See discussions, stats, and author profiles for this publication at: https://www.researchgate.

net/publication/23759063

Multiplex real-time PCR detection of P. falciparum, P. vivax and P. malariae in

human blood samples

Article  in  Experimental Parasitology · April 2009

DOI: 10.1016/j.exppara.2008.12.012 · Source: PubMed

CITATIONS READS

69 758

3 authors, including:

Vincent Veron Stephane Simon

French National Institute for Agriculture, Food, and Environment (INRAE) University of French Guiana
24 PUBLICATIONS   1,229 CITATIONS    50 PUBLICATIONS   2,242 CITATIONS   

SEE PROFILE SEE PROFILE

Some of the authors of this publication are also working on these related projects:

Cutaneous leishmaniasis View project

Iodocyanopindolol Binding Protein View project

All content following this page was uploaded by Stephane Simon on 02 January 2018.

The user has requested enhancement of the downloaded file.

 Experimental Parasitology 121 (2009) 346–351

Contents lists available at ScienceDirect

Experimental Parasitology
journal homepage: www.elsevier.com/locate/yexpr

Multiplex real-time PCR detection of P. falciparum, P. vivax and P. malariae

in human blood samples
Vincent Veron *, Stephane Simon, Bernard Carme
Laboratoire Hospitalo-universitaire de Parasitologie et Mycologie Médicale, Equipe EA3593, UFR de Médecine, Université des Antilles et de la Guyane, Cayenne, French Guiana

a r t i c l e i n f o a b s t r a c t

Article history: Two duplex real-time PCR assays were developed to diagnose three human parasites: Plasmodium falci-
Received 20 October 2008 parum, Plasmodium vivax and Plasmodium malariae. TaqMan duplex real-time PCR was evaluated in 263
Received in revised form 17 December 2008 blood samples of suspected malaria patients by comparing results against those obtained with micros-
Accepted 18 December 2008
copy and nested PCR. Compared with nested PCR, duplex real-time PCR assays showed 100% sensitivity
Available online 25 December 2008
and specificity. Duplex real-time PCR detected all mixtures of P. falciparum and P. vivax DNA, except at
threshold detection limits for both parasites in which P. vivax was not amplified. Threshold detection lim-
Keywords:
its of real-time PCR were 3.1, 0.3 and 0.8 parasites per microlitre of blood for P. falciparum, P. vivax and
Real-time PCR
TaqMan
P. malariae, respectively. Duplex real-time PCR allows the detection of malarial cases, including mixed
Multiplex species infection, it simplifies analysis and reduces cost. Thus, this protocol may prove invaluable for
Malaria use in the diagnosis of human infection, trial treatments and epidemiologic studies in which high-
throughput analyses are often required.
Ó 2009 Elsevier Inc. All rights reserved.

1. Introduction
Malaria remains a leading cause of morbidity and mortality
worldwide. Although transmission is now confined to inter-trop-
ical areas, the number of people living at risk has grown to
about 3 billion and is expected to go on increasing. Of those at
risk, more than 500 million become severely ill with malaria
every year and 1.5–2.7 million die from the effects of this dis-
ease (http://www.rbm.who.int/wmr2005).1 Moreover, cases of
malaria in industrialised countries are frequently diagnosed in
travellers returning from endemic areas. Greater degrees of tourist
movement and migration have resulted in a growing number of
people at risk of infection (Spinazzola et al., 2007). French Guiana,
an overseas French administration unit in South America, have re-
ported 3500–4500 positive malarial cases annually for the last 7
years (Carme, 2005).
For more than 100 years, microscopy was the gold standard
method. Microscopy is a low cost diagnosis protocol; it is rapid
and permits quantification and species identification (Kain et al.,
1998; Moody, 2002; Warhurst and Williams, 1996). However,
blood film examination requires good expertise, especially at low
parasitemia level. It is now well documented that microscopy is
less sensitive than molecular techniques, and error in species iden-
tification can occur with low parasitemia or/and mixed infection
* Corresponding author. Fax: +(594) 594 29 34 13.
E-mail address: vincent.veron@guyane.univ-ag.fr (V. Veron).
1
World Malaria Report.
(Brown et al., 1992; Hanscheid, 2003; Hanscheid et al., 2003; Kain
et al., 1998; Rubio et al., 1999; Snounou et al., 1993a,b). The well-
established nested PCR method targeting small subunit 18S rRNA
developed by Snounou et al. (1993a,b) overcomes these problems,
but the analysis is long and there is a high contamination risk with
nested PCR. Molecular techniques developed recently, such as real-
time PCR, produce rapid results with very low contamination risks,
a high sensitivity and specificity, and the possibility of quantifica-
tion (Andrews et al., 2005; de Monbrison et al., 2003; Elsayed et al.,
2006; Hermsen et al., 2001; Lee et al., 2002; Mangold et al., 2005;
Perandin et al., 2004; Polanco et al., 2002; Rougemont et al., 2004;
Vo et al., 2007). Most published studies use the 18S RNA gene as a
target. Sequence knowledge of this SSU allows the reliable detec-
tion of the four human parasites, except Plasmodium malariae
and Plasmodium ovale in which variant sequences have been re-
ported (Calderaro et al., 2007; Liu et al., 1998). Real-time PCR can
be very useful in epidemiological studies, in drug trials or in hu-
man diagnostics. Also, it may be used as a complementary
technique to microscopy or may replace it in the absence of
well-trained microscopists.
The greatest disadvantage of real-time PCR used in routine or in
high-throughput analyses is the consumable cost. The aims of this
study were to develop a new real-time PCR method able to detect
three human parasites, Plasmodium falciparum, Plasmodium vivax
and Plasmodium malariae in duplex, in turn leading to a reduction
in analysis costs. We compared the results obtained by duplex real-
time PCR, nested PCR and microscopy, using whole blood samples
from patients suspected of malaria.

0014-4894/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved.
doi:10.1016/j.exppara.2008.12.012
 V. Veron et al. / Experimental Parasitology 121 (2009) 346–351
2. Materials and methods
2.1. Origin of blood samples
EDTA-treated blood samples were collected from malaria sus-
pected patients attending the Hospital of Cayenne during 2007. A
total of 263 blood samples obtained from 263 patients were stored
at 4 °C until DNA extractions were carried out. Aliquots of blood
(1 mL) were stored at 20 °C. Ninety blood samples from patients
not suspected of malaria were collected and tested as negative con-
trols. All provided signed informed consent for inclusion in the
study.
2.2. Microscopy
Microscopic examination of Giemsa-stained blood thin and
thick films was the reference method used in the Cayenne hospital
and health centres. An examination was only considered negative
after the analysis of a thick smear sample, including at least 1000
leucocytes, corresponding to a screening sensitivity of about 6
plasmodia per lL.
2.3. DNA extraction
DNA was extracted from 100 lL of EDTA-treated blood using
the DNeasy Blood and Tissue Kit (Qiagen, Crawley, UK) according
to the manufacturer’s instructions. DNA was eluted in 200 lL of
elution buffer (provided with the kit).
2.4. Nested PCR
Nested PCR was performed according to the protocol estab-
lished by Snounou et al. (1993a,b). The first PCR mix consisted of
20 lL of PCR mix and 5 lL of DNA template. The second mix con-
sisted of 1 lL of the first mix in a final volume of 25 lL. Each sam-
ple was analysed in duplicate.
2.5. Real-time PCR
Real-time PCR was carried out in an Applied Biosystem 7300
analytical PCR system: each PCR underwent 50 cycles. Primer
and probe sequences were selected from sequences of the small
subunit of 18S rRNA, after an alignment of sequences deposited
in GenBank. Accession numbers of sequences used were
M19173.1 (P. falciparum), U03079.1 (P. vivax), M54897 (P. mala-
riae), and AB015654.1 and AF488000 (variant sequences of P. mal-
ariae). Liu et al. (1998) have described 18S rRNA sequence variants
among the P. malariae population; thus, we used primers and
probes reported by Rougemont et al., in which nucleotides are con-
served in described sequences. Primer and probes for P. falciparum
and P. vivax were designed with Primer Express Software (Applied
Biosystem, Foster City, CA), from sequences described by Perandin
Table 1
Primers and probes used for real-time PCR assays.
Species Primer or probe
P. falciparum Pf-1
Pf-2
Pf-probe (FAM-MGB)
P. vivax Pv-1
Pv-2
Pv-probe (VIC-MGB)
P. malariae Pm-1
Pm-2
Pm-probe (FAM-MGB)
347
et al. Minor sequence modifications were made to minimise com-
petition between the two amplification systems: the sequences are
detailed in Table 1. We used minor groove binder (MGB) probes
(Applied Biosystem) to increase specificity and limit cross hybrid-
isation of primers and probes in duplex; this allows shorter probe
lengths to be used.
(i) Monoplex real-time PCR assays. Each Plasmodium species
(P. falciparum, P. vivax and P. malariae) was studied in sepa-
rate tubes. PCRs were run in a final volume of 25 lL, consist-
ing of 12.5 lL of GeneExpression Master Mix (Applied
Biosystem), 900 nM of each primer and 300 nM of the corre-
sponding probe and 5 lL of DNA template. The thermal pro-
file was 10 min at 95 °C followed by 50 cycles of 15 s at 95 °C
and 1 min at 60 °C.
(ii) Duplex real-time PCR assays. Samples were analysed in two
reaction tubes, each run in duplex. The first tube contained
P. falciparum and P. vivax primers and probes and the second
tube contained P. malariae primers and probe and the IPC
(Internal Positive Control, Applied Biosystem). Each reaction
mixture contained, in a final volume of 25 lL, 12.5 lL of
GeneExpression Master Mix (Applied Biosystem), 300 nM
of the P. falciparum and P. vivax primers, and 150 nM of each
P. falciparum and P. vivax probe and 5 lL of DNA template.
The IPC was used according to the manufacturer’s instruc-
tions with primers and the probe for P. malariae. The thermal
profile used was identical to that for monoplex assays.
Blood samples from patients were analysed (monoplex and
duplex assays) in duplicate.
2.6. Specificity and sequencing
We tested DNA extracts from protozoa cultures, such as Trypan-
osoma cruzi, Trypanosoma rangeli, Toxoplasma gondii, Leishmania
guyanensis, Leishmania braziliensis, Leishmania infantum and Leish-
mania lainsoni.
To analyse the specificity of real-time PCR assays, this technique
was compared with nested PCR, considered to be the gold standard
method as it is more reliable than microscopy. Specificity was cal-
culated by the following equation: (number of true negatives)/
(number of true negatives + number of false positives).
Real-time PCR specificity assays were run in triplicate.
Thirty-eight real-time PCR products (15 P. falciparum, 15 P. vivax
and 8 P. malariae positive real-time PCR products) were analysed
by double-strand sequencing (Biofial, Lyon, France). Sequences
were aligned using Clustal W.
2.7. Sensitivity
We used three whole blood samples, each uniquely infected
with P. falciparum, P. vivax and P. malariae, to determine the detec-
Sequence (50 –30 ) Length (bp)
ATTGCTTTTGAGAGGTTTTGTTACTTT 95
GCTGTAGTATTCAAACACAATGAACTCAA
CATAACAGACGGGTAGTCAT
CGCTTCTAGCTTAATCCACATAACTG 142
AATTTACTCAAAGTAACAAGGACTTCCAAG
CGCATTTTGCTATTATGT
AGTTAAGGGAGTGAAGACGATCAGA 166
CAACCCAAAGACTTTGATTTCTCATAA
ATGAGTGTTTCTTTTAGATAGC
348 V. Veron et al. / Experimental Parasitology 121 (2009) 346–351

tion threshold limits of the duplex real-time PCR assays. Sample Table 3
parasitemia was evaluated by precise microscopic examination of Real-time PCR results with associated infection cases. Comparison of mean Ct value
(two replicates) obtained with monoplex and duplex real-time PCR.
thin blood smears with the patient’s baseline erythrocyte counts.
Each infected blood sample was 10-fold serially diluted with unin- Duplex Monoplex Pf Monoplex Pv
fected blood from healthy individuals with known baseline eryth- Pf Pv
rocyte counts. Serial dilutions were carried out to obtain final Patient 1 18.24 36.05 18.44 32.03
parasitic level of less than one parasite per microlitre of blood. Patient 2 37.41 25.85 36.65 27.01
We prepared solutions of blood with parasitic concentrations be- Patient 3 19.14 38.59 18.98 31.35
tween 31,500 and 0.03 parasite per lL of blood, 36,800 and 0.03 Patient 4 25.34 41.65 26.57 38.31
Patient 5 22.26 38.41 22.61 33.29
parasite per lL of blood, and 8200 and 0.08 parasite per lL of blood
Patient 6 38.34 33.02 36.67 33.49
for P. falciparum, P. vivax and P. malariae, respectively. Duplex real- Patient 7 22.84 42.05 23.11 38.56
time PCR sensitivity assays were run in triplicate. Patient 8 34.01 32.91 35.02 33.70
We compared the sensitivity of duplex versus monoplex real- Patient 9 24.42 27.30 24.47 27.52
Patient 10 24.56 30.89 24.96 31.12
time PCR in the presence of two species (P. falciparum and P. vivax);
Patient 11 36.31 26.70 35.89 23.50
we prepared mixtures of different DNA extracts from the serial
dilutions described above. These assays were run in triplicate.
Sensitivity was calculated using the following equation: (num-
ber of true positives)/(number of true positives + number of false Results obtained with nested PCR and duplex real-time PCR
negatives). were similar (189 positive and 74 negative samples), with the
exception of two samples in which real-time PCR detected two
3. Results mixed species infections of P. falciparum (mean Ct values of 37.33
and 36.31; the cycle threshold value indicates the point at which
3.1. Microscopy versus nested PCR and real-time PCR the specific amplification signal surpasses background) and P. vi-
vax; by contrast, nested PCR and microscopy detected P. vivax
Among 263 samples, 188 were positive by microscopic exami- alone. The two samples were also found to be mix-infected by P.
nation: 79 samples (42.0%) were shown to be positive for P. falcipa- falciparum and P. vivax by the TaqMan PCR monoplex assay (mean
rum, 88 samples (46.8%) positive for P. vivax, 9 samples (4.8%) Ct values of 36.65 and 35.89 for P. falciparum amplification ob-
positive for P. malariae, 9 samples (4.8%) were infected with P. fal- tained from patients 2 and 11, respectively; results are presented
ciparum and P. vivax, and 3 samples (1.6%) were identified as Plas- in Table 3). The other 19 mixed species infections detected by
modium spp. Seventy-five samples tested negative (results are nested PCR were also detected by real-time duplex PCR. The two
presented in Table 2). samples that tested negative by microscopy and positive for P. vi-
Microscopy failed to detect 12 P. falciparum- and P. vivax-mixed vax by nested PCR were also found to be P. vivax-positive by real-
species infections and instead diagnosed 6 P. falciparum, 5 P. vivax time PCR (with mean Ct values of 40.05 and 38.32).
and 1 Plasmodium spp. positive samples without association. Two Nested PCR is considered the reference method, and in compar-
samples tested positive for P. falciparum by microscopy; however, ison TaqMan duplex real-time PCR assays detected Plasmodium in
of these samples, one was positive for P. vivax and the other nega- all 189 positive samples (100% of sensitivity) and detected no
tive by nested PCR. A sample testing positive for P. vivax by micros- amplification in all of the 74 negative samples (100% of specificity).
copy tested positive for P. falciparum by nested PCR. Nine P. No amplification inhibition was observed with IPC in the 263
falciparum- and P. vivax-mixed species infections were detected samples.
by microscopy; 7 of these samples were also reported to be mix-in-
fected by nested PCR, but two samples were solely infected with P. 3.2. Real-time PCR specificity
falciparum. All samples that tested positive for P. malariae (n = 9) by
microscopy also tested positive by nested PCR. No amplification was detected with real-time PCR, run over 50
Among the 75 samples that tested negative by microscopy, 73 cycles, with DNA samples from T. cruzi, T. rangeli, T. gondii, L. guyan-
tested negative by nested PCR, and two were P. vivax-positive. ensis, L. braziliensis, L. infantum and L. lainsoni.
The 90 samples from cases not suspected of malaria were neg-
ative by microscopy, nested PCR and real-time PCR, and displayed
Table 2 no PCR inhibition. To analyse for amplification specificity, 15 P. fal-
Results obtained by microscopy, nested PCR and duplex real-time PCR. ciparum, 15 P. vivax (including three mixed-infections of P. falcipa-
rum and P. vivax: patients 2, 9 and 11 presented in Table 3) and 8 P.
Species Microscopy Nested PCR Real-time PCR
malariae PCR products underwent double-strand sequencing. All
Pf 79 Pf 71 Pf 71 Pf
sequenced PCR products were consistent with real-time PCR spe-
1 Pv 1 Pv
6 Pf + Pv 6 Pf + Pv cies identification, including mixed-infected samples. We aligned
1 neg. 1 neg. the amplified 18S RNA fragment sequence with the GenBank se-
Pv 88 Pv 82 Pv 80 Pv quences (100% similarity) used to select primers and probes for
1 Pf 1 Pf species-specific real-time PCR: no variation was detected. Se-
5 Pf + Pv 7 Pf + Pv quences from samples isolated from patients 2 and 11 were thus
Pm 9 Pm 9 Pm 9 Pm confirmed as P. falciparum- and P. vivax-specific 18S RNA.
Pf + Pv 9 Pf + Pv 7 Pf + Pv 7 Pf + Pv
2 Pf 2 Pf 3.3. Real-time PCR sensitivity
spp. 3 spp. 1 Pf 1 Pf
1 Pv 1 Pv
1 Pf + Pv 1 Pf + Pv Duplex real-time PCR sensitivity was tested using blood sam-
neg. 75 neg. 73 neg. 73 neg. ples infected solely with a particular parasite. To limit interactions
2 Pv 2 Pv between primers and probes, we determined the optimal concen-
Total 263 263 263
trations of each oligonucleotide: this was the minimum concentra-
Note: Results are classified according to microscopic diagnosis. tion resulting in the best experimental sensitivity and best
 V. Veron et al. / Experimental Parasitology 121 (2009) 346–351
efficiency. Various concentrations between 900 mM and 100 mM
of each primer couple, and 500 mM and 50 mM of each probe were
tested (data not shown). Better results were obtained with 300 mM
of each primer and 150 mM of each probe. Duplex sensitivity tests
were carried out twice in triplicate using these concentrations. The
threshold detection limits of duplex real-time PCR assays for all
replicates were 3.1, 0.3 and 0.8 parasites per blood microlitre for
P. falciparum, P. vivax and P. malariae, respectively. These values
corresponded to 4, 0.9 and 1.2 parasite(s) per PCR assay,
respectively.
Mean triplicate Ct values for P. falciparum were between 21.90
(31,500 parasites/lL of blood) and 37.10 (3.1 parasites/lL of
blood). P. vivax mean Ct values were between 20.32 (36,800 para-
sites/lL of blood) and 38.35 (0.3 parasite/lL of blood), and those
for P. malariae were between 25.57 (8200 parasites/lL of blood)
and 39.81 (0.8 parasite/lL of blood). A standard curve showed lin-
ear regression over a 5 Log range for P. falciparum and P. malariae
and over a 6 Log range for P. vivax. The mean curve slope and coef-
ficient of correlation (two series of the three triplicate values)
were, respectively, 3.60 and 0.989 for P. falciparum, and 3.81
and 0.998 for P. vivax, values obtained in duplex real-time PCR.
The mean reaction efficiency calculated from mean curve slope
was 89.2% and 82.9% for P. falciparum and P. vivax, respectively.
The mean curve slope and coefficient correlation were, respec-
tively, 3.52 and 0.985 for P. malariae (run with IPC), with a corre-
sponding mean reaction efficiency of 92.3%.
Reliability of our duplex real-time PCR assays was also tested
with P. falciparum and P. vivax DNA mixtures. Duplex real-time
PCR was able to detect DNA samples with two target species, ex-
cept at the detection threshold limit for each of the two parasites
(3.1 and 0.3 parasite(s) per blood microlitre, respectively, for P. fal-
ciparum and P. vivax). In this case, P. vivax was not amplified two
times in three replicates. Differences in Ct values were observed
between duplex and monoplex analyses. Ct values of P. vivax
amplification were higher in duplex analyses (with mean Ct values
of 3.5, but Ct values did not exceed 43.0) with low P. vivax concen-
tration values (between 3.6 and 0.36 parasite(s)/lL of blood, inde-
pendent of P. falciparum concentration) than those obtained by
real-time PCR monoplex assays. Duplex real-time PCR amplifica-
tion from samples with high parasitemia for the two species gave
similar Ct values to mono-infected samples with similar parasite-
mia levels. We compared monoplex and duplex PCR (including
IPC) assays of P. malariae: similar sensitivities were obtained, the
shift observed between systems being less than one mean Ct value.
We tested the sensitivity of duplex real-time PCR against vari-
ous blood samples. All blood samples with association were ampli-
fied by monoplex and duplex TaqMan real-time assays (n = 21).
DNA amplification from blood samples of a patient infected with
P. falciparum and P. vivax produced similar results by monoplex
and duplex real-time PCR, except for patients with low P. vivax par-
asitemia values; (samples for 11 patients, Table 3). Ct values in
these cases were higher in duplex PCR than in monoplex PCR,
but signals remained significantly positive. Ct value shift observed
between duplex and monoplex PCR related solely to P. vivax ampli-
fication (patients 1, 3, 4, 5, 7 and 11). Maximum Ct values for P. vi-
vax were 41.65 and 42.05 in duplex amplification, whereas
maximum values were 38.31 and 38.56 in monoplex amplification
(patients 4 and 7, respectively). Sensitivity showed insignificant
differences (about mean 0.5 Ct value) between P. malariae-positive
samples amplified by monoplex and duplex PCR with IPC (data not
shown).
4. Discussion
Microscopic examination remains the easiest technique for the
diagnosis of malaria in blood samples. This method is cheap and
349
rapid, allowing quantification and species determination. However,
microscopy has limitations (Hanscheid, 2003; Hanscheid et al.,
2003; Kain et al., 1998; Rubio et al., 1999): samples with low par-
asitemia and mixed species infections are difficult to diagnose rou-
tinely. Moreover, drug treatments change parasite appearances.
Thus, this technique requires well-trained technicians. Molecular
methods based on DNA amplification, such as nested PCR, devel-
oped by Snounou et al. (1993a,b), allow a very good level of sensi-
tivity and specificity. Therefore, molecular techniques have been
able to show real prevalence of the asymptomatic carrier in ende-
mic countries (Alves et al., 2002; Coura et al., 2006), and reveal reli-
ably cases of mixed species infection. In this study, microscopy
diagnosed 4.8% of mixed species infections, whereas nested PCR
and real-time PCR diagnosed 10.0% and 11.1% of mixed species
infections, respectively.
Recently developed real-time PCR protocols (Andrews et al.,
2005; Elsayed et al., 2006; Han et al., 2007; Lee et al., 2002; Man-
gold et al., 2005; Perandin et al., 2004; Polanco et al., 2002; Rouge-
mont et al., 2004; Safeukui et al., 2008; Vo et al., 2007) overcome
issues linked to nested PCR. The two main drawbacks to nested
PCR are the length of time the process takes and significant con-
tamination risks between samples during adjunction of first PCR
into second PCR. However, with well trained molecular biologist
this risk is low. Real-time PCR requires a single run with no
requirement for agarose gel analysis, and the closed amplification
system highly decreases the contamination risks. Moreover, tech-
nique is quantitative, very sensitive and specific; results can also
be obtained within 3 h. It could be useful in medical places lacking
well-trained microscopy technicians and may also be used to con-
firm or invalidate diagnosis by microscopy. Real-time PCR machine
prices are falling, but the routine analysis costs remain high, espe-
cially for emerging countries. Although several real-time protocols
have been previously described, few studies have investigated
multiplex real-time PCR based on species-specific hybridisation
probes (Rougemont et al., 2004). The aim of this study was to de-
velop a sensitive, specific and low cost real-time PCR assay. P. fal-
ciparum and P. vivax were amplified in the same tube by the
TaqMan duplex assay, and P. malariae was detected in another tube
with internal positive control. The duplex assay allows a reduction
in cost, as the PCR master mix and the number of plastic consum-
ables are divided in half, and simplifies preparation. P. ovale was
not evaluated by real-time PCR, as the parasite is not present in
French Guiana we had an insufficient number of positive samples
to establish a P. malariae and P. ovale duplex. It will be made in a
further work in order to dispose of two TaqMan assays detecting
four Plasmodium species. Sensitivity thresholds were about the
same as those reported elsewhere by real-time PCR with probes
(Perandin et al., 2004; Rougemont et al., 2004). Compared with
nested PCR, the gold standard reference of molecular methods,
real-time PCR assays detected malaria in all 189 positive samples
(100% of sensitivity) and had no amplification in all 74 negative
samples (100% of specificity). No PCR inhibitor was detected
thanks to the internal positive control. Nevertheless, loss of DNA
template during purification cannot be excluded, especially with
low parasitemia infections, this phenomenon cannot be detected
by IPC.
The TaqMan duplex PCR assay diagnosed all the mixed species
infections found by nested PCR (19/19). TaqMan duplex PCR de-
tected two mixed species infection cases: however, the two cases
tested positive for P. vivax by nested PCR. These two samples were
P. falciparum- and P. vivax-positive by the TaqMan PCR monoplex
assay. Mean Ct values (36.65 and 35.89, respectively) correspond-
ing to low levels of P. vivax were observed, and specific amplifica-
tion products were confirmed by sequencing.
We tested DNA mixtures for mixed species infections of P. falci-
parum and P. vivax at different concentration levels: TaqMan du-
350 V. Veron et al. / Experimental Parasitology 121 (2009) 346–351
plex assays diagnosed all associations, except for the mixture cor-
responding to 3.1 and 0.3 parasite(s) per blood microlitre (sensitiv-
ity threshold of our assays) for P. falciparum and P. vivax. No
competition was detected in the amplification of the two species
in the duplex assays, except for the DNA mixture corresponding
to 3.6 and 0.3 parasites per microlitre of blood (9.2 and 0.9 para-
sites per PCR assays). We observed a shift in P. vivax Ct values in
the two assays: they did not exceed a Ct value of 43. Similar results
were observed for a few patients infected by P. falciparum and P. vi-
vax (cf. Table 3). This may be explained by lower concentrations of
primers and probes used in the duplex assay. When developing the
duplex assay, the protocol was fine-tuned to ensure a maximum
sensitivity threshold, a high level of efficiency and the use of low
nucleotide concentrations (to reduce interactions, such as dimer
formation). Another explanation may be competition between
the two systems, in which P. vivax amplification is less efficient
than P. falciparum amplification. The P. falciparum PCR product is
95 bp long and that of P. vivax is 142. Shorter fragments appeared
to be amplified with greater efficiency. Thus, the Ct value for P. vi-
vax was higher than that in a monoplex assay. This implies that
with mixed species samples with predominated P. falciparum load,
P. vivax might be missed although it was detected in our assays.
Nevertheless, the duplex assay developed in this study appeared
to be more sensitive for mixed samples than the multiplex assays
(two duplex assays) described by Rougemont et al., especially
when difference of parasitemia of species is important. Rougemont
and colleagues worked with one primer pair and four probes spe-
cific to each Plasmodium species. We used two primer pairs to limit
amplification competition in the presence of P. falciparum and P. vi-
vax DNA. Other real-time strategies have been described, such as
the SYBR green-based system (de Monbrison et al., 2003; Mangold
et al., 2005; Swan et al., 2005; Vo et al., 2007), which showed good
discriminating power with mixed species infection samples but
gave a lower sensitivity than TaqMan assays (Perandin et al.,
2004; Rougemont et al., 2004). We used TaqMan probes to obtain
signals more specific than the SYBR green PCR system; thus, not to
determine species by SYBR green melting curve analysis. Light-
Cycler probe based protocols are also be published (Safeukui
et al., 2008; Swan et al., 2005), and permit the detection of four
Plasmodium species, however this protocol is not suitable on all
real-time thermocyclers and thus required a machine compatible
with this technology. By developing a TaqMan duplex PCR, we sug-
gest a low cost and specific method of diagnosis usable on all real-
time machines. To our knowledge, only Rougemont et al. and our
work described a multiplex PCR for malaria diagnosis based on
TaqMan probes. In our assays, duplex real-time PCR assays provide
good reproducibility and good efficiency in the presence of a single
Plasmodium species per sample, making it a technique that is semi-
or fully quantitative in routine use. However, in cases of P. falcipa-
rum- and P. vivax-infected blood samples, competition between
amplification systems and efficiency decreases in amplifying P. vi-
vax sequences, making it unsuitable to determine parasitemia
levels.
This new real-time PCR method provides a reliable test for the
detection of P. falciparum, P. vivax and P. malariae infections,
including mixed species infection. The internal positive control is
a useful tool to detect potential inhibitors in human samples;
therefore, this test can be used to diagnose human infection. More-
over, this duplex real-time PCR can be very useful for primary par-
asite research or for use in conjunction with microscopy to confirm
stained blood smear examinations.
Acknowledgment
This work was financial supported by French Ministry of
Research.
References
Alves, F.P., Durlacher, R.R., Menezes, M.J., Krieger, H., Silva, L.H., Camargo, E.P., 2002.
High prevalence of asymptomatic Plasmodium vivax and Plasmodium falciparum
infections in native Amazonian populations. American Journal of Tropical
Medicine and Hygiene 66, 641–648.
Andrews, L., Andersen, R.F., Webster, D., Dunachie, S., Walther, R.M., Bejon, P., Hunt-
Cooke, A., Bergson, G., Sanderson, F., Hill, A.V., Gilbert, S.C., 2005. Quantitative
real-time polymerase chain reaction for malaria diagnosis and its use in malaria
vaccine clinical trials. American Journal of Tropical Medicine and Hygiene 73,
191–198.
Brown, A.E., Kain, K.C., Pipithkul, J., Webster, H.K., 1992. Demonstration by the
polymerase chain reaction of mixed Plasmodium falciparum and P. vivax
infections undetected by conventional microscopy. Transactions of the Royal
Society of Tropical Medicine and Hygiene 86, 609–612.
Calderaro, A., Piccolo, G., Perandin, F., Gorrini, C., Peruzzi, S., Zuelli, C., Ricci, L.,
Manca, N., Dettori, G., Chezzi, C., Snounou, G., 2007. Genetic polymorphisms
influence Plasmodium ovale PCR detection accuracy. Journal of Clinical
Microbiology 45, 1624–1627.
Carme, B., 2005. Substantial increase of malaria in inland areas of eastern French
Guiana. Tropical Medicine and International Health 10, 154–159.
Coura, J.R., Suarez-Mutis, M., Ladeia-Andrade, S., 2006. A new challenge for malaria
control in Brazil: asymptomatic Plasmodium infection—a review. Memórias do
Instituto Oswaldo Cruz 101, 229–237.
de Monbrison, F., Angei, C., Staal, A., Kaiser, K., Picot, S., 2003. Simultaneous
identification of the four human Plasmodium species and quantification of
Plasmodium DNA load in human blood by real-time polymerase chain reaction.
Transactions of the Royal Society of Tropical Medicine and Hygiene 97, 387–
390.
Elsayed, S., Plewes, K., Church, D., Chow, B., Zhang, K., 2006. Use of molecular beacon
probes for real-time PCR detection of Plasmodium falciparum and other
Plasmodium species in peripheral blood specimens. Journal of Clinical
Microbiology 44, 622–624.
Han, E.T., Watanabe, R., Sattabongkot, J., Khuntirat, B., Sirichaisinthop, J., Iriko, H.,
Jin, L., Takeo, S., Tsuboi, T., 2007. Detection of four Plasmodium species by genus-
and species-specific loop-mediated isothermal amplification for clinical
diagnosis. Journal of Clinical Microbiology 45, 2521–2528.
Hanscheid, T., 2003. Current strategies to avoid misdiagnosis of malaria. Clinical
Microbiology and Infection 9, 497–504.
Hanscheid, T., Melo-Cristino, J., Grobusch, M.P., Pinto, B.G., 2003. Avoiding
misdiagnosis of imported malaria: screening of emergency department
samples with thrombocytopenia detects clinically unsuspected cases. Journal
of Travel Medicine 10, 155–159.
Hermsen, C.C., Telgt, D.S., Linders, E.H., van de Locht, L.A., Eling, W.M., Mensink, E.J.,
Sauerwein, R.W., 2001. Detection of Plasmodium falciparum malaria parasites
in vivo by real-time quantitative PCR. Molecular and Biochemical Parasitology
118, 247–251.
Kain, K.C., Harrington, M.A., Tennyson, S., Keystone, J.S., 1998. Imported malaria:
prospective analysis of problems in diagnosis and management. Clinical
Infectious Diseases 27, 142–149.
Lee, M.A., Tan, C.H., Aw, L.T., Tang, C.S., Singh, M., Lee, S.H., Chia, H.P., Yap, E.P., 2002.
Real-time fluorescence-based PCR for detection of malaria parasites. Journal of
Clinical Microbiology 40, 4343–4345.
Liu, Q., Zhu, S., Mizuno, S., Kimura, M., Liu, P., Isomura, S., Wang, X., Kawamoto, F.,
1998. Sequence variation in the small-subunit rRNA gene of Plasmodium
malariae and prevalence of isolates with the variant sequence in Sichuan, China.
Journal of Clinical Microbiology 36, 3378–3381.
Mangold, K.A., Manson, R.U., Koay, E.S., Stephens, L., Regner, M., Thomson Jr., R.B.,
Peterson, L.R., Kaul, K.L., 2005. Real-time PCR for detection and identification of
Plasmodium spp.. Journal of Clinical Microbiology 43, 2435–2440.
Moody, A., 2002. Rapid diagnostic tests for malaria parasites. Clinical Microbiology
Reviews 15, 66–78.
Perandin, F., Manca, N., Calderaro, A., Piccolo, G., Galati, L., Ricci, L., Medici, M.C.,
Arcangeletti, M.C., Snounou, G., Dettori, G., Chezzi, C., 2004. Development of a
real-time PCR assay for detection of Plasmodium falciparum, Plasmodium vivax,
and Plasmodium ovale for routine clinical diagnosis. Journal of Clinical
Microbiology 42, 1214–1219.
Polanco, J.C., Rodriguez, J.A., Corredor, V., Patarroyo, M.A., 2002. Plasmodium vivax:
parasitemia determination by real-time quantitative PCR in Aotus monkeys.
Experimental Parasitology 100, 131–134.
Rougemont, M., Van Saanen, M., Sahli, R., Hinrikson, H.P., Bille, J., Jaton, K., 2004.
Detection of four Plasmodium species in blood from humans by 18S rRNA gene
subunit-based and species-specific real-time PCR assays. Journal of Clinical
Microbiology 42, 5636–5643.
Rubio, J.M., Benito, A., Berzosa, P.J., Roche, J., Puente, S., Subirats, M., Lopez-Velez, R.,
Garcia, L., Alvar, J., 1999. Usefulness of seminested multiplex PCR in surveillance
of imported malaria in Spain. Journal of Clinical Microbiology 37, 3260–3264.
Safeukui, I., Millet, P., Boucher, S., Melinard, L., Fregeville, F., Receveur, M.C., Pistone,
T., Fialon, P., Vincendeau, P., Fleury, H., Malvy, D., 2008. Evaluation of FRET real-
time PCR assay for rapid detection and differentiation of Plasmodium species in
returning travellers and migrants. Malaria Journal 7, 70.
Snounou, G., Viriyakosol, S., Jarra, W., Thaithong, S., Brown, K.N., 1993a.
Identification of the four human malaria parasite species in field samples by
the polymerase chain reaction and detection of a high prevalence of mixed
infections. Molecular and Biochemical Parasitology 58, 283–292.
 V. Veron et al. / Experimental Parasitology 121 (2009) 346–351
Snounou, G., Viriyakosol, S., Zhu, X.P., Jarra, W., Pinheiro, L., do Rosario, V.E.,
Thaithong, S., Brown, K.N., 1993b. High sensitivity of detection of human
malaria parasites by the use of nested polymerase chain reaction. Molecular and
Biochemical Parasitology 61, 315–320.
Spinazzola, F., Nicastri, E., Vlassi, C., Ghirga, P., De Marco, M., Pittalis, S., Paglia, M.G.,
Ferrari, C., Narciso, P., 2007. Imported malaria at Italy’s National Institute for
Infectious Diseases Lazzaro Spallanzani, 1984–2003. European Journal of
Clinical Microbiology & Infectious Diseases 26, 175–179.
Swan, H., Sloan, L., Muyombwe, A., Chavalitshewinkoon-Petmitr, P., Krudsood, S.,
Leowattana, W., Wilairatana, P., Looareesuwan, S., Rosenblatt, J., 2005.
View publication stats
351
Evaluation of a real-time polymerase chain reaction assay for the diagnosis of
malaria in patients from Thailand. American Journal of Tropical Medicine and
Hygiene 73, 850–854.
Vo, T.K., Bigot, P., Gazin, P., Sinou, V., De Pina, J.J., Huynh, D.C., Fumoux, F.,
Parzy, D., 2007. Evaluation of a real-time PCR assay for malaria
diagnosis in patients from Vietnam and in returned travellers.
Transactions of the Royal Society of Tropical Medicine and Hygiene
101, 422–428.
Warhurst, D.C., Williams, J.E., 1996. Laboratory diagnosis of malaria. Journal of
Clinical Pathology 49, 533–538 (ACP Broadsheet no. 148. July 1996).