levels
between the Different Studied Groups
A significant decrease of serum miRNA-126 expression levels
was found between IGT patients as well as diabetic patients
when both compared to controls as well as between diabetic
patients compared with IGT patients.
On comparison of serum miRNA-126 expression levels
between diabetic patients with complications compared with those
without evident complications, we found a significant decrease
between both. Also, serum miRNA-126 levels were significantly
declined in diabetic macrovascular complicated patients as well
as diabetic retinopathy patients when both compared compared
with diabetic patients without evident complications, while, there
was no significant difference of serum miRNA-126 expression lev-
els between diabetic neuropathy as well as diabetic nephropathy
patients when both compared with newly diagnosed diabetic
patients without evident complications (Table 3).
Correlation between Serum miRNA-126 Expression
and Metabolic Parameters in the Studied Subjects
Circulating concentrations of serum miRNA-126 were nega-
tively associated with both fasting blood glucose, HbA1c, and

Rezk et al. 455

 IUBMB LIFE

specificity for diabetes mellitus were 95 and 92% (95% CI:

Comparison of serum miRNA-126 expression 0.91–0.98), respectively with highly statistical significant differ-
TABLE 3 between the different studied groups ence (P < 0.002) when the cutoff value for serum miRNA-126
expression was set to 0.585 (Table 5) and (Figs. 1 and 2)
Adjusted
Groups P value

IGT patients versus control group <0.001

Diabetic patients versus control group <0.001
Diabetic patients versus IGT patients
Complicated diabetic patients versus newly <0.001
diagnosed type 2 diabetes mellitus without
evident complications
Diabetic macrovascular complicated patients
versus newly diagnosed type 2 diabetes
mellitus without evident complications
Diabetic nephropathy patients versus newly
diagnosed type 2 diabetes mellitus without
evident complications
Diabetic retinopathy patients versus newly
diagnosed type 2 diabetes mellitus without
evident complications
Diabetic neuropathy patients versus newly
diagnosed type 2 diabetes mellitus without
evident complications
Adjusted P: multivariate analysis; P adjusted for disease onset.
2hpp blood glucose, while, there was no significant association
between serum miRNA-126 and HOMA-IR in all studied sub-
jects (Table 4).
When the cutoff value for serum miRNA-126 expression
was set to 0.715, the sensitivity and specificity for IGT were 94
and 90% (95% CI: 0.89–0.96), respectively, with highly statisti-
cal significant difference (P < 0.003), while, the sensitivity and
Correlation between serum miRNA-126 expression
TABLE 4 and metabolic parameters in the studied subjects
Serum miRNA-126
expression
r P
FBG (mg/dL) 20.71
2hpp blood glucose (mg/dL) 20.82
HbA1C (%) 20.45
HOMA-IR 20.1
FBG, fasting blood glucose; 2hpp, 2 hours postprandial; HbAlc, glyco-
sylated hemoglobin; HOMA IR, homeostatic model assessment insulin
resistance.
Discussion
Diabetes is associated with reduced life expectancy, significant
morbidity due to related micro vascular complications, increased
0.031 risk of macrovascular complications (ischemic heart disease,
stroke, and peripheral vascular disease) and diminished quality
of life (14).
Given the predicted explosion in the number of cases of
prediabetes and T2DM worldwide especially in Egypt, finding
0.004 a circulating biomarker that not only detects the IGT and dia-
betic patients but also screens the progression of complications
at an early stage is essential.
0.65 In our study, we tried to investigate the role of serum
miRNA-126 expression in different phases of diabetes .We
found a significant decrease of serum miRNA-126 expression
between IGT and diabetic patients when both compared to
0.008
controls as well as between diabetic patients compared to IGT
patients. Circulating concentrations of serum miRNA-126 were
negatively associated with both fasting glucose, HbA1c, and
0.31 2hpp blood glucose, while, there was no significant association
between miRNA-126 and HOMA-IR in all studied subjects.
These results are in accordance with other studies world-
wide including a study done by Liu et al. in China (15), which
found an association between miR-126 expression, T2DM, and
prediabetic patients. The previous study indicated that serum
miR-126 could be used to discriminate prediabetes from healthy
individuals. In addition, low miR-126 expression was signifi-
cantly associated with poor treatment response. Previous stud-
ies had indicated an association between miR-126 expression
levels and T2DM with high specificity (9,16,17). Furthermore, a
decrease in the circulating miR-126 in nondiabetic people was
found to be a significant predictor of DM as reported by Zampe-
taki et al. (16). In fact, the authors detected a gradual decline in
plasma levels of miR-126 from normal glucose tolerance,
through IGT, to evident diabetes mellitus (16).
In different aspect, miR-126 was found to be notably lower
in urine of type-1 diabetic patients compared to controls (18).
However, Karolina et al. (19) reported that there was no change
found of miR-126 level between diabetic patients and controls.
This may be explained by differences in biosamples used in
each study, differences in methods for expression measurement,
<0.01 difference of the sample size, differences in the recruitment cri-
<0.001 teria employed for recruitment of the cases, power of associa-
tion analyses and criteria for statistical significance.
0.041 MiR-126 is highly abundant in endothelial cells, and plays
0.09 a pivotal role in maintaining endothelial homeostasis, vascular
integrity and regulating angiogenesis (20). It helps vascular
endothelial growth factor (VEGF) signaling by suppressing two
negative regulators of the (VEGF) pathway, Sprouty-related
protein (SPRED1) and phosphoinositol-3 kinase regulatory

456 MicroRNA 126 in Diabetes

 Receiver operating characteristics curve (ROC) analysis using serum miRNA-126 expression for discriminating
TABLE 5 IGT and diabetic patients

Serum miRNA-126
expression IGT 1 2 AUC (95% CI) P Std Error Sensitivity Specificity

<0.715 81 9 0.937 (0.89–0.96) 0.003 0.026 94% 90%

>0.715 5 77
Serum miRNA-126 DM 1 2 AUC (95% CI) P Std Error Sensitivity Specificity
expression
<0.585 95 8 0.942 (0.91–0.98) 0.002 0.023 95% 92%
>0.585 5 92

IGT, impaired glucose tolerance; CI, confidence interval; AUC, area under the curve; DM; diabetes mellitus.

subunit 2 (PIK3R2/p85-b; (21)). The shedding of miR-126 from
endothelial cells could regulate VEGF responsiveness and con-
fer vascular protection in a paracrine manner (22,23).
The association of decreased serum miR-126 with high
blood glucose in our study and other previous studies (15,16)
suggested that elevated plasma glucose might result in the
decreased delivery of miR-126 to monocytes (16), which lead
to reduction of plasma content of miR-126 in a glucose-
dependent fashion and in turn contributes to VEGF resistance
and endothelial dysfunction resulting in defective collateral
vessel development (24).
The novelty of our study is that we were the first one who
tried to use miR-126 expression levels as a predictor of various
complications in T2DM, we found a significant decrease of
serum miRNA-126 expression between diabetic patients with
complications compared to those without evident complica-
tions, Also, serum miRNA-126 levels was significantly lower in
patients with diabetic macrovascular complications as well as
diabetic retinopathy when both compared with diabetic
patients without evident complications, while, there was no
significant difference was detected in cases of diabetic neurop-
athy and nephropathy.
Diabetic macrovasular complications are accountable for
the higher incidence of sudden cardiac death and represent
the main cause of morbidity and mortality among the diabetic
patients (25).
MiR-126 is encoded within an intron of Egfl7 and is
enriched in endothelial cells (20). Genetic deletion of miR-126
disrupts the vascular integrity and results in partial embryonic
lethality. MiR-126 knockout mice survived to adulthood show

Receiver operating characteristics curve (ROC) analy- Receiver operating characteristics curve (ROC) analy-
FIG 1 sis using serum miRNA-126 expression for discrimi- FIG 2 sis using serum miRNA-126 expression for discrimi-
nating IGT patients when the cut off value was set to nating diabetic patients when the cut off value was
0.71. set to 0.58.

Rezk et al. 457


defective neo-angiogenesis following a surgical model of myo-
cardial infarction. MiR-126 is enriched in the apoptotic bodies
of dying endothelial cells and signals in a paracrine manner to
induce the anti-apoptotic, pro-repair, CXCL12-CXCR4 signaling
cascade in neighboring vascular cells (22). Direct administra-
tion of premiR-126, or infusion of miR-126 containing apopto-
tic bodies, respectively, decreased the size or promoted the
stabilization of atherosclerotic lesions in Apoe–/– mice.
The signal pathway of miR-126 effecting on circulating
endothelial progenitor cells (EPCs) is partially mediated through
Ras/ERK/VEGF and PI3K/Akt/eNOS regulation. MiR-126 is
downregulated in EPCs from diabetic patients, and impairs
EPCs-mediated function via its target, Spred-1, and through
Ras/ERK/VEGF and PI3K/Akt/eNOS signal pathway (26).
Concerning diabetic retinopathy, in agreement with our
findings, an experimental study done on rats, showed that
miR-126 was not only downregulated under hypoxic conditions
in the retinal tissue of streptozotocin-induced diabetic rats in
vivo and in vitro (27), but it could also modulate the expres-
sion of VEGF and MMP-9 protein levels in monkey chorioreti-
nal vessel endothelial cells (RF/6A; 28).
Our study revealed that circulating concentrations of
miRNA-126 were negatively associated with both fasting blood
glucose, HbA1c, and 2hpp blood glucose, while, there is no sig-
nificant association of miRNA-126 with HOMA-IR or lipid
parameters in all studied subjects. In line with our results, a
study done by Ortega et al. (9) who revealed that circulating
concentrations of the selected miRNA-126 were significantly
associated with fasting glucose, HbA1c (P 5 0.021 and 0.014),
respectively.
In conclusion, serum microRNA-126 expression could be
good marker for detecting IGT and T2DM patients and for
monitoring the various complications of such disease. Further
studies are recommended to understand the mechanisms of
the different actions of microRNA-126.
References
[1] WHO. (2000) Country and regional data on diabetes. Available at: www.who.
int/diabetes/facts/world_figures/en/index2.html. Accessed 12 January 2016.
[2] Zeng, Y. and Cullen, B. R. (2006) Recognition and cleavage of primary micro-
RNA transcripts. Methods Mol. Biol. 342, 49–56.
[3] He, L. and Hannon, G. J. (2004) MicroRNAs: small RNAs with a big role in
gene regulation. Nat. Rev. Genet. 5, 522–531.
[4] Chen, X., Liang, H., Zhang, J., Zen, K., and Zhang, C. Y. Y. (2012) Horizontal
transfer of microRNAs: molecular mechanisms and clinical applications. Pro-
tein Cell 3, 28–37.
[5] Gilad, S., Meiri, E., Yogev, Y., Benjamin, S., Lebanony, D., et al. (2008) Serum
microRNAs are promising novel biomarkers. PloS One 3, e3148.
[6] Wagner, J., Riwanto, M., Besler, C., Knau, A., Fichtlscherer, S., et al. (2013)
Characterization of levels and cellular transfer of circulating lipoprotein-
bound microRNAs. Arterioscler. Thromb. Vasc. Biol. 33, 1392–1400.
[7] Pescador, N., Pe rez-Barba, M., Ibarra, J. M., Corbato
 n, A., Martınez-Larrad, M.
T., and Serrano-Rıos, M. (2013) Serum circulating microRNA profiling for
identification of potential type 2 diabetes and obesity biomarkers. PloS One 8,
e77251.
458
IUBMB LIFE
[8] Rong, Y., Bao, W., Shan, Z., Liu, J., Yu, X., et al. (2013) Increased microRNA-
146a levels in plasma of patients with newly diagnosed type 2 diabetes melli-
tus. PloS One 8, e73272.
[9] Ortega, F. J., Mercader, J. M., Moreno-Navarrete, J. M., Rovira, O., Guerra,
E., et al. (2014) Profiling of circulating microRNAs reveals common micro-
RNAs linked to type 2 diabetes that change with insulin sensitization. Diabe-
tes Care 37, 1375–1383.
[10] American Diabetes Association. (2015) Standards of medical care in diabe-
tes 2015. Diabetes Care 38, S1–S93.
[11] Frieldewald, W. T., Levy, R. I., and Fredrickson, D. S. (1972) Estimation of
the concentration of low density lipoprotein cholesterol in plasma, without
use of the preparative ultracentrifuge. Clin. Chem. 18, 499–502.
[12] Margariti, A., Zampetaki, A., Xiao, Q., Zhou, B., Karamariti, E., et al. (2010)
Histone deacetylase 7 controls endothelial cell growth through modulation
of beta-catenin. Circ. Res. 106, 1202–1211.
[13] Livak, K. and Schmittgen, T. (2001) Analysis of Relative Gene Expression Data
Using RealTime Quantitative PCR and the 22DDCt method. Methods 25, 402–408.
[14] American Diabetes Association. (2005) Standards of Medical Care in Diabe-
tes 2005. Diabetes Care 28(Suppl 1), S4–36.
[15] Liu, Y., Gao, G., Yang, C., Zhou, K., Shen, B., et al. (2014) The role of circulating
MicroRNA-126 (miR-126): a novel biomarker for screening prediabetes and
newly diagnosed type 2 diabetes mellitus. Int. J. Mol. Sci. 15, 10567–10577.
[16] Zampetaki, A. and Kiechl, S. (2010) Plasma microRNA profiling reveals loss
of endothelial miR-126 and other microRNAs in type 2 diabetes. Circ. Res.
107, 810–817.
[17] Zhang, T., Chunfang, L., Li, L., Chen, S., Liu, S., Wang, C., and Su, B. (2013)
Plasma miR-126 Is a Potential Biomarker for Early Prediction of Type 2 Dia-
betes Mellitus in Susceptible Individuals. Biomed. Res. Int. 761617.
[18] Osipova, J., Fischer, D. C., Dangwal, S., Volkmann, I., Widera, C., et al.
(2014) Diabetes-associated micro RNAs in pediatric patients with type1dia-
betes mellitus: across-sectional cohort study. J. Clin. Endocrinol. Metab. 99,
E1661–E1665.
[19] Karolina, D. S., Armugam, A., Tavintharan, S., Wong, M. T. K., Lim, S. C., et al.
(2011) MicroRNA144 impairs insulin signaling by inhibiting the expression of
insulin receptor substrate1in type2 diabetes mellitus. PLoS One 6, e22839.
[20] Wang, S., Aurora, A. B., Johnson, B. A., Qi, X., McAnally, J., et al. (2008)
The endothelial specific microRNA miR-126 governs vascular integrity and
angiogenesis. Dev. Cell 15, 261–271.
[21] Fish, J. E., Santoro, M. M., Morton, S. U., Yu, S., Yeh, R. F., et al. (2008) miR-126
regulates angiogenic signaling and vascular integrity. Dev. Cell 15, 272–284.
[22] Zernecke, A., Bidzhekov, K., Noels, H., Shagdarsuren, E., Gan, L., et al.
(2009) Delivery of microRNA-126 by apoptotic bodies induces CXCL12-
dependent vascular protection. Sci. Signal 2, ra81.
[23] Fichtlscherer, S. and Zeiher, A. M. (2011) Circulating micrornas: biomarkers
or mediators of cardiovascular diseases? Arterioscler. Thromb. Vasc. Biol.
31, 2383–2390.
[24] Waltenberger, J., Lange, J., and Kranz, A. (2000) Vascular endothelial
growth factor-A-induced chemotaxis of monocytes is attenuated in patients
with diabetes mellitus: a potential predictor for the individual capacity to
develop collaterals. Circulation 102, 185–190.
[25] Chavali, V., Tyagi, S. C., and Mishra, P. K. (2013) Predictors and prevention
of diabetic cardiomyopathy. Diabetes Metab. Syndr. Obes. 6, 151–160. doi:
10.2147/DMSO.S30968.
[26] Meng, S., Cao, J. T., Zhang, B., Zhou, Q., and Shen, C. X. (2012) Down regu-
lation of microRNA-126 in endothelial progenitor cells from diabetes
patients, impairs their functional attributes, via target gene Spred-1. J. Mol.
Cell Cardiol. 53, 64–72.
[27] Fan J, Xu G, Jiang T, Qin Y, Wang X (2013) MicroRNA-126 Regulates Heme
Oxygenase-1-Mediated Alterations in Diabetic Retinopathy. Invest. Ophthal-
mol. Vis. Sci. 54, 6199.
[28] Ye, P., Liu, J., He, F., Xu, W., and Yao, K. (2014) Hypoxia-Induced Deregula-
tion of miR-126 and Its Regulative Effect on VEGF and MMP-9 Expression.
Int. J. Med. Sci. 11, 17–23. doi:10.7150/ijms.7329
MicroRNA 126 in Diabetes