Ecological Entomology (2020), 45, 1346–1356 DOI: 10.1111/een.

12918

Different groups of ground-dwelling spiders share

similar trophic niches in temperate forests
A N D R E Y Z U E V, 1 K E R S T I N H E I D E M A N N, 2
V L A D I S L A V L E O N O V, 1 I N A S C H A E F E R, 2 S T E F A N S C H E U, 2,3
A N D R E I T A N A S E V I T C H, 1 A L E X E I T I U N O V, 1
S E R G E Y T S U R I K O V 1 and A N T O N P O T A P O V 1,2 1 A.N. Severtsov Institute of Ecology
and Evolution, Russian Academy of Sciences, Moscow, Russia, 2 J.F. Blumenbach Institute of Zoology and Anthropology, University
of Goettingen, Goettingen, Germany and 3 Centre of Biodiversity and Sustainable Land Use, Göttingen, Germany

Abstract. 1. Generalistic interactions between predator and prey may vary with
ecosystem type, predator traits, and prey traits, but the interplay of these factors has
not been assessed in ground food webs.
2. We investigated trophic interactions of ground-dwelling spiders across eight
forests in European Russia associated with body size, hunting strategy, microhabitat
specialization, potential prey type, potential prey population density, and forest type
(coniferous vs. broadleaved). We analyzed 128 individual spiders, including juveniles,
all identified to the family level with two complementary methods: molecular gut content
analysis, and stable isotope analysis of carbon and nitrogen.
3. The results suggest that feeding frequency of spiders is affected by predator body
size and by selection of certain prey type. Stable isotope analysis showed similar trophic
niches among spider families, varying moderately with forest type. Larger spiders had
higher Δ13 C values than smaller ones, but similar Δ15 N values, suggesting that different
size classes of spiders belong to different food chains. Results based on stable isotope and
molecular gut content analyses were weakly linked, indicating them targeting different
trophic niche dimensions.
4. At least for the group-level interactions, family identity and hunting strategy of
predator has little predictive power while predator body size and prey traits affected
trophic niche dimensions calling for future studies in this direction. Large spiders
feed more and rely on different basal resources than small spiders, suggesting that
including small species and juveniles provides a more comprehensive picture of food
web organization.
Key words. Araneae, gut content, soil food web, stable isotopes, trophic niche.

Introduction species and widespread omnivory (Digel et al., 2014; Eitzinger

Predator–prey interactions shape species diversity, ecosys-
tem functioning, and stability by connecting species in food
webs (Pimm et al., 1991; Brose et al., 2017). On the forest
floor, invertebrate predators such as spiders control the abun-
dance of herbivores and detritivores, coupling brown and
green food webs (Scheu, 2002; Wise, 2004; Kersch-Becker
et al., 2018). Describing and predicting predator–prey interac-
tions in soil food webs is challenging due to the high diversity of
Correspondence: Andrey G. Zuev, Leninsky pr. 33, Moscow 119071,
Russia. E-mail: agzuev.sevin@gmail.com
et al., 2018c). Empirical studies investigating the feeding pref-
erences of ground generalist predators are needed.
Mechanisms behind predator–prey interactions may be
related to body size of predator and prey, behavioural traits,
and population density, that together shape trophic interactions
(Loreau, 2010; Rooney & McCann, 2012; Brose et al., 2019).
Body sizes of predator and prey are recognised to drive
predator–prey interactions across biomes (Brose et al., 2019),
but the same mechanism responsible for size-structured interac-
tions may result in different food-web architecture, depending
on the type of primary producers (Potapov et al., 2019b), and

1346 © 2020 The Royal Entomological Society


body size alone cannot reliably predict trophic interactions
(Nakazawa et al., 2013; Eitzinger et al., 2018c). Besides body
size, predator–prey interactions are affected by various traits of
predator and prey species, their phylogenetic position and habi-
tat conditions (Brose et al., 2006, 2019; Brousseau et al., 2018).
Further, empirical studies indicated that in soil food webs pre-
dation may depend little on environmental characteristics, prey
traits, and predator body mass, being rather taxon-specific
(Eitzinger et al., 2018).
Spiders commonly are used as the model terrestrial preda-
tors due to their high abundance and diversity in virtually any
terrestrial ecosystem (Bristowe, 1958; Rypstra, 1984; Nyffeler
& Benz, 1987; Nyffeler et al., 2017). In agricultural sites, spi-
ders consume a large number of pest species, primarily winged
insects (Nyffeler & Sunderland, 2003; Benamú et al., 2017),
while exclusion experiments showed spiders to feed also
on detritivorous insects including collembolans (Wise, 2004).
Thus, spiders are feeding on a wide range of prey types,
from small soil mesofauna to large herbivore insects, with the
amount of prey consumed correlating positively with prey den-
sity (Chant, 1956).
As generalist predators, spiders may feed on various prey
in their vicinity and thus their diet can vary with habitat, or
microhabitat. However, feeding also varies depending on par-
ticular taxonomic group of potential prey, since different prey
groups have different size, mobility, and defensive characteris-
tics (Nentwig, 1987). Hunting strategy could affect the diet as
well. For web building spiders, prey species need to be small
for not breaking the web (Bristowe, 1958), while for striders
prey needs to be rather easy to catch and handle. The webs
of different litter-dwelling spiders are similar in structure and
are characterised by simple and randomly structured patterns,
which potentially alleviates differences between spider fami-
lies derived from web architecture. Moreover, due to the limited
space, prey spectrum of web-building spiders in litter and soil
may resemble that of striders (Foelix, 2011).
Over the last decade, molecular gut content analysis has
become one of the main techniques to reconstruct trophic inter-
actions of animals at taxon-specific level (Traugott et al., 2013).
Due to the limited detection time of DNA in the gut of consumers
(Greenstone et al., 2007), molecular gut content analysis is
restricted to detecting recent trophic interactions. Taxon-specific
primers detect target prey DNA in consumers and in combina-
tion with frequency analysis this gives information on the rela-
tive importance of prey taxa for predator nutrition. The primers
for molecular gut content analyses are developed to detect even
small amounts of prey DNA (King et al., 2008). Trophic inter-
actions can be detected at different levels of taxonomic resolu-
tion depending on whether specific or more general primers are
used. In soil food webs, a range of primers at different taxo-
nomic level has been developed (Günther et al., 2014; Eitzinger
et al., 2018).
In contrast to molecular gut content analysis, stable isotope
analysis of carbon and nitrogen integrates long-term informa-
tion on the trophic niche of consumers (Post, 2002), but pro-
vides limited insight into species-specific interactions (Rick-
ers et al., 2006). The method proved to be a valuable tool to
uncover the structure of cryptic food webs, such as those in soil
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Trophic generalism of spiders in litter 1347
(Tiunov, 2007; Potapov et al., 2019c). Targeting different tax-
onomic and temporal resolution, stable isotope and molecular
gut content analyses have been rarely applied simultaneously
to understand trophic interactions in soil food webs (Günther
et al., 2014; Ferlian and Scheu, 2014).
Here, we applied molecular analysis of the gut content and
stable isotope analysis to examine the trophic interactions of
ground-dwelling spiders, as a dominant group of invertebrate
predators in soil food webs. Our main objective was to evalu-
ate the role of predator traits (body size, hunting strategy, and
microhabitat specialization), potential prey characteristics (tax-
onomic group of prey and prey abundance in the habitat) on the
trophic niche of ground-dwelling spiders. We hypothesised that
body size and hunting strategy are the main characteristics deter-
mining the prey spectrum and trophic niche of spiders. Micro-
habitat of spiders is an additional criterion bonded both with
hunting strategy and the presence of different prey groups. In
addition, we compared short-term (several days) group-specific
predator–prey interactions, assessed by molecular gut content
analysis, with long-term (several weeks, up to individual life-
time) trophic niche as indicated by the stable isotope signature
of the same individuals. The study was performed in two tem-
perate forest types (coniferous and broadleaved).
Materials and methods
Sampling sites were located in two regions in European Rus-
sia: southern taiga, Tver region, and broadleaved forest zone,
Lipetsk region. These two types of forests are most representa-
tive for ecosystems of the temperate zone in European Russia.
In each region, four forest sites were studied. The soils were
Chernozem chernic and Phaeozem albic in broadleaved forests,
and Albeluvisol umbric in southern taiga (IUSS Working Group
WRB, 2015). More details on the sampling sites are given in
Tables S1 and S2 and Butenko et al. (2017).
Sampling
Samples were taken in July 2018 within three randomly
positioned 2 × 2 m subplots within each 10 × 10 m sampling site
(total of 24 subplots and 8 sites). Spiders were collected by
sieving a 50 × 50 cm area (1 from each 2 × 2 subplot) of litter
through a 2-cm sieve, picked with forceps and an aspirator,
and put individually into vials with 96% ethanol. Vials were
transported at +4∘ C to the laboratory within 5 h after sampling
and stored at −20∘ C. Due to a large proportion of juveniles
(about 50%) and to minimise the time outside freezer, spiders
were identified to family level. This allowed us to include
juveniles that are typically excluded from ecological studies,
making our study more representatives at community level.
Identification was performed on a cooling element to prevent
animals being unfrozen. In total, 128 individual spiders of 11
families were collected and identified. Spiders of individual
families were grouped based on their hunting strategy (web
builders or striders) and microhabitat specialization (ground or
climbing understory vegetation; Table 1).
To estimate the population density of potential prey, six
randomly positioned 5-cm diameter soil cores (5 cm deep) to
1348 Andrey Zuev et al.

Table 1. Number, taxonomic affinity, and ecological traits of spiders analyzed in the study.

Family Ind. southern taiga Ind. broadleaved forest Microhabitat specialization Hunting strategy

Linyphiidae 46 10 Ground Web builders

Theridiidae 22 5 Ground / climbing the vegetation Web builders
Lycosidae 14 3 Ground Striders
Thomisidae 3 5 Ground / climbing the vegetation Striders
Hahniidae 4 0 Ground Web builders
Salticidae 3 0 Ground / climbing the vegetation Striders
Liocranidae 1 0 Ground / climbing the vegetation Striders
Tetragnathidae 1 0 Ground / climbing the vegetation Web builders
Clubionidae 0 3 Ground / climbing the vegetation Striders
Dictynidae 0 1 Ground / climbing the vegetation Web builders
Phrurolithidae 0 1 Ground Striders

Microhabitat specialization and hunting strategy were assigned according to Nentwig (1982, 1983, 1986, 1987), Nentwig and Wissel (1986) and Nyffeler
and Benz (1987). The most abundant families are marked in bold; spiders of the other families were bulked and analyzed together as “other families”.

extract mesofauna and three randomly positioned 20 × 20 soil
samples (5 cm deep) to extract macrofauna were taken from each
subplot. Animals were extracted using Tullgren funnels with
filament lamps for 2 weeks, and sorted into six target taxonomic
groups under a dissecting microscope (Table 2). In addition, one
mixed sample of soil and litter was taken from each subplot for
stable isotope analysis, dried at 55 ∘ C for 2 days and kept dry
until the analysis.
Sample preparation
Frozen ethanol-stored spiders were weighed individually with
the precision of 1 μg using Mettler Toledo MX5 electronic
scales (Mettler Toledo, USA) to estimate living body mass. Wet
weight (μg) henceforth is reported as body size. Subsequently,
the opisthosoma (abdomen) of spiders was separated from the
prosoma (front part with legs). The opisthosoma was used for
molecular gut content analyses; the prosoma was used for stable
isotope analysis.
Molecular gut content analysis
To extract DNA, samples were incubated in 75 μl of lysis
buffer (DNAdvance Genomic DNA Isolation Kit, Beckman
Coulter, Krefeld, Germany) at 37 ∘ C for 20 min, then a 2 μl
aliquot of chitinase (1 mg ml−1 , Sigma-Aldrich, Taufkirchen,
Germany) was added and samples were incubated at 37 ∘ C
for 30 min. Chitinase was thermally deactivated at 55 ∘ C for
10 min. After that, 4 μl of proteinase K (20 mM μl−1 , Beckman
Coulter, Inc., USA) was added with the subsequent incubation
on a shaker for 3 h and quick-spin centrifugation. The super-
natant was used for DNA extraction in accordance with the stan-
dard protocol for Agencourt DNAdvance Genomic DNA Isola-
tion Kit.
Extracted DNA was amplified for each spider individual using
six group-specific primers (Table 2). The reaction mix of 25 μl
volume comprised 1.25 μl forward primer, 1.25 μl reverse primer
(100 pmol μl−1 ), 1 μl MgCl2 (15 mM, Genaxxon, Ulm, Ger-
many), 2 μl BSA (3%), 12.5 μl HotStarTaq (Genaxxon, Ulm,
Germany), 6 μl HPLC H2 O (Sigma-Aldrich, Taufkirchen, Ger-
many) + 1 μl template DNA. Thermal cycle parameters included
an initial denaturation step of 10 min at 95 ∘ C followed by
35 cycles of 95 ∘ C for 30 s, the respective annealing temperature
(see Table 2) for 30 s and 72 ∘ C for 45 s, and a final extension
stage of 72 ∘ C for 3 min. Presence or absence of prey DNA after
PCR was verified using the capillary electrophoresis QIAxcel
Advanced (Qiagen, Hilden, Germany).
Stable isotope analysis
All materials for stable isotope analysis were dried at 55 ∘ C
for 24 h. Samples of soil, litter, and spiders >600 μg dry
weight were milled using a ball mill prior to the analysis
(MM 200, Retsch, Germany) and a subsample was wrapped
into tin capsules. Smaller samples were analysed as a whole.
Stable isotope composition was measured using a Thermo Delta
V Plus IRMS coupled to a Flash 1112 Elemental Analyser
(Thermo, USA). Stable isotope composition is reported as per
mil (‰) using the delta notation: dX = [(Rsample /Rstandard )-1],
where X is 15 N or 13 C and R is the corresponding ratio of
15
N/14 N or 13 C/12 C. Atmospheric nitrogen and VPDB carbon
were used as standards for nitrogen and carbon, respectively. An
internal laboratory standard (casein in the large and acetanilide
in the small samples) was run every five samples. Measurement
errors did not exceed ±0.15 ‰ for 𝛿 13 C and 𝛿 15 N. The 𝛿 13 C
and 𝛿 15 N values of litter and soil varied across the studied
regions and sampling plots (Table S2). Thus, we calibrated
𝛿 13 C and 𝛿 15 N values of spiders to those of the respective
local leaf litter: ΔX = dXspider – (dXlocal litter - dXlitter, overall average ).
Litter-calibrated Δ13 C and Δ15 N values reflect basal resources
and trophic level, respectively (Potapov et al., 2019c).
Statistical analysis
Statistical analysis was performed in R 3.6.1 (R Core
Team, 2019) with the R Studio interface (RStudio, Inc., Boston,
Massachusetts). Rarefaction tests were performed for each plot
separately for prey density and gut content (Fig. S4) analy-
ses (vegan package, Oksanen & Simpson, 2009) and showed
that our molecular gut content data are representative for the
studied field sites. To inspect for effects of potential prey

© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356


Table 2. List of group-specific primers used for amplification of prey DNA in the gut of spiders.
Target taxon Primer name Sequence 5′ –3′
Collembola (COI) Col3F GGACGATYTTRTTRGTTCG
Col5R TCTTGGCAAATGCTTTCGCAGTA
Lumbricidae (12S) 185F TGTGTACTGCCGTCGTAAGCA
14233R AAGAGCGACGGGCGATGTGT
Diptera (18S) DIP S16 CACTTGCTTCTTAAATRGACAAATT
DIP A17 TTYATGTGAACAGTTTCAGTYCA
Gamasina (18S) GAM S7 TTGGGGGCATTCGTATTGTT
GAM A8 ATAACCCTACTTWGGTTTCCCGT
Oribatida (18S) ORI S14 GCGCGCTACACTGAAGTG
ORI A16 TCCTCTAAATGWTCAAGKTTGGG
Staphylinidae (18S) STA S6 TGCGGTTAAAAAGCTCGTAGTC
STA A3 TCAATRAAGAGCACCGSGAT
group identity, potential prey density, forest type, spider family,
spider body size (wet weight), spider hunting type, and spider
microhabitat specialization on the detection of any prey DNA,
we used generalised linear mixed-effect models with binomial
distribution and sampling site as random effect (lme4 package,
Bates et al., 2015). The same set of factors without prey traits,
but with additional factors ‘sum of predator groups positive
amplifications’ (a sum of positive amplifications for Gamasina
and Staphylinidae calculated for each individual spider) and
‘sum of decomposer groups positive amplifications’ (a sum of
positive amplifications for Collembola, Oribatida, Diptera and
Lumbricidae calculated for each individual spider) were used to
explain separately Δ13 C and Δ15 N values in spiders. In the latter
case, linear mixed-effect models were used (Gaussian distribu-
tion) with the design as above for both values. Due to the large
number of factors and collinearity among them (family, hunting
strategy and microhabitat specialization of spiders), in each case
we tested a series of models (Tables S3 and S4) and choose the
most parsimonious one based on Akaike information criterion
(AIC). In total, we tested 16 models for gut content analysis
and 34 models for stable isotopes. All models first included key
factors, such as body weight, prey group, and spider family and
subsequently more factors were added. Factors and interactions
that decreased AIC were included in further models. The full list
of the models tested is given in Tables S3 and S4. Significance
of factors in the selected model was tested using Anova in the
car package in R (Type II Wald chi-square tests).
The effect of spider family, spider body size, hunting strategy,
microhabitat specialization, and forest type on the diet compo-
sition (combination of the positive prey DNA amplifications)
of spiders was inspected using MANOVA (manova in dplyr,
Wickham et al., 2015). Prior to the analysis, binomial data
were transformed to continuous data using two-dimensional
non-metric multidimensional scaling (NMDS; metaMDS in
vegan; Oksanen et al., 2019) and three derived NMDS axes
were used as the response variables. For the analysis, only
spiders with at least one positive DNA amplification were
included. Comparison of the results between stable isotope and
molecular gut content analyses was done by pairwise Spearman
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Trophic generalism of spiders in litter 1349
Size (bp) Ta (∘ C) Reference
272 62 Kuusk & Agusti, 2008; Eitzinger &
Traugott, 2011; Pompanon et al., 2012
225–236 62 Harper et al., 2005; Eitzinger & Traugott,
2011; Pompanon et al., 2012
198 62 Eitzinger et al., 2011; Eitzinger &
Traugott, 2013
230 63
299 68
152 65
correlations between 𝛿 15 N or 𝛿 13 C values in spider tissues and
specific prey group DNA detection (cor.test in stats). Both
observed and posterior isotopic niches of spiders were also
compared using the package SIBER (Jackson et al., 2011),
allowing to quantify the isotopic niches overlap between the
two studied regions. Data were visualised using the packages
bipartite (Dormann et al., 2008) and ggplot2 (Wickham, 2011).
P = 0.05 was taken as the threshold of significance.
Results
Molecular gut content analysis
In total, we obtained 17% positive PCRs among 768
predator–prey pair tests from 128 individual spiders. The
selected model (Table S3) explaining the positive prey DNA
amplifications included prey group (F 5 = 2.49, P = 0.0200),
spider body size (F 1 = 7.73, P = 0.0055), and spider family
(F 4 = 1.49, P = 0.1481), with the first two factors significantly
affecting the probability of DNA detection. Across all spider
individuals, body size correlated positively with the number of
positive amplifications. This was evident for most of the prey
groups (Collembola, Oribatida, Diptera, and Staphylinidae),
whereas Lumbricidae DNA was amplified more frequently
in small spiders (Fig. 1). Lumbricidae also was the most
commonly detected prey (19.5% of the investigated spiders;
n = 128), followed by Staphylinidae and Diptera (14.8% and
14.1%, respectively; n = 128). DNA of small-sized prey groups
with high population densities, such as Collembola, Gamasina,
and Oribatida were present in 10.1%, 8.6%, and 6.2% of the
investigated spiders (n = 128), respectively.
Diet composition of spiders also varied among families and
forest types, but the differences were not statistically significant
(Table S3). As a trend, there were more positive amplifications
for Diptera and Oribatida in broadleaved forest and Staphylin-
idae and Gamasina in southern taiga. Diptera and Staphylinidae
were detected in virtually all families of spiders in both forest
types. Linyphiidae and Lycosidae tended to be more generalistic
1350 Andrey Zuev et al.
Collembola
100%
75%
50%
25%
Probability of detection
0%
Diptera
100%
75%
50%
25%
0%
−1 0 1
Fig 1. Probability of detection of different prey groups depending on spider body size. The upper panel represents mesofauna and the lower one shows
macrofauna. Linear regression lines show the probability of detection and 95% confidence intervals. Points symbolize negative (0%) or positive (100%)
amplifications. Points are jittered to avoid overlap.
in southern taiga compared to broadleaved forest (but the num-
ber of analysed spiders was smaller in the latter forest type),
while prey amplification in Theridiidae and Thomisidae of both
forest types was similar (Fig. 2). The only marginally signifi-
cant effect was detected for spider microhabitat specialization
(F 2 = 3.0, P = 0.0574), reflecting that ground spiders tended to
feed on a wider spectrum of prey and especially to feed more on
Staphylinidae than spiders climbing the understory vegetation
(Fig. 3).
Stable isotope analysis
The selected model for Δ13 C showed a clear effect of body
size, microhabitat specialization, and family of spiders on iso-
topic composition, with the effect of spider family varying with
forest type (Table 3, Fig. S1). Striders of the families Lycosi-
dae and Thomisidae were enriched in 13 C by 0.6% and 1.8 ‰
in broadleaved forest compared to southern taiga, respectively.
Larger spiders were enriched in 13 C by 1.0 ‰ compared to
smaller ones (Fig. 4). Further, striders were enriched in 13 C by
0.6 ‰ compared to web builders.
The selected model for Δ15 N included forest type and the
sum of positive amplifications for nonpredaceous prey group
as two factors, both were nonsignificant. Also, 𝛿 15 N and spider
body size did not significantly correlate (Fig. 4). Theridiidae
and Lycosidae tended to be enriched in 15 N compared to other
families, but the difference was not significant. Web builders did
not differ in Δ15 N from striders. Despite none of these factors
Gamasina Oribatida
Lumbricidae Staphylinidae
2 −1 0 1 2 −1 0 1 2
Spider wet weight, log10(g)
being significant in the model, all spiders in which decomposer
(Oribatida, Collembola, Lumbricidae) DNA was detected in
the gut, were on average enriched in 15 N by 2.3 ‰ compared
to those without decomposer DNA in the gut. Spiders from
southern taiga were slightly enriched in 15 N compared to those
from broadleaved forest (mean Δ15 N values of 5.8‰ and 3.9‰
respectively), but the difference was not significant (Fig. S1).
The analysis of isotopic niches using the standard ellipse
method (Fig. S2) as well as posterior ellipses (Fig. S3) suggest
that isotopic niches of spider families largely overlap. However,
isotopic niches of spider families were shifted in the different
study regions. The percentage of pairwise overlap of standard
ellipses varied between 21.83% and 2.19% and that for posterior
ellipses between 38.89% and 8.57% being higher in Linyphiidae
and Theridiidae and lower in Lycosidae and Thomisidae (Table
S8). The isotopic niches of spiders in broadleaved forest were
more compact and nested within those in southern taiga.
Correlation between methods
High Δ13 C values were associated with more positive ampli-
fications of Oribatida, but the correlation was not significant.
In most of the other groups, the correlation between Δ13 C val-
ues and positive amplifications was slightly negative (Table S5).
Low Δ15 N values were associated with more positive amplifica-
tions of Collembola (R = −0.177, P = 0.046); in other cases, the
correlation was not significant. The trend was driven by the two
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
 Trophic generalism of spiders in litter 1351

Fig 2. The food-web matrix for different groups of prey detected in guts of spiders of different families. The intensity of grey color reflects the
probability of detection. White squares show no detection. Numbers in brackets are the total number of individuals analyzed in each family. Prey
density in the litter is given as decimal logarithm.

1.0
Staphylinidae_GC

0.5
Diptera_GC
NMDS2

Microhabitat
Oribatida_GC
Ground
0.0 Ground−climbing

Collembola_GC

Gamasina_GC
−0.5 Lumbricidae_GC

−1.0

−1 0 1
NMDS1

Fig 3. Non-metric multidimensional scaling based on positive amplifications of specific prey DNA in spider guts. Each point is an individual spider,
only spiders having non-zero values for gut content prey DNA amplifications were used. Ellipses show 95% confidence intervals for ground (red) and
ground-climbing (white) spiders. Pale reddish points show overlapping red and white points. [Colour figure can be viewed at wileyonlinelibrary.com].

most abundant families, Linyphiidae and Theridiidae, both web
builders (Table 1).
Discussion
This study focused on the joint effects of predator traits and
prey characteristics in two forest types on the trophic niche
of spiders. The study combined information on short-term
predator–prey interactions (i.e., molecular gut content analysis)
with information on the long-term diet (i.e., stable isotope
analysis) in ground dwelling predators. For predator traits, we
found that (1) larger spiders had more positive amplifications
of prey DNA in the gut and higher 𝛿 13 C values than smaller
ones; (2) family identity moderately affected the prey spectrum

© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356

1352 Andrey Zuev et al.
Table 3. ANOVA (Type II Wald chi-square tests) table for the selected models explaining isotopic composition in spiders (d13C_g12 for Δ13 C and
d15N_g17 for Δ15 N in the Table S4).
Response: Δ13 C
Factor Chisq Df P Factor
Body size 32.74 1 <0.001
Microhabitat 12.32 1 <0.001
Spider family 22.65 4 <0.001
Forest type 0.32 1 0.570
Spider family × forest type 9.72 4 0.045
Fig 4. Relationship between body size (wet weight, μg) and stable isotope ratios (Δ13 C and Δ15 N values) in spiders.
and did not affect Δ15 N values, but Δ13 C values differed
among spider families; (3) hunting strategy and microhabitat
specialization provided little additional information, however,
ground spiders tended to feed more on Staphylinidae than those
climbing the vegetation. For prey characteristics, we found that
(1) different prey groups were consumed at different frequency,
with Lumbricidae DNA found most frequently in spider guts,
while (2) prey density was not related to prey detection in the
gut of spiders. Forest type little affected both prey spectrum
(gut DNA) and stable isotope composition. There were no
significant correlations between the results of two methods.
The simultaneous consumption of several prey types usually
does not distort the amplification results for each single prey
group (Fülöp et al., 2019), but we cannot confidently say that
all possible positive trophic relationships were revealed con-
sidering the high rates of DNA degradation in guts (Pompozzi
et al., 2019). This is especially true for external digestive sys-
tem of spiders (Juen & Traugott, 2005; Sheppard et al., 2005;
Kuusk et al., 2008), where digestion time is also affected by
many external factors, including the amount and composition
of consumed prey. Therefore, detection rate of prey types might
be underestimated for small-sized spiders, due to small amount
of total DNA (Macías-Hernández et al., 2018).
Effect of body size
The larger number of positive amplifications obtained for
larger spiders correlated well with data on high feeding com-
petitiveness of larger individuals of web-building Linyphiidae
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Response: Δ15 N
Chisq Df P
Forest type 2.62 1 0.106
Sum of decomposer group prey 2.32 1 0.128
(Eichenberger et al., 2009). It was also expected that larger
spiders consume a wider range of prey of different size (Nen-
twig, 1987), resulting the increasing taxonomic variety of
potential prey. However, testing this hypothesis requires more
specific primers for analysis of gut content DNA while only
group-specific primers were used in the present study. Notably,
we more often found prey DNA in large spiders, despite the
predator DNA overrepresentation in comparison to the prey
DNA in bulk body samples (Macías-Hernández et al., 2018).
The positive correlation of body size with Δ13 C values may
be an indicator of size-dependent feeding preferences of spiders.
Decomposers in “brown” food chains (for example, Collembola
and Oribatida) are enriched in 13 C compared to herbivorous
animals in grazing food chains (Potapov et al., 2019c). Larger
spiders were enriched in 13 C, which may be explained by more
frequent feeding on decomposers. This suggestion was partly
supported by gut content analysis: larger spiders tended to
have more positive amplifications for Collembola and especially
Oribatida.
Spiders were collected and kept in ethanol, which extracts
13
C-depleted lipids and can potentially increase 𝛿 13 C values
in the remaining tissue (Boecklen et al., 2011). Although the
effect of ethanol on 𝛿 13 C values in macroarthropods is typically
small (Potapov et al., 2019c), it should be taken into account.
It can be reasonably assumed that the extraction of lipids by
ethanol is more efficient in smaller specimens. Thus, smaller
spiders should get more enriched in 13 C compared to larger ones,
which could only weaken the pattern observed (Fig. 4). Thus, the
effect of alcohol preservation was not likely to affect our main
conclusions.

Δ15 N values generally were not affected by spider body size,
indicating spiders of all size being at a similar trophic level.
This was unexpected since larger predators are usually assumed
to occupy higher trophic levels (Riede et al., 2011), but fits the
concept of size compartmentalization of soil food webs where
small and large organisms form parts of different trophic chains
(Potapov et al., 2019a).
Isotopic data of spider families in this study compare well
with published values (Halaj et al., 2005; Okuzaki et al., 2009,
Korobushkin et al., 2014; Goncharov et al., 2014; Table S6).
Spiders were enriched by 4.7–12.6‰ in 15 N and by 2.2–5.5‰
in 13 C relative to leaf litter, suggesting that they occupy different
predator trophic levels in soil food webs. Lycosidae and Theridi-
idae were most enriched in both 13 C and 15 N, suggesting that that
these spiders are most heavily involved in intraguild predation.
Clubionidae were most depleted in 15 N potentially because they
feed mainly on herbivores. Generally, however, the wide overlap
of stable isotope values among families emphasises that trophic
level omnivory is widespread in spiders.
Another factor that determines prey choice of spiders is
their hunting strategy. In particular, web building spiders are
assumed to be less generalistic compared to free-roaming
spiders (Foelix, 2011). However, we did not detect signifi-
cant variations in prey spectrum or stable isotope values with
hunting strategy alone or in combination with body size. This
again points at trophic generalism among spiders, leading
to the blurred effect of hunting strategy. We observed that
ground-dwelling spiders were more intensively feeding on
Staphylinidae than spiders climbing the vegetation while the
other prey groups were detected at similar frequency. Staphylin-
idae are known as litter-dwellers (Gandhi et al., 2001); thus,
they presumably are less available for spiders climbing the
vegetation. The diet of web-building spiders predominantly
comprises flying prey such as Diptera (Foelix, 2011). However,
in our study the contribution of Diptera to the diet of striders
and web-building spiders, as indicated by detection frequency,
was similar (12.8% and 17.5% of tested spiders, respectively),
suggesting that striders may feed on soil and litter living larvae
of the same groups of flying insects that are caught into by
web building spiders. Thus, along with published data (Nen-
twig, 1987; Riechert & Lawrence, 1997; Foelix, 2011), our
results highlight that the diet between striders and web-building
spiders overlaps widely despite the different hunting strategies
at least if they share the same habitat (i.e. leaf litter).
Effect of prey type and density
The relatively high detection frequency of Lumbricidae DNA
in the gut of spiders was unexpected, but corresponds to ear-
lier reports from field observations (Nyffeler et al., 2001) and
molecular gut content analyses (Eitzinger & Traugott, 2011;
Curtsdotter et al., 2019). The high rates of positive amplifica-
tions at least in part may have been due to high sensitivity of
the Lumbricidae primer used (Eitzinger & Traugott, 2011). Even
though detection frequency might be overestimated in compar-
ison to other prey taxa, the frequent detection of Lumbricidae
DNA in spiders, including small individuals, suggests that Lum-
bricidae may play a more important role in the diet of spiders
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Trophic generalism of spiders in litter 1353
than previously assumed, directly or via secondary predation.
The exact mechanisms of prey capture and feeding however
needs further investigation.
The numbers of positive amplifications for small-sized prey, in
particular Diptera and Collembola, was relatively low, although
these groups are numerically abundant and usually soft-skinned
and thus not well protected from predation. Earlier studies also
found the frequency of positive amplifications of prey DNA
in the gut of predators correlated poorly with prey density
(Günther et al., 2014), or with the abundance of certain groups
of prey (Schmidt et al., 2018). Limited feeding on small prey
may reflect that spiders prefer to capture large prey, which is
energetically more efficient (Brose et al., 2008).
Effect of forest type
Prey spectrum varies with habitat type and habitat type has
been shown to be a major determinant of the diet of spiders (Nen-
twig, 1983; Ludy, 2007). Unexpectedly, however, in our study
the differences in the prey spectrum of spiders between forest
types were relatively small, especially for web-builders. At finer
taxonomic resolution, the spectrum of prey consumed has been
shown to vary with available prey spectrum (Eitzinger et al.,
2018). Contrasting our study, the trophic niche of centipedes,
another major predator group in forests, has been shown to
vary with forest type (Ferlian et al., 2012). However, these stud-
ies were based on fatty acid analysis reflecting basal resources
rather than predator–prey interactions. Shifts in resources of
individual spider families were also observed in our study. How-
ever, the isotopic niches may be less informative to reconstruct
predator–prey interactions compared to prey DNA detection,
since they reflect changes in the trophic niche of the prey, not
only the predator itself. Overall, results of the present study
suggest that the variations in forest type in the temperate zone
moderately affect trophic niches of litter-dwelling predators, at
least on the group level (Klarner et al., 2014).
Correlation between methods
The results of stable isotope analyses weakly correlated
with the results of molecular gut content analyses. The two
methods are integrating trophic interactions at different time
scales. Stable isotope composition of consumers reflect the
diet during the last weeks or months (Potapov et al., 2019c),
whereas molecular gut content analysis reflects current trophic
interactions of the last few days (e.g. Pompozzi et al., 2019).
In this way, the simultaneous use of stable isotope composition
and molecular gut content analyses provides trophic interactions
data at selected taxonomic or ecological) level. Our data show
that the Δ15 N values of spider tissues (trophic level) tended
to decrease with the number of positive amplifications of
Collembola (Table S7). Although Collembola belong mainly
to detrital food webs, many atmobiotic species (likely most
available to spiders) are feeding on nonvascular plants and are
strongly depleted in 15 N (Potapov et al., 2016). At the same
time, the increase in Δ13 C with the body size matches with the
general increase of prey detection in larger spiders, referring the
1354 Andrey Zuev et al.
greater uptake from brown food chains by larger predators. Thus,
the two methods in combination allow more in depth insight into
different aspects of trophic interactions in food webs (Traugott
et al., 2013; Birkhofer et al., 2017).
Conclusions
In this study, we simultaneously used molecular gut content and
stable isotope analyses in order to reconstruct trophic niches of
spiders in soil food webs. Our results support the assumption
that trophic generalism is widespread across spider families,
hunting strategies, and forest types. We showed that different
prey groups are consumed with different frequency, which is
not clearly related to their potential availability (population
density of prey). Body size of spiders correlated with Δ13 C, but
not Δ15 N values, suggesting that large and small spiders may
form a part of food chains based on different basal resources.
Both methods suggested size-related trophic differentiation in
spiders, with larger spiders tended to receive more energy from
decomposer prey, i.e. detrital channels. Overall, we showed
that in soil food webs body size affects predator enrolment
in different energy channels, while spiders with different tax-
onomic affiliation (on family level) and ecological strategies
have similar trophic niches.
Acknowledgements
The study was supported by the Russian Foundation for
Basic Research (project 18-04-01200) and in part by the
Deutsche Forschungsgemeinschaft (DFG, German Research
Foundation) – project number 192626868 – SFB 990 in the
framework of the collaborative German – Indonesian research
project CRC990. Sergey Tsurikov was supported by Russian
Foundation for Basic Research (project 18-34-00830). We are
grateful to Konstantin Gongalsky, Oksana Rozanova and Maxim
Degtyarev who supported our work on the study sites. We thank
two anonymous reviewers for their valuable comments. The
authors have no conflicts of interest to report.
Contribution of authors
Andrey Zuev did the data collection, stable isotope and molec-
ular gut content analyses, data analyses and manuscript prepa-
ration.
Kerstin Heidemann and Ina Schaefer consulted for the gut
content analysis, supervised laboratory analysis and helped with
manuscript revision.
Sergey Tsurikov helped with the data collection and stable
isotope analyses.
Vladislav Leonov helped with the data collection and
manuscript revision.
Andrei Tanasevitch identified spiders and consulted about the
spider ecology.
Stefan Scheu and Alexei Tiunov helped with the project
design and manuscript revision.
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Anton Potapov supervised the project design, data analyses
and manuscript preparation.
All authors contributed to the manuscript writing on different
stages.
Data Availability Statement
The data that support the findings of this study are openly
available in Figshare at http://doi.org/10.6084/m9.figshare.
12520010.
Supporting Information
Additional supporting information may be found online in the
Supporting Information section at the end of the article.
Table S1. Description of studied forests.
Table S2. Stable isotope composition of soil and litter in each
forest.
Table S3. The list of candidate binomial generalized linear
models explaining the prey detection (presence/absence data) in
spiders.
Table S4. The list of candidate general linear models testing
explaining the isotopic composition of spiders.
Table S5. MANOVA table on the effects of microhabitat, forest
type and body size on NMDS results for combined data of gut
content DNA and stable isotope analysis.
Table S6. Stable isotope composition of spiders from different
families: our data compared to published data.
Table S7. Spearman correlations between stable isotope com-
position of spider tissues and the amount of positive gut content
amplifications for different prey groups
Table S8. The proportion of standard and posterior standard
ellipses overlap between two studied forest types (broadleaved
forest and southern taiga) for different spider families.
Fig. S1. Stable isotope composition of spider individuals of
different families.
Fig. S2. Stable isotope niches of spiders of different families
visualized with the use of SIBER package in R. Standard
ellipses.
Fig. S3. Stable isotope niches of spiders of different families
visualized with the use of SIBER package in R. Posterior
Bayesian ellipses.
Fig. S4. Rarefaction test results for gut content analyses.
References
Bates, D., Mächler, M., Bolker, B.M. & Walker, S.C. (2015) Fitting lin-
ear mixed-effects models using lme4. Journal of Statistical Software,
67, 1406.5823.
Benamú, M.A., Lacava, M., García, L.F., Santana, M. & Viera, C. (2017)
Spiders associated with agroecosystems: Roles and perspectives. In

Behaviour and Ecology of Spiders: Contributions from the Neotropi-
cal Region, pp. 275–302. Cham: Springer International Publishing.
Birkhofer, K., Bylund, H., Dalin, P., Ferlian, O., Gagic, V., Hambäck,
P.A. et al. (2017) Methods to identify the prey of invertebrate
predators in terrestrial field studies. Ecology and Evolution, 7,
1942–1953.
Boecklen, W.J., Yarnes, C.T., Cook, B.A. & James, A.C. (2011) On the
use of stable isotopes in trophic ecology. Annual Review of Ecology,
Evolution, and Systematics, 42, 411–440.
Bristowe, W.S. (1958) The World of Spiders. Collins, London, U.K.
Brose, U., Jonsson, T., Berlow, E.L., Warren, P., Banasek-Richter, C.,
Bersier, L.F. et al. (2006) Consumer-resource body-size relationships
in natural food webs. Ecology, 87, 2411–2417.
Brose, U., Ehnes, R.B., Rall, B.C., Vucic-Pestic, O., Berlow, E.L.
& Scheu, S. (2008) Foraging theory predicts predator-prey energy
fluxes. Journal of Animal Ecology, 77, 1072–1078.
Brose, U., Blanchard, J.L., Eklöf, A., Galiana, N., Hartvig, M., Hirt,
M.R. et al. (2017) Predicting the consequences of species loss using
size-structured biodiversity approaches: consequences of biodiversity
loss. Biological Reviews, 92, 684–697.
Brose, U., Archambault, P., Barnes, A.D., Bersier, L.F., Boy, T.,
Canning-Clode, J. et al. (2019) Predator traits determine food-web
architecture across ecosystems. Nature Ecology and Evolution, 3,
919–927.
Brousseau, P.-M., Gravel, D. & Handa, I.T. (2018) Trait matching
and phylogeny as predictors of predator-prey interactions involving
ground beetles. Functional Ecology, 32, 192–202.
Butenko, K.O., Gongalsky, K.B., Korobushkin, D.I., Ekschmitt, K.
& Zaitsev, A.S. (2017) Forest fires alter the trophic structure of
soil nematode communities. Soil Biology and Biochemistry, 109,
107–117.
Chant, D.A. (1956) Predacious spiders in orchards in south-eastern
England. Journal of Horticultural Science, 31, 35–46.
Curtsdotter, A., Banks, H.T., Banks, J.E., Jonsson, M., Jonsson, T.,
Laubmeier, A.N. et al. (2019) Ecosystem function in predator-prey
food webs-confronting dynamic models with empirical data. Journal
of Animal Ecology, 88, 196–210.
Digel, C., Curtsdotter, A., Riede, J., Klarner, B. & Brose, U. (2014)
Unravelling the complex structure of forest soil food webs: higher
omnivory and more trophic levels. Oikos, 123, 1157–1172.
Dormann, C.F., Gruber, B. & Fründ, J. (2008) Introducing the Bipartite
Package: Analysing Ecological Networks. R news, 8, 8–11.
Eichenberger, B., Siegenthaler, E. & Schmidt-Entling, M.H. (2009)
Body size determines the outcome of competition for webs among
alien and native sheetweb spiders (Araneae: Linyphiidae). Ecological
Entomology, 34, 363–368.
Eitzinger, B. & Traugott, M. (2011) Which prey sustains cold-adapted
invertebrate generalist predators in arable land? Examining prey
choices by molecular gut-content analysis. Journal of Applied Ecol-
ogy, 48, 591–599.
Eitzinger, B., Micic, A., Körner, M., Traugott, M. & Scheu, S. (2013)
Unveiling soil food web links: new PCR assays for detection of
prey DNA in the gut of soil arthropod predators. Soil Biology and
Biochemistry, 57, 943–945.
Eitzinger, B., Abrego, N., Gravel, D., Huotari, T., Vesterinen, E.J.
& Roslin, T. (2018) Assessing changes in arthropod predator-prey
interactions through DNA-based gut content analysis-variable envi-
ronment, stable diet. Molecular Ecology, 28(2), 266–280.
Eitzinger, B., Rall, B.C., Traugott, M. & Scheu, S. (2018c) Testing the
validity of functional response models using molecular gut content
analysis for prey choice in soil predators. Oikos, 127, 915–926.
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Trophic generalism of spiders in litter 1355
Eitzinger, B., Abrego, N., Gravel, D., Huotari, T., Vesterinen, E.J. &
Roslin, T. (2019) Assessing changes in arthropod predator-prey inter-
actions through DNA-based gut content analysis-variable environ-
ment, stable diet. Molecular Ecology, 28, 266–280.
Ferlian, O., Scheu, S. & Pollierer, M.M. (2012) Trophic interactions in
centipedes (Chilopoda, Myriapoda) as indicated by fatty acid patterns:
variations with life stage, forest age and season. Soil Biology and
Biochemistry, 52, 33–42.
Ferlian, O. & Scheu, S. (2014) Shifts in trophic interactions with
forest type in soil generalist predators as indicated by complementary
analyses of fatty acids and stable isotopes. Oikos, 123, 1182–1191.
Foelix, R. (2011) Biology of Spiders. Oxford University Press, New
York, New York.
Fülöp, D., Szita, É., Gerstenbrand, R., Tholt, G. & Samu, F. (2019)
Consuming alternative prey does not influence the DNA detectability
half-life of pest prey in spider gut contents. PeerJ, 7, e7680.
Gandhi, K.J.K., Spence, J.R., Langor, D.W. & Morgantini, L.E. (2001)
Fire residuals as habitat reserves for epigaeic beetles (Coleoptera:
Carabidae and Staphylinidae). Biological Conservation, 102,
131–141.
Goncharov, A.A., Khramova, E.Y. & Tiunov, A.V. (2014) Spatial
variations in the trophic structure of soil animal communities in boreal
forests of Pechora-Ilych nature reserve. Eurasian Soil Science, 47,
441–448.
Greenstone, M.H., Rowley, D.L., Weber, D.C., Payton, M.E. &
Hawthorne, D.J. (2007) Feeding mode and prey detectability
half-lives in molecular gut-content analysis: an example with two
predators of the Colorado potato beetle. Bulletin of Entomological
Research, 97, 201–209.
Günther, B., Rall, B.C., Ferlian, O., Scheu, S. & Eitzinger, B. (2014)
Variations in prey consumption of centipede predators in forest
soils as indicated by molecular gut content analysis. Oikos, 123,
1192–1198.
Halaj, J., Peck, R.W. & Niwa, C.G. (2005) Trophic structure of a
macroarthropod litter food web in managed coniferous forest stands:
a stable isotope analysis with 𝛿 15 N and 𝛿 13 C. Pedobiologia, 49,
109–118.
Harper, G.L., King, R.A., Dodd, C.S., Harwood, J.D., Glen, D.M.,
Bruford, M.W. & Symondson, W. O. C. (2005). Rapid screening
of invertebrate predators for multiple prey DNA targets. Molecular
Ecology, 14, 819–827.
IUSS Working Group WRB. World reference base for soil resources
2014, update (2015): International soil classification system for
naming soils and creating legends for soil maps. World Soil Resources
Reports, 106, 192.
Jackson, A.L., Inger, R., Parnell, A.C. & Bearhop, S. (2011) Comparing
isotopic niche widths among and within communities: SIBER–stable
isotope Bayesian ellipses in R. The Journal of Animal Ecology, 80,
595–602.
Juen, A. & Traugott, M. (2005) Detecting predation and scavenging
by DNA gut-content analysis: a case study using a soil insect
predator-prey system. Oecologia, 142, 344–352.
Kersch-Becker, M.F., Grisolia, B.B., Campos, M.J. & Romero,
G.Q. (2018) The role of spider hunting mode on the strength of
spider–plant mutualisms. Oecologia, 188, 213–222.
King, R.A., Read, D.S., Traugott, M. & Symondson, W.O.C. (2008)
Invited review: molecular analysis of predation: a review of best prac-
tice for DNA-based approaches. Molecular Ecology, 17, 947–963.
Klarner, B., Ehnes, R.B., Erdmann, G., Eitzinger, B., Pollierer, M.M.,
Maraun, M. et al. (2014) Trophic shift of soil animal species with
forest type as indicated by stable isotope analysis. Oikos, 123,
1173–1181.
1356 Andrey Zuev et al.
Korobushkin, D.I., Gongalsky, K.B. & Tiunov, A.V. (2014) Isotopic
niche (𝛿 13 C and 𝛿 15 N values) of soil macrofauna in temperate forests.
Rapid Communications in Mass Spectrometry, 28, 1303–1311.
Kuusk, A.K. & Agusti, N. (2008). Group-specific primers for
DNA-based detection of springtails (Hexapoda: Collembola) within
predator gut contents. Molecular Ecology Resources, 8, 678–681.
Kuusk, A.K., Cassel-Lundhagen, A., Kvarnheden, A. & Ekbom, B.
(2008) Tracking aphid predation by lycosid spiders in spring-sown
cereals using PCR-based gut-content analysis. Basic and Applied
Ecology, 9, 718–725.
Loreau, M. (2010) Linking biodiversity and ecosystems: towards a
unifying ecological theory. Philosophical Transactions of the Royal
Society B: Biological Sciences, 365, 49–60.
Ludy, C. (2007) Prey selection of orb-web spiders (Araneidae) on field
margins. Agriculture, Ecosystems and Environment, 119, 368–372.
Macías-Hernández, N., Athey, K., Tonzo, V., Wangensteen, O.S.,
Arnedo, M. & Harwood, J.D. (2018) Molecular gut content analysis
of different spider body parts. PLoS One, 13, e0196589.
Nakazawa, T., Ohba, S.Y. & Ushio, M. (2013) Predator-prey body
size relationships when predators can consume prey larger than
themselves. Biology Letters, 9, 20121193.
Nentwig, W. (1982) Epigeic spiders, their potential prey and competi-
tors: relationship between size and frequency. Oecologia (Berl), 55,
130–136.
Nentwig, W. (1983) The prey of web-building spiders compared with
feeding experiments (Araneae: Araneidae, Linyphiidae, pholcidae,
Agelenidae). Oecologia, 56, 132–139.
Nentwig, W. (1986) Non-webbuilding spiders: prey specialists or gen-
eralists? Oecologia, 69, 571–576.
Nentwig, W. (1987) The prey of spiders. Ecophysiology of Spiders, pp.
249–263. Springer, Berlin Heidelberg, Germany.
Nentwig, W. & Wissel, C. (1986) A comparison of prey lengths among
spiders. Oecologia, 68, 595–600.
Nyffeler, M. & Benz, G. (1987) Spiders in natural pest control: a review.
Journal of Applied Entomology, 103, 321–339.
Nyffeler, M. & Sunderland, K.D. (2003) Composition, abundance and
pest control potential of spider communities in agroecosystems: a
comparison of European and US studies. Agriculture, Ecosystems and
Environment, 95, 579–612.
Nyffeler, M., Moor, H. & Foelix, R.F. (2001) Spiders feeding on
earthworms. The Journal of Arachnology, 29, 119–124.
Nyffeler, M., Lapinski, W., Snyder, A. & Birkhofer, K. (2017) Spiders
feeding on earthworms revisited: consumption of giant earthworms in
the tropics. Journal of Arachnology, 45, 242–247.
Oksanen, J., Blanchet, F.G., Friendly, M., Kindt, R., Legendre, P.,
McGlinn, D., Minchin, P.R., et al. (2019). vegan: Community Ecol-
ogy Package. R package version 2.5-5. https://CRAN.R-project.org/
package=vegan (accessed 1 March 2019).
Okuzaki, Y., Tayasu, I., Okuda, N. & Sota, T. (2009) Vertical het-
erogeneity of a forest floor invertebrate food web as indicated by
stable-isotope analysis. Ecological Research, 24, 1351–1359.
Pimm, S.L., Lawton, J.H. & Cohen, J.E. (1991) Food web patterns and
their consequences. Nature, 350, 669–674.
Pompanon, F., Deagle, B.E., Symondson, W.O., Brown, D.S., Jar-
man, S.N. & Taberlet, P. (2012) Who is eating what: diet assess-
ment using next generation sequencing. Molecular Ecology, 21,
1931–1950.
Pompozzi, G., García, L.F., Petráková, L. & Pekár, S. (2019) Distinct
feeding strategies of generalist and specialist spiders. Ecological
Entomology, 44, 129–139.
© 2020 The Royal Entomological Society, Ecological Entomology, 45, 1346–1356
Post, D.M. (2002) The long and short of food-chain length. Trends in
Ecology and Evolution., 17, 269–277.
Potapov, A.A., Semenina, E.E., Korotkevich, A.Y., Kuznetsova, N.A.
& Tiunov, A.V. (2016). Connecting taxonomy and ecology: Trophic
niches of collembolans as related to taxonomic identity and life forms.
Soil Biology and Biochemistry, 101, 20–31.
Potapov, A.M., Brose, U., Scheu, S. & Tiunov, A.V. (2019a) Trophic
position of consumers and size structure of food webs across aquatic
and terrestrial ecosystems. The American Naturalist, 194, 823–839.
Potapov, A.M., Scheu, S. & Tiunov, A.V. (2019b) Trophic consistency
of supraspecific taxa in belowground invertebrate communities. Func-
tional Ecology, 33, 1172–1183.
Potapov, A.M., Tiunov, A.V. & Scheu, S. (2019c) Uncovering trophic
positions and food resources of soil animals using bulk natural stable
isotope composition. Biological Reviews, 94, 37–59.
R Core Team. (2019) A language and environment for statistical com-
puting [WWW document]. URL https://repo.bppt.go.id/cran/web/
packages/dplR/vignettes/intro-dplR.pdf (accessed 1 March 2019)
Rickers, S., Langel, R. & Scheu, S. (2006) Stable isotope analyses
document intraguild predation in wolf spiders (Araneae: Lycosidae)
and underline beneficial effects of alternative prey and microhabitat
structure on intraguild prey survival. Oikos, 114, 471–478.
Riechert, S.E. & Lawrence, K. (1997) Test for predation effects of single
versus multiple species of generalist predators: spiders and their insect
prey. Entomologia Experimentalis et Applicata, 84, 147–155.
Riede, J.O., Brose, U., Ebenman, B., Jacob, U., Thompson, R.,
Townsend, C.R. et al. (2011) Stepping in Elton’s footprints: a general
scaling model for body masses and trophic levels across ecosystems.
Ecology Letters, 14, 169–178.
Rooney, N. & McCann, K.S. (2012) Integrating food web diversity,
structure and stability. Trends in Ecology and Evolution, 27, 40–46.
Rypstra, A.L. (1984) A relative measure of predation on web-spiders in
temperate and tropical forests. Oikos, 43, 129.
Scheu, S. (2002) The soil food web: structure and perspectives. Euro-
pean Journal of Soil Biology, 38, 11–20.
Schmidt, N.M., Mosbacher, J.B., Eitzinger, B., Vesterinen, E.J. &
Roslin, T. (2018) High resistance towards herbivore-induced habitat
change in a high Arctic arthropod community. Biology Letters, 14,
20180054.
Sheppard, S.K., BELL, J., Sunderland, K.D., Fenlon, J., Skervin, D.
& Symondson, W.O.C. (2005) Detection of secondary predation by
PCR analyses of the gut contents of invertebrate generalist predators.
Molecular Ecology, 14, 4461–4468.
Tiunov, A.V. (2007) Stable isotopes of carbon and nitrogen in soil
ecological studies. Biology Bulletin, 34, 395–407.
Traugott, M., Kamenova, S., Ruess, L., Seeber, J. & Plantegenest, M.
(2013) Empirically characterising trophic networks: what emerging
DNA-based methods, stable isotope and fatty acid analyses can offer.
Advances in Ecological Research, 49, 177–224.
Wickham, H. (2011) ggplot2. Wiley Interdisciplinary Reviews: Compu-
tational Statistics, 3, 180–185.
Wickham, H., Francois, R., Henry, L. & Müller, K. (2015) dplyr: A
grammar of data manipulation. R package version 0.4, 3.
Wise, D.H. (2004) Wandering spiders limit densities of a major
microbi-detritivore in the forest-floor food web. Pedobiologia, 48,
181–188.
Accepted 16 June 2020
First published online 23 July 2020
Associate Editor: Dirk Sanders