Veterinary Parasitology 259 (2018) 17–24

Contents lists available at ScienceDirect

Veterinary Parasitology
journal homepage: www.elsevier.com/locate/vetpar

Research paper

Development of a multiplex quantitative PCR assay for detection and T

quantification of DNA from Fasciola hepatica and the intermediate snail host,
Austropeplea tomentosa, in water samples
Vignesh Rathinasamya,b, Chris Hoskinga,b, Lily Trana,b, Jane Kelleya,b, Genevieve Williamsona,b,
⁎ ⁎
Jaclyn Swana,b, Timothy Elliottd, Grant Rawlina,b,c, Travis Beddoea,b, ,1, Terry W. Spithilla,b, ,1
a
Department of Animal, Plant and Soil Sciences, La Trobe University, Bundoora, Vic., Australia
b
Centre for AgriBioscience, La Trobe University, Bundoora, Vic., Australia
c
Department of Department of Economic Development, Jobs, Transport and Resources, Bundoora, Vic., Australia
d
Invetus, Armidale Research Centre, Armidale, New South Wales, Australia

A R T I C LE I N FO A B S T R A C T

Keywords: Liver fluke (Fasciola hepatica) infection is an increasing threat to livestock production resulting in serious eco-
Fasciola hepatica nomic losses to the beef, dairy and sheep industries in Australia and globally. Triclabendazole (TCBZ) is the main
Austropeplea tomentosa drug used to control liver fluke infections in Australia and the widespread emergence of TCBZ resistance in cattle
Multiplex quantitative PCR and sheep threatens liver fluke control. Alternative control measures to lower exposure of livestock to fluke
qPCR
infection would be useful to help preserve the usefulness of current chemical flukicides. Environmental DNA
Environmental DNA
(eDNA) sampling methodology and associated molecular techniques are suited to rapidly assess the presence of
pathogens on farms. In the present study, we developed a water sampling method in combination with a mul-
tiplex quantitative PCR assay to detect and quantify DNA of F. hepatica and Austropeplea tomentosa (A. to-
mentosa), a crucial intermediate snail host for liver fluke transmission in South-east Australia. The multiplex
qPCR assay allows for the independent detection of F. hepatica and A. tomentosa DNA using specific primers and a
probe targeting the ITS-2 region of the liver fluke or snail. The method allows the highly specific and sensitive
(minimal DNA detection levels to 14–50 fg) detection of F. hepatica or A. tomentosa. The method allows the
detection of both liver fluke and snail eDNA in water samples. The effective quantification of liver fluke and snail
eDNA in water samples using this assay could potentially allow researchers to both identify and monitor F.
hepatica transmission zones on farming properties in South-east Australia which will better inform control
strategies, with potential application of the assay worldwide.

1. Introduction
Fasciola spp., commonly referred to as ‘liver flukes’, are a globally
distributed parasite species consisting of two main causative agents:
Fasciola gigantica, a tropical parasite found in Asia, SE Asia, Africa,
China and the Middle East; and F. hepatica, a temperate parasite found
predominantly in Australia, South America, the United Kingdom,
Ireland and Europe (Mas-Coma et al., 2009; Nyindo and Lukambagire,
2015; Piedrafita et al., 2010). Fasciola infection in ruminants results in
the significant reduction of milk, meat and wool production, posing a
threat to the livestock production industries (Piedrafita et al., 2010).
Triclabendazole (TCBZ) is the drug of choice to control fasciolosis but
TCBZ resistance is now widespread and has been reported in several
regions including Australia, South America, UK, Ireland and Europe
(Kelley et al., 2016). The recent reports of Fasciola infection and TCBZ
resistance in humans exemplify the need to also regard fasciolosis as a
public health problem (Dusak et al., 2012; Hughes et al., 2003; Mas-
Coma et al., 1999).
F. hepatica requires two different hosts to complete its life cycle
(Andrews, 1991; Keiser and Utzinger, 2009): a definitive host (such as
ruminants and humans) and an intermediate snail host (commonly
Lymnaeid snails) (Correa et al., 2010; Molloy and Anderson, 2006).
Several Lymnaeidae snails have been reported as intermediate hosts for
Fasciola transmission across the world (reviewed in Correa et al., 2010).
The liver fluke eggs are released in faeces from the infected definitive
host into the environment and hatch as miracidia which then infect the

⁎
Corresponding authors.
E-mail addresses: t.beddoe@latrobe.edu.au (T. Beddoe), T.Spithill@latrobe.edu.au (T.W. Spithill).
1
Joint senior.

https://doi.org/10.1016/j.vetpar.2018.06.018
Received 5 April 2018; Received in revised form 9 June 2018; Accepted 23 June 2018
0304-4017/ © 2018 Elsevier B.V. All rights reserved.
V. Rathinasamy et al.
intermediate snail host. Inside the snail, parasite development occurs
and hundreds of cercariae are released from the snail after about 4–7
weeks of infection (Rondelaud et al., 2009). The free-swimming cer-
cariae then attach to objects in contact with the water, such as aquatic
plants, soil or pasture, and subsequently encyst into infective meta-
cercariae (Andrews, 1991; Dusak et al., 2012). Thus, it becomes critical
to identify the snails harbouring Fasciola infection in endemic areas in
order to understand and control Fasciola transmission in the field.
Several molecular assays have been developed to identify liver
flukes in the snail host over the last two decades (Caron et al., 2011;
Cucher et al., 2006; Kaplan et al., 1997; Kramer and Schnieder, 1998;
Magalhaes et al., 2004; Schweizer et al., 2007; Velusamy et al., 2004).
Recently, efficient PCR or multiplex PCR- based methods were devel-
oped to identify Fasciola in Pseudosuccinea columella, Lymnaea viatrix,
Galba truncatula and Galba cubensis (Caron et al., 2011; Cucher et al.,
2006; Kozak and Wedrychowicz, 2010; Magalhaes et al., 2004; Mostafa
et al., 2003; Velusamy et al., 2004). A quantitative PCR (qPCR) assay
was also developed to identify F. hepatica prevalence in G. truncatula on
Swiss farms (Schweizer et al., 2007). To date, there are no studies re-
porting the molecular detection (using a multiplex qPCR assay) of F.
hepatica in A. tomentosa, the major liver fluke transmitting snail in
South-east Australia (Puslednik, 2006). To a lesser extent, A. viridis and
P. columella can also act as intermediate hosts for F. hepatica in Aus-
tralia.
The aim of the current study was to develop a sensitive and specific
multiplex qPCR assay to simultaneously detect and quantify F. hepatica
and A. tomentosa DNA from infected snails as well as environmental
DNA (eDNA) from environmental water samples. A novel set of primers
and probes were designed to target the ITS-2 region within the ribo-
somal DNA (rDNA) of F. hepatica and A. tomentosa and used in the
multiplex qPCR assay for simultaneous detection of liver fluke and snail
DNA with high sensitivity and specificity. To our knowledge, this is the
first report to demonstrate the simultaneous detection and quantifica-
tion of DNA/eDNA from F. hepatica and A. tomentosa, providing a cut-
ting-edge tool that could be used to monitor Fasciola transmission zones
on farms.
2. Materials and methods
2.1. Parasites and snails
Adult F. hepatica were collected from the livers of naturally infected
sheep on a farm at Tallangatta, Victoria, Australia or from experimen-
tally infected rats. Live adult flukes were washed and incubated in
RPMI-1640 media (Gibco, USA) for 3 h at 37 °C to remove gut contents.
The clean flukes were snap frozen in liquid nitrogen and stored at
−80 °C. Adult rumen fluke (paramphistomes) were collected from the
rumen of naturally infected cattle on a farm at Maffra, Victoria and
washed in PBS (16 mM Na2HPO4, 5 mM NaH2PO4, 120 mM NaCl, pH
7.6) and stored in RNA later. The L3 larvae of Cooperia oncophora was
maintained at Invetus, Armidale Research Centre, Armidale, NSW, and
stored in RNA later until DNA extraction. Adult Haemonchus contortus
samples were kindly provided by Assoc. Prof. David Piedrafita,
Federation University of Australia, Australia, and stored at −20 °C until
DNA extraction. A. tomentosa snails, with or without F. hepatica infec-
tion, were obtained from Invetus, Armidale Research Centre, Armidale,
NSW, and stored at −20 °C until DNA extraction. The ITS-2 region of A.
lesson (accession number: EU556310), P. acuta (accession number:
KF316328) and G. truncatula (accession number: AJ296271) were
synthesised and cloned into the pBHA vector by Bioneer Pacific,
Australia, due to the unavailability of the biological material from A.
lessoni, P. acuta and G. truncatula for DNA extraction.
2.2. Water samples
Water samples were collected from tanks with an active snail colony
18
Veterinary Parasitology 259 (2018) 17–24
at Invetus, Armidale Research Centre, Armidale, NSW, to validate the
assay for detection of eDNA. Water samples (100 ml) were stored at 4 °C
or −20 °C until eDNA extraction.
2.3. Isolation of genomic DNA
Adult F. hepatica (∼25 mg of tissue) were snap frozen in liquid ni-
trogen and homogenised into a fine powder using a mortar and pestle.
Genomic DNA was extracted using a DNeasy® Blood & Tissue kit
(QIAGEN, Hilden, Germany) as per the manufacturer’s instructions and
stored at −20 °C. DNA from H. contortus and mixed populations of C.
oncophora (95%) and Ostertagia ostertagi (5%) were isolated using
DNAzol (Thermo Scientific, USA) according to the manufacturer’s re-
commendations and stored at −20 °C.
Genomic DNA from snails was isolated according to
Winnepenninckx et al. (1993) with minor modifications. Snail tissue
was homogenised in lysis buffer (2% (w/v) Cetyl Trimethyl Ammonium
Bromide (CTAB), 1.4 M NaCl, 0.2% (v/v) β-mercaptoethanol, 20 mM
EDTA, 100 mM Tris/HCl pH 8.0 and 0.1 mg/ml proteinase K) and in-
cubated at 60 °C for 2 h with mixing every 15–30 min. Proteins from the
suspension were precipitated using an equal volume of phenol:
chloroform: isoamylalcohol (25:24:1) and the mixture was centrifuged
at 4700 x g for 15 min at 4 °C. The aqueous phase was transferred to a
new tube and an equal volume of chloroform: isoamylalcohol (24:1)
added at 4 °C and the mixture was centrifuged at 4700 x g for 15 min at
4 °C. DNA was precipitated by the addition of 2.5 volumes of 100%
ethanol, followed by incubation at −20 °C overnight and centrifugation
at 4700 x g for 15 min at 4 °C. The DNA pellet was washed with 70% (v/
v) ethanol and then centrifuged at 4700 x g for 15 min at 4 °C. The pellet
was air dried, resuspended in nuclease-free water and stored at −20 °C.
DNA concentration and purity were estimated using a Nanodrop™ 2000
spectrophotometer (Thermo Scientific, USA).
2.4. Isolation of environmental DNA
Water samples stored at −20 °C were defrosted at 4 °C for DNA
isolation. Three 10 mL aliquots were taken from each sample and 0.1 μg
of plasmid DNA encoding the internal transcribed spacer (ITS-2) region
of G. truncatula was added as an internal control. The eDNA purification
method was adapted from Li and Sheen (2012) with minor modifica-
tions. Briefly, two volumes of binding solution (6 M NaI, Sigma-Aldrich,
USA) and 100 μL of silica matrix (100 mg/mL SiO2, Sigma-Aldrich,
USA) were added to a 10 mL water sample and mixed on a rocker for an
hour at room temperature. The samples were centrifuged at 4700 x g for
10 min at 4 °C to pellet the silica matrix. The silica matrix pellet was
resuspended in 500 μL of wash buffer (50% [v/v] ethanol, 10 mM
Tris−HCl [pH 7.5], 100 mM NaCl, 1 mM EDTA) and transferred to a
microcentrifuge tube. The silica matrix was washed three times with
wash buffer and the supernatant was removed; after the final wash, the
silica matrix was dried at 70 °C for 30 s and resuspended in 30 μL of
nuclease-free water followed by incubation at 70 °C for 2 min to solu-
bilise the eDNA. The samples were centrifuged at 10,000 x g for 2 min
and the eDNA solution was transferred to a clean tube.
2.5. Primer and probe design
Primers and probes to amplify the ITS-2 region of F. hepatica and A.
tomentosa were designed and analysed using the Oligoarchitect (Sigma-
Aldrich) and Oligo 7 programs (Rychlik, 2007). ITS-2 sequences of F.
hepatica or A. tomentosa were compared with other parasite or snail
species and primers were designed in the region with low sequence
similarity. The ITS-2 sequence of F. hepatica or A. tomentosa was am-
plified from genomic DNA in a conventional PCR with the primers listed
in Table 1. Each primer pair used in the qPCR was optimised first by
conventional PCR to produce single amplicons. Amplicon specificity
was confirmed by Sanger sequencing at the Australian Genome
V. Rathinasamy et al.
Table 1
Primers and probes used in the multiplex qPCR assay. The primers and probes were synthesised by Bioneer Pacific using FAM (6-fluorescein) and HEX (hexachloro-6-
carboxyfluorescein) as reporter dyes at the 5′ end of the qFhITS2P (probe for Fasciola hepatica detection) and the qAtITS2P (probe for Austropeplea tomentosa
detection), respectively. Both the probes were single quenched at the 3’end using BHQ-1 (Black Hole Quencher-1).
Primers and probes Sequence 5’-3’ Concentration
qFhITS2 FP GGTTGGTACTCAGTTGTCA 300 nM
qFhITS2 RP CAAAGTGACAGTGACGGAA
qFhITS2 P CCTAGTCGGCACACTTATGATTTCTG 100 nM
qAtITS2 FP GCCAAATTTTCCTCCTCGT 300 nM
qAtITS2 RP AAGCGAGCGTCAGCGTAA
qAtITS2 P CTAACGGGCCCGCTCGTAACA 150 nM
Research Facility (AGRF), Melbourne.
2.6. Conventional PCR
Conventional PCR was performed to validate the qPCR primers
specific for F. hepatica or A. tomentosa (Table 1) and to assess the cross
reactivity with DNA from other parasites (rumen fluke, H. contortus, C.
oncophora, O. ostertagi) or snails (A. lessoni, P. acuta and G. truncatula).
The genomic DNA from F. hepatica and A. tomentosa were used at 14 ng
and 50 ng, respectively, to validate the qPCR primers specific for F.
hepatica and A. tomentosa. Primers specific for the ITS-2 region of G.
truncatula (FP: CGTTGTCCGTTCATCTCG; RP: CCTGTTCTCCACCCACG)
were used to confirm DNA extraction from water samples. The eDNA
isolated from water samples were diluted to 1:10 and 10 μl of diluted
eDNA was used in the conventional PCR to confirm DNA extraction. All
the primers used in the conventional PCR assays were used at a final
concentration of 0.5 μM. Conventional PCR was performed in 25 μL
reactions with 2x super mastermix (Bimake, China) using a T100
Thermal Cycler (Bio-Rad, California, United States). Reaction condi-
tions included an initial denaturation at 95 °C for 2 min followed by 35
cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s and
extension at 72 °C for 30 s with a final extension at 72 °C for 10 min. All
PCR reaction products were separated by agarose gel electrophoresis at
100 V for 40 min on a 2% (w/v) agarose gel, prepared with 1x TAE
buffer (40 mM Tris−HCl pH 8.0, 20 mM acetic acid, 1 mM EDTA) and
stained with SYBR® Safe DNA Gel Stain following the manufacturer’s
instructions (Invitrogen). PCR amplicons were visualised on a Gel Doc™
EZ imager (Bio-Rad) using Image Lab™ software (Bio-Rad).
2.7. Quantitative PCR
To develop a highly sensitive qPCR assay for the simultaneous de-
tection of F. hepatica and A. tomentosa DNA, the high copy number ITS-2
region in the rDNA of each organism was selected as a target in the
qPCR assay. Quantitative PCR was performed in a Magnetic Induction
Cycler (MicqPCR cycler, Biomolecular Systems, Queensland, Australia).
All qPCR assays were performed in triplicate using the Sensimix II
probe kit (Bioline, Alexandra, Australia). Primer and probe concentra-
tions were optimised for F. hepatica and A. tomentosa using genomic
DNA (Table 1). The Sensimix II probe kit contains 3 mM MgCl2 (final
concentration) and the optimised MgCl2 concentration for the multiplex
assay is 4 mM. Each 25 μL reaction contains 1x Sensimix II probe
mastermix, 300 nM each of F. hepatica and A. tomentosa primers,
100 nM of F. hepatica probe, 150 nM of A. tomentosa probe, 1 mM MgCl2
and template DNA (ng levels of liver fluke or snail DNA). QPCR cycling
conditions included an initial denaturation at 95 °C for 10 min, followed
by 40 cycles of 95 °C at 10 s and 60 °C at 20 s. No-template controls
were performed in each assay to monitor reagent contamination.
A standard curve was generated using genomic DNA ranging from
14 ng-0.14 pg for F. hepatica and 50 ng-0.5 pg for A. tomentosa. The
slope values were calculated from the standard curve and used to de-
termine the reaction efficiency of each primer pair using the formula
E = 10(-1/slope) (Bustin et al., 2009). The multiplex assay was
19
Veterinary Parasitology 259 (2018) 17–24
Probe modifications Product size (bp) Target sequence
FAM-BHQ1 108 Fasciola hepatica ITS-2
(EU260058)
HEX-BHQ1 118 Austropeplea tomentosa ITS-2
(EU556270)
performed with the same concentration of genomic DNA for F. hepatica
and A. tomentosa along with singleplex assays as controls. The limit of
detection (LOD) assay was performed using 10-fold dilutions (undiluted
to 1:1,000,000) of F. hepatica or A. tomentosa genomic DNA as men-
tioned above.
Assay specificity was further evaluated using a non-target compe-
tition assay. The multiplex qPCR assay was performed using: (i) 10-fold
serial dilutions of F. hepatica DNA (14 ng-0.14 pg) each mixed with
50 ng of A. tomentosa DNA; (ii) 10-fold serial dilutions of A. tomentosa
DNA (50 ng-0.5 pg) each mixed with 50 ng of F. hepatica DNA; and (iii)
a mix of 10-fold dilutions of F. hepatica and A. tomentosa DNA.
The specificity of the F. hepatica primers was tested using genomic
DNA from rumen fluke, H. contortus, C. oncophora, O. ostertagi and A.
tomentosa (14 ng of each DNA) or plasmid DNA (5 ng each) containing
the ITS-2 region of A. lessoni, G. truncatula and P. acuta: F. hepatica
genomic DNA was used as a positive control. The specificity of the A.
tomentosa primers was tested using plasmid (5 ng each) encoding ITS-2
region of A. lessoni, G. truncatula and P. acuta or genomic DNA from
rumen fluke, H. contortus and F. hepatica (14 ng each): A. tomentosa
genomic DNA was used as a positive control.
2.8. Data analysis
The raw Ct values were exported from the MicqPCR cycler and
analysed using Microsoft Excel (version 16, 2016). The Logarithm (base
10) of DNA concentration was plotted against average Ct of each con-
centration to obtain a linear regression line of least square fit and used
as a standard curve. The concentration of DNA in unknown samples was
calculated using the formula, quantity = (Cq-b)/m where Cq is the
average Ct, b is the y-intercept and m is slope of the linear regression.
The differences in the Ct values between the multiplex reactions and
singleplex reactions were analysed using an Unpaired t-test and one-
way ANOVA. These tests were used to determine the statistical sig-
nificance between the multiplex and singleplex reactions using
GraphPad Prism version 7 for Windows (GraphPad Software, La Jolla,
California, USA) or OriginLab Data Analysis and Graphing software
(OriginLab, Northampton, MA, USA).
3. Results
3.1. Assay design
Comparison of the ITS-2 region of F. hepatica with rumen fluke, H.
contortus, C. oncophora and O. ostertagi allowed us to design the primers
in a low similarity region to avoid cross reaction in the qPCR assay. The
ITS-2 region of F. hepatica, rumen fluke, H. contortus, C. oncophora and
O. ostertagi share 41–68 % identity at the nucleotide level
(Supplementary Fig. S1). Similarly, comparison of the ITS-2 region of A.
tomentosa shows that it shares 52–91% nucleotide similarity with A.
viridis, A. lessoni, G. truncatula, P. acuta or P. columella (Supplementary
Fig. S2). The primers and probe concentrations were optimised for the
optimal detection of liver fluke and snail DNA in a single assay as in-
dicated in Table 1.
V. Rathinasamy et al.
Fig. 1. Quantitative PCR based amplification of ITS-2 from genomic DNA of Fasciola hepatica or Austropeplea tomentosa. A standard curve was generated using 10-fold
dilutions of F. hepatica genomic DNA (A) or A. tomentosa genomic DNA (B) and analysed in the qPCR assay. The average Ct values were plotted against the log
concentration of DNA used in the standard curve. Each data point represents the mean of three replicates. The equation and R2 values for each standard curve from
the linear regression analysis are shown in the graph.
3.2. Standard curves
The sensitivity and efficiency of the qPCR assay for F. hepatica were
assessed using a standard curve. A linear standard curve was observed
with an efficiency of 96% (R2 of 0.99) (Fig. 1A). Similarly, the qPCR
analysis of 10-fold dilutions of A. tomentosa genomic DNA using primers
and probe specific for the A. tomentosa ITS-2 region produced a linear
standard curve with the reaction efficiency of 90% (R2 of 0.99)
(Fig. 1B).
3.3. Sensitivity and specificity
The analytical sensitivity or limit of detection (LOD) of each primer
and probe set specific for F. hepatica or A. tomentosa, were assessed in
the qPCR assay. The LOD was defined where 95% of the replicates were
positive in the assay. All the DNA dilutions analysed in the qPCR for F.
hepatica or A. tomentosa showed positive DNA detection (Fig. 2A). The
LOD for F. hepatica or A. tomentosa for qPCR were estimated to be 14 fg
or 50 fg, respectively, confirming the high sensitivity of the assay. The
LOD was also performed using the conventional PCR to demonstrate the
sensitivity of qPCR compared to conventional PCR. The conventional
PCR could detect F. hepatica DNA up to 1.4 pg (Fig. 2B) and A. to-
mentosa DNA up to 5 pg (Fig. 2C). These results confirm that the qPCR
assay is 100x more sensitive than conventional PCR.
The specificity of the F. hepatica primers and probe was assessed by
conventional PCR (using primers alone) and qPCR assays, respectively,
using DNA from rumen fluke, H. contortus, A. tomentosa, C. oncophora or
O. ostertagi, in addition to plasmid DNA containing the ITS-2 region of
A. lessoni, P.acuta or G. truncatula. Similarly, the specificity of the A.
tomentosa primers was tested using genomic DNA from rumen fluke, H.
contortus or F. hepatica and plasmid containing the ITS-2 region of A.
lessoni, P.acuta or G. truncatula. The conventional PCR results showed
positive amplification of F. hepatica and A. tomentosa genomic DNA at
range of annealing temperatures (Fig. 3A and B) with no cross ampli-
fication of parasite or snail DNA, confirming the specificity of the pri-
mers at annealing temperature of 58 °C (Fig. 3C and D). Similarly, the
specificity of F. hepatica and A. tomentosa primers and probes were as-
sessed in qPCR using DNA samples as mentioned above. No cross re-
action was observed for F. hepatica and A. tomentosa with DNA/plasmid
DNA from non-specific parasite or snails (data not shown).
3.4. Multiplex qPCR assay
The efficiency and sensitivity of the multiplex qPCR assay to detect
F. hepatica or A. tomentosa DNA was compared with the singleplex qPCR
assay. Comparison of average Ct values obtained from the multiplex
assay (for both F. hepatica and A. tomentosa) with the results from the
singleplex assay showed no significant differences between the assays
(Unpaired t-test and One-way ANOVA) (Table 2). These results
20
Veterinary Parasitology 259 (2018) 17–24
demonstrate the comparable performance of the multiplex assay to
detect liver fluke and snail DNA relative to the singleplex assays. An
assay reproducibility test was performed using two biological replicates
to demonstrate the ability to obtain reliable results using the multiplex
assay. The 10-fold serial dilutions (undiltued to 1:100,000) of F. hepa-
tica or A. tomentosa DNA samples from two biological replicates were
analysed in the multiplex assay. Each biological replicate was analysed
in triplicate to account for any technical variability in the assay. A
linear range of Ct values was obtained for both F. hepatica and A. to-
mentosa in the biological replicates with low variation in the Ct values
(Pearson R = 0.999) (Fig. 4), confirming the reproducibility of the
assay.
Assay specificity was further evaluated using a non-target compe-
tition assay. The qPCR results showed no significant difference in the
average Ct values obtained using three different DNA sets (F. hepatica +
A. tomentosa DNA; F. hepatica + 50 ng of A. tomentosa; and 50 ng of F.
hepatica + A. tomentosa), confirming the specific detection of each
target species DNA in the presence of a higher concentration of non-
target DNA (Fig. 5) (Unpaired t-test and One-way ANOVA).
3.5. Detection of eDNA from environmental water samples
The DNA extracted from all the water samples, including the control
tap water sample, were analysed in a conventional PCR using primers
specific for G. truncatula ITS-2 region to confirm the DNA extraction
method (data not shown). Further, the DNA samples were analysed
using the multiplex qPCR assay to detect eDNA from liver fluke and
snails using F. hepatica and A. tomentosa genomic DNA samples as po-
sitive controls. The genomic DNA from F. hepatica (0.14 ng) and A. to-
mentosa (0.5 ng) were used as positive controls in the assay and the Ct
values obtained for F. hepatica and A. tomentosa controls were 23.67 and
27.91, respectively. The Ct values obtained for all three eDNA samples
ranged from 22 to 36 with water samples containing snails showing
relatively lower Ct values (Fig. 6). This assay specifically detected F.
hepatica or A. tomentosa eDNA from the water samples containing me-
tacercariae alone or snail alone, respectively. A specific detection of the
target of interest was observed in the water samples with a known
eDNA source, confirming the specificity of the assay to detect eDNA
from F. hepatica and A. tomentosa.
4. Discussion
The widespread prevalence of Fasciola infection along with the
detrimental effect on animal production makes fasciolosis an important
disease of livestock worldwide (Mas-Coma et al., 2009; Nyindo and
Lukambagire, 2015; Piedrafita et al., 2010). Given the growing problem
of anthelmintic resistance, mainly TCBZ resistance, an alternative
control measure is essential to reduce the prevalence of Fasciola infec-
tion in livestock (Kelley et al., 2016). Understanding the prevalence of
V. Rathinasamy et al. Veterinary Parasitology 259 (2018) 17–24

Fig. 2. Sensitivity of conventional PCR and quantitative PCR to detect DNA of Fasciola hepatica and Austropeplea tomentosa. The 10-fold serial dilutions of F. hepatica
and A. tomentosa DNA were analysed using quantitative PCR (A) and conventional PCR (B and C). Amplification of ITS-2 from DNA of F. hepatica (B) and A. tomentosa
(C) produced the bands at the estimated sizes of 102 bp and 120 bp, respectively. The average Ct values of three replicates are shown in the graph. NTC: no-template
control.

Fig. 3. Specificity of the primer sets to detect DNA from

Fasciola hepatica and Austropeplea tomentosa. (A) Genomic DNA
samples from F. hepatica (Fh + ve) and (B) A. tomentosa
(At + ve) were used as positive controls for the primers spe-
cific for F. hepatica and A. tomentosa in the specificity assay
performed at range of annealing temperatures. NTC = no
template control (C) The DNA samples from rumen fluke (RF),
H. contortus (Hc), A. tomentosa (At) and plasmid DNA con-
taining ITS-2 region of A. lessoni (Al), P.acuta (Pa), G. trunca-
tula (Gt) were amplified in the conventional PCR using the
primers specific for F. hepatica ITS-2 with annealing tempera-
ture of 58 °C. (D) DNA samples from rumen fluke, H. contortus,
F. hepatica (Fh) and plasmid DNA containing ITS-2 region of A.
lessoni, P.acuta, G. truncatula were amplified in conventional
PCR with primers specific for A. tomentosa ITS-2 with an-
nealing temperature of 58 °C. The amplified PCR products
were visualised in a 2% agarose gel electrophoresis with 100
bp marker.

21
V. Rathinasamy et al. Veterinary Parasitology 259 (2018) 17–24

Table 2
Comparison of Fasciola hepatica and Austropeplea tomentosa DNA detection in singleplex and multiplex quantitative PCR. Ten-fold dilutions of F. hepatica (Fh) and A.
tomentosa (At) genomic DNA were analysed in singleplex and multiplex qPCR assays. The average Ct values were calculated from Ct values obtained from two
separate experiments and each experiment was performed in triplicate.
Sample Average Ct value ± SE

Fh DNA At DNA Fh singleplex Fh multiplex At singleplex At multiplex

(ng) (ng)

14 50 16.21 ± 0.03 16.38 ± 0.02 18.62 ± 0.01 19.15 ± 0.05

1.4 5 19.77 ± 0.02 20.02 ± 0.02 22.75 ± 0.04 23.30 ± 0.04
0.14 0.5 23.27 ± 0.01 23.29 ± 0.01 27.03 ± 0.05 27.50 ± 0.02
0.014 0.05 26.87 ± 0.02 26.97 ± 0.03 31.39 ± 0.02 31.54 ± 0.06
0.0014 0.005 30.32 ± 0.03 30.41 ± 0.01 34.04 ± 0.07 34.64 ± 0.09
0.00014 0.0005 34.03 ± 0.11 33.74 ± 0.14 37.83 ± 0.17 37.61 ± 0.51

Fig. 6. Detection and quantification of eDNA released from Fasciola hepatica

Fig. 4. Reproducibility of the multiplex qPCR assay to detect DNA of Fasciola
hepatica and Austropeplea tomentosa. Ten-fold dilutions of DNA from F. hepatica
and A. tomentosa (isolated from two different biological sources) were analysed
in the multiplex qPCR. F. hepatica DNA samples used in biological replicate 1
and biological replicate 2 were isolated from liver flukes collected from cattle
and rats, respectively. A. tomentosa DNA samples used in biological replicate 1
and biological replicate 2 were isolated from two different snails collected from
VHR, Armidale. Each data point represents the mean of three technical re-
plicates. Data points for biological replicate 1 of F. hepatica and A. tomentosa are
shown in black colour and data points for biological replicate 2 of F. hepatica
and A. tomentosa are shown in grey colour.
Fig. 5. Non-target template DNA competition assay to confirm the specificity of
the primer sets to detect Fasciola hepatica (Fh) and Austropeplea tomentosa (At).
The three sets of DNA samples used to determine the non-target template DNA
competition were as follows: Fh + At: 10-fold dilutions of F. hepatica DNA
(concentrations ranging from 14 ng to 0.00014 ng) and A. tomentosa DNA
(concentrations ranging from 50 ng to 0.0005 ng); Fh + At (50 ng): 10-fold
dilutions of F. hepatica DNA spiked with 50 ng of A. tomentosa DNA: and Fh
(50 ng + At): 10-fold dilutions of A. tomentosa DNA spiked with 50 ng of F.
hepatica DNA. Each reaction was performed in triplicate.
and Austropeplea tomentose in water samples from tanks. DNA was isolated from
water samples containing metacercariae alone, uninfected snails (A. tomentosa)
alone and snails infected with F. hepatica. DNA was analysed using the multi-
plex qPCR assay. A mix of F. hepatica and A. tomentosa genomic DNA was used
as a positive control (data not shown). The DNA extraction from each water
sample was performed in duplicate and each eDNA sample was analysed in
triplicate. Error bars indicate the standard deviation.
liver fluke transmitting snails or snails harbouring liver fluke infection
becomes critical to determine the transmission risk for F. hepatica.
Boray et al (1969) discovered that, when the number of infected snails
exceeded 10%, outbreaks of fasciolosis would subsequently occur in the
tracer sheep grazing the irrigated dairy farm. Therefore, if the infection
levels within snail populations can be established and monitored, the
period of greatest risk to livestock could be more accurately defined in
irrigation regions.
The collection and identification of snails in the field is a laborious
process. Hence, it becomes critical to use effective and robust techni-
ques to identify snail colonies in the field. The advent of species de-
tection using eDNA from water samples provides a robust method for
the detection of aquatic macro-organisms (Deiner et al., 2017; Diaz-
Ferguson and Moyer, 2014). The eDNA approach has gained mo-
mentum in the last decade with several methods developed to detect
macro-organisms from various taxa from different environments (Bass
et al., 2015; Davy et al., 2015; Olds et al., 2016; Piggott, 2016; Weltz
et al., 2017). An eDNA qPCR test to detect A. tomentosa is an efficient
approach to quantitate the level of contamination of this snail species in
environmental water samples since A. tomentosa is small and notor-
iously difficult to locate in the mud and water sources which it typically
inhabits. The qPCR test reported here will allow the monitoring of the
distribution of A. tomentosa in water channels, delvers and drains that
comprise the snail’s natural niche environment on irrigated farms.
Moreover, this test will allow the monitoring of snail populations after
local floods which can spread snails into new water areas where they
can potentially spread liver fluke infections.
Several molecular methods (using radioactive probes or conven-
tional PCR) were previously developed to identify F. hepatica in the

22
V. Rathinasamy et al.
intermediate snail host (Caron et al., 2011; Cucher et al., 2006; Kaplan
et al., 1997; Kramer and Schnieder, 1998; Magalhaes et al., 2004;
Schweizer et al., 2007; Velusamy et al., 2004). These molecular assays
have used several targets including the 124 bp repeat fragment of F.
hepatica, the cytochrome c-oxidase subunit I gene and the ITS-2 se-
quence. ITS-2 present within the rDNA gene is an attractive target for
molecular detection assays due to its high copy number in the genome
(Buckler et al., 1997). The rDNA genes are generally conserved but the
internal transcribed spacer (ITS-1 or ITS-2) within the rDNA genes show
considerable sequence variation among species (Bik et al., 2013; Gasser
et al., 1996; Zhao et al., 2015). In this study, we used ITS-2 as a target to
detect both F. hepatica and A. tomentosa in the multiplex qPCR assay.
The selection of the high copy number ITS-2 sequence for the qPCR
assay resulted in a higher sensitivity with DNA detection levels down to
14 fg and 50 fg for F. hepatica and A. tomentosa, respectively. The use of
rDNA targets (18S or 28S) in Schistosoma diagnosis also resulted in
higher sensitivity with detection limits down to 10 fg (He et al., 2016).
The higher sensitivity of this assay for F. hepatica DNA detection (to
14 fg) will be particularly useful in detecting a single miracidium from
an infected snail as the DNA concentration of a single miracidium was
shown to be 0.5–1 ng (Kaplan et al., 1997; Magalhaes et al., 2004). It is
also important to note that the limit of detection of any target DNA
using environmental samples can be effected by inhibitory substances
in the samples or the type of eDNA extraction method employed
(Forootan et al., 2017). The primers specific to F. hepatica and A. to-
mentosa used here were found not to cross react with DNA from other
common livestock parasites on Victorian dairy farms (H. contortus,
rumen fluke, C. oncophora and O. ostertagi) or other snail species such as
A. lessoni, P. acuta (non-liver fluke transmitting snails) and G. trunca-
tula. The specificity and efficiency of this qPCR assay was successfully
demonstrated by the specific amplification of F. hepatica or A. tomentosa
in the presence of a higher amount of DNA (50 ng) from either A. to-
mentosa or F. hepatica. The eDNA released from macro-organisms in
waterbodies usually occurs at very low concentrations (200 pg/L)
(Goldberg et al., 2016; Takahara et al., 2013), so testing the non-target
effect using the higher amount of DNA used here (50 ng in a 25 μL re-
action or 2000 μg/L) demonstrates the robustness of the assay.
Hydrolysis probe-based quantitative PCR assays were recently used
to detect eDNA from single species due to the ability to quantify low
levels of DNA with higher specificity (Amberg et al., 2015; Wilcox et al.,
2013). To best of our knowledge, this is the first study reporting a
multiplex qPCR assay to detect eDNA from F. hepatica and its inter-
mediate snail host, A. tomentosa. This assay was successfully validated
to detect eDNA of F. hepatica or A. tomentosa from known water samples
collected from tanks containing metacercariae, infected snails or un-
infected snails. The eDNA extracted from water samples containing
metacercariae only, or infected snails with miracidia/cercariae, showed
Ct values around 32-36. Similar Ct values were obtained for detection
of eDNA released from Opisthorchis viverrini in water samples
(Hashizume et al., 2017). The detection of eDNA from F. hepatica and its
intermediate snail host provides a good approach for the surveillance of
liver fluke- transmitting snails in the water bodies including irrigation
channels, delvers or drains, water troughs and dams on farms. Water
sample collection and analysis of liver fluke and snail prevalence using
the multiplex qPCR assay would be helpful to determine the risk of liver
fluke infection in dairy farms since the percentage of snails infected is a
predeterminate for outbreaks in livestock (Boray et al., 1969). How-
ever, several parameters such as sample inhibition, spatial sampling
design, sample volume and site characteristics need to be assessed be-
fore applying this technique to field collected water samples (Goldberg
et al., 2016).
In conclusion, we have developed the first multiplex qPCR assay to
detect and quantify DNA of F. hepatica and A. tomentosa and shown that
we can detect eDNA from liver flukes and snails in water samples. This
assay is robust, sensitive and specific. Further, this method has the great
potential to allow producers and local authorities to estimate the risk of
23
Veterinary Parasitology 259 (2018) 17–24
liver fluke exposure on farms by surveying and monitoring the level of
liver fluke and fluke transmitting snails in water bodies. In the future
these data could be utilised by producers to implement highly specific
integrated parasite management strategies to minimise production
losses caused by liver fluke. More generally, this technique could prove
to be a valuable tool for monitoring the risk of human fasciolosis in Asia
and South America by allowing the identification and categorisation of
water ways that pose the greatest risk to the public, potentially allowing
for the development of an intermediate host snail control program.
Acknowledgements
This work was supported by funds provided by Dairy Australia and
the Gardiner Dairy Foundation Australia and with support from La
Trobe University.
Appendix A. Supplementary data
Supplementary material related to this article can be found, in the
online version, at doi:https://doi.org/10.1016/j.vetpar.2018.06.018.
References
Amberg, J.J., Grace McCalla, S., Monroe, E., Lance, R., Baerwaldt, K., Gaikowski, M.P.,
2015. Improving efficiency and reliability of environmental DNA analysis for silver
carp. J. Gt. Lakes Res. 41, 367–373.
Andrews, J.H., 1991. The life cycle. Comparative Ecology of Microorganisms and
Macroorganisms. Springer, New York, pp. 178–207.
Bass, D., Stentiford, G.D., Littlewood, D.T.J., Hartikainen, H., 2015. Diverse applications
of environmental DNA methods in parasitology. Trends Parasitol. 31, 499–513.
Bik, H.M., Fournier, D., Sung, W., Bergeron, R.D., Thomas, W.K., 2013. Intra-genomic
variation in the ribosomal repeats of nematodes. PLoS One 8, e78230.
Boray, J.C., Happich, F.A., Andrews, J.C., 1969. The epidemiology of fasciolosis in two
representative endemic regions of Australia. Aust. Vet. J. 45, 549–553.
Buckler, E.St., Ippolito, A., Holtsford, T.P., 1997. The evolution of ribosomal DNA: di-
vergent paralogues and phylogenetic implications. Genetics 145, 821–832.
Caron, Y., Righi, S., Lempereur, L., Saegerman, C., Losson, B., 2011. An optimized DNA
extraction and multiplex PCR for the detection of Fasciola sp. in lymnaeid snails. Vet.
Parasitol. 178, 93–99.
Correa, A.C., Escobar, J.S., Durand, P., Renaud, F., David, P., Jarne, P., Pointier, J.P.,
Hurtrez-Bousses, S., 2010. Bridging gaps in the molecular phylogeny of the
Lymnaeidae (Gastropoda: Pulmonata), vectors Fascioliasis. BMC Evol. Biol. 10, 381.
Cucher, M.A., Carnevale, S., Prepelitchi, L., Labbe, J.H., Wisnivesky-Colli, C., 2006. PCR
diagnosis of Fasciola hepatica in field-collected Lymnaea columella and Lymnaea viatrix
snails. Vet. Parasitol. 137, 74–82.
Davy, C.M., Kidd, A.G., Wilson, C.C., 2015. Development and validation of environmental
DNA (eDNA) markers for detection of Freshwater turtles. PLoS One 10, e0130965.
Deiner, K., Bik, H.M., Machler, E., Seymour, M., Lacoursiere-Roussel, A., Altermatt, F.,
Creer, S., Bista, I., Lodge, D.M., de Vere, N., Pfrender, M.E., Bernatchez, L., 2017.
Environmental DNA metabarcoding: transforming how we survey animal and plant
communities. Mol. Ecol.
Diaz-Ferguson, E.E., Moyer, G.R., 2014. History, applications, methodological issues and
perspectives for the use of environmental DNA (eDNA) in marine and freshwater
environments. Rev. Biol. Trop. 62, 1273–1284.
Dusak, A., Onur, M.R., Cicek, M., Firat, U., Ren, T., Dogra, V.S., 2012. Radiological
imaging features of Fasciola hepatica infection - a pictorial review. J. Clin. Imaging
Sci. 2, 2.
Forootan, A., Sjoback, R., Bjorkman, J., Sjogreen, B., Linz, L., Kubista, M., 2017. Methods
to determine limit of detection and limit of quantification in quantitative real-time
PCR (qPCR). Biomol. Detect. Quantif. 12, 1–6.
Gasser, R., Nansen, P., Guldberg, P., 1996. Fingerprinting sequence variation in ribosomal
DNA of parasites by DGGE. Mol. Cell. Probes 10, 99–105.
Goldberg, C.S., Turner, C.R., Deiner, K., Klymus, K.E., Thomsen, P.F., Murphy, M.A.,
Spear, S.F., McKee, A., Oyler-McCance, S.J., Cornman, R.S., Laramie, M.B., Mahon,
A.R., Lance, R.F., Pilliod, D.S., Strickler, K.M., Waits, L.P., Fremier, A.K., Takahara,
T., Herder, J.E., Taberlet, P., 2016. Critical considerations for the application of
environmental DNA methods to detect aquatic species. Methods Ecol. Evol. 7,
1299–1307.
Hashizume, H., Sato, M., Sato, M.O., Ikeda, S., Yoonuan, T., Sanguankiat, S., Pongvongsa,
T., Moji, K., Minamoto, T., 2017. Application of environmental DNA analysis for the
detection of Opisthorchis viverrini DNA in water samples. Acta Trop. 169, 1–7.
He, P., Song, L.G., Xie, H., Liang, J.Y., Yuan, D.Y., Wu, Z.D., Lv, Z.Y., 2016. Nucleic acid
detection in the diagnosis and prevention of schistosomiasis. Infect. Dis. Poverty
5, 25.
Hughes, A.J., Spithill, T.W., Smith, R.E., Boutlis, C.S., Johnson, P.D., 2003. Human fas-
ciolosis acquired in an Australian urban setting. Med. J. Aust. 178, 244–245.
Kaplan, R.M., Dame, J.B., Reddy, G.R., Courtney, C.H., 1997. The prevalence of Fasciola
hepatica in its snail intermediate host determined by DNA probe assay. Int. J.
Parasitol. 27, 1585–1593.
V. Rathinasamy et al.
Keiser, J., Utzinger, J., 2009. Food-borne trematodiases. Clin. Microbiol. Rev. 22,
466–483.
Kelley, J.M., Elliott, T.P., Beddoe, T., Anderson, G., Skuce, P., Spithill, T.W., 2016.
Current threat of triclabendazole resistance in Fasciola hepatica. Trends Parasitol.
Kozak, M., Wedrychowicz, H., 2010. The performance of a PCR assay for field studies on
the prevalence of Fasciola hepatica infection in Galba truncatula intermediate host
snails. Vet. Parasitol. 168, 25–30.
Kramer, F., Schnieder, T., 1998. Sequence heterogeneity in a repetitive DNA element of
Fasciola. Int. J. Parasitol. 28, 1923–1929.
Li, J.-F., Sheen, J., 2012. DNA purification from multiple sources in plant research with
homemade silica resins. Plant DNA Fingerprinting Barcoding: Methods Protoc.
53–59.
Magalhaes, K.G., Passos, L.K., Carvalho Odos, S., 2004. Detection of Lymnaea columella
infection by Fasciola hepatica through multiplex-PCR. Mem. Inst. Oswaldo Cruz 99,
421–424.
Mas-Coma, M.S., Esteban, J.G., Bargues, M.D., 1999. Epidemiology of human fascioliasis:
a review and proposed new classification. Bull. World Health Organ. 77, 340–346.
Mas-Coma, S., Valero, M.A., Bargues, M.D., 2009. Climate change effects on tremato-
diases, with emphasis on zoonotic fascioliasis and schistosomiasis. Vet. Parasitol.
163, 264–280.
Molloy, J.B., Anderson, G.R., 2006. The distribution of Fasciola hepatica in Queensland,
Australia, and the potential impact of introduced snail intermediate hosts. Vet.
Parasitol. 137, 62–66.
Mostafa, O.M., Taha, H.A., Ramadan, G., 2003. Diagnosis of Fasciola gigantica in snail
using the polymerase chain reaction (PCR) assay. J. Egypt Soc. Parasitol. 33,
733–742.
Nyindo, M., Lukambagire, A.H., 2015. Fascioliasis: an ongoing zoonotic trematode in-
fection. Biomed. Res. Int. 2015, 786195.
Olds, B.P., Jerde, C.L., Renshaw, M.A., Li, Y., Evans, N.T., Turner, C.R., Deiner, K.,
Mahon, A.R., Brueseke, M.A., Shirey, P.D., Pfrender, M.E., Lodge, D.M., Lamberti,
24
Veterinary Parasitology 259 (2018) 17–24
G.A., 2016. Estimating species richness using environmental DNA. Ecol. Evol. 6,
4214–4226.
Piedrafita, D., Spithill, T.W., Smith, R.E., Raadsma, H.W., 2010. Improving animal and
human health through understanding liver fluke immunology. Parasite Immunol. 32,
572–581.
Piggott, M.P., 2016. Evaluating the effects of laboratory protocols on eDNA detection
probability for an endangered freshwater fish. Ecol. Evol. 6, 2739–2750.
Puslednik, L., 2006. Systamatics of Australasan Lymnaeidae. University of Wollongong.
http://ro.uow.edu.au/theses/815.
Rondelaud, D., Belfaiza, M., Vignoles, P., Moncef, M., Dreyfuss, G., 2009. Redial gen-
erations of Fasciola hepatica: a review. J. Helminthol. 83, 245–254.
Rychlik, W., 2007. OLIGO 7 primer analysis software. Methods Mol. Biol. 402, 35–60.
Schweizer, G., Meli, M.L., Torgerson, P.R., Lutz, H., Deplazes, P., Braun, U., 2007.
Prevalence of Fasciola hepatica in the intermediate host Lymnaea truncatula detected
by real time TaqMan PCR in populations from 70 Swiss farms with cattle husbandry.
Vet. Parasitol. 150, 164–169.
Takahara, T., Minamoto, T., Doi, H., 2013. Using environmental DNA to estimate the
distribution of an invasive fish species in ponds. PLoS One 8, e56584.
Velusamy, R., Singh, B.P., Raina, O.K., 2004. Detection of Fasciola gigantica infection in
snails by polymerase chain reaction. Vet. Parasitol. 120, 85–90.
Weltz, K., Lyle, J.M., Ovenden, J., Morgan, J.A.T., Moreno, D.A., Semmens, J.M., 2017.
Application of environmental DNA to detect an endangered marine skate species in
the wild. PLoS One 12, e0178124.
Wilcox, T.M., McKelvey, K.S., Young, M.K., Jane, S.F., Lowe, W.H., Whiteley, A.R.,
Schwartz, M.K., 2013. Robust detection of rare species using environmental DNA: the
importance of primer specificity. PLoS One 8, e59520.
Zhao, Y., Tsang, C.C., Xiao, M., Cheng, J., Xu, Y., Lau, S.K., Woo, P.C., 2015. Intra-
genomic internal transcribed spacer region sequence heterogeneity and molecular
diagnosis in clinical microbiology. Int. J. Mol. Sci. 16, 25067–25079.