MB-303

CELL BIOLOGY- II/ B. S.

5th Semester Credit Hours
3(2-1)
Dr. Muniza Shaikh
Sardar Bahadur Khan University for Women, Quetta
Recombinant DNA Molecule
• Isolation of distinct fragments of DNA from any organism and
recombining them into a smaller genome that is much easier to
analyze.
• These recombinant DNA molecules can be made by joining
nonhomologous DNAs from virtually any source, including DNAs
from widely differing species.
• Vector: is a DNA molecule used as a vehicle to artificially carry
foreign genetic material into another cell, where it can
be replicated and/or expressed (e.g.-
plasmid, cosmid, Lambda phages)
• The vector itself is generally a DNA sequence that consists of an insert
(transgene) and a larger sequence.
• Purpose of a vector which transfers genetic information to another cell
is typically to isolate, multiply, or express the insert in the target cell
• Most of the vectors are cloning vectors as they serve the purpose of
cloning.
• Others may be designed specifically for other purposes, such as
transcription and protein expression
• Expression vectors: Vectors designed specifically for the expression
of the transgene in the target cell.
• generally have a promoter sequence that drives expression of the
transgene.

• Transcription vectors: Simpler vectors

called transcription vectors are only
capable of being transcribed but not
translated: they can be replicated in a
target cell but not expressed, unlike
expression vectors. Transcription vectors
are used to amplify their insert.
 Features:
• Modern artificially-constructed vectors contain essential
components found in all vectors, and may contain other additional
features found only in some vectors:
• Origin of replication: Necessary for the replication and
maintenance of the vector in the host cell.
• Promoter: Promoters are used to drive the transcription of the
vector's transgene as well as the other genes in the vector such as
the antibiotic resistance gene. Some cloning vectors need not have
a promoter for the cloned insert but it is an essential component of
expression vectors so that the cloned product may be expressed.
• Cloning site: This may be a multiple cloning site or other features
that allow for the insertion of foreign DNA into the vector through
ligation.

• Genetic markers: Genetic markers for viral vectors allow for

confirmation that the vector has integrated with the host genomic
DNA.
• Antibiotic resistance: Vectors with antibiotic-resistance open
reading frames allow for survival of cells that have taken up the
vector in growth media containing antibiotics through antibiotic
selection.
• Epitope: Some vectors may contain a sequence for a specific epitope that can be incorporated into
the expressed protein. It allows for antibody identification of cells expressing the target protein.
• Reporter genes: Some vectors may contain a reporter gene that allow for identification of plasmid
that contains inserted DNA sequence. An example is lacZ-α which codes for the N-terminus
fragment of β-galactosidase, an enzyme that digests galactose. A multiple cloning site is located
within lacZ-α, and an insert successfully ligated into the vector will disrupt the gene sequence,
resulting in an inactive β-galactosidase. Cells containing vector with an insert may be identified
using blue/white selection by growing cells in media containing an analogue of galactose (X-gal).
Cells expressing β-galactosidase (therefore doesn't contain an insert) appear as blue colonies.
White colonies would be selected as those that may contain an insert. Other commonly used
reporters include green fluorescent protein and luciferase.
• Targeting sequence: Expression vectors may include encoding for a targeting sequence in the
finished protein that directs the expressed protein to a specific organelle in the cell or specific
location such as the periplasmic space of bacteria.
• Protein purification tags: Some expression vectors include proteins or peptide sequences that
allows for easier purification of the expressed protein. Examples include polyhistidine-tag,
glutathione-S-transferase, and maltose binding protein. Some of these tags may also allow for
increased solubility of the target protein. The target protein is fused to the protein tag, but a
protease cleavage site positioned in the polypeptide linker region between the protein and the tag
allows the tag to be removed later.
Restriction Enzymes
• A restriction enzyme or restriction endonuclease is an enzyme that
cleaves DNA into fragments at or near specific recognition sites within
molecules known as restriction sites.
• To cut DNA, all restriction enzymes make two incisions, once through
each sugar-phosphate backbone (i.e. each strand) of the DNA double
helix.
• Restriction enzymes are commonly classified into five types, which
differ in their structure and whether they cut their DNA substrate at
their recognition site, or if the recognition and cleavage sites are
separate from one another.

• Daniel Nathans and Kathleen Danna showed that cleavage of simian

virus 40 (SV40) DNA by restriction enzymes yields specific
fragments that can be separated using polyacrylamide gel
electrophoresis, thus showing that restriction enzymes can also be
used for mapping DNA.

• The discovery of restriction enzymes allows DNA to be manipulated,

leading to the development of recombinant DNA technology that has
many applications, for example, allowing the large scale production
of proteins such as human insulin used by diabetics.
Recognition site
• Restriction enzymes recognize a specific sequence of
nucleotides and produce a double-stranded cut in the DNA.
• Many of them are palindromic, meaning the base sequence
reads the same backwards and forwards.
• The inverted repeat palindrome is also a sequence that reads
the same forward and backward, but the forward and backward
sequences are found in complementary DNA strands (i.e., of
double-stranded DNA), as in GTATAC (GTATAC being
complementary to CATATG).
• Inverted repeat palindromes are more common and have
greater biological importance than mirror-like palindromes.
Examples:
• EcoRI digestion produces "sticky" ends,

• SmaI restriction enzyme cleavage produces "blunt" ends:

• Recognition sequences in DNA differ for each restriction enzyme,

producing differences in the length, sequence and strand orientation
(5' end or 3' end) of a sticky-end "overhang" of an enzyme
restriction.
Types:
• Naturally occurring restriction endonucleases are categorized into
four groups (Types I, II III, and IV) based on their:
• composition and enzyme cofactor requirements,
• the nature of their target sequence,
• and the position of their DNA cleavage site relative to the target
sequence.
The specificity and results of restriction enzyme cleavage. The 5’ end of each DNA strand and the site of cleavage (small red arrows) are indicated. The large dot indicates the
site of rotational symmetry of each recognition site. Note that the recognition sites differ for different enzymes. In addition, the positions of the cut sites may differ for different
enzymes, producing single-stranded overhangs (sticky ends) at the 5’ or 3’ end of each double-stranded DNA molecule or producing blunt ends if the cut sites are not offset. (a)
Three hexanucleotide (six-cutter) recognition sites and the restriction enzymes that cleave them. Note that one site produces a 5’ overhang, another a 3’ overhang, and the third a
blunt end. (b) Examples of enzymes that have tetranucleotide (four-cutter) recognition sites.
DNA LIGASES
• Are special type of enzymes that facilitates the joining of DNA
strands together by catalyzing the formation of a
phosphodiester bond.
• DNA ligase is used in both DNA repair and DNA replication.
• extensive use in molecular biology laboratories for recombinant
DNA experiments.
• Purified DNA ligase is used in gene cloning to join DNA
molecules together to form recombinant DNA.
Enzymatic mechanism
• The mechanism of DNA ligase is to form
two covalent phosphodiester bonds
between 3' hydroxyl ends of one
nucleotide ("acceptor"), with the 5'
phosphate end of another ("donor").
Two ATP molecules are consumed for each phosphodiester
bond formed.

AMP is required for the ligase reaction, which proceeds in

four steps:

1. Reorganization of activity site such as nicks in DNA segments or

Okazaki fragments etc.

2. Adenylation (addition of AMP) of a lysine residue in the active

center of the enzyme, pyrophosphate is released

3. Transfer of the AMP to the 5' phosphate of the so-called donor,

formation of a pyrophosphate bond

4. Formation of a phosphodiester bond between the 5' phosphate

of the donor and the 3' hydroxyl of the acceptor.
 pictorial example of how a ligase works (with sticky ends)

Ligase will also work with blunt ends, although higher enzyme concentrations and different reaction
conditions are required.
Types
• E. coli:
• The E. coli DNA ligase is encoded by the lig gene.
• DNA ligase in E. coli, as well as most prokaryotes, uses energy
gained by cleaving nicotinamide adenine dinucleotide (NAD) to
create the phosphodiester bond.
• T4:
• The DNA ligase from bacteriophage T4 (a bacteriophage that infects
Escherichia coli bacteria).
• It can ligate either cohesive or blunt ends of DNA.
• T4 DNA ligase cannot utilize NAD and it has an absolute
requirement for ATP as a cofactor.
Mammalian:
• In mammals, there are four specific types of ligase.
• DNA ligase I: ligates the nascent DNA of the lagging strand after the Ribonuclease
H has removed the RNA primer from the Okazaki fragments.
• DNA ligase III: complexes with DNA repair protein XRCC1 to aid in sealing DNA
during the process of nucleotide excision repair and recombinant fragments. Of
the all known mammalian DNA ligases, only Lig III has been found to be present in
mitochondria.
• DNA ligase IV: complexes with XRCC4. It catalyzes the final step in the non-
homologous end joining DNA double-strand break repair pathway. It is also
required for V(D)J recombination, the process that generates diversity in
immunoglobulin and T-cell receptor loci during immune system development.
• DNA ligase II: appears to be used in repair. It is formed by alternative splicing of a
proteolytic fragment of DNA ligase III and does not have its own gene, therefore it
is often considered to be virtually identical to DNA ligase III.
• DNA ligase from eukaryotes and some microbes uses adenosine triphosphate
(ATP) rather than NAD
Entry of recombinant molecules into the
bacterial/host cell:
TRANSFORMATION :
• The vector is inserted into a host cell, in a process called
transformation. One example of a possible host cell is E. Coli. The host
cells must be specially prepared (competent) to take up the foreign
DNA.

• In transformation, bacteria are bathed in a solution containing the

recombinant DNA molecule which enters the competent cell and
forms a plasmid chromosome
Competent cells:
• Competent cells are bacterial cells that can accept extra-
chromosomal DNA or plasmids (naked DNA) from the environment.
• The generation of competent cells may occur by two methods:
natural competence and artificial competence.
• Natural Competence:
• Natural competence is the genetic ability of a bacterium to receive
environmental DNA under natural or in vitro conditions.
• In some genera, certain portions of the population are competent at
a time, and in others, the whole population gains competence at the
same time.
• Natural competence and transformation are efficient for linear
molecules such as chromosomal DNA but not for circular plasmid
molecules.
 Artificial Competence:
• Bacteria can also be made competent artificially by chemical
treatment and heat shock to make them transiently permeable to
DNA.
• Artificial competence is not coded by the genes of the bacterial
cells.
• It is a laboratory procedure in which cells are passively made
permeable to DNA using unnatural conditions.
• The procedure of artificial competence is relatively simple and
easy and can be used to engineer a bacterium genetically.
• However, transformation efficiency is very low as only a portion
of the cells become competent to successfully take up DNA.
• There are two main methods for the
preparation of competent cells.
1. Calcium chloride method :
The addition of calcium chloride to a cell
suspension promotes
the binding of plasmid DNA
to lipopolysaccharides (LPS). Positively
charged calcium ions attract both the negatively
charged DNA backbone and the negatively
charged groups in the LPS inner core. The
plasmid DNA can then pass into the cell
upon heat shock, where chilled cells (+4 degrees
Celsius) are heated to a higher temperature (+42
degrees Celsius) for a short time.
2. Electroporation.
• Electroporation is a physical transfection method that uses an
electrical pulse to create temporary pores in cell membranes
through which substances like nucleic acids can pass into cells.
• It is a highly efficient strategy for the introduction of foreign
nucleic acids into many cell types, including bacteria and
mammalian cells.
3. Transduction:
• It is the process by which foreign DNA is introduced into a cell
by a virus or viral vector.
• An example is the viral transfer of DNA from one bacterium to
another and hence an example of horizontal gene transfer.
• Transduction does not require physical contact between the
cell donating the DNA and the cell receiving the DNA (which
occurs in conjugation), and it is DNase resistant
(transformation is susceptible to DNase).
• Transduction is a common tool used by molecular biologists
to stably introduce a foreign gene into a host
cell's genome (both bacterial and mammalian cells).

4. Bacterial conjugation:
It is the transfer of genetic material between bacterial
cells by direct cell-to-cell contact or by a bridge-like
connection between two cells. This takes place through
a pilus.
Vectors:
• 1. Requirements for a cloning vector
• a) Should be capable of replicating in host cell
• b) Should have convenient RE sites for inserting DNA of interest
• c) Should have a selectable marker to indicate which host cells
received recombinant DNA molecule
• d) Should be small and easy to isolate
Plasmids:
• Bacterial plasmids are small, circular DNA molecules that are separate
from the rest of the chromosome.
• They replicate independently of the bacterial chromosome.
• Useful for cloning DNA inserts less that 20 kb (kilobase pairs).
• Inserts larger than 20 kb are lost easily in the bacterial cell.
λ- Phage:
• Bacteriophage lambda (45 kb) contains a central region of 15 kb that is
notrequired for replication or formation of progeny phage in E. coli.
• Thus, lambda can be used as a cloning vector by replacing the central
15 kb with 10-15 kb of foreign DNA.
• This is done as follows: mix RE cut donor DNA and lambda DNA in
test tube ligate use in vitro packaging mix that will assemble
progeny phage carrying the foreign DNA infect E. coli with the
phage to amplify.
Cosmids:
• Cosmids are hybrids of phages and plasmids that can carry DNA
fragments up to 45 kb.
• They can replicate like plasmids but can be packaged like phage
lambda.
Expression Vectors:
• Expression vectors are vectors that carry host signals that facilitate
the transcription and translation of an inserted gene.
• They are very useful for expressing eukaryotic genes in bacteria.
Yeast artificial chromosomes (YACS)
• Yeast artificial chromosomes (YACS) are yeast vectors that have been
engineered to contain a centromere, telomere, origin of replication, and a
selectable marker.
• They can carry up to 1,000 kb of DNA. Since they are maintained in yeast (a
eukaryote), they are useful for cloning eukaryotic genes that contain
introns.
• Also, eukaryotic genes are more easily expressed in a eukaryotic host such
as yeast.
• Bacterial artificial chromosomes (BACS)
• Bacterial artificial chromosomes (BACS) are bacterial plasmids derived from
the F plasmid. They are capable of carrying up to 300 kb of DNA.
Type of donor DNA
• Genomic DNA: This DNA is obtained directly from the chromosomes
of the organism under study. It is the most straightforward source of
DNA.
• It needs to be cut up before cloning is possible.
• cDNA: Complementary DNA (cDNA) is a doublestranded DNA
version of an mRNA molecule. In higher eukaryotes, an mRNA is a
more useful predictor of a polypeptide sequence than is a genomic
sequence, because the introns have been spliced out.
• cDNA is preferred to be used rather than mRNA itself because RNAs
are inherently less stable than DNA and techniques for routinely
amplifying and purifying individual RNA molecules do not exist.
• The cDNA is made from mRNA with the
use of a special enzyme called reverse
transcriptase, originally isolated from
retroviruses.
• Using an mRNA molecule as a template,
reverse transcriptase synthesizes a single-
stranded DNA molecule that can then be
used as a template for double-stranded DNA
synthesis.
• cDNA does not need to be cut in order to be
cloned.
• To create bacteria that express human
insulin, cDNA was the choice because
bacteria do not have the ability to splice out
introns present in natural genomic DNA.
Amplification of recombinant DNA molecule inside a
bacterial cell
Making genomic and cDNA libraries
• Any one clone represents a small part of the genome of an organism or only
one of thousands of mRNA molecules that the organism can synthesize.
• Take all the DNA from a genome, break it up into segments of the right size
for our cloning vector, and insert each segment into a different copy of the
vector, thereby creating a collection of recombinant DNA molecules that,
taken together, represent the entire genome.
• Transform or transduce these molecules into separate bacterial recipient
cells, where they are amplified.
• The resulting collection of recombinant DNA-bearing bacteria or
bacteriophages is called a genomic library.
• If we are using a cloning vector that accepts an average insert size of
10 kb and if the entire genome is 100,000 kb in size (the approximate
size of the genome of the nematode (Caenorhabditis elegans), then
10,000 independent recombinant clones will represent one genome’s
worth of DNA.
• Similarly, representative collections of cDNA inserts require tens or
hundreds of thousands of independent cDNA clones; these collections
are cDNA libraries and represent only the protein-coding regions of
the genome.
• A comprehensive cDNA library is based on mRNA samples from
different tissues, different developmental stages, and organisms grown
in different environmental conditions.
• Whether we choose to construct a genomic DNA library or a cDNA library
depends on the situation.
• If we are seeking a specific gene that is active in a specific type of tissue in
a plant or animal, then it makes sense to construct a cDNA library from a
sample of that tissue.
• For example, suppose we want to identify cDNAs corresponding to insulin
mRNAs.
• The B-islet cells of the pancreas are the most abundant source of insulin,
and so mRNAs from pancreas cells are the appropriate source for a cDNA
library because these mRNAs should be enriched for the gene in question.
• A cDNA library represents a subset of the transcribed regions of the
genome; so it will inevitably be smaller than a complete genomic library.
Although genomic libraries are bigger, they do have the benefit of
containing genes in their native form, including introns and untranscribed
regulatory sequences. A genomic library is necessary at some stage as a
prelude to cloning an entire gene or an entire genome.
Finding a specific clone of interest:
• BY USING PROBES:
• A library might contain as many as hundreds of thousands of cloned
fragments.
• This huge collection of fragments must be screened to find the
recombinant DNA molecule containing the gene of interest to a
researcher.
• Such screening is accomplished by using a specific probe that will
find and mark only the desired clone.
• There are two types of probes: those that recognize a specific nucleic
acid sequence and those that recognize a specific protein
• Probing for DNA makes use of the power of base complementarity.
• Two single-stranded nucleic acids with full or partial complementary
base sequence will “find” each other in solution by random collision.
• A single-stranded probe, labeled radioactively or chemically, is sent
out to find its complementary target sequence in a population of DNAs
such as a library.
• Probes as small as 15 to 20 base pairs will hybridize to specific
complementary sequences within much larger cloned DNAs.
• The identification of a specific clone in a library is a two-step procedure:
• First, colonies or plaques of the library on a petri dish are transferred to an
absorbent membrane (often nitrocellulose) by simply laying the membrane
on the surface of the medium.
• The membrane is peeled off, colonies or plaques clinging to the surface are
lysed in situ, and the DNA is denatured.
• Second, the membrane is bathed with a solution of a single-stranded probe
that is specific for the DNA being sought.
• Generally, the probe is itself a cloned piece of DNA that has a sequence
homologous to that of the desired gene.
• The probe must be labeled with either a radioactive isotope or a fluorescent
dye.
• Thus the position of a positive clone will become clear from the position of
the concentrated radioactive or fluorescent label.
• For radioactive labels, the membrane is placed on a piece of X-ray
film, and the decay of the radioisotope produces subatomic particles
that “expose” the film, producing a dark spot on the film adjacent to
the location of the radioisotope concentration.
• Such an exposed film is called an autoradiogram.
• If a fluorescent dye is used as a label, the membrane is exposed to the
correct wavelength of light to activate the dye’s fluorescence, and a
photograph is taken of the membrane to record the location of the
fluorescing dye.
Where does the DNA to make a probe come from?
• The DNA can come from one of several sources.

• cDNA from tissue that expresses a gene of interest at a high level. For the insulin
gene, the pancreas would be the obvious choice.
• A homologous gene from a related organism. This method depends on the
evolutionary conservation of DNA sequences through time. Even though the probe
DNA and the DNA of the desired clone might not be identical, they are often
similar enough to promote hybridization.
• The protein product of the gene of interest. The amino acid sequence of part of
the protein is back translated, by using the table of the genetic code in reverse
(from amino acid to codon), to obtain the DNA sequence that encoded it.
• A synthetic DNA probe that matches that sequence is then designed.

• Labeled free RNA. This type of probe is possible only when a nearly pure
population of identical molecules of RNA can be isolated, such as rRNA.
Probes for
finding proteins
• If the protein product of
a gene is known and
isolated in pure form,
then this protein can be
used to detect the clone
of the corresponding
gene in a library.
• The process requires two components:

• First, it requires an expression library, made by using expression vectors.

• To make the library, cDNA is inserted into the vector in the correct triplet reading frame
with a bacterial protein (in this case, -galactosidase), and cells containing the vector and its
insert produce a “fusion” protein that is partly a translation of the cDNA insert and partly a
part of the normal -galactosidase.
• Second, the process requires an antibody to the specific protein product of the gene of
interest.
• The antibody is used to screen the expression library for that protein.
• A membrane is laid over the surface of the medium and removed so that some of the cells of
each colony are now attached to the membrane at locations that correspond to their positions
on the original petri dish.
• The imprinted membrane is then dried and bathed in a solution of the antibody, which will
bind to the imprint of any colony that contains the fusion protein of interest.
• Positive clones are revealed by a labeled secondary antibody that binds to the first antibody.
• By detecting the correct protein, the antibody effectively identifies the clone containing the
gene that must have synthesized that protein and therefore contains the desired cDNA.
PROBING TO FIND A SPECIFIC NUCLEIC ACID IN A
MIXTURE

It is often necessary to detect and isolate a specific DNA or

RNA molecule from among a complex mixture.

The most extensively used method for detecting a

molecule within a mixture is blotting.

Blotting starts by separating the molecules in the mixture by

gel electrophoresis.

A mixture of linear DNA molecules is placed into a well cut

into an agarose gel, and the well is attached to the cathode of
an electric field.

Because DNA molecules contain charges, the fragments will

migrate through the gel to the anode at speeds inversely
dependent on their size.
• can be visualized by staining the DNA with ethidium bromide, which
causes the DNA to fluoresce in ultraviolet light.
• The absolute size of each restriction fragment in the mixture can be
determined by comparing its migration distance with a set of standard
fragments of known sizes.
• If the bands are well separated, an individual band can be cut from the
gel, and the DNA sample can be purified from the gel matrix.
• Therefore DNA electrophoresis can be either diagnostic (showing
sizes and relative amounts of the DNA fragments present) or
preparative (useful in isolating specific DNA fragments).
Southern Blotting:
• Genomic DNA digested by restriction enzymes generally yields so many
fragments that electrophoresis produces a continuous smear of DNA and no
discrete bands.
• A probe can identify one fragment in this mixture, with the use of a
technique developed by E. M. Southern called Southern blotting.
• Like clone identification this technique entails getting an imprint of DNA
molecules on a membrane by using the membrane to blot the gel after
electrophoresis is complete.
• The DNA must be denatured first, which allows it to stick to the membrane.
• Then the membrane is hybridized with labeled probe. An autoradiogram or
a photograph of fluorescent bands will reveal the presence of any bands on
the gel that are complementary to the probe.
• If appropriate, those bands can be cut out of the gel and further processed.
Chromosome Walking
• A technique with which an unknown region of a chromosome
can be explored.
• It is generally used to isolate a locus of interest for which no
probe is available but that is known to be linked to a gene which
has been identified and cloned.
• A fragment containing a known gene is selected and used as a
probe to identify other overlapping fragments which contain the
same gene.
• The nucleotide sequences of these fragments can then be
characterized. This process continues for the length of the
chromosome.
Restriction Mapping:
• A restriction map is a linear map
showing the order and distances of
restriction endonuclease cut sites in a
segment of DNA.
• Restriction maps are very important in
many aspects of DNA cloning, because
the distribution of restriction-
endonuclease-cut sites determines where
a recombinant DNA engineer can create
a clonable DNA fragment with sticky
ends.
Determining the base sequence
of a DNA segment
• The ultimate language of the genome is composed of strings of the
nucleotides A, T, C, and G.
• Dideoxy sequencing or, Sanger sequencing.
• The term dideoxy comes from a special modified nucleotide, called a
dideoxynucleotide triphosphate (generically, a ddNTP).
• This modified nucleotide is key to the Sanger technique because of its
ability to block continued DNA synthesis.
• What is a dideoxynucleotide triphosphate? And how does it block
DNA synthesis?
• A dideoxynucleotide lacks the 3-hydroxylgroup as well as the 2-
hydroxyl group, which is also absent in a deoxynucleotide.
• For DNA synthesis to take place, the DNA polymerase must catalyze a
condensation reaction between the 3’-hydroxyl group of the last
nucleotide added to the growing chain and the 5’-phosphate group of
the next nucleotide to be added, releasing water and forming a
phosphodiester linkage with the 3-carbon atom of the adjacent sugar.
Procedure:
• Suppose we want to read the sequence of a cloned DNA segment of, say,
5000 base pairs.
• First, we denature the two strands of this segment.
• Next, we create a primer for DNA synthesis that will hybridize to exactly
one location on the cloned DNA segment.
• Then add a special “cocktail” of DNA polymerase, normal nucleotide
triphosphates (dATP, dCTP, dGTP, and dTTP), and a small amount of a
special dideoxynucleotide for one of the four bases (for example,
dideoxyadenosine triphosphate, abbreviated ddATP).
• The polymerase will begin to synthesize the complementary DNA strand,
starting from the primer, but will stop at any point at which the
dideoxynucleotide triphosphate is incorporated into the growing DNA chain
in place of the normal nucleotide triphosphate.
 5’ ACGGGATAGCTAATTGTTTACCGCCGGAGCCA 3’

5 ACGGGATAGCTAATTGTTTACCGCCGGAGCCA 3’
3’CGGCCTCGGT 5’
Direction of DNA synthesis
• DNA fragments that have the same starting point but different end points because the fragments
stop at whatever point the insertion of ddATP instead of dATP halted DNA replication
• We can generate an array of such fragments for each of the four
possible dideoxynucleotide triphosphates in four separate cocktails
(one spiked with ddATP, one with ddCTP, one with ddGTP, and one
with ddTTP).
• If we add up the results of all four cocktails, we will see that the
fragments can be ordered in length, with the lengths increasing by one
base at a time.
• The final steps of the process are:
1. Display the fragments in size order by using by gel electrophoresis.
2. Label the newly synthesized strands so that they can be visualized
after they have been separated according to size by gel
electrophoresis. Do so by either radioactively or fluorescently
labeling the primer (initiation labeling) or the individual
dideoxynucleotide triphosphate (termination labeling).
Polymerase Chain Reaction (PCR)
• Starts with a solution containing the DNA source, the primers, the four
deoxyribonucleotide triphosphates, and a special DNA polymerase.
• The DNA is denatured by heat, resulting in single-stranded DNA
molecules.
• Primers hybridize to their complementary sequences in the single-
stranded DNA molecules in cooled solutions.
• A special heat-tolerant DNA polymerase (Taq DNA Polymerase from
Thermus aquaticus) replicates the single-stranded DNA segments
extending from a primer.
• This bacterium normally grows in thermal vents and so has evolved
proteins that are extremely heat resistant.
• Thus it is able to survive the high temperatures required to denature
the DNA duplex, which would denature and inactivate DNA
polymerase from most species.
Advantages:
• The great advantage of PCR is that fewer procedures are necessary
compared with cloning because the location of the primers determines
the specificity of the DNA segment that is amplified.
• Because of its high sensitivity it can amplify target sequences that are
present in extremely low copy numbers in a sample, as long as primers
specific to this rare sequence are used.
Limitations:
• To design the PCR primers, at least some sequence information must
be available for the piece of DNA that is to be amplified; in the
absence of such information, PCR amplification cannot be applied.
• The polymerase amplifies DNA segments reliably only when the
segments are less than 2 kb.
• Thus, PCR is best used for small fragments of recombinant DNA.
SDS-PAGE (sodium dodecyl sulfate–
polyacrylamide gel electrophoresis)
• An analytical method in biochemistry for the separation of charged
molecules in mixtures by their molecular masses in an electric field.
• It uses sodium dodecyl sulfate (SDS) molecules to help identify and
isolate protein molecules.
• The medium (also referred to as ′matrix′) is a polyacrylamide-based
discontinuous gel.
The SDS-PAGE method is composed of gel preparation, sample preparation, electrophoresis, protein
staining or western blotting and analysis of the generated banding pattern.

The Role of SDS: SDS is a detergent that is present in the SDS-PAGE sample buffer where, along with
a bit of boiling, and a reducing agent (normally DTT or B-ME to break down protein-protein disulphide
bonds), it disrupts the tertiary structure of proteins. This brings the folded proteins down to linear
molecules.
SDS also coats the protein with a uniform negative charge, which masks the intrinsic charges on the R-
groups. SDS binds fairly uniformly to the linear proteins (around 1.4g SDS/ 1g protein), meaning that the
charge of the protein is now approximately proportional to its molecular weight.
• Since the SDS-coated proteins have the same charge to mass ratio, there will be no differential
migration based on charge.
• The gel matrix used for SDS-PAGE is polyacrylamide, which is a good choice because it is
chemically inert. -so won’t interact with proteins as they pass through –
• It can easily and reproducibly be made with different pore sizes to produce gels with different
separation properties.
• Polyacrylamide gel polymerization:
• Polyacrylamide, used mainly for SDS-PAGE, is a matrix formed from monomers of acrylamide
and bis-acrylamide.
• Polyacrylamide gel polymerization:
• Polyacrylamide, used mainly for SDS-PAGE, is a matrix formed from monomers of acrylamide
and bis-acrylamide.
• The reaction is initiated by TEMED (N, N, N’, N’-tetraethylenediamine), which induces free
radical formation from ammonium persulphate (APS). The free radicals transfer electrons to the
acrylamide/bisacrylamide monomers, radicalizing them and causing them to react with each other
to form the polyacrylamide chain.
• The amount of crosslinking, and therefore the pore size and consequent separation properties of the
gel can be controlled by varying the ratio of acrylamide to bis-acrylamide.
The Discontinuous Buffer System and the Stacking Gel – Lining Them Up at
the Starting Line.
• To conduct the current from the cathode (negative) to the anode (positive) through the gel,
a buffer is obviously needed. Mostly we use the discontinuous Laemmli buffer system.
• “Discontinuous” simply means that the buffer in the gel and the tank are different.
• Typically, the system is set up with a stacking gel at pH 6.8, buffered by Tris-HCl, a
running gel buffered to pH 8.8 by Tris-HCl and an electrode buffer at pH 8.3.
• The stacking gel has a low concentration of acrylamide and the running gel a higher
concentration capable of retarding the movement of the proteins.
In the discontinuous system, as soon as the power is turned on, Glycine, proteins, chloride ions
and bromophenol in HCI would be dissociated into anion, forming an ion flow and moving to the
anode. Its mobility depends on the number of electric charges of the ion, molecular size and
shape. However, when the glycine ions of electrophoresis buffer (pH8.3) entered into the stacking
gel and encountered lower pH (6.7), which lowered down by nearly two units, almost close to the
isoelectric point (5.97) of glycine, the dissociation degree of glycine suddenly drop, the amount
of charge reduced significantly and then the mobility became slower.Protein sample entered into
the stacking gel, pH changes has impact on its dissociation degree either, but the impact is much
smaller than on glycine. Thus it has larger mobility than glycine. What’s more, the pore size of
stacking gel is too large to cause obstruction to protein molecular. So, in the stacking gel, the
mobility of various ions is in the order of: glycine <protein <BPB <Cl.
PAGE gels are also cast in two sections. The top section, where the wells are made and samples loaded is
called the stacking gel and is generally around 3.5-4% polyacrylamide and pH 6.8. In this gel,
the proteins form discrete bands which improve the resolution of the overall gel. The lower section is
the resolving gel and ranges from 4-20% polyacrylamide (depending on the proteins investigated) and pH 8.8.
It is in the resolving gel that the protein bands are analysed.
STEM CELLS:
• Stem cells are cells that can differentiate into other types of cells, and
can also divide in self-renewal to produce more of the same type of
stem cells.
Properties:
• The classical definition of a stem cell requires that it possesses two properties:
• Self-renewal: the ability to go through numerous cycles of cell division while maintaining the
undifferentiated state.
• Potency: the capacity to differentiate into specialized cell types. In the strictest sense, this requires
stem cells to be either totipotent or pluripotent—to be able to give rise to any mature cell type,
although multipotent or unipotent progenitor cells are sometimes referred to as stem cells.
• Cellular differentiation is the process where a cell changes from one cell type to another. Usually,
the cell changes to a more specialized type.
• Cell potency is a cell's ability to differentiate into other cell types.
• The more cell types a cell can differentiate into, the greater its potency.
• There are levels of potency that begins with totipotency to designate a cell
with the most differentiation potential, pluripotency, multipotency,
oligopotency, and finally unipotency.
Levels of Potency:
Totipotency:
Totipotency (Lat. totipotentia, "ability for all [things]") is the ability of a single cell to divide and
produce all of the differentiated cells in an organism.
Spores and zygotes are examples of totipotent cells.
Totipotency represents the cell with the greatest differentiation potential, being able to differentiate
into any embryonic cell, as well as extraembryonic cells.
Pluripotency:
Pluripotency (Lat. pluripotentia, "ability for many [things]") refers to a stem cell that has the potential
to differentiate into any of the three germ layers: endoderm (interior stomach lining, gastrointestinal
tract, the lungs), mesoderm (muscle, bone, blood, urogenital), or ectoderm (epidermal tissues and
nervous system).
Induced pluripotency:
Induced pluripotent stem cells, commonly abbreviated as iPS cells or iPSCs, are a type of pluripotent
stem cell artificially derived from a non-pluripotent cell, typically an adult somatic cell, by inducing a
"forced" expression of certain genes and transcription factors.
• The ability to induce cells into a pluripotent state was initially pioneered in 2006 using mouse
fibroblasts and four transcription factors, Oct4, Sox2, Klf4 and c-Myc.
• Multipotency:
• Multipotency describes progenitor cells which have the gene activation potential to differentiate
into discrete cell types. For example, a multipotent blood stem cell —and this cell type can
differentiate itself into several types of blood cell like lymphocytes, monocytes, neutrophils, etc.
• Oligopotency:
• In biology, oligopotency is the ability of progenitor cells to differentiate into a few cell types. It is a
degree of potency. Examples of oligopotent stem cells are the lymphoid or myeloid stem cells.
• Unipotency:
• A unipotent cell is the concept that one stem cell has the capacity to differentiate into only one cell
type but have the property of self-renewal, which distinguishes them from non-stem cells.
• Examples of unipotent cells is hepatoblasts, which differentiate into hepatocytes
Types of Stem Cells:
Embryonic Stem Cells:
• Embryonic stem cells (ESCs) are the cells of the inner cell mass of a blastocyst, formed prior to
implantation in the uterus.
• ESCs are pluripotent and give rise during development to all derivatives of the three germ layers:
ectoderm, endoderm and mesoderm.
• They do not contribute to the extraembryonic membranes or to the placenta.
Adult Stem Cells:
• Adult stem cells, also called somatic (from Greek σωματικóς, "of the body") stem cells, are stem
cells which maintain and repair the tissue in which they are found.
• They can be found in children, as well as adults.
• There are three known accessible sources of autologous adult stem cells in humans:
• Bone marrow, which requires extraction by harvesting, that is, drilling into bone (typically the
femur or iliac crest).
• Adipose tissue (fat cells), which requires extraction by liposuction.
• Blood, which requires extraction through apheresis, wherein blood is drawn from the donor
(similar to a blood donation), and passed through a machine that extracts the stem cells and returns
other portions of the blood to the donor.
• Stem cells can also be taken from umbilical cord blood just after birth