Highlighting Excellent Research at

ACEGID
Judith U. Oguzie, DVM
PhD Research Fellow, World Bank-African Center of Excellence for Genomics of Infectious Diseases (ACEGID)

Redeemer’s University, Ede, Nigeria

 Why?
We want to understand and control transmission
of infectious diseasesjdhd
in Africa to save lives and
protect an already fragile health system

How?
By establishing a continental consortium of key
national laboratories, academic and public health
institutions to advance outbreak surveillance and
research in Africa

What?
Generate and analyze the genomic diversity of
Pathogens in real-time to map the spread of the
disease and characterize its pathogenicity, virulence
and to inform public health preventive and control
measures.
 real-time to map the spread of the disease and characterize its
Rapid sequencing of Ebola Virus-Summer 2014: Data made public immediately.

• First large-scale genome

sequence-based analysis of the
circulating Ebola viral population

• June 2014: 99 genomes publicly available

• Another 150 genomes released between

March 2014 and August 2015

•New deep Sequencing Methods for Lassa and Ebola viruses developed and published immediately for the
benefit of the community ( Matranga CB et al. Genome Biol. 15 (2014)
The data were generated super quickly!

10 days from sample to Genbank

Real-time Diagnosis: Key to West Africa Successful Containment of the 2014 Ebola
Outbreak.

• First large-scale genome We Developed the First EBOLA RDT

sequence-based analysis of the
circulating Ebola viral population

• June 2014: 99 genomes publicly available

• Another 150 genomes released between

March 2014 and August 2015

Next Generation Sequencing

Capacity 1st Generation Ebola Virus RDT Approved for EU by WHO and US FDA

Real-time PCR
Next Generation Sequencing of Lassa Virus Genomes

• ~400 patient samples

• 22 Rodents

• Unbiased sequencing - no
specific amplification
• Average 1,000X coverage of
Lassa genome
• Real-time Genome Sequencing of Outbreak
samples

• Whole Genome sequencing of 90% of 2018

outbreak samples.

• Lassa virus extensive genetic diversity

• Transmission pattern of Lassa virus clustered

by Geography.

• Rodents to human transmission

Metagenomic analysis of blood samples obtained from
Lassa Fever patients in Nigeria

Oguzie et al 2019
 Lassa virus validation of Rapid Diagnostic Test Kit

Control

Test Line

Sensitivity = 85%
Specificity = 90%
Also validated for testing of urine and saliva samples.
 • The 2018 clade was more closely related to sequences from other
West African countries than to earlier (1946–1991) Nigerian
sequences

• 2018 YFV sequences formed a tightly clustered clade.

 Next Generation Sequencing of COVID-19 Samples: SARS-CoV-2 Genome analysis from
Nigeria

• First African SARS-CoV-2

OVER 70,000 COVID-19 genome sequenced was
TESTING METAGENOMIC SEQUENCING
SUSPECTED SAMPLES in ACEGID, RUN,Ede,
Nigeria in 48 hours.
Boost testing capacity from 300 to
over 5000 per day at ACEGID
• Announced in March 06,
2020
 ❖ The sample of the index case was sent to the ACEGID lab for
sequencing on 1st March, 2020.

❖ Using one of the two Illumina MiSeqs in the sequencing platform

of ACEGID, we sequenced the sample and obtained a full genome
of SARS-CoV-2 within 48 hours.

❖ We obtained all HCoV whole genome sequences obtained from

human hosts with geographical annotations from GISAID
and aligned with the index genome sequence from Nigeria.

❖ The genome clusters with a European clade, consistent with the

known travel history of this case (Figure 1).

Figure 1: Maximum likelihood tree of SARS-CoV-2 including Nigeria’s index case

SARS-CoV-2 Genomes from
Nigeria
 We have screened over twenty thousand (20,000) samples for SARS-COV-2 by rt-qPCR.
 Currently, we have sequenced over 1300 SARS-CoV-2 samples across the country and have
assembled 623 genomes so far from twenty-six (26) states of the country.
SARS-CoV-2 PANGO Lineages in Nigeria

At the moment, there are about 37 different lineages of SARS-CoV-2 circulating in

Nigeria and they are changing at a very fast speed. Currently, B.1.525 accounts for the
largest after taking over the B.1.1.7 (second largest) PANGO lineage in Nigeria.
.
 Detection of B.1.1.7 lineages (UK Variant of
Concern) in Nigeria
● Since the first B.1.1.7 genome detected in Edo State, Nigeria, 14th December, 2020. 339
genomes have been assembled since then and 97 (28.6%) of them are B.1.1.7

● As at 24th of May 2021, we have detected a total of 106 cases of the B.1.1.7 lineage
across Nigeria

● These samples were collected between 14th December, 2020 and 22nd of February,
2021.
 Discovery of the Nigeria Lineage- B.1.525

● On the 11th of February, some recent SARS-CoV-2 genomes from England

(28), Nigeria (10), USA (7), France (5), Canada (4), Ghana (4), Japan (4),
Jordan (2), Belgium (1), Italy (1) and Spain (1) were seen to have distinct
mutations.

● These new cluster of viruses have characteristic Spike protein mutations:

E484K, Q677H, F888L, 69 - 70 deletion, 144 deletion and 9 nucleotide
mutations in the Non-structural protein 6 (nsp6) as seen in B.1.1.7, B.1.351
and P.1.

● Origin of this new cluster so far is located in Nigeria.

B.1.525 lineage (Variant of interest) in Nigeria
● Currently observed in 9 states across the country with a total of 147
genomes

● 1st B.1.525 was from an Edo State sample dated 20th December, 2020.
Since the detection of B.1.525, 339 genomes have been assembled and
(43%) were B.1.525
Discovery of a New variant B.1.1.318 (Variant under investigation) in
Nigeria
● The B.1.1.318 lineage has been discovered in samples from Lagos, Akwa-Ibom, Oyo and Ebonyi states through
whole genome sequencing of COVID-19 positive samples, as far back as January 2021.

● This new variant has spread within and outside Africa

● This variant has Spike mutations D614G, D796H, E484K, P681H, T95I and Y144 deletion

● So far, 8 genomes have been sequenced and this lineage has the potential to spread rapidly like the B.1.1.7 and
B.1.525 due to the E484K mutation in the Receptor binding domain and the P681H in the furin cleavage site of
the virus.

● Because of the E484K and other mutations in the RBD of the spike protein, there is a risk for immune escape for
this variant just like the B.1.525 variant.
Second wave of SARS-CoV-2 in Nigeria

Epicurve of SARS-CoV-2 confirmed cases in Nigeria. States that contributed to the resurgence are
highlighted in red (Lagos State, FCT Abuja and Kaduna State. Source: NCDC, 2021
Metagenomics of COVID samples

● Assembled a partial genome of Morbillivirus measles virus (85% of viruses from

Kraken2 hit) was assembled from a PCR SARS-CoV-2 positive sample
 ● Multiple introductions into Nigeria from different parts of
the world.
Summary: ● Detection of B.1.1.7 variant of concern in Nigeria
● Evidence of community transmission in different states
SARS-CoV-2 of Nigeria.
● The two variants of concern (B.1.1.7 and B.1.525) now
Sequencing account for 80% of the genomes in the country since
their detection in December 2020.
in Nigeria ● D614G mutation taking over in the country.
● Emergence of B.1.525 variant under investigation in
Nigeria which is spreading rapidly like the B.1.1.7
SARS-CoV-2 Genome Analysis from Somalia

• So far we have generated 18 genomes from Somalia samples.

• Including A, B.1, B.31, and B.1.422 lineages
• With the B.1 being the most dominant.
 SARS-CoV-2 LINEAGES IN CAMEROON

Thirty-nine (39) full SARS-CoV-2 genomes

were assembled from sequenced Cameroon
COVID-19 samples sent to the ACEGID lab
using
Lineage in Cameroon: A.23.1, A.27 and W.1
● All of these lineages have mutations with potential for increase
transmission and evade the immune system.
● So far, only 2 genomes have been assembled which belongs to the
A.23.1 lineage.

● Only 2 genomes have been assembled so far that belong to W.1

GGTGGAAAGTTGTTGGGCGGTATAGAGTTTGATGTGACTCACAAAGGATGGCCTATTGCATAG
ACTGAAAACTAATGACTTTGCCCCTGCATGGTCAATGACAGGAACCTATTTCCCATTTATTTC
AAATCCGAATTCCACATTGAATCACCGCTGTGGGCACTGAGAGTCATCCTTGCTGCAGGGATA
CAGGACCAGTTAATTGACCAGTCTTTGATTGAACCCTTAGCAGGAGCCCTTGGTTGATCTCTG
ATTGGCTGCTAACAACCAACACTAACCATTCAACATACGAACACAACGTGTCAAGGAGCAATT
GAGCCTAAAAATGCTGTCGTTGATTCGATCCAATATTCTCAAGTTTATTAACGAATTGGAGCT
CTACATGTTGTGAACTATAATGGATTATTGAGCAGTATTGAAATTGGGACTCAAAATCATACA
ATCATCATAACTCGAACTAACATGGGTTTTCTGGTGGAGCTCCAAGAACCCGACAAATCGGCA
ATGAACCGCAAGAAGCCTGGGCCGGCGAAATTTTCCCTCCTTCATGAGTCCACACTGAAAGCA
TTTACACAAGGGTCCTCGACACGAATGCAAAGTTTAATTCTTGAATTCAATAGCTCTCTTGCT
ATCTAACTAAGATGGAGTACTTCATATTGGGCTAACTCATATATGCTGACTCAATAGTTAACT
TGACATCTCTGCCTTCATAATCAGATATATAAGCATAATAAATAAATACTCATATTTCTTGAT
AATTTGTTTAACCACAGAGAAATCCTCACTGTAAGCCAGCTTCCAAGTTGACACCCTTACAAA
AACCAGGACTCAGAATTCCTCAAATAAGAGATTCCAAGACAACATCATAGAATTGCTTTATTA
TATATTAATAAGCATTTTATCACTAGAAATCCAATATACGAAATGGTTAATTGTAACTAAACT
CGCAGGTCATGTGTGTTAGGTTTCACAAATTATATATATTACTAACTCCATACTCATAACTAA
CATTAGATAAGTAGGTTAAGAAAAAAGCTTGAGGAAGATTAAGAAAAAACTGCTTATTGGGTC
 Our Approach: Genomics-informed clinical tools
EMPOWERING LOCAL CLINICIANS
ENHANCING LOCAL VIRAL DIAGNOSTICS

Mobile platform for

data collection

Designed in close
collaboration with
CRISPR-based SHERLOCK
clinicians and staff
diagnostics
Low cost, deployable lateral flow assay Streamline existing
workflows
Highly sensitive and specific
Audiovisual aids for
Designed, tested and deployed RUO patient enrollment
Lassa assay in 2 weeks
 SHINE (Streamlined Highlighting of Infections to Navigate Epidemics)

Ambient-temperature, no equipment required

Ambient-temperature, no equipment required, higher throughput

 SHINE Assay Validation

Validated in Nigeria

Tested 500 Nigerian RNA samples

extracted from clinical samples (saliva,
nasal swabs)

Test performed well on samples with

high viral load but needs improvement
for samples with low viral load.

Rapid assay development Fully field deployable

Urine Saliva
Day 1: Days 2-5: Day 6:
Design crRNAs crRNAs, primer, SNP Dengue Patient Healthy
& RPA primers target synthesis testing Test line

Control line
 CARMEN - CRISPR-Cas13 in massive multiplex

All human-associated viruses with Design and select Comprehensively test

≥10 genomes primers and crRNAs cross-reactivity
(8 chips; 28,561 tests)

CATCH-dx

Extensive test of cross-reactivity (169 × 169), using synthetic targets at 104 cp/ul
Data Availability
• Open protocols (data generation, assembly and analysis).

• Open data but FAIR research (involve, acknowledge and capacitate).

• Open updates to public health officials and general public (pandemic

responsiveness before academic exercise).
 SENTINEL – Pandemic Preemption and Response

Dr. Christian Happi Dr. Pardis Sabeti

African Center of Excellence for Genomics of Infectious Disease Broad Institute of MIT and Harvard
Redeemer’s University Harvard T.H. Chan School of Public Health
Harvard T.H. Chan School of Public Health Howard Hughes Medical Institute
 Conclusion
• Genomic data generated are the bases for diagnostics development and
improvement.

• Our research output has been instrumental in vaccine development for Lassa
virus and SARS-COV-2.

• Several Public health interventions such as mass YFV vaccination in affected

communities and lock down recommendations during SARS-COV2.

• Genomic surveillance is an ongoing effort and we keep making our data

publicly available to the scientific community.
 Acknowledgements

outbreaks genomic response team

Outstanding Partners Generous Funders
Redeemer’s University
Irrua Specialist Teaching Hospital
NCDC
Viral Hemorrhagic Fever Consortium
Broad Institute of Harvard and MIT
Harvard University
Tulane University
UCAD, Senegal
KGH, Sierra Leone
NPHI, Liberia
Zalgen
University of Cambridge
FETHA
FMC-Owo