1

Preventing Waterborne Infection and Pulmonary Disease in War-Torn Regions Using

Evening Primrose Extract

Andrew Joun Kim

Seoul International School, Seongnam-si, Gyeonggi-do, South Korea

Dr. Min Hee Cho

January 25, 2024

 2

Table of Contents

.
Introduction ................................................................................................................................ 3

Materials and Methods ............................................................................................................... 6

Extraction of Evening primrose .......................................................................................... 6

Extraction ..................................................................................................................... 6

Creating an Artificial War Polluted Soil Model for Post-war Soil .............................. 6

Bacterial cell culture............................................................................................................ 7

Cells ..................................................................................................................................... 7

Cell Lines and Media .................................................................................................... 7

PMA Differentiated THP-1 Cells ................................................................................. 8

Primer sequencing ............................................................................................................... 9

Selection of Biomarker Gene ........................................................................................ 9

RNA preparation and cDNA synthesis ....................................................................... 12

RT-PCR ....................................................................................................................... 12

Gel electrophoresis ..................................................................................................... 13

Results ...................................................................................................................................... 14

Plant growth in Artificial War Polluted Model ................................................................. 14

Inhibition of bacterial growth by Evening primrose Extract ............................................. 14

Effects of Evening primrose Extract on Human Immune Cells ........................................ 15

Cell differentiation ...................................................................................................... 15

The effects of Evening primrose extract on proliferation of THP-1 cells .................. 15

Expression of biomarker caused by Evening primrose ..................................................... 16

Expression of Apoptosis related gene ......................................................................... 16

Expression of Inflammation related gene ................................................................... 17

Discussion and Conclusion ...................................................................................................... 18

Acknowledgements .................................................................................................................. 21

References ................................................................................................................................ 22
 3

Preventing Waterborne Infection and Pulmonary Disease in War-Torn Regions Using

Evening Primrose Extract

With the prolonging of the Russia-Ukraine war in current date, the pollution and

damaged water supply and sewage systems as well as other direct exposure to war-related

chemicals has shown to cause an increase in waterborne diseases (Melkozerova, 2023). By

June 2022, more than 25 major Ukrainian freshwater industries had been damaged or

destroyed (Shumilova et al., 2023).

In addition to the damage of such freshwater industries, continued war has caused

imports of medicines to Ukraine in 2022 to decline 38% year-on-year to $1.9 billion from

$3.1 billion after a five-year growth (Interfax, 2023). Such an occurrence makes the

waterborne diseases that increase from the contaminated sewage systems hard to treat,

causing active-war areas such as Ukraine to have no simple way to recover from illnesses.

Among these illnesses that become hard to treat, one of the most concerning ones are

pulmonary diseases. There is proof that pulmonary diseases in general have increased due to

past wars, and Ukraine currently has the fourth‐highest Tuberculosis (TB) incidence in the

WHO European region (Paul et al., 2023). Not only Tuberculosis but other pulmonary

diseases such as Chronic obstructive pulmonary diseases (COPD) result due to war

(Piotrowicz, et al. 2022).

In order to treat these diseases that occur in a war-polluted area without many imports

of medication, a local solution that is tolerant to the extreme conditions of pollution had to be

found. Of those, the local Evening primrose (Oenothera biennis) plant was found to be a

hardy plant which proliferates throughout most biomes excluding Greenland and Antarctica

due to its high tolerance for extreme temperatures (GBIF, 2022). Also, the Evening primrose

has commonly been used in past efforts of curing diseases arising from war-pollution, as it

has been proven to be able to treat and prevent salmonella and staphylococcus (Zhang et al.,
 4

2020).

In common pulmonary diseases, the first line of defense against the infection would

be the immune system, making it a pertinent part to investigate in the study (Vijay, 2020).

Apoptosis is also an important aspect to consider, since once cells are infected, apoptosis

controls and prevents the disease from harming different areas of the lungs (Schmidt &

Tuder, 2010).

Therefore, the main objective of the study was to determine whether Evening

primrose extracts either provide a direct treatment of the disease by inducing apoptosis, or an

indirect preventive method through the immune system for the pulmonary diseases linked to

the increase in waterborne diseases in conditions of the Russia-Ukraine war.

Considering the objective of the study, it was interesting to note that the Evening

primrose mainly contains the amino acid tryptophan and has been known for being able to

cure certain inflammatory disorders (Timoszuk et al., 2018). The oil extract from the Evening

primrose also contains an unusually high content of essential fatty acids and gamma-linoleic

acid (Hernandez, 2016).

Figure 1

Distribution of Evening primrose in the world (GBIF, 2022)

 5

In the study, the flower, leaf, and oil parts of the Evening primrose were chosen for

examination. Commonly, the flower has been known for its sedative properties and for acting

as a treatment for gastrointestinal disorders (Mehmood & Ahmad, 2019). The leaf is also well

known for treating asthma and digestive problems (Timoszuk et al., 2018). Lastly, the oil

extracts are commonly used to treat acne, eczema, dry skin, while also having properties that

help with blood vessel dilation and the prevention of blood clotting (Mehmood & Ahmad,

2019).

The cells used in the research include the A549 cell line, which is commonly used

when studying pulmonary diseases and cancers, to determine if the Evening primrose could

act as a direct treatment to affected cells. The THP-1 cell line was also used, which is a

monocyte that is commonly used for immunology research, to examine the anti-inflammatory

properties of the Evening primrose. Additionally, treatments were also tested directly on

gram-negative bacteria such as Shigella flexneri, Escherichia coli, Bacillus bravis, and Vibrio

carchariae, which is known for being a marine family of bacteria that causes Pulmonary

cholera (Shannon & Kimbrough, 2006).

To evaluate the curing and preventing properties of the Evening primrose, expression

of genes signifying apoptosis and anti-inflammation would be examined. The primers used

were Bax and Bcl-2 to measure apoptosis, as it has been proven that the high ratio of Bax to

Bcl-2 causes a release in cytochrome C and therefore increases apoptosis (National Library of

Medicine, 2023a). To measure anti-inflammatory aspects of the Evening primrose, pro-

inflammatory genes such as IL-1β, TNF-α, and NF-kB gene expressions were examined

(Pugazhenthi et al., 2013). The GAPDH, housekeeping gene, was also checked for as a

control as it measures the production of ATP and pyruvate within the cells, which should

apply for each variable tested (National Library of Medicine, 2023b).

 6

Materials and Methods

Extraction of Evening primrose

Extraction

The Evening primrose’s flower petals and leaf extracts were retrieved by using 20 mL

of 80% ethanol with 0.50 g of the leaf (EL), and 0.415 g for the flowers (EF), respectively.

Filtration of the samples was done using a DISMIC-25 0.22 μm Disposable Membrane Filter

Unit (ADVANTEC) and 20 mL Sterile Hypodermic Syringe (Korea Vaccine Co. The seed oil

sample (PO) was gathered from 500 mg Evening primrose oil capsules, using a 1 mL Sterile

Hypodermic Syringe (Korea Vaccine Co.) (See Figure 2).

Creating an Artificial War Polluted Soil Model for Post-war Soil

Soil Preparation. In order to measure the survival tolerance of the Evening primrose

plant, a control and an experimental group was prepared for the soil. In the experimental

group, 18g soil, 1 mL diesel fuel, 0.2 g Urea, 0.2 g potassium phosphate monobasic, 0.175 g

copper chloride, 0.231 g iron oxide, and 30 mL DW were mixed and placed in a plastic cup.

Meanwhile, the control group contained 18 g of soil and 30 mL DW (See Figure 3).

Figure 2

Extraction of Evening primrose

Note. A. Preparation for flower, leaf, and oil of the Evening primrose. B. Extraction of the

Evening primrose with DW and 80% ethanol. C. Filtration through a 0.22μm disk filter.
 7

Figure 3

Preparation of War polluted soil model

Plant Growth in Soil. Two seeds were germinated on damp paper towels in an

enclosed capsule for 48 hours and were inserted below the surface level of the control soil.

These were grown for a week and watered once every 48 hours. Afterwards, a 1 cm layer of

war-polluted soil was placed on top of the control soil and sprout, and later carefully mixed to

see if the sprouted plants would be able to tolerate the conditions for 14 days.

Bacterial cell culture

Four agar plates were each divided into quarters and each section was labeled:

negative control (-), EF, EL, and PO. Using a micropipette, 100 μL of each bacterial culture,

S. flexneri, V. carchariae, E. coli, and B. subtilis, were dropped on the center of their

respective plates, and spread with a sterilized spreader. Afterwards, 16 paper discs, four for

each agar plate, were treated with either 20 μL DMSO, for the negative control, 40 μL EF

extract, 40 μL EL extract, or 20 μL PO extract. These volumes have been decided through

trials of which volume would carry the most of each treatment while also not overflowing.

Cells

Cell Lines and Media

The human monocyte cell line THP-1 was obtained from the Korean Cell Line Bank

(KCLB). The cells were cultured as recommended: in RPMI 1640 medium supplemented
 8

with 10% Fetal Bovine Serum (FBS) and 1% penicillin-streptomycin. The cells were

incubated at 37 °C in a humidified atmosphere with 5 % CO2. The human lung cancer cell

line, A549 cells were purchased from KCLB and cultured in RPMI1640 in the same

condition as THP-1 cells (See Figure 4).

PMA Differentiated THP-1 Cells

1.5 × 106 THP-1 cells were seeded in each well of the six-well plate and differentiated

with 100 ng/ml phorbol-12-myristate 13-acetate (PMA, Sigma) and 2 mL of RPMI 1640 at

37°C in a humidified atmosphere with 5% CO2 for 48h for 3 days. After this time, the cells

were changed with fresh medium without PMA to allow cell recovery and were cultivated for

2 days under the same incubation conditions. Cell differentiation was verified by microscopy.

PMA-differentiated THP-1 cells and A549 cells were incubated with EF, EL and PO extracts

for 48h, then the cell viability was assessed by Trypan Blue dye exclusion assay.

Figure 4

Cell Cultivation

Note. A. cell cultivation on the bench. B. Observation using microscope. C. A549 cells. D.

THP-1 cells.
 9

Primer sequencing

Selection of Biomarker Gene

Three genes (IL-1β, TNF-α, NF-kB) associated with pro-inflammation were selected

to quantify their expression levels by THP-1 cells in response to the extracts of different

Evening primrose parts. Two genes (Bcl-2, Bax) associated with apoptosis were selected to

analyze if the treatment groups caused a change in the inducing or inhibiting of apoptosis.

Expression of pro-inflammatory and apoptosis related gene expressions were normalized to

the expression of GAPDH (See Table 1).

Table 1

Biomarker gene for corresponding apoptosis and anti-inflammatory response

Gene Function

Bax Apoptosis inducer

A549
Bcl-2 Apoptosis Inhibitor

IL-1β

THP-1 TNF-α Pro-inflammation

NK-kB

A549/ THP-1 GAPDH Housekeeping gene

Another significant property of the pro-inflammatory genes is in the signaling

transduction pathway of inflammation (See Figure 5). The NF-kB biomarker gene is the

transcription factor for the pathway, meaning that the biomarker must be maintained for the

final target gene to be reached and a response to be produced. Of the responses, one explains

an increase in pro-inflammatory genes, which include IL-1β and TNF-α, meaning that if NF-

kB is maintained within the THP-1 cells, the target gene produces many responses, one of
 10

which could be the expression of pro-inflammatory genes. This direct relationship between

the biomarkers in the signaling pathway made them even more critical in evaluating

inflammation.

Additionally, the significance of apoptosis biomarker genes Bax and Bcl-2 were

proven by the apoptosis signaling transduction pathway (See Figure 6). The signaling

pathway explains that one way apoptosis is induced is the decrease in NF-kB, but also, when

Bax expression is increased and Bcl-2 expression is decreased, a suppression of

mitochondrial functions leads to the activation other protein kinases that ultimately induce

apoptosis.

Exon sequences of six genes (IL-1β, TNF-α, NF-kB, Bax, Bcl-2, GAPDH) were

utilized to construct respective primers of the genes. The designed primer sequences are

shown in Table 2.

Figure 5.

NF-kB and inflammation signaling transduction pathway (Zahedi, 2021)

 11

Figure 6.

Apoptosis signaling transduction pathway (Xu et al., 2020)

Table 2

Primer design for biomarker genes

GENE Direction Sequence

F CCTGTCCTGCGTGTTGAAAGA
IL-1β
R GGGAACTGGGCAGACTCAAA
F TGCTCCTCACCCACACCAT
TNF-α
R GAGATAGTCGGGCCGATTGA
F GGGAAGGCCTGAACAAATGTTTC
NF-kB
R CGGATTAGCTCTTTTTCCCGATCTCC
F ATGGAGCCACTGGCCACAGCAGAAG
Bcl-2
R GTTGCGATCCGACTCACCAATACCT
F TCTGACGGCAACTTCAACTG
Bax
R TGGGTGTCCCAAAGTAGGAG
F GTATCGTGGAAGGACTCATGACCAC
GAPDH
R GCCAAATTCGTTGTCATACCAGGAA
 12

RNA preparation and cDNA synthesis

Total RNA extraction was performed on each sample using AccuPrep Universal RNA

Extraction Kit (Bioneer, K-3140) according to the manufacturer’s protocol (See Figure 7A).

RNJA samples were stored at -80 °C for further analysis. In order to proceed with cDNA

synthesis, five samples were designed: one negative, lipopolysaccharides (LPS) (100 ng/mL),

EF, EL, PO. The procedures was as indicated by the Prime Script ast strand cDNA Synthesis

kit (TAKARA, USA), creating a mix of 5 μL total RNA per sample, 1 μL 50μM oligo dT

primer, 2 μL 5X reaction buffer, 0.5 μL Reverse transcriptase, 1.5 μL RNase-free water, and

90 μL ddH2O. These five samples were then run at 12,000 rpm on the mini centrifuge to drop

all the solutions stuck on the sides of the tube, and then incubated at 42 ˚C for 1 hour.

RT-PCR

For the PCR process, cDNA of unexposed A549 cells, EF, PO, and EL exposed cell

groups were mixed, each with the Forward and Reverse of each primer, Bax, Bcl2 and

GAPDH. Also, cDNA of unexposed THP-1 cells, LPS, EF, PO, and EL exposed THP-1 cells

were mixed, each with IL-1β, TNF-α, NF-kB and GAPDH primers. Each mixture contained

2.7 μL cDNA and 1 μL of each primer, and 2 μL 10x PCR Buffer, 2 μL dNTP Mixture, 0.5

μL TaKaRa Taq, and 11.8 μL nuclease free water were added to run the PCR process as

noted in Table 3.

Table 3

PCR condition

Step 1 Step 2 Step 3

94 ˚C 94 ˚C 60 ˚C 72 ˚C 72 ˚C

1 min 30 s 30 s 30 s 7 min

1 cycle 30 cycles 1 cycle

 13

Gel electrophoresis

100 ml of 1X TAE buffer and 1.5g (1.5%) of Agarose LE master were mixed and

microwaved to dissolve the solute. 10 μL of GreenStar Nucleic Acid Staining Solution I

(BIONEER) was mixed with 1% agarose since the solution was originally 10,000x. The agar

solution was poured into the gel mold and left to harden, then put into the gel electrophoresis

machine and the gel was completely submerged in 1X TAE buffer. Then, 10 μL of 100bp

DNA ladder was added to each well of the gel, one for each of the groups of the PCR

products. Also, 6x DNA loading dye was mixed with the PCR product and loaded to the

remaining wells. Therefore, a total of 16 wells were used, 4 for the 100bp ladder and 12 for

the samples. After loading all the PCR products, electrophoresis was run at 100V for 25

minutes (See Figure 7B). 10 μL of PCR products was loaded into each well before running

gel electrophoresis to observe the amount of amplified pro-inflammatory and apoptosis

related gene. The resulting visual of the gel electrophoresis process was retrieved through a

ChemiDoc (Accuris Smartdoc, Accuris, USA) to observe gene expression, and the relative

expressions in the photograph were quantified with the use of the ImageJ software.

Figure 7.

RNA preparation and gel electrophoresis

Note. RNAs of THP-1 cells and A549 cells treated with LPS and extract for Evening

primrose.
 14

Results

Plant growth in Artificial War Polluted Model

After planting the germinated sprouts in the normal soil for 7 days, the first small

sprouts grow above the surface of the soil, proving that there was no issue with the setting of

the control soil (See Figure 8A-B). After 7 more days, there were a series of the sprouts,

proving that the plants were able to grow further from the 7-day mark. Similarly, even after

14 days of covering a full layer of war polluted soil over the plants, the plants continued to

grow, displaying that they did have some war-tolerant properties (See Figure 8C).

Inhibition of bacterial growth by Evening primrose Extract

After 2 days of incubating the bacteria with the Evening primrose extract on the plate,

there seemed to be two signs of inhibition zones. Firstly, there was a moderately wide

inhibition zone around the PO treated disk when observing its effect on V. carchariae.

Additionally, the EF treatment group on S. flexneri portrayed a similar moderate inhibition

zone, leading to the possibility that the oil and flower extracts do influence inhibiting bacteria

growth (See Figure 9).

Figure 8.

Evening primrose seeds in non-contaminated Soil

Note. A. sprouts in non-contaminated soil after 7 days. B. sprouts in non-contaminated soil

after 14 days. C). sprouts in contaminated soil for 28 days.

 15

Figure 9.

Growth inhibition of bacterial strains caused by Evening primrose extract

Effects of Evening primrose Extract on Human Immune Cells

Cell differentiation

THP-1 cells were differentiated into macrophage-like cells by incubation in the

presence of PMA, and viewed under an inverted light microscope at 100× to compare the

non-differentiated cells to the differentiated cells. When not treated by PMA, THP-1 cells are

round and non-adherent (See Figure 10A). Differentiation of THP-1 cells with PMA resulted

in a change in morphology, with cells changing dendrite-like cells and an adherent (See

Figure 10B). PMA-treated THP-1 cells were treated with LPS (100ng/ml), which is one of

the major components of the outer membrane of gram-negative bacteria. The cells treated

with LPS showed dendrites branched out in THP-1 cells (See Figure 10C).

The effects of Evening primrose extract on proliferation of THP-1 cells

Afterwards, the differentiated THP-1 cells were treated with the Evening primrose

extracts (EF. EL. PO), which resulted in a visible difference in cell density among the treated

samples but no significant difference in morphology as shown in Figure 10D-F.

Differentiated THP-1 cells and A549 cells were incubated with EF, EL and PO

extracts for 48h, then the cell viability was assessed by Trypan Blue dye exclusion assay

(data not shown). As a result, THP-1 cells and A549 cells treated with the Evening primrose

extracts were all alive, meaning that these extracts do not have cytotoxicity.
 16

Figure 10.

Morphology of THP-1 cells treated with Evening primrose extract

Note. A. THP-cell, B. THP-1 cell treated with PMA for 48h. C-F. PMA-treated THP-1 cells

treated with: C. LPS, D. EF, E. EL, and F. PO.

Expression of biomarker caused by Evening primrose

Expression of Apoptosis related gene

The expression of the Bcl-2 gene indicates that Evening primrose influenced anti-

apoptosis in A549 cells (See Figure 11A). More specifically, except for the positive control

LPS, the leaf, flower and oil treatments all had similar relative expressions of Bcl-2.

However, the detection of Bax gene expression in the Evening primrose extract-

treated cells indicates that Evening primrose influenced apoptosis in cells (Figure 11B).

Precisely, every treatment of the A549 cell led to an extremely low Bax relative expression,

but only in the flower treatment, the expression spiked to a value of 44.67. This evidence

bolstered the possibility that the flower extracts induce apoptosis as it was higher than any

value of relative expression in both the Bcl-2 and Bax analysis.

 17

Figure 11.

Relative expression graph of Bcl-2 and Bax genes in A549 cells treated with Evening

primrose extract.

Note. A. Bcl-2 expression, B. Bax expression, M. 100bp ladder, 1. LPS, 2. EF, 3. EL, 4. PO

Expression of Inflammation related gene

After the PCR and gel electrophoresis analysis of the pro-inflammatory biomarkers in

the THP-1 cells, two primers signified changes (See Figure 12). First, there was a decrease in

IL-1β when treated with EL since the relative expression hit a low value of 0.04, proving that

it has anti-inflammatory properties. Comparatively, IL-1β expression was highest at a relative

expression value of 1.33 in the positive LPS control group.

TNF-α also decreased as a result of the EF treatment, reaching a low relative

expression value of 0.14, portraying that EF also had anti-inflammatory properties. On the

other hand, TNF-α relative expression was highest at a value of 1.00 in the no treatment

group.
 18

Figure 12.

Pro-inflammatory cytokine relative expression graph in differentiated THP-1 cells treated

with Evening primrose extract.

Note. M: 100bp ladder, 1, non-treated, 2. LPS, 3. EF, 4. EL, 5. PO.

Finally, NF-kB relative expression did not experience any major suppressions, but the

lowest value was 0.57 due to oil treatment and highest at 1.54 as a result of positive control

treatment. Moreover, the two control groups, the positive LPS treatment of 1.54 and negative

no treatment group at 1.00 and had the two highest relative expressions, with the next highest

being due to flower treatments, at a value of 0.93.

Discussion and Conclusion

Given the current prolonging of the Russia-Ukraine war causing a boom in

waterborne infectious diseases and leading to severe pulmonary disorders (Melkozerova,

2023), a great concern is a possible local treatment to such large-scale disorders. Of such

candidates for local treatment is Evening primrose, which has commonly been used not only

as food but also for traditional medicine (Hernandez, 2016).

This research was conducted to investigate 1) whether Evening primrose covered with

war contaminant soil can grow. 2) whether Evening primrose has anti-bacterial activities for
 19

the waterborne disease related bacteria. 3) whether THP-1 cells, an immune cell line, treated

with Evening primrose extract are inhibited from releasing pro-inflammatory cytokines, such

as IL-1β, TNF-α, NF-kB. And 4) whether A549 cells, a lung cancer cell line, can change the

expression of apoptosis-related genes, such as Bcl-2 and Bax.

In brief, first, Evening primrose sprouts covered with contaminant soil were

examined, and it explained that the plants were able to grow after 14 days. Therefore, it could

be confirmed that Evening primrose could grow and survive even in harsh war-polluted

conditions.

In the research, the oil of Evening primrose especially decreased the growth in V.

carchariae, as represented by the Disk diffusion method, and the flower extract treatment

resulted in a moderate inhibition of S. flexneri growth. Therefore, it was found that Evening

primrose extracts directly affect the inhibition of water-borne infectious bacteria such as V.

carchariae and S. flexneri and has antibacterial activity by itself. Though previous research

published that Evening primrose has antibacterial activity on Salmonella typhimurium and

Staphylococcus aureus (Zhang et al., 2020), results of this research explain the specific parts

of Evening primrose that are related to different antibacterial activities and their effects on

different pathogenic bacteria.

In A549 cells, although Bcl-2 was overall consistently expressed except in the

positive control LPS where the relative expression dropped to 1.00, since it consists of a

substance that is within membrane of gram-negative bacteria. However, an increase in Bax

relative expression to 44.67 as a result of flower treatment proved that the flower could

induce apoptosis. Such would mean that the flower extract could directly prevent harms done

by the pulmonary diseases via apoptosis. Additionally, in the apoptosis signaling pathway,

there are three primary paths: through the decrease in expression of NF-kB, through the

decrease in mitochondrial activity, and through cell cycle arrest. Since apoptosis is induced
 20

but NF-kB was comparatively the most expressed in the flower treatment after the two control

groups with a relative expression of 0.93, the first path is likely not followed. Therefore, the

protein kinases that lead into the responses of the decrease in mitochondrial activity and the

inducing of cell cycle arrest will most likely see increased activity. Some of these protein

kinases include p38, CDK 1/2, and Cyclin B1.

Also, THP-1 cells were differentiated into macrophage-like cells by treatment in the

presence of PMA, which leads to a macrophage-like phenotype characterized by changes in

morphology (Tedesco et al., 2018). When PMA-differentiated THP-1 cells are treated with

LPS, potent immunogen, macrophage-like THP-1 cells engulf pathogens to present to the

second immune cells, like neutrophils, and T cells (Ubanako et al., 2019). They release

inflammatory cytokines, IL-1β, TNF-α and NF-kB. However, the leaf extract treatment

showed the greatest decrease in IL-1β expression to a point of 0.04 relative expression value,

and the flower extract treatment showed the biggest decrease in TNF-α expression to 0.14

relative expression value, proving that the leaf and flower extracts had anti-inflammatory

properties. Furthermore, in the inflammation signaling pathway, NF-kB is the primary

transcription factor which carries onto the target gene and produces multiple responses.

Considering this property of the gene, NF-kB relative expression was also highest of the

evening primrose treatment groups in the flower treatment at a value of 0.93, meaning that

the flower group can both have high concentrations of the transcription factor but also

decrease the pro-inflammatory gene expression. Moreover, of the possible responses, one of

them is an increase in the expression of pro-inflammatory genes. However, since results

explained that IL-1β and TNF-α both decreased in expression due to evening primrose

treatment, other responses most likely experience increased activity, such as an increase in

chemokines, or adhesive molecules which are both agents that aid the cell signaling and

recognition of inflammation-inducing factors.

 21

So far, the physiological activity of Evening primrose has been confirmed, but there

have been few studies confirming the anti-inflammatory response in lung cancer cells and

immune cells. This research, however, explains that the Evening primrose not only has anti-

inflammatory properties, but its extracts, particularly the flower and oil extracts, have war-

influenced disease preventive attributes as well. Furthermore, such characteristics of the plant

make it a strong candidate for easy-access but effective solutions to increasing and spreading

infectious diseases during or after war-polluted environments.

Acknowledgements

Firstly, I would like to express my appreciation for my parents Dr. Yoojin Kim and Mr.

Donghyon Kim for giving me the opportunity to conduct my studies as well as consistently

support my fields of interests and studies. I would like to express my sincere gratitude to the

private institute Genuine Research which enabled me to research within their laboratory daily

with their instruments and materials. Also, I want to acknowledge the assistance I received

from my mentor Dr. Min Hee Cho, who helped demonstrate the use of certain lab equipment

as well as procedures within the institution.

 22

References

GBIF (2022). Oenothera biennis L. GBIF Secretariat. GBIF Backbone Taxonomy.

https://doi.org/10.15468/39omei accessed via GBIF.org on 2023-09-23.

Hernandez, E. M. (2016). Oenothera. ScienceDirect.

https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/oenothera

Interfax (2023, March 29). Medicine imports to Ukraine fall 38%, exports decline 24% in

2022 - survey. Interfax. https://interfax.com/newsroom/top-stories/89133/

Mehmood, Z. & Ahmad, I. (2019). Oenothera biennis. Oenothera biennis - an overview.

ScienceDirect Topics. https://www.sciencedirect.com/topics/medicine-and-

dentistry/oenothera-biennis

Melkozerova, V. (2023, June 16). Ukraine readies for waterborne disease outbreak from dam

floodwaters. POLITICO. https://www.politico.eu/article/ukraine-waterborne-disease-

outbreak-dam-floodwaters-nova-kakhovaka/

National Library of Medicine (2023a, September 7). Bax BCL2 associated X, apoptosis

regulator [homo sapiens (human)] - gene - NCBI. National Center for Biotechnology

Information. https://www.ncbi.nlm.nih.gov/gene/581#bibliography

National Library of Medicine (2023b, September 7). Gapdh glyceraldehyde-3-phosphate

dehydrogenase [homo sapiens (human)] - gene - NCBI. National Center for

Biotechnology Information. https://www.ncbi.nlm.nih.gov/gene/2597

Paul, I. K., Nchasi, G., Bulimbe, D. B., Mollel, M. K., Msafiri, G. G., Mbogo, A.,

Mswanzari, M. B., Joseph, M., Mahmoud, A., & Volkova, A. (2023). Public health

concerns about Tuberculosis caused by Russia/Ukraine conflict. Health science

reports, 6(4), e1218. https://doi.org/10.1002/hsr2.1218

Piotrowicz, K., Semeniv, S., Kupis, R., Ryś, M., Perera, I., Gryglewska, B., Gąsowski, J.

(2022, September 16). Disease burden in older Ukrainian refugees of war: a synthetic
 23

reanalysis of public records data. The Lancet.

https://www.thelancet.com/journals/lanhl/article/PIIS2666-7568(22)00187-8/fulltext

Pugazhenthi, S., Zhang, Y., Bouchard, R., & Mahaffey, G. (2013). Induction of an

inflammatory loop by interleukin-1β and tumor necrosis factor-α involves NF-kB and

STAT-1 in differentiated human neuroprogenitor cells. PloS one, 8(7), e69585.

https://doi.org/10.1371/journal.pone.0069585

Schmidt, E. P. & Tuder, R. M. (2010). Role of Apoptosis in Amplifying Inflammatory

Responses in Lung Diseases. Journal of cell death, 2010(3), 41–53.

https://doi.org/10.4137/JCD.S5375

Shannon, J. D. & Kimbrough, R. C. (2006). Pulmonary cholera due to infection with a non-

O1 Vibrio cholerae strain. Journal of clinical microbiology, 44(9), 3459–3460.

https://doi.org/10.1128/JCM.02343-05

Shumilova, O., Tockner, K., Sukhodolov, A. Khilchevski, V., Meester, L.D., Stepanenko, S.,

Trokhymenko, G., Hernández-Agüero, J.A., Gleick, P. (2023). Impact of the Russia–

Ukraine armed conflict on water resources and water infrastructure. Nat Sustain 6,

578–586. https://doi.org/10.1038/s41893-023-01068-x

Tedesco, S., De Majo, F., Kim, J., Trenti, A., Trevisi, L., Fadini, G.P., Bolego, C., Zandstra,

P.W., Cignarella, A., Vitiello, L. (2018). Convenience versus Biological Significance:

Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived

Macrophages When Studying In vitro Polarization? Frontiers in Pharmacology

Volume 9. https://www.frontiersin.org/articles/10.3389/fphar.2018.00071

Timoszuk, M., Bielawska, K., & Skrzydlewska, E. (2018). Evening primrose (Oenothera

biennis) Biological Activity Dependent on Chemical Composition. Antioxidants

(Basel, Switzerland), 7(8), 108. https://doi.org/10.3390/antiox7080108

 24

Ubanako, P., Xelwa, N. & Ntwasa, M. (2019). LPS induces inflammatory chemokines via

TLR-4 signalling and enhances the Warburg Effect in THP-1 cells. PloS one, 14(9),

e0222614. https://doi.org/10.1371/journal.pone.0222614

Vijay, K. (2020) Pulmonary Innate Immune Response Determines the Outcome of

Inflammation During Pneumonia and Sepsis-Associated Acute Lung Injury. Frontiers

in Immunology. Volume 11.

https://www.frontiersin.org/articles/10.3389/fimmu.2020.01722

Xu, W., Shen, G., Li, T., Zhang, Y., Zhang, T., Xue, H., Zuo, W., Li, Y., Zhang, D., & Jin, C.

(2020, August 1). Isoorientin induces the apoptosis and cell cycle arrest of A549

human lung cancer cells via the ros-regulated MAPK, STAT3 and NF-ΚB signaling

pathways. International Journal of Oncology. https://www.spandidos-

publications.com/10.3892/ijo.2020.5079

Zahedi, M. (2021, June) Inhibiting NF-κB During Cytokine Storm in COVID-19: Potential

Role of Natural Products as a Promising Therapeutic Approach - Scientific Figure on

ResearchGate. Available from: https://www.researchgate.net/figure/NF-kB-signaling-

pathway-TNF-a-IL1-b-which-are-over-secreted-induced-by-COVID-

19_fig1_352186984 [accessed 2 Feb, 2024]

Zhang, K., Piao, X., Li, J., Jin, M. & Jiang, J. (2020). Extract from Oenothera biennis L.

stalks efficiently inhibits Staphylococcus aureus activity by affecting cell permeability

and respiratory metabolism, Industrial Crops and Products, Volume 158, 112961,

ISSN 0926-6690, https://doi.org/10.1016/j.indcrop.2020.112961.