RESEARCH ARTICLE

Molecular Cloning and

Characterization of the
Gonadotropin Subunits GPa,
FSHb, and LHb Genes in the
Stinging Catfish Heteropneustes
fossilis: Phylogeny, Seasonal Expression,
and Pituitary Localization
ARUP ACHARJEE1, RADHA CHAUBE2,
1
AND KEERIKKATTIL PAILY JOY *
1
Department of Zoology, Centre of Advanced Study, Banaras Hindu University, Varanasi, India
2
Department of Zoology, Mahila Mahavidyalaya, Banaras Hindu University, Varanasi, India

ABSTRACT Gonadotropins are heterodimeric glycoproteins secreted by the pituitary, and consist of a common
glycoprotein hormone alpha (GPa) and the function-specific follicle-stimulating hormone beta
subunit (FSHb) or luteinizing hormone beta subunit (LHb). In the present study, the subunit protein
genes were cloned and characterized from the pituitary of the catfish Heteropneustes fossilis. Full-
length cDNAs of GPa, FSHb, and LHb are 511 base pairs (bp), 659 bp and 660 bp long, and encode 92,
108, and 112 aminoacids long mature proteins, respectively. GPa has 10 cysteines with 2 N-linked
glycosylation sites while LHb contains 12 cysteines with a single N-linked glycosylation site. In
contrast, FSHb has 13 cysteines, 1 additional over the conserved 12 cysteines of other vertebrates,
and a single glycosylation site between Cys 3 and Cys 4. Phylogenetic analyses of the deduced
proteins confirm their homology and relationships with the respective gonadotropin subunit
proteins of gnathostome vertebrates. Tissue expression analysis by semi-quantitative RT-PCR shows
that GPa mRNA is expressed only in the pituitary while both FSHb and LHb mRNA are expressed in
extra-pituitary sites. The subunit mRNAs show both seasonal and sex dimorphic variations especially
in the expression of FSHb and LHb transcripts. In the sexually quiescent phase, the transcript
expression is low while in the recrudescent phase, the expressions are differential, high, and varied
with regard to sex and reproductive phase. In situ hybridization of the mRNAs gave positive signals in
gonadotropes in the pars distalis of the pituitary, which exhibited seasonal variation in staining
intensity and numbers. J. Exp. Zool. 323A:567–585, 2015. © 2015 Wiley Periodicals, Inc.
How to cite this article: Acharjee A, Chaube R, Joy KP. 2015. Molecular cloning and
J. Exp. Zool. characterization of the gonadotropin subunits GPa, FSHb, and LHb genes in the stinging
323A:567–585, catfish Heteropneustes fossilis: Phylogeny, seasonal expression and pituitary localization. J. Exp.
2015 Zool. 323A:567–585.

Grant sponsor: Department of Science and Technology; grant number: SA/ Advanced Study, Banaras Hindu University, Varanasi 221005, India.
SO/AS-43/2009. E-mail: kpjoybhu@gmail.com
Conflicts of interest: None Received 28 January 2015; Revised 1 May 2015; Accepted 21 May 2015
Additional supporting information may be found in the online version DOI: 10.1002/jez.1949
of this article. Published online 23 July 2015 in Wiley Online Library

(wileyonlinelibrary.com).
Correspondence to: K. P. Joy, Department of Zoology, Centre of

© 2015 WILEY PERIODICALS, INC.

568
In vertebrates, reproductive activity is controlled and coordinated
by the brain-pituitary-gonadal (BPG)-endocrine axis (Yaron
et al., 2003; Rosenfled et al., 2007; Levavi-Sivan et al., 2010;
Zohar et al., 2010). The classical reproductive hormones of the
BPG-axis are gonadotropin-releasing hormones (GnRH), gona-
dotropins (GtHs), and gonadal steroid hormones, as well as a host
of other regulatory molecules that act on the BPG-axis in a
paracrine/autocrine manner. The GtHs are glycoprotein hor-
mones secreted by gonadotropes in the pars distalis of the
pituitary. These are the follicle-stimulating hormone (FSH) and
luteinizing hormone (LH), each having a common alpha (a)
subunit and a hormone-specific beta (b) subunit (Pierce and
Parsons, '81). The subunits bind noncovalently forming a
biologically active dimeric peptide hormone (Boime and
Ben-Menahem, '99). The GtHs act through distinct receptors
(LH and FSH receptors), which are long polypeptide chains with a
transmembrane topology of G-protein coupled receptors (GPCR)
belonging to the rhodopsin/b2 adrenergic receptor subfamily
(Gether, 2000).
In vertebrates with the exception of cyclostomes, the duality
and homology of GtHs have been established (Li and Ford, '98;
Qu
erat et al., 2000). However, in catfishes only a single GtH of LH
type has been characterized (Koide et al., '92; Schulz et al., '97),
though the genes for both FSHb and LHb subunits have been
isolated and characterized (channel catfish Ictalurus punctatus,
Liu et al., 2001; African catfish Clarias gariepinus, Vischer et al.,
2003a; Southern catfish Silurus meridionalis, Wu et al., 2009). In
the African catfish, LH was the only GtH detected in circulation
(Vischer et al., 2003b). In the catfish, Heteropneustes fossilis,
earlier studies by Sundararaj and Samy ('74), adopting chemical
purification procedures used for isolating mammalian GtHs,
demonstrated only a single LH-like protein that induced
maturation and ovulation. Subsequently, a heterologous radio-
immunoassay using the antibodies against purified African
catfish GtH (LH type), GtH activity was investigated in relation to
the annual reproductive cycle, photo-thermal alterations, and
under altered physiological states induced by ovariectomy and/or
E2 replacement, GnRH analogue, monoamine-blocking agents
such as pimozide, pargyline and diethyldithiocarbamate,
g-amino butyric acid (GABA) and its blocker, and the GtH
inhibitor methallibure (Senthilkumaran and Joy, '94, '95, '96,
1998; Tharakan and Joy, '96; Joy et al., 1997). The results also
suggest that H. fossilis may have a single GtH of the LH type that
takes care of gametogenesis and spawning (Chaube et al., 2015).
The non-availability of native FSH has been an impediment in
investigating the role of FSH in catfishes. The production of
recombinant catfish GtHs in both African catfish (Vischer et al.,
2003b) and channel catfish (Zmora et al., 2007) has helped to
analyze receptor binding characteristics and functions. The FSH
recombinant protein activates the GtH receptors in vitro,
promoted steroidogenesis, up-regulated steroidogenic enzyme
genes in the channel catfish ovarian follicles, and increased
J. Exp. Zool.
ACHARJEE ET AL.
androgen secretion in the African catfish testis (Schulz et al.,
2010; Zmora et al., 2007). The FSH receptor is promiscuous while
LH receptor is highly selective. Interestingly, the FSH and LH
dose–response curves for each of these biological activities
clearly demonstrate differences in their cellular action and
physiological roles.
In order to extend further our studies on GtH biology in
H. fossilis, we have attempted molecular cloning and character-
ization of FSH and LH subunit genes, and deduced their
phylogenetic relationships, as a first step for developing
recombinant proteins and antibodies. Tissue, seasonal and spatial
expression patterns of the genes were studied by reverse
transcriptase (RT)- polymerase chain reaction (PCR), quantitative
(q) PCR and in situ hybridization techniques. The catfish is widely
used as an aquaculture species and the availability of GtHs can
promote aquaculture practice in a big way. Further, the catfish is
the lone member of the family Heteropneustidae or Saccobran-
chidae and is, therefore, important in phylogenetic studies.
MATERIALS AND METHODS
Animal Collection and Sampling
Adult male and female catfish Heteropneustes fossilis (40–50 g)
of the first reproductive cycle were purchased from a local fish
market in Chaukaghat, Varanasi. The fish were collected in
January (resting), April (preparatory), June (prespawning), July
(spawning), and September (postspawning) phases of the annual
reproductive cycle. They were maintained in aquarium tanks. The
tanks were provided with flow-through freshwater and the fish
were fed ad libitum on boiled goat liver. After a 2-week
acclimatization period, the fish were used for experiments. Sex
was determined manually by examining the genital papilla. The
fish were anaesthetized by spraying 0.01% tricaine methane
sulfonate (MS-222, Sigma, St. Louis, MO, USA) over the gills,
sacrificed by decapitation, and tissues were dissected out.
Pituitary glands were collected, immediately frozen in liquid
nitrogen and stored at 80°C until RNA extraction. For in situ
hybridization, brains along with pituitaries of female fish from
the different reproductive phases, were fixed in 4% neutral-
buffered formalin and processed for making paraffin blocks. All
experiments were performed in accordance with the guidelines of
the Animal Ethics Committee of Banaras Hindu University,
Varanasi and all care was taken to prevent cruelty of any kind.
Chemicals and Reagents
The following molecular biology kits and reagents were used:
RNeasy lipid tissue mini kit (Qiagen GmBH, Hilden, Germany),
Revert-Aid H minus first strand cDNA synthesis kit (Fermentas,
Hanover, MD, USA), DNase I RNase-free (Ambion Inc., Austin,
TX, USA), RNAlater (Ambion Inc.), 2X PCR master mix
(Fermentas), 2X VeriQuest SYBR Green qPCR Master Mix Ex
(Cleveland, Ohio, USA), Nucleopore PCR clean up gel extraction
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH
kit (Genetix, New Delhi, India), pGEM-T Easy Vector (Promega
Co., Madison, WI, USA), 50 /30 RACE kit 2nd Generation (Roche
Applied Science, Madison, WI, USA), Ambion MAXIscript SP6/T7
in vitro Transcription Kit (Ambion Inc.), Digoxigenin-11-UTP
(Roche Molecular Biochemicals GmbH, Mannheim, Germany).
The primers used in the present study were synthesized by
Integrated DNA Technologies (Coralville, IA, USA). Agarose, tris
base, glacial acetic acid, EDTA–Na2 and other chemicals were of
molecular grade and purchased from Sigma–Aldrich Ltd., St.
Louis, MO, USA.
RNA Isolation and Complementary (c) DNA Synthesis
Since the pituitary weighs only 1 mg, pooling of the tissue was
required to get sufficient total RNA. Fifteen pituitaries of female
fish in the preparatory phase were homogenized using a T 10
basic ULTRA-TURRAX homogenizer (IKA, Steaufen, Germany) in
1 mL QIAZOL (Qiagen) buffer and total RNA was isolated with
RNeasy Lipid Tissue Mini Kit (Qiagen) and treated with 2 U DNaseI
RNase-free (Ambion) for 30 min at 37°C, following the
manufacturer's protocol. The total RNA yield was determined
in a NanoDrop (ND-1000 Spectrophotometer; NanoDrop Tech-
nologies, Rockland, DE, USA) and quality assessed by formamide
RNA gel electrophoresis. The RNA samples with an A260/A280
ratio of 1.8-2.0 were used in the cDNA synthesis reaction. For
reverse transcription (RT), 1 mg of total RNA of each sample was
reverse transcribed in a 20 mL reaction with the RevertAid H
Minus First Strand cDNA Synthesis Kit (Thermo Scientific,
Lithuania, EU), following the manufacturer's protocol. Briefly, in
a sterile nuclease-free tube on ice, the following reagents were
added: total RNA template (1 mg), 1 mL of random hexamer
primer (100 pM) and nuclease-free water to 12 mL. After mixing
gently and centrifuging briefly, the mixture was incubated at
65°C for 5 min. Then it was chilled on ice, spinned down and the
vial placed back on ice to add 4 mL of 5X reaction buffer, 1 mL of
RiboLock RNase Inhibitor (20 U/mL), 2 mL of 10 mM dNTP Mix
and 1 mL of RevertAid H Minus M-MuLV Reverse Transcriptase
(200 U/mL). The mixture was incubated for 5 min at 25°C,
followed by 60 min at 42°C. The reaction was terminated by
heating at 70°C for 5 min. cDNA was stored at 80°C. Negative
control reactions were performed without the addition of the
reverse transcriptase for a subset of the RNA sample. Determi-
nations of optimal template concentration and annealing
temperature were validated routinely.
Degenerate Primer Design and Partial Cloning of Catfish FSHb,
LHb, and GPa Subunits
For the amplification of the GtH subunit genes, three sets of
degenerate primer pairs for FSHb, LHb, and GPa were designed
using the web server-based software iCODEHOP (Boyce et al.,
2009). The available protein sequences of FSHb, LHb, and GPa
subunits of different teleosts and tetrapod species were aligned
and using the CODEHOP algorithm (Rose et al., 2003) hybrid
569
primers consisting of a consensus clamp and degenerate 30 part,
the primers were designed. cDNA from the pooled pituitaries of
the catfish was used as a template for partial cloning. All the
primer sequences used for cloning are listed in Table 1. The PCR
products were resolved on a 2% agarose gel, and DNA bands of
the desired size were observed for the presence of specific and
nonspecific bands. Since the PCR resulted in only specific
products, the resultant PCR products were purified using Sure-
Extract Spin PCR purification kit (Nucleopore, Genetix). The
purified products were ligated into a pGEM-T Easy vector plasmid
(Promega Co.) and transformed into Escherichia coli DH5a
competent cells. Colony PCR assays were carried out on at least
five bacterial colonies to check that the DNA insert was present in
the plasmids. Sequencing was performed using SP6/T7 universal
primers for at least four positive clones on an ABI 3730XL
sequencer (Applied Biosystem, Life Technologies, Foster City, CA,
USA) by Eurofins MWG Operon, Bangalore, India. Partial cDNA
sequences of catfish GtH subunits were checked by BLASTN
software (NCBI).
30 and 50 Rapid Amplification of cDNA Ends
Based on the obtained sequences, gene-specific primers were
designed using FastPCR (Kalendar et al., 2011) and used to
amplify the cDNA ends by 50 and 30 RACE (Rapid Amplification of
the cDNA Ends) using 50 /30 RACE kit 2nd Generation (Roche
Applied Science), according to the manufacturer's protocol.
For 30 RACE, cDNA was synthesized from total RNA using a
30 RACE anchored oligo dT primer. Next, using the gene-specific
sense primer (GS) (GS FSHb forward primer, GS GPa forward
primer, and GS LHb forward primer), and oligo dT adaptor as the
reverse primer and 1 mL of cDNA as template, the 30 end of the
gene was amplified. The products were purified, cloned into
pGEM-T vector and transformed into E. coli DH5a competent
cells. All PCR reactions were run in duplicate and their products
were cloned and sequenced. RT-PCR assays were carried out on at
least five colonies of the cloned DNA for confirming the desired
DNA inserts and sequencing was performed using SP6/T7
universal primers for at least three positive clones of each PCR
product to avoid any sequencing error. The sequences were
confirmed using BLASTN software (NCBI).
The 50 cDNA ends were amplified by a nested PCR using
combinations of two antisense primers namely an outer primer
and an inner nested primer located at the upstream of the outer
primer. The outer primers namely external reverse primer GS
GPa, external reverse primer GS FSHb, and external reverse
primer GS LHb were used for gene-specific cDNA synthesis from
total RNA using reverse transcriptase. The cDNA thus produced
was purified using Sure-Extract Spin PCR purification kit
(Nucleopore, Genetix). Next a poly-A tail was added on to the
cDNA using dATP and terminal transferase. Using the resulting
cDNA as template, oligo dT primer as forward primer and the
inner nested primer namely nested reverse primer GS GPa, nested
J. Exp. Zool.
 Table 1. List of primers used in the study.
Experiment Primer name
J. Exp. Zool.
Degenerate primers for partial cloning FSHb forward primer
FSHb reverse primer
GPa forward primer
GPa reverse primer
LHb forward primer
LHb reverse primer
Gene-specific primers GS FSHb forward primer
GS FSHb reverse primer
GS GPa forward primer
GS GPa reverse primer
GS LHb forward primer
GS LHb reverse primer
Gene-specific primers for qPCR qPCR GPa forward primer
qPCR GPa reverse primer
qPCR FSHb forward primer
qPCR FSHb reverse primer
qPCR LHb forward primer
qPCR LHb reverse primer
Primer for 30 RACE Oligo dT adaptor
Oligo dT anchor primer
GS FSHb forward primer
GS GPa forward primer
GS LHb forward primer
Primer for 50 RACE Nested reverse primer GS GPa
External reverse primer GS GPa
Nested reverse primer GS FSHb
External reverse primer GSP FSHb
External reverse primer GSP LHb
Nested reverse primer LHb
Internal control b-actin forward primer
b-actin reverse primer
570
Sequence 50 –30
ATCACCGTGGAGTCCGAYGARTGYGG
GCAGCTGGACGTCTCRTANGTCCA
CCGTGTACCAGTGCATGGGNTGYTG
AGCAGGTGGAGCAGTGRCANTCNGT
AGACCGTGTCCGTGGARAARGAYGG
TGGTGCAGTCGGAGGTRTCCATNGT
ATCACCGTGGAGTCCGATGAGTGTGG
GCAGCTGGACGGTCTCGTATGTCCA
CCGTGTACCAGTGCATGGGATGTTG
AGCAGGTGGAGCAGTGGCATTCT
AGACCGTGTCCGTGGAGAAGGACGG
TGGTGCAGTCGGAGGTGTCCATTGT
CCAACTCCCTTGAGGTCCAAGAA
GCAGTCTGTGTGATTCACCAGC
ATCACCGTGGAGAGTGACGAG
CCCTGAAGTTACAGGTGTTCTGG
CTGAGCGATCACGGCAAAAGCT
CGGTCTCATTCACAGGTTGGCA
GGCCACGCGTCGACTAGTAC
GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT
ATCACCGTGGAGTCCGATGAGTGTGG
CCGTGTACCAGTGCATGGGATGTTG
AGACCGTGTCCGTGGAGAAGGACGG
GTAGCAAGTGCTGCAATGG
GTTTCAAAGTCGTGGCATCTA
GCAGCTGAACGGTCTCGTA
ACAGCTCAGAGCCACAGGGT
TCTGTGTCATGCAGAAATCAGG
ATCCACACCAGGGCGACAGTC
TGGCCGTGACCTGACTGAC
CCTGCTCAAAGTCAAGAGCGAC
ACHARJEE ET AL.
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH
reverse primer GS FSHb, and nested reverse primer LHb as
reverse primers, each subunit was PCR amplified for its 50 end.
All PCR reactions were carried out in Applied Biosystems 2720
96-well thermal cycler in a final volume of 25 mL containing
12.5 mL of 2X PCR Master Mix (Thermo Scientific) [Taq DNA
polymerase 0.05 U/mL, reaction buffer, 4 mM MgCl2, and 0.4 mM
of each dNTP], 20 pM of each primer and 2.5 mL of template DNA.
The partial sequences obtained after 30 and 50 RACE were
assembled using CAP3 Sequence Assembly Program (Huang and
Madan, '99). In order to rule out any ambiguity in the assembled
sequences, the complete coding sequences for all three subunits
were amplified in single PCR reactions, cloned and sequenced.
The complete nucleotide (nt) and predicted amino acid (aa)
sequences were compared to known sequences in GenBank using
BLASTN and BLASTP, respectively.
Sequence Analysis and Phylogeny Studies
The deduced amino acid sequences of the GtH subunits were
aligned by ClustalX (Chenna et al., 2003) and graphically
represented using the Geneious package (Geneious 4.8.5 version
created by Biomatters, available from http://www.geneious.com/),
using default settings (gap-opening penalty 10, gap extension
penalty 0.05, gap-distance 8).
Phylogenetic analyses were conducted in MEGA6 (Tamura
et al., 2013). The evolutionary history was inferred by using the
Maximum-Likelihood method based on the Whelan and Gold-
man model (Whelan and Goldman, 2001). The bootstrap
consensus tree inferred from 100 replicates to represent the
evolutionary history of the respective taxa was analyzed
(Felsenstein, '85). Branches corresponding to partitions repro-
duced in less than 50% bootstrap replicates were collapsed. The
percentage of replicate trees in which the associated taxa
clustered together in the bootstrap test (100 replicates) was shown
next to the branches (Felsenstein, '85). Initial tree(s) for the
heuristic search was obtained by applying the Neighbor-Joining
method to a matrix of pair-wise distances estimated using a JTT
model. A discrete Gamma distribution was used to model
evolutionary rate differences among sites. All positions with
less than 95% site coverage were eliminated. That is, fewer than
5% alignment gaps, missing data, and ambiguous bases were
allowed at any position. All the protein sequences used in the
phylogenetic analysis were obtained from GenBank (http://www.
ncbi.nlm.nih.gov/). The accession numbers are given in Table S1
(supplementary file). The presence and location of signal peptide
cleavage sites in amino acid sequences were predicted based on a
combination of several artificial neural networks using SignalP
4.1 Server (http:// www.cbs.dtu.dk/services/SignalP/) (Petersen
et al., 2011). To predict the N-glycosylation site in the deduced
protein sequences the NetNGlyc1.0 Server (http:// www. cbs. dtu.
dk/ services/NetNGlyc/) was used. The putative O-glycosylation
sites were also predicted using the NetOGlyc 4.0 Server (http://
www.cbs.dtu.dk/services/NetOGlyc/).
571
Tissue Expression
Tissue gene expression analysis was done by a semi-quantitative
RT-PCR using the gene-specific primers. For the tissue expression
study, pituitary (positive control), brain without pituitary, ovary,
testis, muscle, heart, kidney, gill, intestine, spleen, and liver were
sampled from adult male and female catfish in the preparatory
phase (March). Total RNA was extracted using the RNeasy Lipid
Tissue mini kit (Qiagen). Two microgram of total RNA was reverse
transcribed using 1.0 mL of random primers, 10mM dNTPs,
20 U/mL RiboLock RNAse inhibitor (Thermo Scientific), and
200 U/mL M-MuLV-RT (Thermo Scientific), and the mixture was
incubated for 5 min at 25°C followed by 60 min at 42°C.
Transcripts encoding GtH subunit genes were amplified from
1 mL cDNA using 10 pM each of a set of the gene-specific primers
designed from partial gene sequence in 12.5 mL 2X PCR Master
mix (Thermo Scientific) to make 25 mL of the reaction mixture.
The gene-specific primers for the catfish GPa, LHb, FSHb and for
the catfish internal control beta (b) - actin gene are given in
Table 1. For all the genes, the PCR conditions were the same
(initial denaturation for 5 min at 94°C; denaturation for 50 sec at
94°C, extension for 1 min at 72°C; and 30 cycles with a final
extension of 5 min at 72°C) except for the annealing temper-
atures. The annealing temperatures were: GPa and LHb genes,
51.1°C for 50 sec; FSHb gene, 55°C for 50 sec; and b-Actin gene,
57° C for 30 sec. The PCR products were resolved on 2.5% agarose
gel and then stained with ethidium bromide to visualize the bands
with a Syngene G-Box Gel-Doc System. The amplicon sizes were:
189 bp for GPa, 163 bp for FSHb, 264 bp for LHb, and 157 bp for
b-actin. The RT-PCR method was validated with control studies.
Optimal cycle number was determined for each from the
exponential phase of the amplification curves (data not shown).
Seasonal Studies and Sexually Dimorphic Variation by qPCR
For seasonal studies, 15 pituitaries each of male and female
catfish were pooled to make a sample (Sample size n ¼ 5 in each
reproductive phase). Total RNA was extracted using RNeasy Lipid
Tissue mini kit (Qiagen) and first strand cDNA was synthesized
from 2 mg total RNA using Revert-Aid H minus first strand cDNA
synthesis kit as per manufacturer's instructions.
The real time qPCR was done with an ABI Prism 7500 Sequence
Detection System (PE Applied Biosystems, CA, USA). The PCR
reaction mixture (20 mL) contained 1 mL of sample cDNA (diluted
1:10), 1 mL of 10 pM of forward and reverse primers (Table 1), and
10 mL of 2X VeriQuest SYBR Green qPCR Master Mix Ex. PCR
condition was: 95°C for 30 sec, followed by 40 cycles at 95°C for
5 sec, and 60°C for 20 sec. Specific amplification of each cDNA
was verified by melting curve analysis, gel electrophoresis of the
PCR products on a 3% agarose gel and visualized with ethidium
bromide in addition to sequencing of qPCR products. The
amplicon sizes were: 132 bp for GPa, 136 bp for FSHb, 128 bp for
LHb, and 157 bp for b-actin. In each assay, sample cDNA was
processed in duplicate. A non-template control and dissociation
J. Exp. Zool.
572
curve assay were performed to ensure that only one PCR product
was amplified and that stock solutions were not contaminated. A
cDNA synthesis sample without reverse transcriptase (no RT
control for the absence of genomic DNA contamination) was
tested for all the genes and no amplification was detected. b-actin
was taken as the reference gene as its expression in the pituitary
was found to be consistent throughout the seasons. PCR
efficiency for each gene was measured using serial dilutions of
stock cDNA. The amplification efficiencies of all the genes were
approximately equal and ranged from 95% to 103%.
The cycle threshold was obtained from the exponential phase
of PCR amplification curve and the expression of GtH subunit
mRNAs were normalized to the expression of b-actin mRNA. The
relative expression levels were calculated using the 2DDCt
method (Livak and Schmittgen, 2001), and the resting season
pituitary cDNA was taken as the calibrator.
Pituitary Localization and Seasonal Expression of GPa, LHb, and
FSHb mRNAs by In Situ Hybridization
Specific digoxigenin (DIG)-labeled sense and anti sense ribop-
robes were generated for GPa (position 69–452 of GPa cDNA;
size 384 nt), FSHb (position 41–464 of FSHb cDNA; 424 nt), and
LHb (position 74–520 of LHb cDNA; 447 nt) by in vitro
transcription of sense and antisense riboprobes using a MAXI-
script T7/SP6 in vitro transcription kit (Ambion). In vitro
transcription was carried out in a 20 mL reaction volume using
T7/SP6 polymerase and 1 mL of 10 mM stock each of adenosine
triposphate (ATP), cytosine triphosphate (CTP), guanosine
triphosphate (GTP), uridine triphosphate (UTP), and digoxige-
nin-11-UTP (Roche Molecular Biochemicals GmbH) (3.5 mM
stock) to be used as the labeled UTP. The reaction was allowed to
proceed at 37°C for 1 hr. One microliter of the resulting reaction
was checked by agarose gel electrophoresis to confirm the
formation of the riboprobe and stored at 80°C till used for in situ
hybridization. The in situ hybridization was performed on
sections of adult catfish pituitary, as described below.
Female catfish were anaesthetized with 0.01% MS-222
(Sigma) and decapitated. The brains were fixed with 4%
neutral-buffered formalin (NBF) in 0.05 M phosphate buffered
saline (PBS) for 24 hr at 25°C. The brains were subsequently
dehydrated, cleared in xylene and embedded in paraffin, and
sectioned at 6 mm thickness in the sagittal plane with a semi-
motorized Leica RM2245 microtome (Leica Microsystems,
Nussloch GmbH, Germany) and mounted on to (3-Aminopropyl)
triethoxysilane-coated glass slides (Sigma). Sections were
de-waxed in xylene and washed with PBS and treated with
40 mg/mL proteinase K for 7 min at 37°C. The sections were then
washed in PBS and post-fixed in 4% paraformaldehyde (PFA)
for 20 min, washed with 2X saline sodium citrate (SSC),
dehydrated in ethanol grades and air-dried. Finally, the sections
were hybridized with 1 mg/mL DIG-labeled antisense cRNA
(Roche Molecular Biochemicals GmbH) in hybridization buffer
J. Exp. Zool.
ACHARJEE ET AL.
(50% formamide/10% dextran sulphate/1X Denhardt's reagent/
1 mg/mL yeast tRNA/1X salts overnight in a humidified
chamber at 60°C. After hybridization, the sections were washed
twice with 2X SSC containing 50% formamide, 0.1% Tween-20
for 15 min at 60°C, followed by 1X maleic acid buffer with
Tween-20 (MABT) 30 min each at room temperature. Anti-DIG
immunohistochemistry was performed on the sections by
immersing them in 800 mL of MABT/ 2% blocking reagent
(Roche Molecular Biochemicals)/10% sheep serum at room
temperature for 1.5 hr. Finally sections were immersed in 100 mL of
antibody by mixing 1 mL anti-DIG antibody to 2 mL of MABT/2%
blocking reagent/10% sheep serum and incubated overnight in a
moist chamber. On the third day, the sections were washed with 1X
MABT þ levamisole. Finally, the sections were treated with NTT
buffer [100 mM NaCl, 100 mM tris-HCl (pH 9.5), and Tween-20] to
activate alkaline phosphatase enzyme. After this, the sections were
treated with a chromogenic solution (337 mg/mL 4-nitro blue
tetrazolium chloride, 175 mg/mL 5-bromo-4 chloro-3-indolyl-
phosphate in NTT buffer) until a visible signal was detected
(20 min). The reaction was stopped after 20 min by adding a
reaction stop solution [10 mM tris-HCl (pH 7.6) and 1 mM EDTA
(pH 8.0)]. The sections were observed under a Leica DM 2,000
microscope and documented using a 3 megapixel Leica DFC295
digital camera. Three parallel sections from the prespawning phase
pituitaries were processed as described above with the sense probe
for GPa, LHb and FSHb mRNA. The reaction was allowed to
develop for 2 hr.
Statistical Analysis
Seasonal gene expression studies were replicated five times with
five different batches of fish. The cycle threshold (Ct) value of
catfish GPa, FSHb, and LHb mRNA level was normalized with the
Ct value of b-actin for each sample. The resting phase sample was
taken as the calibrator to give a relative ratio of the mRNA
expression. Data are presented as means  SEM. Data were tested
for statistical significance using the Statistical Package for the
Social Sciences software program (version 10.0; SPSS). One way
analysis of variance (ANOVA, P < 0.001), followed by Duncan's
test was used to compare differences at a significance level of
P < 0.05.
RESULTS
Isolation of GPa, FSHb, LHb Subunit cDNAs and Sequence Analysis
Full-length sequences of GPa, FSHb, and LHb were cloned and
submitted to the GenBank (GenBank accession No. KF573626,
KF573627, KF573628, respectively). The full-length sequence of
GPa is 511 bp long. The open-reading frame (ORF) starts at an
ATG codon at nt 84 and is continued to a TAG stop codon (nt 434).
The 50 -untranslated region (UTR) is 77 bp long upstream and the
30 -UTR is 53 bp long downstream. The ORF codes for a protein of
116 amino acid residues (signal peptide 24 aa; mature protein
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH 573

92 aa, Fig. 1A). The deduced protein has a signal peptide-cleavage
site between amino acids 24 and 25: GQL-YP and two
N-glycosylation sites at 77 (NITS sequon) and 102 (NHTD
sequon). There are 10 cysteine residues in the peptide. It has the
highest sequence identity with C. gariepinus (97%), and the
lowest with hagfish (55%) (supplementary Table S2). Other
comparisons are given in the table.
FSHb cDNA has a full-length sequence of 659 bp. The ORF
starts at an ATG codon (nt 60) and is continued to the TGA stop
codon (nt 458). The 50 -UTR of the FSHb is 201 bp long upstream
and the 30 -UTR is 59 bp long downstream. The ORF codes for a
protein of 132 amino acid residues (signal peptide 24 aa, mature
protein 108 aa, Fig. 1B). The predicted protein has a signal
peptide-cleavage site between amino acids 17–18: VWA-GS.
Only a single putative N-glycosylation site is present at Asn 46,
following an Asn-X-Ser/Thr sequon (NTTA) and an O-glyco-
sylation site at Ser 120 in the sequon FSMQ. The deduced protein
has 13 cysteine residues, the extra one is near the N-terminus. The
beta loop 1, 2, and 3 along with the “seatbelt” loop are crucial for
interaction with the receptor. The subunit protein shows the
highest identity with C. gariepinus (97%) (supplementary
Table S3) and the lowest homology (33%) with the Australian
ghost shark Callorhinchus mili, a holocephalian. Other compar-
isons are given in the table.
LHb cDNA has a full-length sequence of 660 bp. The ORF starts
at an ATG codon (nt 82) and is continued to the TGA stop codon

Figure 1. A comparison of the structural features of putative GPa (A), FSHb (B), and LHb (C) proteins in the catfish Heteropneustes fossilis.
The conserved cysteine residues are numbered. The additional cysteine residue in the FSHb is circled in (B). The putative N-glycosylation
sequon are boxed. a and b loops and “seatbelt” position are indicated.

J. Exp. Zool.
574 ACHARJEE ET AL.

Figure 2. Multiple sequence alignment of catfish GPa protein with that of other vertebrates. Identical amino acids are indicated in black,
while conserved and semi-conserved substitutions are indicated by gray or light gray, respectively.

(nt 498). The 50 -UTR of the LHb cDNA is 162 bp long upstream
and the 30 -UTR is 81 bp long downstream. The ORF codes for a
protein of 138 amino acid residues (signal peptide 26 aa, mature
protein 112 aa, Fig. 1C). It has 12 cysteine residues. A signal
peptide-cleavage site exists between amino acids 21 and 22 i.e.,
AQS-YL. The N-glycosylation site is present at Asn 31 of NETV
and a putative O-glycosylation is predicted at Ser122. The
subunit protein shows the highest identity with C. gariepinus
(97%, supplementary Table S4), and the lowest sequence identity
(37%) with Hippoglossus hippoglossus, a member of Acanthop-
terygii. Other comparisons are given in the Table 1.
Homology and Phylogenetic Analysis
The deduced amino acid sequences of GPa, FSHb, and LHb of H.
fossilis were aligned with those of other fishes and tetrapods
obtained from the NCBI Protein database (Figs. 2–4). Phyloge-
netic trees were constructed for each of the subunit genes using
the Maximum-Likelihood method (supplementary Fig. S1–3). The

Figure 3. Multiple sequence alignment of catfish FSHb protein with that of other vertebrates. Identical amino acids are indicated in black,
while conserved and semi-conserved substitutions are indicated by gray or light gray, respectively.

J. Exp. Zool.
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH 575

Figure 4. Multiple sequence alignment of catfish LHb protein with that of other vertebrates. Identical amino acids are indicated in black,
while conserved and semi-conserved substitutions are indicated by gray or light gray, respectively.

H. fossilis GPa protein has a high sequence identity with
members of Siluriformes and Cypriniformes under Ostariophysi.
The N-terminus is variable while the C-terminus is relatively
more conserved. The GPa dendrogram shows hagfish as an out
group diverged into two major clades. The first clade includes
members of the Acanthopterygii and Protoacanthopterygii of
Teleostei. The second clade, the major one, includes all other
vertebrate groups: Ostariophysi and Elopomorpha of Teleostei,
Chondrostei, cartilaginous fishes (Elasmobranchii and Holoce-
phali) and tetrapods.
FSHb shows a great variability in its structure in vertebrates.
The H. fossilis protein has >90% sequence identity with other
catfishes, >60% identity with Cypriniformes and a low identity
with other teleost groups, cartilaginous fishes and tetrapods. The
protein shows great variability at both N-terminus and C-
terminus sequences. In the phylogenetic tree, the teleost FSHb
protein forms a large cluster with three distinct lineages:
Ostariophysi, Protacanthopterygii, and Acanthopterygii. LHb
has relatively a more conserved structure than FSHb. However,
the sequences at both N-terminus and C-terminus are variable.
The protein has a high sequence identity with that of other
catfishes (>88%), median level identity with other ostariophy-
sians (>69%) except grass carp Ctenopharyngodon idella (41%).
The identity with acanthopterygians, elasmobranch, and lungfish
is also low (39–44%) and the lowest homology is with E. atami
(29%). Relatively, the similarity with Chondrostei is more than the
acanthopterygians (60%). In the phylogenetic tree, the teleost
LHb cluster together as a single clade with chondrostei closely
related to it.
Tissue Expression Analysis
The expression study of GtH subunit mRNAs was conducted in
the preparatory phase in different tissues of male and female fish
(Fig. 5). All the genes were expressed in the pituitary (positive
control) and no expression was obtained in the no-template
control (negative control). In the pituitary, the expression of GPa
and FSHb was higher than LHb. The GPa mRNA expression was
not detected in any of the tissue except the pituitary. The FSHb

Figure 5. Expression of GPa, FSHb, and LHb subunit genes in different tissues of female catfish, and testis of Heteropneustes fossilis. The
gel image is a representative of five replicates. Pituitary was used as the positive control. NTC- no template control.

J. Exp. Zool.
576
transcripts were expressed differently; high in intestine, heart and
brain without pituitary, modest in gill, liver, and muscle and low
in spleen, ovary and testis. The expression of LHb gene was high
in the brain without pituitary and ovary, modest in testis and
spleen and low in other tissues. There was no expression of the
transcripts in the kidney.
Seasonal and Sexually Dimorphic Expression of GtH Subunit Genes
In the pituitary, all the subunit genes were expressed throughout
the seasonal reproductive cycle in both sexes. However, the
relative transcript abundance varied seasonally and also between
the sexes (Fig. 6A–C). In the quiescent phase (postspawning and
resting phases), the subunit mRNA expression was low and
insignificantly different between the phases except for LHb gene
expression in females. In the recrudescent phase (preparatory,
prespawning, and spawning phases), the subunit gene expression
increased significantly and the fold-increase varied according to
the season and sex. In females, the GPa transcript level was low in
the preparatory phase and increased to give the highest
abundance in the prespawning phase and then decreased
significantly in the spawning phase. In males, the pattern of
expression was different. The GPa expression was at the peak in
the preparatory phase, decreased significantly in the prespawn-
ing phase to increase again in the spawning phase. The
expression of FSHb transcript showed distinct dimorphic
changes. In females, the transcript abundance was the highest
in the preparatory phase and then decreased through the
prespawning to a low expression level in the spawning phase.
In males, the transcript level was high throughout the
recrudescent phases with the peak expression in the prespawning
phase. The LHb mRNA showed a similar seasonal pattern in both
sexes but the fold- increase varied seasonally between the sexes.
In females, there was a steady increase in the expression reaching
its peak in the spawning phase. In males, the LHb mRNA level was
low throughout similar to the quiescent phase except for the
sharp increase in its abundance in the spawning phase. The
transcript level was very low compared to the females.
Pituitary Localization of GPa, FSHb, and LHb mRNAs by In Situ
Hybridization
The pituitary of the catfish is leptobasic, suspended from the brain
by a distinct stalk and is divided into a rostral pars distalis (RPD),
proximal pars distalis (PPD), and pars intermedia (PI). Gonado-
tropes are distributed in the PPD along with thyrotropes and
somatotropes. The DIG-labeled antisense probes for GPa (Fig. 7),
FSHb (Fig. 8), and LHb (Fig. 9) gave positive signals only in the
PPD. In control studies, the DIG-labeled sense probes of the
subunit genes did not give any positive signal (Fig. 7G and H;
Fig. 8G and H; Fig. 9G and H). The GPa cells were greater in
number than FSHb and LHb cells and the staining intensity of the
cells varied seasonally. In the preparatory phase (early gameto-
genesis phase), the cells were numerically less and seen largely in
J. Exp. Zool.
ACHARJEE ET AL.
the ventral part of the PPD (Fig. 7A and B). In the prespawning
phase with intense vitellogenic activity, the PPD was uniformly
filled with the GPa cells (Fig. 7C and D). In the spawning phase,
the intensity of the staining decreased due to degranulation and
vacuolization of the cells (Fig. 7E and F).
In the preparatory phase, the FSHb cells were seen throughout
the PPD and stained less intensely (Fig. 8A and B). In the
prespawning phase, the cells were more in number throughout
the PPD, and stained more intensely (Fig. 8C and D). The number
of the FSH cells and staining intensity were markedly low in the
spawning phase (Fig. 8E and F). The LHb cells were less in number
and stained moderately in the preparatory phase (Fig. 9A and B).
The number and staining intensity increased in the prespawning
phase (Fig. 9C and D). In the spawning phase (Fig. 9E and F), the
LHb cells were numerous, but the intensity of staining varied,
indicating different stages of secretory activity such as
degranulation and vacuolization.
DISCUSSION
In this study, the cDNAs coding the GtH subunits GPa, FSHb, and
LHb were cloned and characterized in H. fossilis. The results
concur with the previous studies in the African catfish (Rebers
et al., '97; Vischer et al., 2003a), channel catfish (Liu et al., 2001)
and Southern catfish (Wu et al., 2009) indicating the presence of
two GtH subunits at least at the gene level. In the African catfish,
only the LH type was characterized (Goos et al., '86; Koide et al.,
'92), and the FSH type was not isolated chemically in later studies
(Schulz et al., '97). As of now, catfishes seem to have a single GtH,
which is also true for some other teleost species and squamate
reptiles (Li and Ford, '98; Qu
erat et al., '90). It is proposed that the
FSHb gene may be “silent” in these species (Li and Ford, '98;
Schulz et al., '97). In H. fossilis also, only the LH type GtH was
measured in our functional studies (Senthilkumaran and Joy, '94,
'95; Tharakan and Joy, '96). With the characterization of FSHb
cDNA, the FSH type GtH can be investigated in this species albeit
at the transcriptional level. The data will be useful to extend the
research to produce recombinant proteins for catfish culture,
which is now in progress.
Structural Properties, Homology, and Phylogeny
Multiple sequence alignments of the subunit proteins indicate
that, like GtHs in other tetrapods (Boime et al., 1999), the catfish
FSH and LH are heterodimeric glycoproteins each with a common
a subunit and the hormone-specific b subunit that are non-
covalently linked. Homology analysis of the tertiary structure of
the catfish GtH subunits indicates that they are cysteine-knot
proteins each consisting of three elongated loops (b loops 1–3 in
b subunits and a loops 1–3 in a subunit) formed by six disulfide
bonds, like in other teleosts (Swanson et al., 2003; Rosenfeld
et al., 2007; Chaube et al., 2015). The GPa is the common subunit
of FSH, LH and TSH and is conserved with 10 cysteines forming 5
disulphide bridges and 2 N-linked glycosylation sites. This
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH 577

Figure 6. Expression of GPa (A), FSHb (B), and LHb (C) in pituitaries of female and male Heteropneustes fossilis in different reproductive
phases. Cycle threshold value of catfish GPa, FSHb, and LHb mRNA level was normalized with the cycle threshold value of b-actin for each
sample to give a relative quantity of the mRNA expression by 2DDCt. Resting phase samples were taken as the calibrator. Data are presented
as means  SEM. b-actin was taken as the internal control. Data were analyzed by one-way ANOVA (P < 0.001), followed by Duncan's test
(P < 0.05) Groups with the same letters are not significantly different and those with different letters are significantly different.

J. Exp. Zool.
578 ACHARJEE ET AL.

Figure 7. RNA in situ hybridization of GPa transcripts in the pituitary (sagittal sections) of female Heteropneustes fossilis. The right panel
shows the expression of the gene in (A) preparatory phase (C) prespawning phase, and (E) spawning phase. The left panel (B, D, and F) shows
the same at higher magnifications. G and H are the sense probe control. There is no staining in the brain.

arrangement is true for H. fossilis as with other vertebrates except
agnathans. In hagfish, there are only 8 cysteines (Uchida et al.,
2010). The conserved N-linked glycosylation sites are predicted in
the a-loop 1 (NITS sequon) and a-loop 2 (NHTD sequon).
The deduced amino acid sequence of catfish LHb subunit is
highly conserved, particularly in regions thought to be important
for receptor interaction such as the concave side of the b subunit
(“seatbelt” and a portion of b loop 2) and the tip of b loop 3.
Positions of 12 cysteine residues and the single potential
N-glycosylation site (b-loop 1, sequon NXTX) in LHb are
strongly conserved throughout vertebrates. Similarly, the LH
determinant loop between Cys 10 and Cys 11 is highly conserved
(Swanson et al., 2003). In the African catfish using chimeric
gonadotropin constructs, Vischer et al., (2004) showed that the
Cys 10–Cys 11 loop of the LHb “seatbelt” region contained the LH
receptor (R) selective determinant while the Cys 11–Cys 12 region

J. Exp. Zool.
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH 579

Figure 8. RNA in situ hybridization of FSHb transcripts in the pituitary (sagittal sections) of female Heteropneustes fossilis. The right panel
shows the expression of the gene in (A) preparatory phase (C) prespawning phase, and (E) spawning phase. The left panel (B, D, and F) shows
the same at higher magnifications. G and H are the sense probe control. There is no staining in the brain.

is held for the FSH R-stimulating activity. Ala-cassette
substitution of the LH R-determinant loop of cfLHb (amino
acids TMDTS, excluding the conserved D96) showed that the
Cys10 and Cys11 was indispensable for LH R-stimulating activity.
In contrast, the primary structure of fish FSHb subunit is more
variable than that of fish LHb subunit even in regions thought to
confer ligand specificity (see also Swanson et al., 2003). The FSHb
subunits of ancient fish (elephant shark, and sturgeon) and basal
teleosts (eel) conform to the tetrapod paradigm of 12 cysteine
residues and two potential N-linked glycosylation sites. However,
most teleosts depart from this basic structure. Notably, the FSHb
subunits of salmonids and perciform fish lack the third conserved
cysteine and the second potential N-linked glycosylation site in b
loop 1 but have an additional cysteine near the N-terminus,
making a total of 12 cysteines. The FSHb subunit in cypriniform
fish is similar to that of salmonids and perciform fish except that
the third cysteine is retained to give a total of 13 cysteine residues.
The same pattern (13 cysteines) holds true for the catfishes

J. Exp. Zool.
580 ACHARJEE ET AL.

Figure 9. RNA in situ hybridization of LHb transcripts in the pituitary (sagittal sections) of female Heteropneustes fossilis. The right panel
shows the expression of the gene in (A) preparatory phase) (C) prespawning phase and (E) spawning phase. The left panel (B, D, and F) shows
the same at higher magnifications. G and H are the sense probe control. There is no staining in the brain.

studied so far. In zebrafish, Cys 10 and Cys 11, supposed to be the
determinant loop of the “seatbelt” are missing (So et al., 2005).
But two cysteines are added in the N-terminus so that the total
cysteines are 12. These changes may be due to alternate
processing of the leader peptide and loss of the third cysteine
in b loop 1, which potentially alters the “seatbelt” latch point
from the third cysteine in b loop 1 to the cysteine near the
N-terminus of the b subunit (Swanson et al., 2003). Given the
importance of the “seatbelt” region to receptor interaction and
heterodimer formation, the variation in the structure of FSHb
subunits among the fish species may result in considerable
species differences in the nature of receptor interactions and
possibly stability of the heterodimer.
The two putative N-linked glycosylation sites between Cys 1
and Cys 2, and Cys 3 and Cys 4 are conserved in tetrapods, Dipnoi
(lungfish), Chondrostei (sturgeon), and Holocephali (elephant

J. Exp. Zool.
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH
shark). This pattern is also retained in the Japanese eel, channel
catfish and Southern catfish. However, in a majority of teleosts
that have been used in cloning studies, only one potential
N-linked glycosylation site is present. This is the case in the
African catfish and stinging catfish (present study) among
catfishes, Cypriniformes, Salmoniformes, etc (Supplementary
Table S2). While in the African catfish and stinging catfish, the
first glycosylation site (Cys 1 and Cys 2) is lost, in non-catfishes
(more evolved fishes belonging to orders Perciformes, Pleuro-
nectiformes, Salmoniformes, Cypriniformes, and Cyprinodonti-
formes), it is the first one that is retained. In an extreme situation,
in Atlantic halibut (Hippoglossus hippoglossus) and orange
spotted grouper (Epinephelus coioides), a potential N-linked
glycosylation site is absent in the FSHb subunit (Li et al., 2005;
Weltzien et al., 2003). Glycosylation of GtH is essential for proper
bioactivity, disulphide bond formation, rate of secretion,
circulatory persistence, clearance rate, and signal transduction
(Feng et al., '95; Ulloa-Aguirre et al., '99). The loss of the second
N-glycosylation may affect biological potencies since the
carbohydrate moieties alter physiological clearance rates and,
in some cases, the receptor interactions (Bousfield et al., '94). In
humans, the site 1 has been associated with signal transduction
while the site 2 is linked to thermal stability with the latter having
a greater effect on disulphide bond formation and hormone
secretion (Feng et al., '95). Thus, the absence of a second
glycosylation site in the FSHb of some catfishes and most other
fishes appears to be a major deviation from the highly conserved
vertebrate pattern. Whether it has a bearing on the half-life of the
molecule and hence its non-detection in these catfishes, is a
question to be investigated.
The phylogenetic trees constructed with the inclusion of
H. fossilis GtH subunit proteins do not show any deviation from
the already known phylogenetic relationships among vertebrates
(Li and Ford, '98). The catfish GPa clusters with the teleost
subclade Ostariophysi, away from the Acanthopterygii-Prota-
canthopterygii groups, but closer to all other vertebrates. The
dendrogram analyses show that the teleost FSHb and LHb
proteins cluster differently. Catfish FSHb forms a common
lineage (Siluriformes) with Cypriniformes in Ostariophysi. The
LHb protein of H. Fossilis, C. gariepinus, I. punctatus, and
S. meridionalis, on the other hand, clusters together (Silur-
iformes) but distantly with Cypriniformes. It is noteworthy that
LHb of the catfish Hemibagrus nemurus is aligned separately
from Siluriformes but close to Cypriniformes.
Seasonal and Sexual Variation in GtH Subunit Expression
Teleosts exhibit different temporal patterns of FSH and LH
secretion associated with the reproductive cycle. Li et al., (2005)
described six patterns based on studies in salmonids (Nozaki
et al.,'90a,b; Swanson et al., '91; Breton et al., '98), gilthead sea
bream (Elizur et al., '96), striped bass and Japanese eel (Han et al.,
2003; Hassin et al., '95), Atlantic halibut (Weltzien et al., 2003),
581
European sea bass (Mateos et al., 2003) and red-spotted grouper
(Li et al., 2005). It is evident from this comparison that a
functional dissociation between FSH and LH is conspicuous only
in salmonids, and in others, the two hormones may have
overlapping functions. In the daily spawner zebrafish, all the
three subunits are expressed temporally in the pituitary but
the expression increases with migration of the germinal vesicle in
the decreasing order GPa < LHb < FSHb (So et al., 2005).
In the annual spawner channel catfish, Kumar and Trant (2004)
made a detailed profiling of the subunit expression during the
reproductive cycle. The subunit transcript abundance was low
during the resting phase, all of them were increased at the time of
initial recrudescence (pre-vitellogenesis) with a significant but
transient elevation of the GPa and FSHb transcript levels. The
transcript levels of GPa and FSHb, but not LHb, were high
coinciding with the vitellogenic growth period. FSHb level
decreased but to elevate again to give a minor peak before
spawning. The LHb transcript showed a sharp peak in
the spawning phase along with a modest GPa peak, prior to
spawning. After spawning, the transcript levels of the subunit
genes were low. In the African catfish males, LHb appeared early
in development, a situation contrasted with salmonids (Schulz
et al., '97). This implies that the LH type gonadotropin may fulfill
all functions related to gonadotropin control of reproduction in
the catfish.
The present data of seasonal profiles of the expression of
the subunit genes in H. fossilis shows some differences, unlike
the observations in the channel and African catfishes. All
the three subunit genes were expressed throughout the
reproductive cycle, but the abundance and pattern of the
expression are influenced by the reproductive stage and sex. In
both the sexes, the transcript expression was very low (basal) and
insignificantly different in the sexually quiescent (resting and
postspawning) phases except LHb that showed a significant
difference in females. The transcript levels were high in the
recrudescent phases: preparatory (early recrudescence), prepar-
atory (mid-recrudescence), and spawning (end recrudescence)
phases. The pattern of GPa expression differed in both sexes; the
expression was low in females in the preparatory phase but was
the highest in males. This sex-specific difference may be due to
the differences in the pace and tempo of oogenesis and
spermatogenesis. Oogenesis is slower while spermatogenesis is
faster, and sperm appear in the late preparatory to early
prespawning phase (April–May). Therefore, males showed an
early and high GPa transcriptional activity, which was decreased
in the prespawning phase but increased again in the spawning
phase, coinciding with spermiation. In females, the GPa tran-
scriptional activity was high in the prespawning phase and
declined significantly in the spawning phase. The FSHb
transcriptional activity also showed sex-specific patterns. In
females, the transcript abundance was early and the highest in the
preparatory phase and expression declined sharply across the
J. Exp. Zool.
582
prespawning phase to the spawning phase. In the spawning phase,
the fold increase was low, compared to the other two phases. In
contrast, in males the FSHb abundance was high throughout the
recrudescent phase with the peak increase in the prespawning
phase. Thus, there is a marked difference in the pattern of the FSHb
gene expression in the two sexes, and whether the difference is
functionally relevant is difficult to answer in this species. The LHb
gene expression pattern is also significantly different from that of
the FSHb gene expression. In females, LHb transcript level
increased with the recrudescent phase, giving the peak level in the
spawning phase, a pattern opposite to that of the FSHb gene
expression. A significant and early expression of LHb was evident
in females, coinciding with oogenesis. In contrast, in males the
LHb transcript abundance and pattern were low and quite different
from the females. Comparing the FSHb and LHb gene expressions
in the males, it appears that the FSHb gene expression is more
related to spermatogenesis and LHb gene expression coincides
with the spermiation process. The catfish LHb transcriptional
activity can be compared with salmonid LHb activity especially in
the males (Nozaki et al., '90a,b).
Sexual dimorphic expressions of GtH subunit genes were also
demonstrated in other teleosts. In red sea bream Pagrus major, a
unique sexual dimorphic expression of the two subunit tran-
scripts was reported during the sexual cycle (Gen et al., 2003).
The FSHb level in females was low throughout sexual
maturation and increased in males with gonad development.
The LHb levels in both sexes were high throughout gonad
maturation and spawning. Sex steroids are likely to be involved
in the sexual dimorphic gene expression of the GtH subunits. In
rat, it was reported that androgens positively regulated higher
steady-state levels of FSHb expression, but not of GPa or LHb
(Gharib et al., '87,'90). In male Atlantic salmon, it was shown
that 11-ketoandrostenedione increased the pituitary and plasma
FSH levels (Borg et al., '98). Further, in protogynous honey-
comb grouper (Epinephelus merra) males have high FSHb
associated with the testis development during the female-to-
male sex change (Kobayashi et al., 2010).
Pituitary Localization of GtH Subunit Genes
Unlike mammals, separate FSH and LH cells have been described in
the pituitary of teleosts (Suzuki et al., '88a,b; Vissio et al., '97;
Kagawa et al., '98; Yaron et al., 2001; Vischer et al., 2003a;
Weltzien et al., 2003 Li et al., 2005; Pandolfi et al., 2006; Aizen
et al., 2007; Kanda et al., 2011). In the African catfish, Vischer et al.,
(2003a) distinguished separate FSHb and LHb cells along with GPa
cells, and a spatiotemporal analysis reported an overlapping
expression in a limited number of the cells. Through double
immunofluorescence technique, distinct FSH and LH cells were
described in the grouper (Li et al., 2005). In tilapia, the FSH cells
are closer to the hypothalamic nerve fibers of the neurohypophysis
and the LH cells are distributed in the periphery of the PPD (Aizen
et al., 2007). In the pituitary of medaka, the FSHb and LHb genes
J. Exp. Zool.
ACHARJEE ET AL.
are localized in separate populations of cells, which have been
attributed to distinct genomic environments (Kanda et al., 2011)
that help in differential control of their secretion. These authors
have reasoned that the LHb locus in teleosts has no syntenic
homology with the tetrapod LHb locus while the FSHb and TSHb
loci in teleosts have syntenic relation with the tetrapod counter-
parts. In H. fossilis, both FSHb and LHb transcripts were localized
in the PPD of the pituitary along with GPa. The cellular transcript
abundance showed conspicuous seasonal variations. In the
preparatory phase, the FSHb cells are more in number than LHb
cells In the prespawning phase, the LH cells were greater in number
and more intensely stained, compared to the FSH cells. In the
spawning phase, the LH cells were the dominant gonadotropes. The
GPa cells were predictably greater in number. The question
whether both subunit genes co-exist in the same cell needs future
studies. Since female pituitaries were used for the localization
study, there is a need to examine male pituitaries particularly to
know the localization of LHb transcripts across seasons, given the
sex-dimorphic differences obtained in the qPCR study.
The functional significance of the seasonality in FSHb
transcriptional activity is difficult to answer in catfishes since
the native FSH protein is not yet characterized either in the
pituitary or in circulation (Schulz et al., '97). Our understanding
of FSH functions in catfishes stems from the use of the
recombinant FSH. In H. fossilis, a single gonadotropin of the
LH type was described in the pituitary and in circulation during
the reproductive cycle and in response to altered photo-thermal
conditions on ovarian recrudescence (Senthilkumaran and
Joy, '94, '95). The LH activity responded to GnRH analogue
and pimozide (a dopamine-2 receptor antagonist) treatments in
ovulation studies (Tharakan and Joy, '96). Recently, Sarkar et al.,
(2014) have investigated the biological activities of semi-purified
LH-like and FSH-like fractions on vitellogenesis and oocyte
maturational activity in the Asian catfish C. batrachus. Since the
authors have not sequenced their preparations, their observations
particularly on the “FSH-like” fraction need to be viewed with
some reservations (see also Schulz et al., 2001). Recombinant FSH
can only answer the biological significance of the protein in the
catfish reproduction.
Extra-Pituitary Expression of the GtH Subunit Genes
The pituitary is traditionally the site of GtHs synthesis and
release. Recent studies have demonstrated the presence of both
FSHb and LHb in peripheral tissues. Against this background, we
studied the expression of the subunit genes in peripheral tissues
of the catfish. Both FSHb and LHb mRNAs were expressed in
varying degrees in the peripheral tissues. In spite of repeated
attempts during this study, we could not get the expression of
GPa, in the peripheral tissues. This rules out any peripheral
production of functional GtH molecules since the GtH subunit
alone is not biologically active. Monomeric subunit expression
was also reported in zebrafish (So et al., 2005). The transcripts
GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH
were expressed in highly amplified cycle numbers (35–40 cycles).
In rat ovary, free LHb subunit has been shown to bind to the LH
receptor without increasing cAMP level and can suppress hCG
binding to the LH receptors (Muralidhar and Moudgal, '76). The
significance of the monomeric subunit transcript expression in
the catfish peripheral tissues is not clear at present.
In summary, the GtH subunit genes were cloned and
characterized in H. fossilis. The deduced proteins elicit structural
homology with the vertebrate GtH subunit proteins, as evident
from multiple alignment and phylogenetic analyses. FSHb shows
considerable variability, as in other vertebrates. The subunit
transcripts were localized in the PPD of the pituitary and show
seasonal variations in cell number and staining intensity. The
qPCR expression studies indicate both seasonal and dimorphic
transcriptional activity. GtH b subunits, but not GPa, are also
expressed in peripheral tissues.
ACKNOWLEDGMENTS
The research was partly supported by a project grant of
Department of Science and Technology, New Delhi (grant no.
SA/SO/AS-43/2009) awarded to KPJ and RC. AA is grateful to the
Council of Scientific and Industrial Research, New Delhi for a
Senior Research Fellowship. The authors thank the DBT-BHU
Interdisciplinary School of Life Sciences for providing qPCR
facilities.
LITERATURE CITED
Aizen J, Kasuto H, Golan M, Zakay H, Levavi-Sivan B. 2007. Expression
and characterization of biologically active recombinant tilapia FSH:
Immunohistochemistry, stimulation by GnRH and effect on steroid
secretion. Biol Reprod 76:692–700.
Boime I, Ben-Menahem D. 1999. Glycoprotein hormone structure
function and analog design. Recent Prog Horm Res 54:217–288.
Borg B, Antonopoulou E, Mayer I, et al. 1998. Effects of gonadectomy
and androgen treatments on pituitary and plasma levels of
gonadotropins in mature male Atlantic salmon, Salmo salar parr-
positive feedback control of both gonadotropins. Biol Reprod
58:814–820.
Bousfield GR, Perry WM, Ward DN. 1994. Gonadotropins: Chemistry
and biosynthesis. In: Knobil E, Neill JD, editors. The physiology of
reproduction. New York: Raven Press. p 1749–1792.
Boyce R, Chilana P, Rose TM. 2009. ICODEHOP: A new interactive
program for designing COnsensus-DEgenerate Hybrid Oligonucleo-
tide Primers from multiply aligned protein sequences. Nucleic Acids
Res 37(Web Server issue):W222–W228.
Breton B, Govoroun M, Mikolajczyk T. 1998. GTH I and GTH II secretion
profiles during the reproductive cycle in female rainbow trout:
Relationship with pituitary responsiveness to GnRH-A stimulation.
Gen Comp Endocrinol 111:38–50.
Chaube R, Joy KP, Acharjee A. 2015. Catfish gonadotrophins: cellular
origin, structural properties and physiology. J Neuroendocrinol
27:536–543. DOI: 10.1111/jne.12286.
583
Chenna R, Sugawara H, Koike T, et al. 2003. Multiple sequence
alignments with the Clustal series of programs. Nucleic Acids Res
31:3497–3500.
Elizur A, Zmora N, Rosenfeld H, et al. 1996. Gonadotropins b-GtHI and
b-GtHII from the gilthead seabream, Sparus aurata. Gen Comp
Endocrinol 102:39–46.
Felsenstein J. 1985. Confidence limits on phylogenies: An approach
using the bootstrap. Evolution 39:783–779.
Feng W, Matzuk MM, Mountjoy K, et al. 1995. The asparagine-
linked oligosaccharides of the human chorionic gonadotropin b
subunit facilitate correct disulfide bond pairing. J Biol Chem
270:11851–11859.
Gen K, Yamaguchi S, Okuzawa K, et al. 2003. Physiological roles of
FSH and LH in red seabream, Pagrus major. Fish Physiol Biochem
28:77–80.
Gether U. 2000. Uncovering molecular mechanisms involved in
activation of G protein-coupled receptors. Endocr Rev 21:90–113.
Gharib SD, Leung PC, Carroll RS, Chin WW. 1990. Androgens positively
regulate follicle-stimulating hormone b-subunit mRNA levels in
rat pituitary cells. Mol Endocrinol 4:1620–1626.
Gharib SD, Wierman ME, Badger TM, Chin WW. 1987. Sex steroid
hormone regulation of follicle-stimulating hormone subunit
messenger ribonucleic acid (mRNA) levels in the rat. J Clin Invest
80:294–299.
Goos HJ, De Leeuw R, Burzawa-Gerard E, Terlou M, Richter CJJ. 1986.
Purification of gonadotropic hormone from the pituitary of the
African catfish Clarias gariepinus (Burchell), and the development
of a homologous radioimmunoassay. Gen Comp Endocrinol
63:162–170.
Han YS, Liao I, Huang YS, et al. 2003. Synchronous changes of
morphology and gonadal development of silvering Japanese eel
Anguilla japonica. Aquaculture 219:783–796.
Hassin S, Elizur A, Zohar Y. 1995. Molecular cloning and sequence
analysis of striped bass (Morone saxatilis) gonadotrophin-I and-II
subunits. J Mol Endocrinol 15:23–35.
Huang X, Madan A. 1999. CA P3: A DNA sequence assembly program.
Genome Res 9:868–877.
Joy KP 1997. Catfish pituitary gonadotrops and regulation of
gonadotropin secretion. In: Singh BR, editor. Advances in fish
research Vol II. New Delhi: Narendra Publishing House.
p 221–232.
Kagawa H, Kawazoe I, Tanaka H, Okuzawa K. 1998. Immunocyto-
chemical identification of two distinct gonadotropic cells (GTH I
and GTH II) in the pituitary of bluefin tuna, Thunnus thynnus. Gen
Comp Endocrinol 110:11–18.
Kalendar R, Lee D, Schulman AH. 2011. Java web tools for PCR, in
silico PCR, and oligonucleotide assembly and analysis. Genomics
98:137–144.
Kanda S, Okubo K, Oka Y. 2011. Differential regulation of the
luteinizing hormone genes in teleosts and tetrapods due to their
distinct genomic environments-insights into gonadotropin beta
subunit evolution. Gen Comp Endocrinol 173:253–258.
J. Exp. Zool.
584
Kobayashi Y, Alam MA, Horiguchi R, Shimizu A, Nakamura M. 2010.
Sexually dimorphic expression of gonadotropin subunits in the
pituitary of protogynous honeycomb grouper (Epinephelus merra):
Evidence that follicle-stimulating hormone (FSH) induces gonadal
sex change. Biol Reprod 82:1030–1036.
Koide Y, Noso T, Schouten G, et al. 1992. Maturational gonadotropin
from the African catfish, Clarias gariepinus: Purification, character-
ization, localization, and biological activity. Gen Comp Endocrinol
87:327–341.
Kumar RS, Trant JM. 2004. Hypophyseal gene expression profiles of
FSH-beta, LH-beta, and glycoprotein hormone-alpha subunits in
Ictalurus punctatus throughout a reproductive cycle. Gen Comp
Endocrinol 136:82–89.
Levavi-Sivan B, Bogerd J, Ma~nan
os EL, G
omez A, Lareyre JJ. 2010.
Perspectives on fish gonadotropins and their receptors. Gen Comp
Endocrinol 165:412–437.
Li CJ, Zhou L, Wang Y, Hong YH, Gui JF. 2005. Molecular and
expression characterization of three gonadotropin subunits
common a, FSHb and LHb in groupers. Mol Cell Endocrinol
233:33–46.
Li MD, Ford JJ. 1998. A comprehensive evolutionary analysis based on
nucleotide and amino acid sequences of the a- and b-subunits of
glycoprotein hormone gene family. J Endocrinol 156:529–542.
Liu Z, Kim S, Karsi A. 2001. Channel catfish follicle-stimulating
hormone and luteinizing hormone: Complementary DNA cloning
and expression during ovulation. Mar Biotechnol 3:590–599.
Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods 25:402–408.
Mateos J, Ma~nan
os E, Martı ́nez-Rodrı ́guez G, et al. 2003. Molecular
characterization of sea bass gonadotropin subunits (a, FSHb, and
LHb) and their expression during the reproductive cycle. Gen Comp
Endocrinol 133:216–232.
Muralidhar K, Moudgal NR. 1976. Studies on rat ovarian receptors for
lutropin (luteinizing hormone). Interaction with b-subunit of sheep
lutropin. Biochem J 160:615–619.
Nozaki M, Naito N, Swanson P, et al. 1990a. Salmonid pituitary
gonadotrophs. I. Distinct cellular distributions of two gonado-
tropins, GTH I and GTH II. Gen Comp Endocrinol 77:348–357.
Nozaki M, Naito N, Swanson P, et al. 1990b. Salmonid pituitary
gonadotrophs. II. Ontogeny of GTH I and GTH II cells in the
rainbow trout (Salmo gairdneri irideus). Gen Comp Endocrinol
77:358–367.
Pandolfi M, Nostro FLL, Shimizu A, et al. 2006. Identification of
immunoreactive FSH and LH cells in the cichlid fish Cichlasoma
dimerus during the ontogeny and sexual differentiation. Anat
Embryol 211:355–365.
Petersen TN, Søren B, von Heijne G, Henrik N. 2011. SignalP 4.0:
Discriminating signal peptides from transmembrane regions. Nat
Meth 8:785–786.
Pierce JG, Parsons TF. 1981. Glycoprotein hormones: Structure and
function. Annu Rev Biochem 50:465–495.
J. Exp. Zool.
ACHARJEE ET AL.
Qu
erat B, Moumni M, Jutisz M, Fontaine YA, Counis R. 1990.
Molecular cloning and sequence analysis of the cDNA for the
putative beta subunit of the type-II gonadotrophin from the
European eel. J Mol Endocrinol 4:257–264.
Qu
erat B, Sellouk A, Salmon C. 2000. Phylogenetic analysis of the
vertebrate glycoprotein hormone family including new sequences
of sturgeon (Acipenser baeri) beta subunits of the two
gonadotropins and the thyroid-stimulating hormone. Biol Reprod
63:222–228.
Rebers FEM, Tensen CP, Schulz RW, Goos HJTh, Bogerd J. 1997.
Modulation of glycoprotein hormone a- and gonadotropin II b-
subunit mRNA levels in the pituitary gland of mature male African
catfish, T Clarias gariepinus. Fish Physiol Biochem 17:99–108.
Rose TM, Henikoff JG, Henikoff S. 2003. CODEHOP (COnsensus-
DEgenerate Hybrid Oligonucleotide Primer) PCR primer design.
Nucleic Acids Res 31:3763–3766.
Rosenfeld H, Meiri I, Elizur A. 2007. Gonadotropic regulation of oocyte
development: from basic studies to biotechnological applications.
In: Babin PJ, Cerda J, Esther L, editors. The fish oocyte: From basic
studies to biotechnological applications. Springer: p 175–202.
Sarkar S, Bhattacharya D, Juin SK, Nath P. 2014. Biological properties
of Indian walking catfish (Clarias batrachus) (L.) gonadotropins in
female reproduction. Fish Physiol Biochem 40:1849–1861.
Schulz RW, de França LR, Lareyre JJ, et al. 2010. Spermatogenesis in
fish. Gen Comp Endocrinol 165:390–411.
Schulz RW, Vischer HF, Cavaco JE, et al. 2001. Gonadotropins, their
receptors, and the regulation of testicular functions in fish. Comp
Biochem Physiol B Biochem Mol Biol 129:407–417.
Schulz RW, Zandbergen MA, Peute J, et al. 1997. Pituitary
gonadotrophs are strongly activated at the beginning of
spermatogenesis in African catfish, Clarias gariepinus. Biol
Reprod 57:139–147.
Senthilkumaran B, Joy KP. 1994. Effects of ovariectomy and
oestradiol-17b replacement on hypothalamic serotonergic and
monoamine oxidase activity in the catfish, Heteropneustes fossilis:
A study correlating plasma oestradiol and gonadotropin levels.
J Endocrinol 142:193–203.
Senthilkumaran B, Joy KP. 1995. Changes in hypothalamic catechol-
amines, dopamine-b-hydroxylase and phenylethanolamine-N-
methyltranserase in the catfish Heteropneustes fossilis in relation
to season, raised photoperiod and temperature, ovariectomy and
estradiol-17b replacement. Gen Comp Endocrinol 97:121–134.
Senthilkumaran B, Joy KP. 1996. Effects of administration of some
monoamine-synthesis blockers and precursors on ovariectomy-
induced rise in plasma gonadotropin II in the catfish Hetero-
pneustes fossilis. Gen Comp Endocrinol 101:220–226.
Senthilkumaran B, Joy KP. 1998. Methallibure-induced inhibition of
hypothalamo-hypophyseal-ovarian activity in the catfish Hetero-
pneustes fossilis involves changes in hypothalamic monoamine
activity. Fish Physiol Biochem 19:359–364.
So WK, Kwok HF, Ge W. 2005. Zebrafish gonadotropins and their
receptors: II. Cloning and characterization of zebrafish follicle-
 GONADOTROPIN SUBUNIT GENES IN STINGING CATFISH
stimulating hormone and luteinizing hormone subunits-their
spatial-temporal expression patterns and receptor specificity.
Biol Reprod 72:1382–1396.
Sundararaj BI, Samy TSA. 1974. Some aspects of chemistry and
biology of piscine gonadotropins. In: Moudgal NR, editor.
Gonadotropins and gonadal function. New York: Academic Press.
p 118–127.
Suzuki K, Kawauchi H, Nagahama Y. 1988a. Isolation and character-
ization of two distinct gonadotropins from chum salmon pituitary
glands. Gen Comp Endocrinol 71:292–301.
Suzuki K, Kawauchi H, Nagahama Y. 1988b. Isolation and character-
ization of subunits of two distinct gonadotropins from chum
salmon pituitary glands. Gen Comp Endocrinol 71:302–306.
Swanson P, Dickey JT, Campbell B. 2003. Biochemistry and physiology
of fish gonadotropins. Fish Physiol Biochem 28:53–59.
Swanson P, Suzuki K, Kawauchi H, Dickhoff WW. 1991. Isolation and
characterization of two coho salmon gonadotropins, GtH-I and
GtH-II. Biol Reprod 44:29–38.
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEG A6:
Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol
30:2725–2729.
Tharakan B, Joy KP. 1996. Effect of mammalian gonadotropin—
releasing hormone analogue, pimozide, and the combination on
plasma gonadotropin levels in different seasons and induction of
ovulation in female catfish. J Fish Biol 48:623–632.
Uchida K, Moriyama S, Chiba H, et al. 2010. Evolutionary origin of a
functional gonadotropin in the pituitary of the most primitive
vertebrate, hagfish. Proc Nat Acad Sci 107:15832–15837.
Ulloa-Aguirre A, Timossi C, Dami
an-Matsumura P, Dias JA. 1999. Role
of glycosylation in function of follicle-stimulating hormone.
Endocrine 11:205–215.
Vischer HF, Teves ACC, Ackermans JCM, et al. 2003a. Cloning and
spatiotemporal expression of follicle-stimulating hormone b
View publication stats
585
subunit complementary DNA in the African catfish (Clarias
gariepinus). Biol Reprod 68:1324–1332.
Vischer HF, Granneman JC, Linskens MH, Schulz RW, Bogerd J. 2003b.
Both recombinant African catfish LH and FSH are able to activate
the African catfish FSH receptor. J Mol Endocrinol 31:133–140.
Vischer HF, Marques RB, Granneman J, et al. 2004. Receptor-selective
determinants in catfish gonadotropin seat-belt loops. Mol Cell
Endocrinol 224:55–63.
Vissio PG, Somoza GM, Maggese MC, Paz DA, Strussman CA. 1997.
Structure and cell type distribution in the pituitary gland of pejerrey
(Odonthestes bonariensis). Fish Sci 63:64–68.
Weltzien FA, Kobayashi T, Andersson E, Norberg B, Andersen Ø. 2003.
Molecular characterization and expression of FSHbeta, LHbeta, and
common alpha-subunit in male Atlantic halibut (Hippoglossus
hippoglossus). Gen Comp Endocrinol 131:87–96.
Whelan S, Goldman N. 2001. A general empirical model of protein
evolution derived from multiple protein families using a maximum-
likelihood approach. Mol Biol Evol 18:691–699.
Wu F, Zhang X, Zhang W, et al. 2009. Expression of three gonadotropin
subunits in Southern catfish gonad and their possible roles during
early gonadal development. Comp Biochem Physiol A Mol Integr
Physiol 153:44–48.
Yaron Z, Gur G, Melamed P, et al. 2001. Regulation of gonadotropin
subunit genes in tilapia. Comp Biochem Physiol B Biochem Mol Biol
129:489–502.
Yaron Z, Gur G, Melamed P, et al. 2003. Regulation of fish
gonadotropins. Int Rev Cytol 225:131–185.
Zmora N, Kazeto Y, Kumar RS, Schulz RW, Trant JM. 2007. Production
of recombinant channel catfish Ictalurus punctatus FSH and LH in
S2 Drosophila cell line and an indication of their different actions.
J Endocrinol 194:407–416.
Zohar Y, Mu~noz-Cueto JA, Elizur A, Kah O. 2010. Neuroendocrinology
of reproduction in teleost fish. Gen Comp Endocrinol 165:438–455.
J. Exp. Zool.