ANNALS OF CARNEGIE MUSEUM

15 JulY 2014

Vol. 82, number 3, PP. 231239

FIRST RECORDS OF CRANE FLY SUBGENUS EMODOTIPULA ALEXANDER

(DIPTERA: TIPULIDAE: TIPULA) FROM TAIWAN AND THAILAND,
WITH DESCRIPTION OF NEW SPECIES
Chen W. Young
Associate Curator Emeritus, Section of Invertebrate Zoology,
Carnegie Museum of Natural History, 4400 Forbes Avenue,
Pittsburgh, Pennsylvania 15213-4080
youngc@carnegiemnh.org

ABSTRACT
Two new species of crane flies in the genus Tipula Linnaeus, 1758, subgenus Emodotipula Alexander, 1966 (Diptera: Tipulidae: Tipulinae), are
described from Taiwan and Thailand. Tipula (Emodotipula) lishanensis, new species, is the first representative of the subgenus known from
Taiwan and is closely related to Tipula (Emodotipula) thailandica, new species, here described as the first species of that subgenus from Thailand
based on characters of external male genitalia and on DNA-sequence comparisons. Illustrations of the diagnostic morphological features of the
new species are provided.
KeY Words: Diptera, Emodotipula, new species, Taiwan, Thailand, Tipula, Tipulidae

INTRODUCTION
Emodotipula Alexander, 1966, was first proposed as a subgenus of genus Tipula Linnaeus, 1758, for the type species
Tipula marmoratipennis Brunetti, 1912, recorded from India by original designation. Alexander chose this Oriental
species as type species of Emodotipula even though it is
known from the female only, instead of a Palearctic species as subgenotype, anticipating that more species would
eventually be discovered in the Himalayan region of Asia,
thus the Greek name emodos the Himalaya Mountains.
Prior to the establishment of this subgenus, Savchenko
(1964) had questioned the placement of several species
in the Tipula saginata group of the subgenus Lunatipula,
namely Tipula (Lunatipula) breviscapha Alexander, 1953,
T. (L.) holoteles Alexander, 1924, T. (L.) multibarbata Alexander, 1935, T. (L.) multisetosa Alexander, 1935, T. (L.)
naviculifer Alexander, 1920, and T. (L.) saginata Bergroth,
1891, from Japan, Korea, and Europe. Alexander (1966)
included all those species questioned by Savchenko, plus
incorporating T. fabriciana Alexander, 1966, T. stylostena Alexander, 1961, T. submarmoratipennis Alexander,
1936, and T. vaillantiana Alexander, 1964, chiefly from
the southern Asiatic region (Himalayan Pakistan, Sikkim,
and Assam of India) in Emodotipula when the subgenus
was first proposed. A total of nineteen described species,
including additional species from India (Alexander 1970),
Japan (Alexander 1971), and Europe (Dufour 1991, 2003)
are currently classified in the subgenus Emodotipula
(Oosterbroek 2014) with primarily Palearctic and Oriental
distribution.
The eastern Palearctic distribution of the subgenus extends from Russia to Korea and Japan. The Oriental distribution extends from the Indian subcontinent to the southern provinces of China.
Taxonomic revisions at the species level have in recent
years taken advantage of DNA barcoding as a molecular

tool for recognizing species on the basis of divergences in

mtDNA. This method has not yet been commonly utilized
for study of crane flies (Pilipenko et al. 2012; Young et
al. 2013). The current study attempts to facilitate specimen identification by including DNA analysis with conventional morphological study in order to establish an acceptable standard of species-level divergences useful as a
tool for identification at the species level. Thus a library of
sequences linked to voucher specimens would allow sequences to serve as an identifier for species (Hebert et al.
2003).
A new species of Emodotipula, described below as Tipula (Emodotipula) lishanensis, was collected during recent
research efforts to document the crane fly fauna of Taiwan;
it represents the first record of the subgenus Emodotipula
in Taiwan. Further study of mtDNA, specifically the barcode portion, or Folmer region, of the mitochondrial cytochrome c oxidase subunit 1 gene (CO1), provided data on
possible relationships of the new species with other Emodotipula species. The new species from Taiwan appears to
be closely related to Tipula (Emodotipula) thailandica, a
new species described below from Thailand and collected
by the TIGER (Thailand Invertebrate Group for Entomology Research) project. It represents the first record of this
subgenus in Thailand. Both species are described and illustrated in this paper. The inferred relationships based on
the results from the DNA sequences study are presented in
the Discussion.
Since the male of the subgenotype species (T. marmoratipennis) is still unknown, the subgenus Emodotipula is
recognized primarily based on the characters of the female
and by a combination of male genitalia characters of the
known species: nasus distinct; calypter with group of distinctive setae; spur formula 1-1-2; claws simple in both
sexes without any secondary teeth. Female with small,

AnnAls of CArnegie museum

232

Vol. 82

Table 1: Information on voucher specimens used in CO1 barcode analyses

Sample #

CMNH #

Species

Sex

Region

Year

TIPTW788-11

544541

Tipula lishanensis

male

Taiwan

2011

SATIP1034-10

543512

T. lishanensis

male

Taiwan

2010

TIPTW489-10

544107

T. lishanensis

male

Taiwan

2010

TIPTW787-11

544540

T. lishanensis

female

Taiwan

2011

TIPTW488-10

544106

T. lishanensis

female

Taiwan

2010

TIPTW777-11

544530

T. lishanensis

female

Taiwan

2011

SATIP1503-11

544686

T. thailandica

male

Thailand

2008

EUTIP363-11

Tipula sp.

larva

Switzerland

2008

EUTIP364-11

Tipula sp.

larva

Switzerland

2008

FINTI480-12

T. obscuriventris

male

Finland

2007

FINTI486-12

T. obscuriventris

male

Finland

2006

FINTI654-12

T. obscuriventris

male

Finland

2009

short and fleshy ovipositor; cerci positioned side by side;

hypovalvae small and compressed. Male ninth tergite and
sternite fused into a continuous ring; ninth tergite with or
without median small single or bifid lobe; ninth tergite and
eighth sternite usually with elongated hairs.
MATERIALS AND METHODS
This study is based on field-collected specimens. Specimens from Taiwan were collected in 2010 through 2012.
Hand-collected specimens were taken using insect nets
both during daylight hours and light trap with white cloth
sheet illuminated by mercury vapor lamp at night. Preparation of freshly collected specimens follows that of Byers
(1961:677678). Cyanide jars were used for quick killing
of the collected specimens, which were then stored in individual envelopes allowing for quick drying. Specimens
were later transported to the laboratory where they were
dry-mounted and labeled. Genitalia preparations were
made by soaking the three posterior abdominal segments
in cold 10% KOH overnight. They were rinsed with 10%
acetic acid, then water after removal from KOH. They
were stored in glycerin-filled microvials pinned below the
corresponding specimens. A specimen from Thailand was
collected in a Malaise trap and stored in ethanol. The specimen was later retrieved from ethanol and dried before being mounted and labeled. A single segment of one leg was
collected from each available specimen and stored in individual wells on a micro-plate; each micro-plate has wells
accommodating 95 samples. These micro-plates were sent
to the Biodiversity Institute of Ontario (Guelph, Ontario,
Canada) for DNA extraction and subsequent sequencing
and analysis.
CO1 barcode sequences from twelve specimens belonging to four species of Tipula (Emodotipula) were
obtained and analyses were performed. The resulting

sequence data have been stored in four projects (Tipuloidea of Europe, Tipuloidea of the World, Tipuloidea of Finland, and Tipuloidea of Taiwan) at BOLD (Barcode of Life
Data systems). Table 1 lists all voucher specimens used
in the DNA barcode CO1 analyses with associated BOLD
sample numbers and CMNH specimen numbers when
available.
Images of whole adult specimens were taken. The
descriptions are accompanied by drawings of characters
found useful in segregating the species. Descriptive terminology follows that of McAlpine (1981), Gelhaus (1986,
2005), and Young (1999). The following abbreviations
are used: CMNH, Carnegie Museum of Natural History,
Pittsburgh, Pennsylvania, USA; ESRI, Endemic Species
Research Institute, Jiji, Nantou, Taiwan; NMNS, National
Museum of Nature Science, Taichung, Taiwan. Specimens
studied were deposited in some of the above institutions.
SYSTEMATIC ENTOMOLOGY
Order Diptera Linnaeus, 1758
Family Tipulidae Latreille, 1802
Subfamily Tipulinae, Latreille, 1802
Genus Tipula Linnaeus, 1758
Subgenus Emodotipula Alexander, 1966
Tipula (Emodotipula) Alexander, 1966:244. Type species: Tipula marmoratipennis Brunetti, 1912, by original designation.

Tipula (Emodotipula) lishanensis, new species

(Figs. 12)
Diagnosis.Tipula lishanensis is a large crane fly with
distinct patterned wings. It is the only species of Emodotipula currently described from Taiwan. Their bodies are
proportionally shorter than their elongated wings; legs are

2014

YoungEmodotipula of TAiWAn And ThAilAnd

233

Fig. 1.Tipula (Emodotipula) lishanensis, new species. A, adult male habitus, right lateral view; B, adult female habitus, right lateral view; C, adult
gravid female habitus, right lateral view; D, wing, right dorsal view; E, head and thorax, dorsal view.

equally long and slender in both sexes. Posterior margin

of ninth tergite of male has small medial lobe apically divided into two narrow finger-like lobes covered with small
black spinulae. Female in general agrees with characteristics of male except for the terminal abdominal segments;
the ovipositor is exceptionally small and fleshy.
Description.Based on dry-mounted specimens of both sexes. Body
length: males (Fig. 1A) (N=3) 1314 mm; females (Figs. 1BC) (N=7)
1519 mm. Wing length: 2024 mm.
Head.Brownish yellow, white pollinose on frons. Rostrum brownish yellow, darker laterally; nasus long, slender, one third as long as rostrum. Vertex buffy with conspicuous dark brown median longitudinal line
between eyes (Fig. 1E). Antennae 13 segmented, 4 mm in males, 3 mm in
females; scape and pedicel yellowish; flagellum brown, cylindrical, basally slightly enlarged, subequal in length except apical segment; verticils
about one and a third-length of corresponding segments. Labellum grayish brown, palpi with basal three segments light brown, elongate terminal
segment light yellow.
Thorax.Fig.1E. Grayish brown, weakly pollinose. Pronotum yellowish brown with pair of brown lateral spots. Mesonotal prescutum
gray with four distinct brown longitudinal stripes narrowly margined
with dark brown, intermediate pair completely separated by gray median
vitta; lateral stripes from pseudosutural fovea to posterior edge of scutum,

anterior and lateral margins brown. Scutum with two separate grayish
brown spots on both sides, and groups of dense hairs on either side of
median line. Mediotergite yellowish brown, with long hairs and distinct
blackish brown median stripe, extending from transverse suture to basal
two abdominal segments. Pleura dull yellow, faintly pollinose. Coxae and
trochanters yellow with dense yellow hairs; femora yellow basally, passing
into brownish yellow with distinct dark brown tips; tibiae brown with black
tips; tarsi black. Wings (Fig. 1D) narrow, with long basal petiole; ground
color grayish white, heavily variegated with creamy yellow, pale brown,
and darker brown areas; cells C and Sc yellow; post-arcular darkening in
bases of cells R and M; stigma brownish yellow, with dark spots on both
ends; darkened shades leave four oblique bands on anterior cord, outer part
of cell 1st M2, mid-length of outer radial field, and anal area leading to
posterior wing margin; outer radial and medial cells grayish white, with
restricted dark marginal shades at ends of longitudinal veins. Calypter with
groups of 1012 distinct setae; CuA1 joining vein dm some distance after
branches of M1+2 and M3, dm hexagonal in outline. Haltere yellow, knob
brown. Macrotrichia on R3, sparse on veins beyond cord.
Abdomen.Basal abdominal tergites ochreous yellow passing into
dark brown on terminal segments, tergites with brown longitudinal
stripes near paler lateral margins; basal six sternites yellow, terminal sternites dark brown. Gravid female (Fig.1C) shows longitudinal stripes on
lateral margins of sternites and on lateral membranous areas.
Hypopygium.Figs. 2AD. Posterior border of tergite 9 broad, narrowly transverse with small, median lobe, basally one-sixth width of

234

AnnAls of CArnegie museum

Vol. 82

Fig. 2.Tipula (Emodotipula) lishanensis, new species. AD, male hypopygium: A, tergite 9, left lateral view; B, hypopygium, dorsal view; C, hypopygium, inner gonostylus, left lateral view; D, hypopygium, outer gonostylus, left lateral view; EF, female ovipositor: E, left lateral view; F, dorsal view.
Abbreviation: sl, sacculi laterales. (Scale of AB and EF = 0.5 mm; CD = 0.25 mm)
tergite 9, apically divided into two finger-like lobules with narrow notch,
covered with distinct small black spinulae on all surfaces; a pair of black
tooth-like lobes, each with 45 smaller teeth on outside margin, located
below median lobe (Fig. 2B); single sacculi laterales located on the outer
corner of each black tooth-like lobe; transverse row of long, conspicuous
hairs on nearly entire posterior margin behind median bifid lobe of tergite
9. Outer gonostylus (Fig. 2D) long, broad, gently curved as boomerangshaped blade, apex forming shallow disc with semicircular arrangement
of black spinulae on anterior and medial edges. Inner gonostylus (Fig.
2C) with slender distal beak; next to beak on outside edge, a small forked
lobe, below beak a dark lobe with cluster of stiff hairs; near mid-length on
mesal edge with a rounded paler lobe covered with long hairs; a second
lobe covered with long hairs, slightly larger, near mid-length on ventral
edge. Gonocoxite with two obtuse lobes at point of insertion of gonostyli.

Sternite 8 with outer lateral angles produced into pale bulbous lobes set
with abundant long hairs; median area of sternite truncate with long yellow hairs. Sternite 9 with two apical conical lobes, each lobe bearing at
its mesal tip a pencil of long golden bristles pointed posteriorly (Fig. 2A).
Ovipositor.Figs. 2EF. Tergite 9 narrow, simple. Cerci short, fleshy,
oriented side by side, subequal to length of tenth tergite, apical narrowed
(Fig. 2F). Sternite 9 (fused valvulae) visible, situated above expanded
sternite 8. Sternite 10 (infra-anal plate) visible, nested below cerci. Hypovalves short, sclerotized, compressed, sharply pointed (Fig. 2E). Pair
of soft, pale sac-like sacculi laterales (Tjeder 1979) located on the intersegmental membrane between tergites 9 and 10 (Fig. 2F).

Specimens examined.Type material: Holotype

(NMNS). Verbatim label data (each label is separated

2014

YoungEmodotipula of TAiWAn And ThAilAnd

235

Fig. 3.Tipula (Emodotipula) thailandica, new species. A, adult male habitus, right lateral view; B, head and thorax, dorsal view.

by /): TAIWAN: Taichung County, LiShan Rest Area

at light, 24.2551N; 121.2507E 1929 m 23 March 2011
Chen Young / Carnegie Museum Specimen Number
CMNH-544, 541 / HOLOTYPE Tipula (Emodotipula) lishanensis Young, 2013 [printed red label].
DNA barcode (658 bp) of holotype [TIPTW788-11]
Composition: A (192), G (115), C (98), T (253).
TACTTTATATTTTATTTTTGGGGCTTGGGCTGG
TATAGTAGGAACTTCATTAAGAATTTTAATTCGAG
CAGAACTTGGTCATCCGGGAGCATTAATTGGGGAT
GATCAAATTTATAATGTTATTGTAACAGCTCATG
CATTTATTATAATTTTTTTTATAGTAATACCTAT
TATAATTGGAGGATTTGGAAATTGATTAGTGCCGCT
TATACTTGGTGCACCTGATATAGCTTTTCCTCGAATA
AATAATATAAGTTTTTGAATATTACCTCCTTCTAT
TACTCTTTTATTAGCAAGTAGTATAGTAGAAAATG
GAGCGGGTACTGGTTGAACAGTTTATCCACCCCTAT
CAGCAGGAATTGCCCATACTGGGGCTTCAGTTGATT
TAGCTATTTTTTCATTACATTTAGCTGGAATTTCAT
CAATTCTAGGAGCAGTAAATTTTATTACAACAGT
TATTAATATACGGTCTAGAGGAATTACTTTAGACC
GAATACCCTTATTTGTTTGATCAGTAGTAATTACT
GCAGTATTATTATTACTCTCTTTACCTGTTTTAG
CAGGGGCTATTACAATACTATTAACAGATCGAAATT
TAAATACATCATTCTTTGACCCGGCTGGAGGAGGAGA
TCCTATTTTATATCAACATTTATTT
Paratypes: 2, 7. TAIWAN: Haulian Co.: SiouLin (
), East end of Jin-Ma Tunnel (24.1773N;
121.3727E 2508 m), 14 Nov 2011, Han-Po Chen 1
(CMNH-559,980; ESRI-0808-001060). Nantou Co.:
RenAi Township (), Hsing-Pai-Young (
24.1980N; 121.4326E 1486 m), 12 Mar 2012, Yu-Chuan
Chiu, 1 (CMNH-557,672; ESRI-0808-000540); Endemic
Species res. Ct. (24.1813N; 121.2866E 2939 m) 14 May

2010, Chen Young, 1 (CMNH-543512) [CO1 Barcode

SATIP1034-10]. Taichung Co.: [same locality as holotype] LiShan Rest Area () at light, (24.2551N;
121.2507E 1929m), 23 March 2011, Chen Young,
3 (CMNH-544,530 (callow specimen) [Dissection];
544,540) [CO1 Barcode TIPTW777-11; TIPTW787-11];
(CMNH-562,077 (callow specimen)). B-LuSi (),
Taiwan Forest Res. Inst. (24.2226N; 121.3050E 2149 m)
4 Oct 2010, Chen Young, 1 (CMNH-544,107) [CO1
Barcode TIPTW489-10] [Dissection]; 1 (CMNH544,106) [CO1 Barcode TIPTW488-10]. Kaohsiung
Co.: Taoyuan Township (), TengZhih Station (
23.0848N; 120.7877E 1806 m), 04 May 2011 YuChuan Chiu, 1 (CMNH-576,498; ESRI-2007-000021)
[CO1 Barcode TIPTW1030-12].
Etymology.The name lishanensis emphasizes LiShan (
), the type locality of this new species.
Remarks.Tipula lishanensis is known for both sexes
as confirmed by DNA sequence analysis. It is the first
record of this subgenus recorded in Taiwan and can be
readily separated from all other large body-sized species by its distinctly patterned wings. The other eastern
Asian species, Tipula multisetosa Alexander, 1935, from
Korea shares the following morphological characters of
the male with T. lishanensis: patterned wings; tergite 9
narrowly transverse, caudal margin laterally produced as
two slender black-toothed lobes below median lobe; outer
gonostylus long, broad, gently curved, boomerang-shaped
blade; long hairs along posterior margin of tergite 9, lateral
lobes, and posterior margins on either side of midline of
sternite 8. These two closely similar species can be easily
separated by the detailed structures of the posterior median
lobe on tergite 9 which is undivided in T. multisetosa, but
with two small lobes in T. lishanensis. The collecting data

236

AnnAls of CArnegie museum

Vol. 82

Fig. 4.Tipula (Emodotipula) thailandica, new species, male hypopygium. A, tergite 9 left lateral view; B, dorsal view; C, inner gonostylus, left lateral
view; D, outer gonostylus, left lateral view. Abbreviation: sl, sacculi laterales. (Scale of AB = 0.5 mm, CD = 0.25 mm)

indicate T. lishanensis occurs in March, May, October, and

November in the central and eastern mountain ranges between altitudes of 1806 and 2939 meters.
Tipula (Emodotipula) thailandica, new species
(Figs. 34)
Diagnosis.Tipula thailandica is a medium-sized crane
fly with distinctly patterned wings. It is the only species
of Emodotipula currently described from Thailand. Male
has small abdominal segment 9, with tergite and sternite
complete fused; gonocoxite small and also fused with sternite 9, partially enclosed on the sides by lateral lobes of
sternite 8.
Description.Based on dry-mounted male specimen recovered from
ethanol; body shows minor shrinkage and discoloration. Body length:
male (Fig. 3A) (N=1) 10 mm. Wing length: 20 mm.
Head.Light brownish yellow with white pollen on frons. Rostrum
yellow; nasus long, slender, one third as long as rostrum. Vertex buffy
with conspicuous dark brown median longitudinal line between eyes.
Antennae 13 segmented, 6 mm in length; scape and pedicel yellowish; flagellum brown, cylindrical, basally slightly enlarged, subequal in
length except apical segment; verticils about one and a third the length of
corresponding segments. Labellum grayish brown.
Thorax.Fig. 3B. Grayish brown, weakly pollinose. Pronotum yellowish brown. Mesonotal prescutum grayish brown with four distinct
brown longitudinal stripes narrowly margined with dark brown, intermediate pair completely separated by brownish yellow median vitta; lateral

stripes extended from pseudosutural fovea to posterior edge of scutum,

anterior and lateral margins brown. Scutum brown with groups of dense
hairs on either side of median line. Mediotergite yellowish brown, pollinose, with long hairs and distinct blackish brown median stripe, extending from transverse suture to basal two abdominal segments. Pleura
brownish gray, faintly pollinose. Coxae and trochanters grayish yellow
with dense yellow hairs; femora yellow basally, passing into brownish
yellow with dark brown tips; tibiae brown with narrow black tips; tarsi
black. Wings narrow, with long basal petiole. The colors of the wings
have discolored due to preservation in ethanol for some period. Calypter
with groups of 1012 distinct setae; CuA1 joining dm some distance after
branches of M1+2 and M3, vein dm hexagonal in outline. Haltere yellow,
knob brown. Macrotrichia on R3, sparse on veins beyond cord.
Abdomen.Basal abdominal tergites ochreous yellow passing into
dark brown on terminal segments, tergites with brown longitudinal
stripes near paler lateral margins, distinctly visible on basal first two segments; remaining abdominal segments show signs of shrinkage due to
salvage from having been previously preserved in ethanol.
Hypopygium.Figs. 4AD. Tergite 9 fused with sternite 9; tergite
9 narrow, posterior border of tergite 9 broad, narrowly transverse with
two small, median lobes with narrow notch, covered with distinct small
black spinulae on posterior margins; ventrolaterally to median lobes
situated pair of blackened cushions covered with dense blackened spinulae; single sacculi laterales located on the outer corner of each cushion;
transverse row of long, conspicuous hairs on either side of midline along
margin of tergite 9 (Fig. 4B). Outer gonostylus (Fig. 4D) round-shaped
blade, narrow at base, apex with dense depressed black spinulae on mesal
edges, posterior edges with small black spines. Inner gonostylus (Fig.
4C) with slender, outward beak, next to beak on outside edge with small
dark-pointed lobe, below it about mid-length with distinct smaller tooth;
below main beak an upward larger tooth; near base on mesal edge with a
rounded paler lobe covered with short hairs; a second lobe covered with
long hairs, slightly larger, near mid-length on ventral edge. Gonocoxite

2014

YoungEmodotipula of TAiWAn And ThAilAnd

237

Fig. 5.Maximum likelihood tree based on CO1 sequences from 12 specimens of four species of Tipula (Emodotipula) of Finland, Switzerland, Thailand, and Taiwan. Numerical number on branches indicates bootstrap values after 1000 replications.
small, with single obtuse lobe at insertion of gonostylus. Sternite 8 large,
with outer lateral angles produced into pale bulbous lobes expanding
below and partially covering gonocoxite; lobes set with abundant long
hairs; median area of sternite truncate with long yellow hairs (Fig. 4A).

Female.Unknown.
Specimens examined. Holotype . Verbatim label data
(each label is separated by /): THAILAND: Suphanburi
PhuToei NP. PhuToei Road 14.9553N; 99.4495E 650m 8
Aug 2008 L. Saunbua, Malaise Trap T3136 / Carnegie
Museum Specimen Number CMNH-544,686/ HOLOTYPE Tipula (Emodotipula) thailandica Young, 2013
[printed red label] [Dissection].
DNA barcode (658 bp) of holotype [SATIP1503-11]
Composition: A (192), G (111), C (98), T (257).
TACTTTATATTTTATTTTTGGGGCTTGGGCTG
GTATAGTAGGAACTTCATTAAGTATTTTAATTC
GAGCAGAACTTGGTCATCCGGGAGCACTA
ATTGGGGATGATCAAATTTATAATGTTATCGTAA
CAGCTCATGCATTTATTATAATTTTTTTTATAG
TAATACCTATTATAATTGGAGGATTTGGAAATT
GATTGGTACCTTTAATACTTGGTGCCCCT
GATATAGCATTTCCTCGAATAAATAATATA
AGTTTCTGAATATTACCTCCTTCTATTACCCTTT
TATTAGCAAGCAGTATAGTAGAAAATGGAG
CAGGGACTGGTTGAACAGTTTACCCACCATTATC
GGCTGGTATTGCCCATACTGGAGCTTCAGTT
GATTTAGCTATTTTTTCATTACATTTAGCTG
GAATTTCATCAATTTTAGGTGCAGTAAATTT
TATTACAACAGTTATTAATATACGATCAAGAG
GAATTACTTTAGATCGAATACCTCTATTT
GTTTGATCAGTAGTAATTACTGCAGTATTAT
TATTACTTTCTTTACCTGTTTTAGCTGGAGC

TATTACAATATTATTAACAGATCGAAATT
TAAATACTTCTTTTTTCGATCCTGCAGGAG
GAGGAGATCCAATTCTTTATCAACATTTATTT
Etymology.The name thailandica emphasizes the first
record of the subgenus in Thailand. It represents the southernmost distribution record for this lineage of crane flies.
Remarks.Tipula thailandica is known from holotype
male. It is the first species in this subgenus recorded in
Thailand. The nearest regional relative of this species is T.
hemmingseni Alexander, 1968, from Assam, India. These
two species share several external male genitalic characters, especially the posterior margin of tergite 9 with two
ventrolateral black lobes with cushion densely set with
small black spines. Males of both species have long hairs
along posterior border of tergite 9 and lateral lobes of sternite 8, but can be easily separated by shape of outer gonostylus, which is boomerang-shaped in T. hemmingseni, and
is rounded in T. thailandica. The collecting data indicate T.
thailandica is known from August in forest at an altitude
of 650 meters.
DISCUSSION
This is the second contribution of a faunistic research project dealing with the Tipuloidea of the island of Taiwan.
The results of this study will be used to test hypotheses
concerning the origin and history of the various Taiwanese crane fly lineages. Species delimitation in this study
was based on both male genitalia structures and mtDNA
sequence (CO1) data, which in this study have shown significant congruence with each other. The sequence data
has also facilitated positive association of the sexes when

238

AnnAls of CArnegie museum

both were available for analyses, thus the male and female
associations of the new species, Tipula lishanensis, is rigorously established based on the sequence data.
Dufour (1991) emphasized the existence of sac-like
sacculi laterales (Tjeder 1979) in female species of Emodotipula and confirmed their occurrence in females of the
following species: T. leo, T. obscuriventris, T. saginata,
and T. submarmoratipennis. This study shows that sacculi
laterales are present in both the male and female of T. lishanensis (Figs. 2B, EF), and also in the male of T. thailandica (Fig. 4B). The function of these structures was assumed to involve pheromones, but the fact that both sexes
possess sacculi laterales calls for further investigation on
the subject.
Immature instar associations of the two new species are
unknown. Theowald (1957) described the larva and pupa
of the European T. saginata. The illustrations on the larva
revealed the arrangement of characteristic features around
the spiracular disc, such as subequal spiracular lobes with
setae, median longitudinal streak on the ventral lobes, and
elongated anal papillae; these features bear superficial resemblance to similar structures in several species of the
mostly semi-aquatic subgenera of Tipula (Gelhaus 1986).
The illustration of the frontal lateral view of the pupa indicates a strongly recurved apex of the maxillary palpal
sheath, an extended distal section of the antennal sheath,
and apices of antennal and palpal sheaths widely separated. All these pupal characters suggest Emodotipula resembles most species of advanced lineages within Tipulinae
(Gelhaus and Young 1995). Relevant information regarding the biology of immature T. saginata was also provided
by Savchenko (1965), Hemmingsen (1965), and Theowald
(1967).
Kimura two-parameter distance (K2P; Kimura 1980)
for all specimens of T. lishanensis from this study was
calculated and the intraspecific CO1 divergence is 0.92%.
Molecular analyses were conducted using MEGA version
5 (Tamura et al. 2011) to produce a maximum likelihood
tree for 12 specimens from Taiwan and other biogeographic regions that were grouped together as Tipula (Emodotipula) based on a TaxonID tree from BOLD. Trees were
visualized using the MEGA software (http://www.kumarlab.net). The analyses support the hypothesis that all species of T. (Emodotipula) species with barcodes available
for study form a monophyletic clade (Fig. 5). This tree surmises CO1 divergence and associations among the taxa; it
does not necessarily show phylogenetic relationships.
Geographical distribution of many tipuloid species in
Taiwan and its adjacent areas is inadequately documented.
The fact that few recent surveys have been conducted, existing species have been misidentified, and only a limited
number of specimens are available for examination have
all contributed to the complexity in achieving a comprehensive understanding of the origins of the local fauna.
Current classification (Oosterbroek 2014) of T. (Emodotipula) shows it is essentially a northern hemisphere subgenus and both new species described in this study represent

Vol. 82

the southern boundary distribution for the Oriental Region.

Current study on the crane fly fauna of Taiwan suggests
possible origins and dispersal routes, and diverse distribution patterns of the various species in that island (Young
et al. 2013). Additional results from the investigation in
progress for the other two major lineages of T. (Vestiplex)
and T. (Pterelachisus) in Taiwan may strengthen theories
relating to origins and dispersal routes.
ACKNOWLEDGMENTS
This paper is based on specimens collected while conducting research on
the insect fauna of Taiwan sponsored by the National Science Council of
Taiwan. Thanks are due to George Byers (University of Kansas), Pjotr
Oosterbroek (Amsterdam, Netherlands), and John Rawlins (CMNH) for
suggestions on an early draft of this manuscript; to Virginia Podeniene
for valuable notes on immature instars, and to Fenja Brodo and Sigitas
Podenas for reviewing the manuscript. Special thanks are due to Paul
Hebert, Sarah Adamowicz, and Valerie Levesque-Beaudin for arranging
barcode sequencing at the Canadian Centre for DNA Barcoding in the
Biodiversity Institute of Ontario at the University of Guelph. Appreciation is extended to the support of Barcode of Life Data systems (BOLD)
essential for data management and analysis. Lujza Keresztes (BabesBolyai University, Romania) and Jukka Salmela (University of Turku,
Finland) provided permits for accessing their respective research projects
sequence data at BOLD. I would also like to thank Yu-Chuan Chiu, WenChen Chu, Huai-Sheng Fang, and Han-Chi Hsu from Endemic Species
Research Institute of Taiwan for their assistance in collecting specimens
and gathering data in the field. The research in Taiwan was supported by
National Geographic Society Grant 8726-09, National Science Council
of Taiwan Grant 99WFA0100673 to Chen Young; National Science
Council of Taiwan Grant 1022101010410-130503W2 to Huai-Sheng
Fang. The field research in Thailand was supported by NSF Grant DEB0542864 to Michael Sharkey and Brian Brown.
LITERATURE CITED
AlexAnder, C.P. 1935. New or little-known Tipulidae from eastern Asia
(Diptera), XXIV. The Philippine Journal of Science, 56(4):525562.
. 1966. New or little-known Tipulidae from eastern Asia (Diptera),
LVI. The Philippine Journal of Science, 94(2):235286.
. 1968. New or little-known Tipulidae from eastern Asia (Diptera),
LXI. The Philippine Journal of Science, 95(3):353400.
. 1970. New or little-known species of Asiatic Tipulidae
(Diptera), III. Transactions of the American Entomological Society,
96:307352.
. 1971. Undescribed species of Japanese Tipulidae (Diptera). Part
IV. Transactions of the Shikoku Entomological Society, 11:113.
bruneTTi, e. 1912. Diptera Nematocera (excluding Chironomidae and
Culicidae). Fauna of British India, including Ceylon and Burma,
1:1581.
bYers, g.W. 1961. The crane fly genus Dolichopeza in North America.
University of Kansas Science Bulletin, 42(6):665924.
dufour, C. 1991. The identity of Tipula (Emodotipula) saginata
Bergroth and T. (E.) obscuriventris Strobl, and the description of
Tipula (E.) leo sp. n. from the Sierra Nevada in Spain (Diptera,
Tipulidae). Mitteilungen der Schweizerischen Entomologischen
Gesellschaft, 64:8191.
. 2003. Descriptions of four new species of Tipulidae from the
Alpes-Maritimes in southern France (Diptera, Tipulidae). Bulletin
de la Societe Neuchateloise des Sciences Naturelles, 126:6980.
gelhAus, J.K. 1986. Larvae of the crane fly genus Tipula in North
America (Diptera: Tipulidae). University of Kansas Science
Bulletin, 53(3):121182.
. 2005. Systematics and biogeography of the desert crane fly
subgenus Tipula (Eremotipula) Alexander (Diptera: Tipulidae).

2014

YoungEmodotipula of TAiWAn And ThAilAnd

Memoirs of the American Entomological Society, 46:1235.

gelhAus, J.K., And C.W. Young. 1995. Pupae of the crane fly genus
Leptotarsus (Diptera: Tipulidae) in the New World, with discussion of the monophyly of the genus. Annals of Carnegie Museum,
64:135145.
heberT, P.d.n., A. CYWinsKA, s.l. bAll, And J.r. deWAArd. 2003.
Biological identifications through DNA barcodes. Proceedings of
the Royal Society B, 270:313321.
hemmingsen, A.m. 1965. The lotic cranefly, Tipula saginata Bergroth,
and the adaptive radiation of the Tipulinae, with a test of Dyars law.
Videnskabelige Meddelelser fra Dansk Naturhistorisk Forening,
128:93150.
mCAlPine, J.f. 1981. Morphology and terminology adult. Pp. 963,
in Manual of Nearctic Diptera. Volume 1 (J.F. McAlpine, B.V.
Peterson, G. E. Shewell, H.J. Teskey, J.R. Vockeroth, and D.M.
Wood, eds.). Agriculture Canada Monograph.
KimurA, m. 1980. A simple method for estimating evolutionary rate
of base substitutions through comparative studies of nucleotide
sequences. Journal of Molecular Evolution, 16:111120.
oosTerbroeK, P. 2014. Catalogue of the Craneflies of the World,
(Diptera, Tipuloidea: Pediciidae, Limoniidae, Cylindrotomidae,
Tipulidae). Available from: http://ip30.eti.uva.nl/ccw/ (accessed 1
July 2014).
PiliPenKo, V.e., J. sAlmelA, And e.J. VesTerinen. 2012. Description
and DNA barcoding of Tipula (Pterelachisus) recondite sp. n. from

239

the Palaearctic region (Diptera: Tipulidae). Zookeys, 192:5165.

sAVChenKo, e.n. 1964. Crane-flies (Diptera, Tipulidae). Subfamily
Tipulinae, Genus Tipula L., 2 Fauna USSR, N.S. 89, Nasekomye
Dvukrylye [Diptera], 2(4):1503 (in Russian).
TAmurA, K., d. PeTerson, n. PeTerson, g. sTeCher, m. nei, And s.
Kumer. 2011. MEGA5: Molecular Evolutionary Genetics Analysis
using Maximum Likelihood, Evolutionary Distance, and Maximum
Parsimony Methods. Molecular Biology and Evolution, 28:2731
2739.
TheoWAld, br. 1957. Die Entwicklungsstadien der Tipuliden (Diptera,
Nematocera) insbesondere der west-palaearktischen Arten.
Tijdschrift voor Entomologie, 100:195308.
. 1967. Familie Tipulidae (Diptera, Nematocera). Larven und
Puppen. Bestimmungsbucher zur Bodenfauna Europas, 7:1100.
TJeder, b. 1979. Presence of abdominal sacculi laterales in females
of the subgenus Emodotipula (Diptera, Tipulidae). Entomologica
Scandinavica, 10:241-243.
Young, C.W. 1999. New species and immature instars of the crane flies
of subgenus Tipulodina Enderlein from Sulawesi (Insecta: Diptera:
Tipulidae: Tipula). Annals of Carnegie Museum, 69(2):8190.
Young, C.W., Y. li, W.-C. Chu, And f.-s. fAng. 2013. Review of
Acutipula crane flies of Taiwan: with description of new species and
immature instars (Diptera: Tipulidae: Tipulinae: Tipula). Annals of
Carnegie Museum, 82(2):115148.