Research Project:

Molecular Dynamics of
miRNA-mRNA Interaction
Presented by:
Ayushi Mandloi
2019H1290104P
M.E. Biotechnology (IInd sem)
 ~25 bp long, non-coding RNAs, found
in animals, plants and some viruses

Functions: mRNA silencing and post

transcriptional regulation of gene
expression

Introduction The biogenesis of miRNA is supported

by many enzymes, like DGCR8,
Drosha and Dicer.

miRNA along with ago proteins form

RISC which helps in RNAi
 To assess the dynamics
and structural stability of
Objective
miRNA-mRNA duplex
using AMBER simulation
software.
 hsa-miR-7-5p
>hsa-miR-7-5p MIMAT0000252
UGGAAGACUAGUGAUUUUGUUGUU

hsa-miR-7-5p sequence is a product of miR-7-5p, hsa-miR-7-5p, hsa-miR-7, miR-7, MIR7-3, MIR7-

2, MIR7-1 genes.

There are 875 predicted targets for hsa-miR-7-5p in miRDB.

Part of extracellular space; plasma/serum circulating miRNAs could be used to discriminate various
cancer patients from healthy individuals.

microRNA-7 inhibits the epidermal growth factor receptor and the Akt pathway and is down-
regulated in glioblastoma; miR-7 inhibits colorectal cancer cell proliferation and induces apoptosis
by targeting XRCC2.
 Literature Survey
miRNAs consist of mainly three regions:
 Seed region (2-8 nt)
 Bulge region (9- 13 nt)
 3’ UTR (14-25 nt)

The binding and stability of the miRNA-mRNA duplex was earlier thought to be
a contribution of 3’ – UTR

It was then experimentally validated that 3′ UTR target sites outnumber those
in coding regions reflects a potentially flawed bias of most bioinformatics tools
towards 3′ UTRs.
Base-pairing at the 5′ end of miRNAs is important for target recognition, and the
introduction of mismatches into the seed region of a presumptive miRNA–mRNA
duplex has become standard practice in target site validation.

The seed ‘rule’ states that contiguous Watson–Crick base-pairing to the 5′ miRNA
nucleotides 2–7 is required for activity in ways that are predictive of bona fide
miRNA target sites

Perfectly complementary miRNA–target pairs promote slicing, whereas imperfectly

matched pairs with central bulges lead to translational inhibition or mRNA decay.

Brodersen et al., 2009

Mostly the studies have been done on lin4:lin14-miRNA duplex, the studies
include the simulation of the duplex and assessment of structural aspects like
presence of mismatches and its impact on groove dimension and base stacking.

Mismatches causing change in the structure and hence its effect on

recruitment of Ago proteins and assembly of RISC. (Balasubramanian et al.,
2010)

Paciello et al. in 2011 studies let-7 miRNA:lin-41 mRNA interaction to calculate

the free energy of binding of the duplex using two different methods to
establish that 3D arrangement of atoms play a fundamental role in recognition
of miRNA targets.
 AMBER stands for Assisted
Model Building and Energy
Refinement.
Software used: Mimic what atoms do in real life,
AMBER assuming a given potential energy
function

Molecular dynamics (MD) allows

the study of biological and
chemical systems at the atomistic
level on time scales from
femtoseconds to milliseconds.
RMSD measures the deviation
of a target set of coordinates to
a reference set of coordinates,
with RMSD=0.0 indicating a
perfect overlap
Calculates basic nucleic acids
structure parameters like shear,
stretch, stagger, buckle, propeller,
opening HB, major and minor
groove measurements for that
particular base pair.
Calculate native contacts
within a region or between
two regions using a given
reference. Can also be used to
get min/max distances
between groups of atoms.

Pseudo
H-bond Native
RMSD pucker Nastruct
stability Contacts
rotation

The pucker commands Calculates the overall

measure the pseudo-pucker stability of the duplex
rotation around the atoms C1′ based on the H-bonds
through O4′ of residue of
interest.
 Literature survey was done to study
the pre-existing research and to
understand the gaps in the research.

Conclusion Simulation software AMBER was

studied to learn the parameters on
which the stability of duplex is to be
predicted.
Way Forward...

➔ Analysis of the stability of the duplex in-silico

based on the mentioned parameters.
➔ To study in detail the quantitative structure
activity relationship of the duplex (QSAR)
➔ To analyse the important aspects of the
miRNA-mRNA interaction
 
REFERENCES
1. Balasubramanian, C., Ojha, R. P., Maiti, S., & Desideri, A. (2010). Sampling the structure of the noncanonical lin-4:lin-14 microRNA:mRNA complex by molecular
dynamics simulations. Journal of Physical Chemistry B, 114(49), 16443–16449. https://doi.org/10.1021/jp104193r

2. Brodersen, P., & Voinnet, O. (2009). Revisiting the principles of microRNA target recognition and mode of action. Nature Reviews Molecular Cell Biology, 10(2), 141–
148. https://doi.org/10.1038/nrm2619

3. D.A. Case, K. Belfon, I.Y. Ben-Shalom, S.R. Brozell, D.S. Cerutti, T.E. Cheatham, III, V.W.D. Cruzeiro, T.A. Darden, R.E. Duke, G. Giambasu, M.K. Gilson, H. Gohlke,
A.W. Goetz, R. Harris, S. Izadi, S.A. Izmailov, K. Kasavajhala, A. Kovalenko, R. Krasny, T. Kurtzman, T.S. Lee, S. LeGrand, P. Li, C. Lin, J. Liu, T. Luchko, R. Luo, V.
Man, K.M. Merz, Y. Miao, O. Mikhailovskii, G. Monard, H. Nguyen, A. Onufriev, F.Pan, S. Pantano, R. Qi, D.R. Roe, A. Roitberg, C. Sagui, S. Schott-Verdugo, J. Shen,
C.L. Simmerling, N.R.Skrynnikov, J. Smith, J. Swails, R.C. Walker, J. Wang, L. Wilson, R.M. Wolf, X. Wu, Y. Xiong, Y. Xue, D.M. York and P.A. Kollman (2020),
AMBER 2020, University of California, San Francisco.

4. Giraldez, A. J. et al. Zebrafish miR-430 promotes deadenylation and clearance of maternal mRNAs. Science 312, 75–79 (2006).

5. Gunawardane, L. S. et al. A slicer-mediated mechanism for repeat-associated siRNA 5′ end formation in Drosophila. Science 315, 1587–1590 (2007).

6. Jenny, A. et al. A translation-independent role of oskar RNA in early Drosophila oogenesis. Development 133, 2827–2833 (2006).

7. Lu, C. et al. Elucidation of the small RNA component of the transcriptome. Science 309, 1567–1569 (2005).

8. Paciello, G., Acquaviva, A., Ficarra, E., Deriu, M. A., & MacIi, E. (2011). A molecular dynamics study of a miRNA:mRNA interaction. Journal of Molecular Modeling,
17(11), 2895–2906. https://doi.org/10.1007/s00894-011-0991-x

9. Pauler, F. M., Koerner, M. V. & Barlow, D. P. Silencing by imprinted noncoding RNAs: is transcription the answer? Trends Genet. 23, 284–292 (2007).

10. Saetrom, P. et al. Distance constraints between microRNA target sites dictate efficacy and cooperativity. Nucleic Acids Res. 35, 2333–234 (2007).

11. Song, J. J., & Joshua-Tor, L. (2006). Argonaute and RNA - Getting into the groove. Current Opinion in Structural Biology, 16(1), 5–11.
https://doi.org/10.1016/j.sbi.2006.01.010