Professional Documents
Culture Documents
Topics Covered
Background Definitions Effects Advantages Disadvantages Evidence Future Direction Questions
Background
Bt Brinjal, Indias (and the worlds) first genetically modified food crop has been temporarily stopped in India, thanks to a massive grassroots campaign. Bt Cotton, however, is being cultivated in many parts of India. Benefits are doubtful, though Doubts exist about its productivity, and has been implicated with negative effects, like resistant test, high water consumption, farmer suicides, etc.
Definition
What does Bt stand for? Bt stands for Bacillus thuringiensis, which is a natural soil bacteria, which secretes a toxin that is deadly to two pests - fruit and shoot borer (FSB, Leucinodes orbonalis) and fruit borer (Helicoverpa armigera).
Eggplant borer : Helicoverpa armigera Cotton bollworm: Leucinode s orbonalis
Definition
What is a genetic modification? Insertion of Bt gene in the Brinjal genetic code
But is only the gene introduced? No, a PROMOTER and an antibiotic resistance MARKER GENE are also introduced!
Definition
What is a gene
What is genetic modification How is it done Potential effects
Definition
Gene part of a chromosome Looks like AACCGGCCCTT TTACGTTATTA
Chromosomes
Genes
Definition
Genes produce protein
Protein Nucleus Genetic material
Cell
The genes in the genetic code have the template for creating the proteins Proteins (extracellular, cell surface, or intracellular) confer behaviour the phenotype
Definition
Protein production occurs at specific times and places GENE EXPRESSION: A gene creates proteins only at specific times and locations in an organism, and in very tightly regulated amounts. Example: Pancreatic cells have genes for producing the insulin protein, and so do cells in the eye.
Specific location Specific amount Specific time
Definition
Regulation How does regulation occur? For a gene to be expressed, specific chemical factors need to bind to a PROMOTER region and other regulatory region in the genetic code upstream of the gene.
Regulatory region
Gene
Promoter
Definition
Regulatory region Therefore a gene is expressed only when specific agents bind to promoter and regulatory regions at specific time and at specific cell types (eye cell vs pancreatic cell). Though promoter sequence are known, information about regulatory regions and what factors binds to them is mostly unknown.
Definition
BT Gene insertion A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV) promoter) The promoter is so powerful that it keeps the BT gene expression turned on at full volume at all times in BT Brinjal! This could lead to metabolic stress as the plant has to keep producing this toxin despite the external conditions.
Definition
BT Gene insertion A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV) promoter)
ACTGTCTATGTA + TACGTATAATGGTAGATTTATATGGG
Insertion point Gene
TAACTGTCTATGTACGTATAATGGTAGATTTATATGGG
Promoter
Definition
Insertion process The insertion is carried out using an mobile microbial DNA which infects the host cell (for dicotyledons like lugumes, or by a gene gun (gold pellets carrying fragments of DNA), either which performs the random insertion in some of the target cells.
Microbial Vector Gene gun Target cell Target cell Target cell
Definition
BT Gene insertion Microbial Vector has the genetic sequence of toxin present in a part of an insertion sequence.
AACCGTGGTGGGTCCCAATTAGGGTTACCGGGG
The gene gun shoots gold pellets having the sequence of interest
Gold Pellet
AACGTTCCGTT
Definition
Result of insertion process
Target cell
Target cell Target cell
To identify the successfully converted viable cells, an antibiotic resistance marker gene IS ALSO INSERTED
Definition
Resistance marker gene
Insertion sequence
AACCGGTTGGTTGGGTTTGGGGGGGCCGGTTAAA
Resistance marker gene
Promoter Sequence
Bt gene
The target cells which successfully incorporate the insert sequence are selected on the basis of their resistance to an antibiotic
Definition
Result of insertion process
Target cell
Antibiotic
Target cell
Target cell
Target cell
Definition
Create final hybrid variety
Primary transformant
bacterial plasmid DNA (pMON10518) Backcross
Final variety
Bt MHB
Final variety needs high amounts water and fertilisers .
Effects
Random insertion Jumping gene (plants) Jumping gene (animals) Antibiotic marker
Transformation-induced unexpected changes might lead to unexpected production of toxins, allergens, carcinogens (rotenone Parkinsons) or teratogens in the transformed cells. Domingo, J.L., Toxicity Studies of Genetically Modified Plants, Critical Rev Food Sc and Nutrition 47: 721-33 (2007) Transgene-vector recombinant DNA had the capacity of jumping into' alien species, it could also jump out' of a transgenic crop and jump into' another species causing gene contamination. Evidences are now available that show that DNA from GM plants can survive in the human gastrointestinal tract.
Netherwood,T. et al Nature Biotechnology 22, 204 - 209 (2004)
Advantages?
Yield not shown to increase in Bt Cotton or GM Soy
Mahyco admits unable to control pests in Gujarat with Bt Cotton
Disadvantages
Could lead to genetic contamination
Farmers suicides have doubled in Bt cotton belt in Vidarbha
Evidence
Long terms lab tests on rats have all shown illeffects Monsanto made tests only on few rats (10) for only 3 months
Evidence
Non-target effects of GM food crops 21 reported harmful environmental effects; 44 reported unexpected changes in plant physiology; 20 reported unpredicted changes in plant morphology; 6 reported a decrease in the food or feed quality 4 reported scrambling of both the transgene and host DNA
Effect on animals (a) Arpad Putszai paper in the Lancet, showed the unpredicted changes (b) in the gastro-intestinal mucosa of rats fed with GM potato; (c) A 90-day internal company study on rats fed with MON863 Bt-maize showed decreased body-weight and severe toxic effects in the liver and kidneys; (c) a 20-week feeding study by the Austrian Federal Ministry of Health revealed lower fertility and reduced birth weight in mice fed with Bt-maize; (d) a study carried out in the Italian governments National Institute of Research on Food and Nutrition showed that very young and old mice fed with Btmaize (MON810) for 90 days were immunologically compromised
Future Directions
Do we really need this?
We already have varieties Negative effects on farmers
Danger to consumers
Benefit to corporations
Future Directions
Tissue specific expressions
(instead everywhere like root)
Chlorpolast transformation
(instead of nuclear transformation)
Future Directions
GM potato, tomato, rice, everything in the waiting Control of food for the world
References
Questions or comments? Crop management yield increase of 28% with better crop management Yield increase 3-4% on average
Questions
Questions or comments?