1

Preventing Waterborne Infection and Pulmonary Disease in War-Torn Regions Using

Evening Primrose Extract

Andrew Joun Kim

Seoul International School, Gyeonggi-do, Seongnam-si, South Korea

October 14th, 2023

 2

Preventing Waterborne Infection and Pulmonary Disease in War-Torn Regions Using

Evening Primrose Extract

Abstract

Due to wars, sewage systems often break down and become polluted, leading to

increased waterborne infectious diseases. This study aims to use the Evening primrose

(Oenothera biennis) plant, which has been known to embody properties that allow them to

survive in polluted areas, in order to examine its preventive and treating characteristics on

pulmonary inflammatory diseases that arise from waterborne infectious diseases. First, an

artificial war-polluted environment was created in order to determine whether the Evening

primrose was able to sprout and grow, and the effects of the Evening primrose’s flower petal

(EF), leaf (EL), and oil (PO) ethanol extracts on 4 species of bacteria (Shigella flexneri,

Escherichia coli, Vibrio carchariae, Bacillus bravis) was checked using the Disk Diffusion

Method. The results explained that the EF and PO treatments curbed the growth of S. flexneri

and V. carchariae, respectively. Also, in order to examine the anti-inflammatory effect of the

Evening primrose extracts on THP-1 monocytes, primers for representative immune

biomarkers such as IL-1β, TNF-α, and NF-κB were prepared. Additionally, to investigate the

possible inducement in apoptosis as a result of the Evening primrose extract treatments in

A549 lung cancer cells, primers for Bax and Bcl-2 were made. These primers were used to

proceed with the RT-PCR process afterwards. The final results exemplify that although LPS

treatment in differentiated THP-1 cells by PMA showed increased IL-1β and TNF-α

expression, when EL was treated, IL-1β expression decreased, and when EF was treated,

TNF-α expressed decreased, explaining that Evening primrose leaves and flowers each had

anti-inflammatory properties. Moreover, when the A549 lung cancer cells were treated with

the EF extract, the apoptosis inducer gene, Bax, rather than the apoptosis repressor gene, Bcl-
 3

2, was more expressed, illustrating properties that could have a positive effect on helping

treat lung cancers. Therefore, not only do Evening primrose extracts directly suppress the

harmful effects and spread of waterborne infectious diseases, they also have cancer-

suppressing and anti-inflammatory properties when examined on lung cancer cells and

monocytes, being a strong candidate for an easily accessible cure to a variety of disorders that

result from increased waterborne infectious diseases in war-polluted areas.

Keywords: Oenothera biennis, Immune response, cytokine, waterborne infectious diseases

Introduction

With the prolonging of the Russia-Ukraine war in current date, the pollution and

damaged water supply and sewage systems as well as other direct exposure to war-related

chemicals has shown to cause an increase in waterborne diseases (Melkozerova, 2023). By

June 2022, more than 25 major Ukrainian freshwater industries had been damaged or

completely destroyed (Shumilova et al., 2023).

In addition to the damage of such freshwater industries, continued war has caused

imports of medicines to Ukraine in 2022 to decline 38% year-on-year to $1.9 billion from

$3.1 billion after a five-year growth (Interfax, 2023, March 29). Such an occurrence makes

the waterborne diseases that increase from the contaminated sewage systems hard to treat,

causing active-war areas such as Ukraine to have no simple way to recover from illnesses.

Among these illnesses that become hard to treat, one of the most concerning ones are

pulmonary diseases. There is proof that pulmonary diseases in general have increased due to

past wars, and Ukraine currently has the fourth‐highest Tuberculosis (TB) incidence in the

WHO European region (Paul et al., 2023). Not only Tuberculosis but other pulmonary

diseases such as Chronic obstructive pulmonary diseases (COPD) result due to war
 4

(Piotrowicz, et al. 2022, September 16).

In order to treat these diseases that occur in a war-polluted area without many imports

of medication, a local solution that is tolerant to the extreme conditions of pollution had to be

found. Of those, the local Evening primrose (Oenothera biennis) plant was found to be a

hardy plant which proliferates throughout most biomes excluding Greenland and Antarctica

due to its high tolerance for extreme temperatures (GBIF Secretariat, 2022). Also, the

Evening primrose has commonly been used in past efforts of curing diseases arising from

war-pollution, as it has been proven to be able to treat and prevent salmonella and

staphylococcus (Zhang et al., 2020).

Figure 1

Distribution of Evening primrose in the world (GBIF Secretariat, 2022)

In common pulmonary diseases, the first line of defense against the infection would

be the immune-system, making it a pertinent part to investigate in the study (Vijay, 2020).

Apoptosis is also an important aspect to consider, since once cells are infected, apoptosis

controls and prevents the disease from harming different areas of the lungs (Schmidt &
 5

Tuder, 2010).

Therefore, the main objective of the study was to determine whether Evening

primrose extracts either provide a direct treatment of the disease by inducing apoptosis, or an

indirect preventive method through the immune system for the pulmonary diseases linked to

the increase in waterborne diseases in conditions of the Russia-Ukraine war.

Considering the objective of the study, it was interesting to note that the Evening

primrose mainly contains the amino acid tryptophan and has been known for being able to

cure certain inflammatory disorders (Timoszuk et al., 2018). The oil extract from the Evening

primrose also contains an unusually high content of essential fatty acids and gamma-linoleic

acid (Hernandez, 2016).

In the study, the flower, leaf, and oil parts of the Evening primrose were chosen for

examination. Commonly, the flower has been known for its sedative properties and for acting

as a treatment for gastrointestinal disorders (Mehmood & Ahmad, 2019). The leaf is also well

known for treating asthma and digestive problems (Timoszuk et al., 2018). Lastly, the oil

extracts are commonly used to treat acne, eczema, dry skin, while also having properties that

help with blood vessel dilation and the prevention of blood clotting (Mehmood & Ahmad,

2019).

The cells used in the research include the A549 cell line, which is commonly used

when studying pulmonary diseases and cancers, to determine if the Evening primrose could

act as a direct treatment to affected cells. The THP-1 cell line was also used, which is a

monocyte that is commonly used for immunology research, to examine the anti-inflammatory

properties of the Evening primrose. Additionally, treatments were also tested directly on

gram-negative bacteria such as Shigella flexneri, Escherichia coli, Bacillus bravis, and Vibrio

carchariae, which is known for being a marine family of bacteria that causes Pulmonary

cholera (Shannon & Kimbrough, 2006).

 6

To evaluate the curing and preventing properties of the Evening primrose, expression

of genes signifying apoptosis and anti-inflammation would be examined. The primers used

were Bax and Bcl-2 to measure apoptosis, as it has been proven that the high ratio of Bax to

Bcl-2 causes a release in cytochrome C and therefore increases apoptosis (National Library of

Medicine, 2023, September 7). To measure anti-inflammatory aspects of the Evening

primrose, pro-inflammatory genes such as IL-1β, TNF-α, and NF-kB gene expressions were

examined (Pugazhenthi et al., 2013). The GAPDH, housekeeping gene, was also checked for

as a control as it measures the production of ATP and pyruvate within the cells, which should

apply for each variable tested (National Library of Medicine, 2023, September 7).

Materials and Methods

Extraction of Evening primrose

Extraction

The Evening primrose’s flower petals and leaf extracts were retrieved by using 20 mL

of 80% ethanol with 0.50 g of the leaf (EL), and 0.415 g for the flowers (EF), respectively.

Filtration of the samples was done using a DISMIC-25 0.22 μm Disposable Membrane Filter

Unit (ADVANTEC) and 20 mL Sterile Hypodermic Syringe (Korea Vaccine Co. The seed oil

sample (PO) was gathered from 500 mg Evening primrose oil capsules, using a 1 mL Sterile

Hypodermic Syringe (Korea Vaccine Co.) (See Figure 2).

Figure 2

Extraction of Evening primrose

 7

Note. A. Preparation for flower, leaf, and oil of the Evening primrose. B. Extraction of the

Evening primrose with DW and 80% ethanol. C. Filtration of extracts through a 0.22μm disk

filter.

Creating an Artificial War Polluted Soil Model for Post-war Soil

Soil Preparation In order to measure the survival tolerance of the Evening primrose

plant, a control and an experimental group was prepared for the soil. In the experimental

group, 18g soil, 1 mL diesel fuel, 0.2 g Urea, 0.2 g potassium phosphate monobasic, 0.175 g

copper chloride, 0.231 g iron oxide, and 30 mL DW were mixed and placed in a plastic cup.

Meanwhile, the control group contained 18 g of soil and 30 mL DW (See Figure 3).

Figure 2

Preparation of War polluted soil model

 8

Plant Growth in Soil Two seeds were germinated on damp paper towels in an

enclosed capsule for 48 hours and were inserted below the surface level of the control soil.

These were grown for a week and watered once every 48 hours. Afterwards, a 1 cm layer of

war-polluted soil was placed on top of the control soil and sprout, and later carefully mixed to

see if the sprouted plants would be able to tolerate the conditions for 14 days.

Bacterial cell culture

Four agar plates were each divided into quarters and each section was labeled:

negative control (-), EF, EL, and PO. Using a micropipette, 100 μL of each bacterial culture,

S. flexneri, V. carchariae, E. coli, and B. subtilis, were dropped on the center of their

respective plates, and spread with a sterilized spreader. Afterwards, 16 paper discs, four for

each agar plate, were treated with either 20 μL DMSO, for the negative control, 40 μL EF

extract, 40 μL EL extract, or 20 μL PO extract. These volumes have been decided through

trials of which volume would carry the most of each treatment while also not overflowing.

Cell

Cell Lines and Media

The human monocyte cell line THP-1 was obtained from the Korean Cell Line Bank

(KCLB). The cells were cultured as recommended: in RPMI 1640 medium supplemented

with 10% Fetal Bovine Serum (FBS) and 1% penicillin-streptomycin. The cells were

incubated at 37 °C in a humidified atmosphere with 5 % CO2. The human lung cancer cell

line, A549 cells were purchased from KCLB and cultured in RPMI1640 in the same

condition as THP-1 cells (See Figure 4).

 9

Figure 4

Cell Cultivation

Note. A. cell cultivation on the bench. B. Observation using microscope. C. A549 cells. D.

THP-1 cells.

PMA differentiated THP-1 cells

1.5 × 106 THP-1 cells were seeded in each well of the six-well plate and differentiated

with 100 ng/ml phorbol-12-myristate 13-acetate (PMA, Sigma) and 2 mL of RPMI 1640 at

37°C in a humidified atmosphere with 5% CO2 for 48h for 3 days. After this time, the cells

were changed with fresh medium without PMA to allow cell recovery and were cultivated for

2 days under the same incubation conditions. Cell differentiation was verified by microscopy.

PMA-differentiated THP-1 cells and A549 cells were incubated with EF, EL and PO extracts

for 48h, then the cell viability was assessed by Trypan Blue dye exclusion assay.

Primer sequencing

Selection of Biomarker Gene

Three genes (IL-1β, TNF-α, NF-kB) associated with pro-inflammation were selected
 10

to quantify their expression levels by THP-1 cells in response to the extracts of different

Evening primrose parts. Expression of pro-inflammatory related gene expressions were

normalized to the expression of GAPDH (See Table1).

Table 1

Biomarker gene for corresponding apoptosis and anti-inflammatory response

Gene Function

Bax Apoptosis inducer

A549
Bcl-2 Apoptosis Inhibitor

IL-1β

THP-1 TNF-α Pro-inflammation

NK-kB

A549/ THP-1 GAPDH Housekeeping gene

Apoptosis related genes are known to Bcl-2, inhibition of apoptosis and Bax, inducer

of apoptosis. Exon sequences of six genes (IL-1β, TNF-α, NF-kB, Bax, Bcl-2, GAPDH) were

utilized to construct respective primers of the genes. The designed primer sequences are

shown in Table 2.

Table 2

Primer design for biomarker genes

GENE Sequence

F CCTGTCCTGCGTGTTGAAAGA
IL-1β
R GGGAACTGGGCAGACTCAAA
 11

F TGCTCCTCACCCACACCAT
TNF-α
R GAGATAGTCGGGCCGATTGA

F GGGAAGGCCTGAACAAATGTTTC
NF-kB
R CGGATTAGCTCTTTTTCCCGATCTCC

F ATGGAGCCACTGGCCACAGCAGAAG
Bcl-2
R GTTGCGATCCGACTCACCAATACCT

F TCTGACGGCAACTTCAACTG
Bax
R TGGGTGTCCCAAAGTAGGAG

F GTATCGTGGAAGGACTCATGACCAC
GAPDH
R GCCAAATTCGTTGTCATACCAGGAA

RNA preparation and cDNA synthesis

Total RNA extraction was performed on each sample using AccuPrep Universal RNA

Extraction Kit (Bioneer, K-3140) according to the manufacturer’s protocol (See Figure 5A)

. RNA samples were stored at 80 °C for further analysis. In

st
strand cDNA Synthesis Kit (TAKARA,

USA), creating a mix of 5 μL total RNA per sample, 1 μL 50μM oligo dT primer, 2 μL 5X

reaction buffer, 0.5 μL Reverse transcriptase, 1.5 μL RNase-free water, and 90 μL ddH2O.

These five samples were then run at 12,000 rpm on the mini centrifuge to drop all the

solutions stuck on the sides of the tube, and then incubated at 42 ˚C for 1 hour.

RT-PCR

For the PCR process, cDNA of unexposed A549 cells, EF, PO, and EL exposed cell

groups were mixed, each with the Forward and Reverse of each primer, Bax, Bcl2 and
 12

GAPDH. Also, cDNA of unexposed THP-1 cells, LPS, EF, PO, and EL exposed THP-1 cells

were mixed, each with IL-1β, TNF-α, NF-kB and GAPDH primers. Each mixture contained

2.7 μL cDNA and 1 μL of each primer, and 2 μL 10x PCR Buffer, 2 μL dNTP Mixture, 0.5

μL TaKaRa Taq, and 11.8 μL nuclease free water were added to run the PCR process as

noted in Table 3.

Table 3

PCR condition

Step 1 Step 2 Step 3

94 ˚C 94 ˚C 60 ˚C 72 ˚C 72 ˚C

1 min 30 s 30 s 30 s 7 min

1 cycle 30 cycles 1 cycle

Gel electrophoresis

100 ml of 1X TAE buffer and 1.5g (1.5%) of Agarose LE master were mixed and

microwaved to dissolve the solute. 10 μL of GreenStar Nucleic Acid Staining Solution I

(BIONEER) was mixed with 1% agarose since the solution was originally 10,000x. The agar

solution was poured into the gel mold and left to harden, then put into the gel electrophoresis

machine and the gel was completely submerged in 1X TAE buffer. Then, 10 μL of 100bp

DNA ladder was added to each well of the gel, one for each of the groups of the PCR

products. Also, 6x DNA loading dye was mixed with the PCR product and loaded to the

remaining wells. Therefore, a total of 16 wells were used, 4 for the 100bp ladder and 12 for

the samples. After loading all the PCR products, electrophoresis was run at 100V for 25

minutes (See Figure 5B).

10 μL of PCR products was loaded into each well before running gel electrophoresis
 13

to observe the amount of amplified pro-inflammatory and apoptosis related gene.

Figure 5

RNA preparation and gel electrophoresis

Note. RNAs of THP-1 cells and A549 cells treated with LPS and extract for Evening

primrose.

Results

Plant growth in Artificial War Polluted Model

After planting the germinated sprouts in the normal soil for 7 days, the first small

sprouts grow above the surface of the soil, proving that there was no issue with the setting of

the control soil (See Figure 6A-B). After 7 more days, there were a series of the sprouts,

proving that the plants were able to grow further from the 7-day mark. Similarly, even after

14 days of covering a full layer of war polluted soil over the plants, the plants continued to

grow, displaying that they did have some war-tolerant properties (See Figure 6C).

Figure 6

Evening primrose seeds in non-contaminated Soil

 14

Note. A. sprouts in non-contaminated soil after 7 days. B. sprouts in non-contaminated soil

after 14 days. C). sprouts in contaminated soil for 28 days.

Inhibition of bacterial growth by Evening primrose Extract

After 2 days of incubating the bacteria with the Evening primrose extract on the plate,

there seemed to be two signs of inhibition zones. Firstly, there was a moderately wide

inhibition zone around the PO treated disk when observing its effect on V. carchariae.

Additionally, the EF treatment group on S. flexneri portrayed a similar moderate inhibition

zone, leading to the possibility that the oil and flower extracts do influence inhibiting bacteria

growth (See Figure 7).

Figure 7

Growth inhibition of waterborne infectious bacterial strains caused by Evening primrose

extract

Note. A. V. carchriae, B. B. subtilis, C. E. coli, D. S. flexneri.

 15

Effects of Evening primrose Extract on Human Immune Cells

Cell differentiation

THP-1 cells were differentiated into macrophage-like cells by incubation in the

presence of PMA, and viewed under an inverted light microscope at 100× to compare the

non-differentiated cells to the differentiated cells. When not treated by PMA, THP-1 cells are

round and non-adherent (See Figure 8A). Differentiation of THP-1 cells with PMA resulted

in a change in morphology, with cells changing dendrite-like cells and an adherent (See

Figure 8B). PMA-treated THP-1 cells were treated with LPS (100ng/ml), which is one of the

major components of the outer membrane of gram-negative bacteria. The cells treated with

LPS showed dendrites branched out in THP-1 cells (See Figure 8C).

The effects of Evening primrose extract on proliferation of THP-1 cells

Afterwards, the differentiated THP-1 cells were treated with the Evening primrose

extracts (EF. EL. PO), which resulted in a visible difference in cell density among the treated

samples but no significant difference in morphology as shown in See Figure 8D-F.

Figure 8

Morphology of THP-1 cells treated with Evening primrose extract

 16

Note. A. THP-cell, B. THP-1 cell treated with PMA for 48h. C-F. PMA-treated THP-1 cells

treated with: C. LPS, D. EF, E. EL, and F. PO.

Cell viability

Differentiated THP-1 cells and A549 cells were incubated with EF, EL and PO

extracts for 48h, then the cell viability was assessed by Trypan Blue dye exclusion assay

(data not shown). As a result, THP-1 cells and A549 cells treated with the Evening primrose

extracts were all alive, meaning that these extracts do not have cytotoxicity.

Expression of biomarker caused by Evening primrose

Expression of Apoptosis related gene

The expression of the Bcl-2 gene indicates that Evening primrose influenced anti-

apoptosis in A549 cells (See Figure 9A). But the detection of Bax gene expression in the

Evening primrose extract-treated cells indicates that Evening primrose influenced apoptosis

in cells (Fig, 9B). Therefore, the Bax gene showed up for the EF treatment, meaning that the

flower extract induced apoptosis, proving to be helpful in treating the infection.

 17

Figure 9

Expression of Bcl-2 and Bax genes in A549 cells treated with Evening primrose extract

Note. M: 100bp ladder, 1, LPS, 2. EF, 3. EL, 4. PO

Expression of Inflammation related gene

After the PCR and gel electrophoresis analysis of the inflammatory biomarkers in the

THP-1 cells, two primers signified changes. First, there was a decrease in IL-1β when treated

with EL, proving that it has anti-inflammatory properties as IL-1β is pro-inflammatory. TNF-

α also decreased as a result of the EF treatment, portraying that EF also had anti-

inflammatory properties (See Figure 10). These data demonstrate that Evening primrose EL

and EF extract treatment of THP-1 cells has suppressing effects on IL-1β and TNF-α

secretion respectively.

Figure 10

Pro-inflammatory cytokine expression in differentiated THP-1 cells treated with Evening

primrose extract
 18

Note. M: 100bp ladder, 1, non-treated, 2. LPS, 3. EF, 4. EL, 5. PO.

Discussion and Conclusion

Given the current prolonging of the Russia-Ukraine war causing a boom in

waterborne infectious diseases and leading to severe pulmonary disorders (Melkozerova,

2023), a great concern is a possible local treatment to such large-scale disorders. Of such

candidates for local treatment is Evening primrose, which has commonly been used not only

as food but also for traditional medicine (Hernandez, 2016).

This research was conducted to investigate 1) whether Evening primrose covered with

war contaminant soil can grow. 2) whether Evening primrose has anti-bacterial activities for

the waterborne disease related bacteria. 3) whether THP-1 cells, an immune cell line, treated

with Evening primrose extract are inhibited from releasing pro-inflammatory cytokines, such

as IL-1β, TNF-α, NF-kB. And 4) whether A549 cells, a lung cancer cell line, can change the

expression of apoptosis-related genes, such as Bcl-2 and Bax.

In brief, first, Evening primrose sprouts covered with contaminant soil were

examined, and it explained that the plants were able to grow after 14 days. Therefore, it could

be confirmed that Evening primrose could grow and survive even in harsh war-polluted

conditions.
 19

In the research, the oil of Evening primrose especially decreased the growth in V.

carchariae, as represented by the Disk diffusion method, and the flower extract treatment

resulted in a moderate inhibition of S. flexneri growth. Therefore, it was found that Evening

primrose extracts directly affect the inhibition of water-borne infectious bacteria such as V.

carchariae and S. flexneri and has antibacterial activity by itself. Though previous research

published that Evening primrose has antibacterial activity on Salmonella typhimurium and

Staphylococcus aureus (Ke-Xin Zhang et al., 2020), results of this research explain the

specific parts of Evening primrose that are related to different antibacterial activities and their

effects on different pathogenic bacteria.

THP-1 cells were differentiated into macrophage-like cells by treatment in the

presence of PMA, which leads to a macrophage-like phenotype characterized by changes in

morphology (Tedesco Serena et al., 2018). When PMA-differentiated THP-1 cells are treated

with LPS, potent immunogen, macrophage-like THP-1 cells engulf pathogens to present to

the second immune cells, like neutrophils, and T cells (Ubanako et al., 2019). They release

inflammatory cytokines, IL-1β, TNF-α and NF-kB. However, the leaf extract treatment

showed a decrease in IL-1β expression and the flower extract treatment showed a decrease in

TNF-α expression, proving that the leaf and flower extracts had anti-inflammatory properties.

Also, in A549 cells, an increase in Bax expression proved that the flower could induce

apoptosis. Such would mean that the flower extract could directly prevent harms done by the

pulmonary diseases via apoptosis.

So far, the physiological activity of Evening primrose has been confirmed, but there

have been few studies confirming the anti-inflammatory response in lung cancer cells and

immune cells. This research, however, explains that the Evening primrose not only has anti-

inflammatory properties, but its extracts, particularly the flower and oil extracts, have war-

influenced disease preventive attributes as well. Furthermore, such characteristics of the plant
 20

make it a strong candidate for easy-access but effective solutions to increasing and spreading

infectious diseases during or after war-polluted environments.

References

GBIF (2022). Oenothera biennis L. GBIF Secretariat. GBIF Backbone Taxonomy.

https://doi.org/10.15468/39omei accessed via GBIF.org on 2023-09-23.

Hernandez, E. M. (2016). Oenothera. ScienceDirect.

https://www.sciencedirect.com/topics/agricultural-and-biological-sciences/oenothera

Interfax. (2023, March 29). Medicine imports to Ukraine fall 38%, exports decline 24% in

2022 - survey. Interfax. https://interfax.com/newsroom/top-stories/89133/

Mehmood, Z., & Ahmad, I. (2019). Oenothera biennis. Oenothera biennis - an overview.

ScienceDirect Topics.

https://www.sciencedirect.com/topics/medicine-and-dentistry/oenothera-biennis

Melkozerova, V. (2023, June 16). Ukraine readies for waterborne disease outbreak from dam

floodwaters. POLITICO. https://www.politico.eu/article/ukraine-waterborne-disease-

outbreak-dam-floodwaters-nova-kakhovaka/

National Library of Medicine. (2023, September 7). Bax BCL2 associated X, apoptosis

regulator [homo sapiens (human)] - gene - NCBI. National Center for Biotechnology

Information. https://www.ncbi.nlm.nih.gov/gene/581#bibliography

National Library of Medicine. (2023, September 7). Gapdh glyceraldehyde-3-phosphate

dehydrogenase [homo sapiens (human)] - gene - NCBI. National Center for

Biotechnology Information. https://www.ncbi.nlm.nih.gov/gene/2597

Paul, I. K., Nchasi, G., Bulimbe, D. B., Mollel, M. K., Msafiri, G. G., Mbogo, A.,

Mswanzari, M. B., Joseph, M., Mahmoud, A., & Volkova, A. (2023). Public health
 21

concerns about Tuberculosis caused by Russia/Ukraine conflict. Health science

reports, 6(4), e1218. https://doi.org/10.1002/hsr2.1218

Piotrowicz, K., Semeniv, S., Kupis, R., Ryś, M., Perera, I., Gryglewska, B., Gąsowski, J.

(2022, September 16). Disease burden in older Ukrainian refugees of war: a synthetic

reanalysis of public records data. The Lancet.

https://www.thelancet.com/journals/lanhl/article/PIIS2666-7568(22)00187-8/fulltext

Pugazhenthi, S., Zhang, Y., Bouchard, R., & Mahaffey, G. (2013). Induction of an

inflammatory loop by interleukin-1β and tumor necrosis factor-α involves NF-kB and

STAT-1 in differentiated human neuroprogenitor cells. PloS one, 8(7), e69585.

https://doi.org/10.1371/journal.pone.0069585

Schmidt, E. P., & Tuder, R. M. (2010). Role of Apoptosis in Amplifying Inflammatory

Responses in Lung Diseases. Journal of cell death, 2010(3), 41–53.

https://doi.org/10.4137/JCD.S5375

Shannon, J. D., & Kimbrough, R. C., (2006). Pulmonary cholera due to infection with a non-

O1 Vibrio cholerae strain. Journal of clinical microbiology, 44(9), 3459–3460.

https://doi.org/10.1128/JCM.02343-05

Shumilova, O., Tockner, K., Sukhodolov, A. Khilchevski, V., Meester, L.D., Stepanenko, S.,

Trokhymenko, G., Hernández-Agüero, J.A., Gleick, P. (2023). Impact of the Russia–

Ukraine armed conflict on water resources and water infrastructure. Nat Sustain 6,

578–586. https://doi.org/10.1038/s41893-023-01068-x

Tedesco, S., De Majo, F., Kim, J., Trenti, A., Trevisi, L., Fadini, G.P., Bolego, C., Zandstra,

P.W., Cignarella, A., Vitiello, L. (2018). Convenience versus Biological Significance:

Are PMA-Differentiated THP-1 Cells a Reliable Substitute for Blood-Derived

Macrophages When Studying In vitro Polarization? Frontiers in Pharmacology

Volume 9. https://www.frontiersin.org/articles/10.3389/fphar.2018.00071
 22

Timoszuk, M., Bielawska, K., & Skrzydlewska, E. (2018). Evening primrose (Oenothera

biennis) Biological Activity Dependent on Chemical Composition. Antioxidants

(Basel, Switzerland), 7(8), 108. https://doi.org/10.3390/antiox7080108

Ubanako, P., Xelwa, N., & Ntwasa, M. (2019). LPS induces inflammatory chemokines via

TLR-4 signalling and enhances the Warburg Effect in THP-1 cells. PloS one, 14(9),

e0222614. https://doi.org/10.1371/journal.pone.0222614

Vijay, K. (2020) Pulmonary Innate Immune Response Determines the Outcome of

Inflammation During Pneumonia and Sepsis-Associated Acute Lung Injury. Frontiers

in Immunology. Volume 11.

https://www.frontiersin.org/articles/10.3389/fimmu.2020.01722

Zhang, K., Piao, X., Li, J., Jin, M., Jiang, J. (2020). Extract from Oenothera biennis L. stalks

efficiently inhibits Staphylococcus aureus activity by affecting cell permeability and

respiratory metabolism, Industrial Crops and Products, Volume 158, 112961, ISSN

0926-6690, https://doi.org/10.1016/j.indcrop.2020.112961.