ENZYMES

HISTORY
As early as the late 17th and early 18th centuries, the digestion of meat by
stomach secretions[7] and the conversion of starch to sugars by plant extracts
and saliva were known. However, the mechanism by which this occurred had
not been identified.[8]
In the 19th century, when studying the fermentation of sugar
to alcohol by yeast, Louis Pasteur came to the conclusion that this
fermentation was catalyzed by a vital force contained within the yeast cells
called "ferments", which were thought to function only within living
organisms. He wrote that "alcoholic fermentation is an act correlated with the
life and organization of the yeast cells, not with the death or putrefaction of
the cells."[9]
In 1877, German physiologist Wilhelm Khne (18371900) first used the
term enzyme, which comes from Greek , "in leaven", to describe this
process.[10] The word enzyme was used later to refer to nonliving substances
such as pepsin, and the word ferment was used to refer to chemical activity
produced by living organisms.

In 1897, Eduard Buchner submitted his first paper on the

ability of yeast extracts that lacked any living yeast cells to
ferment sugar. In a series of experiments at the University of
Berlin, he found that the sugar was fermented even when
there were no living yeast cells in the mixture.[11]He named
the enzyme that brought about the fermentation of sucrose
"zymase".[12] In 1907, he received the Nobel Prize in
Chemistry "for his biochemical research and his discovery of
cell-free fermentation". Following Buchner's example,
enzymes are usually named according to the reaction they
carry out. Typically, to generate the name of an enzyme, the
suffix -ase is added to the name of its substrate (e.g., lactase is
the enzyme that cleaves lactose) or the type of reaction
(e.g., DNA polymerase forms DNA polymers).[13]

ENZYMES
Enzymes are biological catalysts.
Recall that by definition, catalysts alter the
rates of chemical reactions but are neither
formed nor consumed during the reactions
they catalyze.
Enzymes are the most sophisticated catalysts
known.
Most enzymes are proteins. Some nucleic
acids exhibit enzymatic activities (e.g., rRNA).

ENZYMES

Catalysts for biological reactions

Most are proteins
Increase the rate of reaction
Activity lost if denatured
May be simple proteins
May contain cofactors such as metal ions or organic
(vitamins)

Enzyme structure
Enzymes are
proteins
They have a globular
shape
A complex 3-D
structure
Human pancreatic amylase

Formation Of Enzymes
The DNA guides the production of the
enzyme.
A specific sequence of amino acids is linked
together at the ribosomes.
The chain of amino acids folds and twists to
form a particular three-dimensional shape.

Making reactions go faster

Increasing the temperature make molecules move
faster
Biological systems are very sensitive to temperature
changes.
Enzymes can increase the rate of reactions without
increasing the temperature.
They do this by lowering the activation energy.
They create a new reaction pathway a short cut

 Enzymes significantly enhance the rates of

reactions
For example, the enzyme carbonic
anhydrase accelerates the dissolution of
carbon dioxide in water:
CO2 + H2O H2CO3
While this occurs without the help of this
enzyme, the enzyme increases the rate of
reaction by one million times (106).
9

Enzymes: Rate Enhancement

10

Enzymes Turnover Number

How fast can an enzyme produce products?
The turnover number is used to rate the
effeciency of an enzyme. This number tells
how many molecules of reactant a molecule
of enzyme can convert to product(s) per
second.
In the case of carbonic anhydrase, this means
that a single molecule of enzyme converts 105
molecules of CO2 to H2CO3 per second!
Biochemistry 3070 Enzymes

11

Enzymes Turnover Numbers

Biochemistry 3070 Enzymes

12

 Enzymes can be very

specific.
For example,
proteolytic enzymes
help hydrolyze
peptide bonds in
proteins.
Trypsin is rather
specific
Thrombin is very
specific
Biochemistry 3070 Enzymes

13

 DNA Polymerase I is a very specific enzyme.

Enzymes also recognize stereochemistry.
The enzyme L-amino acid oxidase acts only
upon L-amino acids, ignoring D amino acids.

Biochemistry 3070 Enzymes

14

Restriction Enzyme Activity

Scanning

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Recognition Sequence

GGACGCTAGCTGATGAATTCGCATCGGATCCGAATCCGCTCTTTCAA
CCTGCGATCGACTACTTAAGCGTAGCCTAGGCTTAGGCGAGAAAGTT

Cleavage

GGACGCTAGCTGATG
CCTGCGATCGACTACTTAA

AATTCGCATCGGATCCGAATCCGCTCTTTCAA
GCGTAGCCTAGGCTTAGGCGAGAAAGTT

A: Restriction Endonucleases (enzymes that cleave DNA at specific sites)

The Restriction-Modification System of Bacteria

Foreign DNA

Part I: Restriction
Bacteria produce restriction
enzymes that digest foreign (viral DNA)

Host DNA

Part II: Modification

Bacteria methylate their DNA to
protect it from digestion

 Some enzymes require

cofactors.
Cofactors are split into two
groups:

Enzyme Cofactors

Metals
Coenzymes (small organic
molecules)

Most vitamins are

coenzymes.

Apoenzyme + cofactor = Holoenzyme

Biochemistry 3070 Enzymes

19

Active site
The active site is the region of the enzyme
that binds the substrate, to form an enzymesubstrate complex, and transforms it into
product.

Lock and Key Theory

Enzyme is lock and Substrate is the key.
Substrate structure
must fit into enzymes structure.

Induced Fit Theory

Active site may not fit substrate.
Site must change in order to form the complex.

Enzyme activity can be affected by other

molecules. Inhibitors are molecules that decrease enzyme
activity;
activators are molecules that increase activity.
Many drugs and poisons are enzyme inhibitors.
Activity is also affected by temperature, pressure, chemical
environment (e.g., pH), and the concentration of substrate.
Some enzymes are used commercially, for example, in the
synthesis of antibiotics.
In addition, some household products use enzymes to speed
up biochemical reactions (e.g., enzymes in biological washing
powders break down protein or fat stains on clothes; enzymes
in meat tenderizers break down proteins into smaller

ENZYME ACTIVITY
Structural Studies
Assay Methods
Spectrophotometric methods

Enzyme Applications