Journal of Cereal Science 60 (2014) 323e330

Contents lists available at ScienceDirect

Journal of Cereal Science

journal homepage: www.elsevier.com/locate/jcs

The co-operative interaction of puroindolines in wheat grain texture

may involve the hydrophobic domain
Rebecca L. Alfred a, Enzo A. Palombo a, Joseph F. Panozzo b, Mrinal Bhave a, *
a
b

Faculty of Science, Engineering and Technology, Swinburne University of Technology, PO Box 218, Melbourne, Victoria 3122, Australia
Department of Environment and Primary Industries, Horsham, Victoria 3400, Australia

a r t i c l e i n f o

a b s t r a c t

Article history:
Received 21 March 2014
Received in revised form
29 May 2014
Accepted 5 June 2014
Available online 5 July 2014

The puroindoline genes are causatively associated with wheat grain hardness, a commercially signicant
property. The proteins puroindoline (PIN) A and B are both required in their wild-type (WT) to impart
soft grain texture, and absence of/mutations in either/both PIN(s) results in hard wheat. However, there
is no biochemical clarity yet that explains this interdependence. This work critically analyses the roles of
the tryptophan-rich domain (TRD), the little-known hydrophobic domain (HD), and certain other residues, in the physical associations of PINs. Site-directed mutagenesis-PCR was used to delete the TRD or
HD and introduce an Arg39Gly substitution in PINA. The PINB-D1c mutant (Leu60Pro) was also investigated. The yeast two-hybrid system was used to assess the proteineprotein interactions (PPI) of proteins. The TRD deletion or Arg39Gly substitution in PINA did not adversely affect its PPI, while deletion of
HD resulted in a signicant reduction. No effect on PPI was observed for Leu60Pro PINB. The results of
this expression system strongly suggest that the HD is essential (but not sufcient) in higher-order associations of PINs. We propose a two-event model that explains the co-operative action of the PINs and
why mutations outside the TRD may alter grain texture.
2014 Elsevier Ltd. All rights reserved.

Keywords:
Grain texture
Proteineprotein interaction
Puroindolines
Tryptophan

1. Introduction
The two puroindoline genes of common wheat have been causatively associated with grain texture, a commercially highly signicant property. The putative full-length PINA and PINB proteins,
encoded by the wild-type (WT) alleles Pina-D1a and Pinb-D1a, are
148 amino acids long helicoid proteins that exhibit a unique
tryptophan-rich domain (TRD) comprised of 5 Trp residues in PINA
but only 3 in PINB (Gautier et al., 1994). The PINA and PINB are lipidbinding proteins and both must be present together in their wildtype forms to impart soft grain texture, and the deletions of, or
diverse mutations in, either or both Pin gene(s) result in hard
common wheats (reviewed in Bhave and Morris, 2008a; NadolskaOrczyk et al., 2009; Pauly et al., 2013). The functionality of PINs has
been associated with their lipid-binding properties, the TRD being

Abbreviations: Gsp-1, grain softness protein-1 gene; GSP, grain softness protein;
HD, hydrophobic domain; Pin, puroindoline gene; PIN, puroindoline protein; TRD,
tryptophan rich domain.
* Corresponding author. Faculty of Science, Engineering and Technology, Swinburne University of Technology, PO Box 218, John Street, Hawthorn, Victoria 3122,
Australia. Tel.: 61 3 9214 5759; fax: 61 3 9819 0834.
E-mail address: mbhave@swin.edu.au (M. Bhave).
http://dx.doi.org/10.1016/j.jcs.2014.06.001
0733-5210/ 2014 Elsevier Ltd. All rights reserved.

considered the most important domain. The Gly46Ser and

Trp44Arg mutations in the TRD of PINB led to signicant reduction
in interactions with anionic phospholipids and may affect their
antimicrobial properties and inuence the degree of penetration of
both PINA and PINB into anionic lipids (Clifton et al., 2007). Residues in the TRD were also found to be involved in binding to the
yeast cell plasma membrane (Evrard et al., 2008), and in planta
mutagenesis conrmed that mutations causing signicant increases in grain hardness were all located within/near the TRD of
PINA or PINB (Feiz et al., 2009a). Causative associations of PINs with
increases in seed-bound polar lipids, and the ability of each PIN to
associate at the starch surface (Feiz et al., 2009b) and direct binding
of the TRD to the starch granule surface (Wall et al., 2010) have been
shown. Further, the two WT PINs were found to act co-operatively
to prevent break-down of the polar lipids in soft grains, mutations
in either gene leading to higher polar lipid degradation (Kim et al.,
2012a).
Despite the above effects on grain texture, the in-vivo biological
roles of PINs are still unclear, although evidence is gathering to
support the hypothesis (Gautier et al., 1994) that they may have
roles in defence against microbial pathogens. Puried PINs
exhibited in vitro antimicrobial activity and transgenic introductions have also led to in-vivo resistance to fungal pathogens

324

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

(Kim et al., 2012b; other work reviewed in Bhave and Morris,

2008b). The TRD of PINA (FPVTWRWWKWWKG-NH2) was identied as the antimicrobial domain by testing the activity of a synthetic peptide PuroA, its Arg (equivalent of Arg-39 in mature
protein) being important in this role (Jing et al., 2003), as conrmed
in our work (Phillips et al., 2011).
While the above studies conrm some key properties of PINs,
certain other observations have escaped close scrutiny and their
biochemical explanations are unresolved. For example, some of the
hardness-associated mutations reside outside the TRD, such as the
Pinb-D1c (Leu60Pro), which affects the grain hardness to the same
extent as Pinb-D1b (Gly46Ser) (Lillemo and Morris, 2000; Takata
et al., 2010). Ikeda et al. (2005) reported no observable mutant
PINB-c protein and suggested it may not be able to bind to lipids
(leading to its instability). This raises the question whether the
lipid-binding properties of PINs are restricted to the TRD alone.
Further, both PINs are required together in their WT forms, and act
co-operatively to impart the soft grain texture (Swan et al., 2006;
Wanjugi et al., 2007). Clifton et al. (2007) showed that the PINB
mutants Gly46Ser and Trp44Arg each exhibited reduced lipid
binding, and inuenced the degree of penetration of both PINA and
PINB into anionic lipids. This suggests these mutations may affect
the cooperation of the proteins, the nature of this being currently
unknown. Thirdly, the minor contributions of some Pinb-2 alleles to
grain texture (Wilkinson et al., 2008; Chen et al., 2013) suggest that,
despite having only two Trp residues in the TRD, the PINB-2 proteins may retain certain residues/domains required for starch
granule association, or that PINA and/or PINB may co-operate with
PINB-2s also. It is thus critical to gain a comprehensive understanding of the higher order interactions in PIN protein family, to
fully elucidate and exploit their functionality for crop properties.
We have previously shown in vivo proteineprotein interactions
(PPI) between PINA and PINB, using the yeast two-hybrid system
(Ziemann et al., 2008). However, it is unclear whether the TRD
alone can be credited for these, or whether other motifs/residues
may be involved. The present work strategically queries the involvements of the TRD, a separate hydrophobic domain, as well as
certain residues associated with natural hardness mutations, in the
PPI of PIN proteins.
2. Experimental
2.1. PINA structure modelling
The sequence of the putative mature PINA protein (Genbank
ABD72477) (Gautier et al., 1994) was used as template for homology
modelling using SWISS-MODEL (http://swissmodel.expasy.org/).
The Kyte-Doolittle Hydropathy Plot was generated with Bioedit v
7.1.11 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html).
2.2. Primer design for site-directed mutagenesis of PINA by inverse
PCR (SDM-PCR)
Primers were designed as per Qi and Scholthof (2008), as
detailed below and shown in Fig. 1. The overall proteineprotein
interaction studies strategy is summarised in Fig. S1 and Fig. S2. An
Arg in the peptide PuroA (representing Arg39 in TRD of mature
PINA) is important for its antimicrobial activity (Jing et al., 2003;
Phillips et al., 2011). Hence, to test its role in PPI, it was
substituted with Gly by a C to G change. Primers PINAR39G-F (50
GATTTCCCGGTCACCTGGGGTTGGTGGAAATGGTGG
30 )
and
PINAR39G-R (50 CCACCATTTCCACCAACCCCAGGTGACCGGGAAATC
30 ) were designed such that the 50 complementary region of each
primer included the substitution and its 30 complementary region
anked the target (Fig. 1). For deleting the 39 base pair (bp) section

encoding the TRD of PINA (residues 34e46 in the mature protein)

to create the mutant PINADTRD, primers PINADTRD-F
(50 atgaaggatGGTTGTCAAGAGCTCCTTGG 30 ) and PINADTRD-R (50
ttgacaaccATCCTTCATCGTTGAGCATC 30 ) were designed such that
each primer consisted of (i) a 50 complementary region of 18 nucleotides (9 nucleotides directly upstream of the deletion target
and 9 nucleotides directly downstream of it); and (ii) an 11
nucleotide 30 complementary region adjacent to the target, for
stable primer binding (Fig. 1). Based on homology modelling, a
33 bp section encoding a putative HD in PINA (residues 75e85 in
the mature protein) was deleted to create the mutant
PINADHD, using similarly designed primers PINADHD-F
(50 caggggtcaCAGCGTGATCGGGCAAGCAA 30 ) and PINADHD-R
(50 atcacgctgTGACCCCTGGATGATGTTGC 30 ).
2.3. SDM-PCR and isolation of mutant clones
The 363, 360 and 369 bp sections of WT Pina-D1a (Genbank
DQ363911) and Pinb-D1a (DQ363913) and the related gene Gsp-1
(CR626934), encoding the putative mature PINA, PINB and GSP-1,
respectively, were previously cloned from a soft wheat cultivar
into the yeast two-hybrid bait (pGBKT7) and prey (pGADT7)
vectors using primers with appropriate restriction sites
(Table S1). These constructs, designated PINA-bait, PINB-bait,
PINA-prey, PINB-prey, GSP-bait and GSP-prey (kindly donated by
Dr A Ramalingam, Swinburne University of Technology)
(Ramalingam, 2012) were transformed into E. coli JM109 and
their plasmids (PINA-bait and prey) used as templates for SDMPCR using the QuikChange II kit (Stratagene, USA), which utilises inverse-PCR with primers bearing mutations (Fig. 1; Fig. S1).
Each 50 mL SDM-PCR comprised of 1 mL (~200 ng) of a plasmid
template, 1 mL of each primer (125 ng), 1 mL dNTP mix (10 mM),
5 mL 10X buffer and 1 mL (2.5 U) PfuUltra HF DNA polymerase. The
PCR conditions were initial denaturation (95  C, 30s), then 18
cycles of denaturation (95  C, 30 s), primer annealing (55  C, 30 s)
and extension (68  C, 45 s), to generate plasmids with mutated
sequences and staggered nicks (at 50 ends of primers). The PCR
products were treated with 1 mL (20 U) of Dpn I (specic for
(hemi) methylated 50 Gm6ATC 30 ) to specically digest the original plasmid template (as E. coli JM109 allows dam methylation).
The digests were transformed into E. coli XL-1 Blue (assumed to
carry out nick-repair). Colony-PCR was conducted using vectorbased primers T7 (50 TAATACGACTCACTATAGGG 30 ), with
30 BDpGBKT7 (50 TTTTCGTTTTAAAACCTAAGAG 30 ) or 30 ADpGADT7
(50 AGATGGTGCACGATGC ACAG 30 ) to test for inserts. The halfcolonies of interest were cultured, their plasmids sequenced,
and selected clones transformed into appropriate yeast strains for
PPI studies.
2.4. Cloning of gene section encoding PINB-D1c
Genomic DNA puried from seedlings of Triticum aestivum
landrace IRAQ 42 encoding the hardness allele Pinb-D1c (Pickering
and Bhave, 2007) was used to amplify the full-length gene with
primers PINB-D1F (50 ATGAAGACCTTATTCCTCCTA 30 ) and PINB-D1R
(50 TCACCAGTAATAGCCAC TAGGGAA 30 ). 100 ng of these products
were used for 2nd round PCR to amplify the 360 bp section
encoding mature PINB-D1c, with primers PINB-Y2HF (50 AAAGAATTCGAAGTTGGCG 30 ) and PINB-Y2HR (50 AAAGGATCCTCACCAGTA 30 ) (underlines indicating EcoRI or BamHI restriction sites).
The 2nd round products were puried, double-digested with
EcoRI BamHI, ligated to similarly digested pGBK-T7 and pGAD-T7
and transformed into E. coli JM109. The plasmids were sequenced
and transformed into yeast strains for PPI studies.

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

325

Fig. 1. Design of primers for siteedirected mutagenesis in the putative PINA protein. A. Section of PINA containing the TRD (in grey), showing the alignment of the forward
(PINAR39G-F) and reverse (PINAR39G-R) primers. The point mutation to be introduced is underlined. B. Section of PINA containing the TRD, showing the alignment of the forward
(PINADTRD-F) and reverse (PINADTRD-R) primers. PINADTRD-F has 9 nucleotides directly upstream of the 50 end of the TRD, 9 nucleotides directly downstream of the 30 end of the
TRD, and a further 11 nucleotide 30 region (grey). Likewise, PINADTRD-R has 9 nucleotides directly upstream of the 50 end of the TRD, 9 nucleotides directly downstream of the 30
end of the TRD, and a further 11 nucleotide 30 region (grey). C. Section of PINA containing the HD, showing the alignment of the forward (PINADHD-F) and reverse (PINADHD-R)
primers. PINADHD-F has 9 nucleotides directly upstream of the 5 end of the HD, 9 nucleotides directly downstream of the 30 end of the HD, and a further 11 nucleotide 30 region
(grey). Likewise, PINADHD-R has 9 nucleotides directly upstream of the 50 end of the HD, 9 nucleotides directly downstream of the 30 end of the HD, and a further 11 nucleotide 30
region (grey).

2.5. DNA sequencing

Sequencing was carried out using the Big Dye Terminator (BDT)
v3.1 (Applied Biosystems, USA) and separated on an AB3730xl 96
sequencer at the Australian Genomic Research Facility (AGRF). The
chromatograms were inspected and any base calls corrected using
Bioedit v 7.1.11 (http://www.mbio.ncsu.edu/BioEdit/bioedit.html)
and multiple sequence alignments performed by Bioedit.

YSD-WLAH3-amino-1,2,4-triazole (3AT) to select for 2n cells and

assess the strength of PPI, respectively. All plates were incubated at
30  C for 4e5 days. The b-galactosidase reporter activity in mated
cultures was measured by detection of ortho-nitrophenyl (ONP)

2.6. Analysis of proteineprotein interactions (PPI) of wild type and

mutant PINs and GSP-1
The yeast two-hybrid system, which allows detection and
quantitation of physical interactions of the fusion proteins
expressed from inserts in the bait (pGBK-T7) and prey (pGAD-T7)
vectors
(www.clontech.com/xxclt_ibcGetAttachment.jsp?
cItemId17597), was applied as described previously (Ziemann
et al., 2008). All clones in pGBK-T7 and the empty vector (ev)
were transformed into Saccharomyces cerevisiae strain AH109 and
selected on yeast synthetic dened (YSD) medium decient in Trp
(YSD-W). The clones in pGAD-T7 and ev were transformed into
S. cerevisiae Y187a and selected on YSD-Leu (YSD-L). Different pairs
of bait and prey transformants were then mated. 100 mL of mated
cultures were spread on YSD-Trp-Leu (YSD-WL) to select 2n cells,
and 5 mL replica-spotted on YSD-Trp-Leu-Ala-His (YSD-WLAH) and

Fig. 2. Deduced tertiary structure of PINA using SWISSeMODEL. The sequence of the
putative mature PINA (Gautier et al., 1994) (Genbank ABD72477) was used as template
for homology modelling of its tertiary structure using SWISS-MODEL (http://
swissmodel.expasy.org/). The TRD (Phe34 to Gly46) is located as an extended loop
between a-helix 1 and 2 and the putative hydrophobic domain (HD) (Ile75 to Phe85) is
located as a smaller loop between a-helix 3 and 4.

326

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

and calculated as Miller units 1000  OD420/(t  V  OD600)

(where t time (min) after incubation, V 0.1 mL  concentration
factor), as described (Ziemann et al., 2008). The data were analysed
statistically by Students unpaired T-Test.
3. Results
3.1. Construction of clones expressing mutated PINA and PINB
proteins
The Kyte-Doolittle Hydropathy Plot identied a strong hydrophobic domain (HD) at positions 75e80 in the putative mature
PINA (Fig. S3). The tertiary structure prediction by SWISS-MODEL
showed the TRD (residues 34e46 in the mature protein) formed
an extended loop between a-helices 1 and 2, and the HD formed a
distinct smaller loop between a-helices 3 and 4 (residues 75e85 in
the mature protein) (Fig. 2). Three approaches were then employed
to study the role of these regions in any physical interactions of PIN
proteins: (i) substitution of Arg39; (ii) deletion of the TRD and
retention of HD; (iii) retention of the TRD and deletion of HD. SDMPCR of the WT PINA-bait and PINA-prey clones with the primers
PINAR39G-F and PINAR39G-R, followed by DpnI digestion, transformation into E. coli XL1-Blue and plasmid sequencing conrmed
the Arg39Gly substitution in a number of clones (Fig. S4). SDMPCRs with PINADTRDF PINADTRDR or PINADHD-F PINADHDR led to clones with smaller inserts (Fig. S5), DNA sequencing
conrming the 39 bp TRD and 30 bp HD deletions (Fig. S4). The
efciency of deletion mutagenesis seemed more limited than the
substitution. The clone encoding the mature PINB from IRAQ 42
(Pickering and Bhave, 2007) conrmed the PINB-D1c (Leu60Pro)
mutation (Fig. S6). The various bait transformants in S. cerevisiae
AH109 and prey transformants in Y187a enabled a number of
mating (2n cultures), which were plated on YSD-WLAH and YSDWLA3AT selective media to assess the relative strength of PPIs.
The lack of growth and the marginal b-galactosidase reporter activity of all 2n controls comprising one or both ev(s) (Figs. S7eS9)
indicated no false-positive interactions, except one unique case (see
below). Thus any notable colony growth and enzyme activity would
indicate genuine PPI between the fusion proteins expressed by the
two vectors. The average of enzyme activity units of all relevant ev
controls was subtracted from that for each test pair to obtain corrected values. All PPI results are presented below as bait/prey pairs.
3.2. Interactions of the wild type PINA, PINB and GSP-1
The colony growth was much stronger when PINA was
expressed in the bait vector, i.e., for PINA/PINA, PINA/PINB and
PINA/GSP-1 cultures (Fig. S7A, spots 8, 9, 10), while the PINB-bait
pairs PINB/PINA, PINB/PINB and PINB/GSP-1 showed moderate
growth (spots 14, 15, 16). However, all cultures grew weakly on
YSD-WLAH3AT (Fig. S7B), indicating relatively weak PPI (weak
induction of the HIS3 reporter). Quantications of the interactions
by the b-galactosidase reporter assays (all data corrected for relevant ev controls; see above) indicated that PINA/PINA (5.13 Miller
units) and PINA/PINB (9.3 MU) interactions were much stronger
than PINB/PINA (1.59 MU) and PINB/PINB (2.59 MU) (Fig. 3,
Table S2). The WT PINA and PINB pairs were also set up in all
further experiments for comparative purposes. While their absolute values varied (Tables S3, S4) possibly due to the number of
samples in a set and rapid colour development, certain trends were
consistent: (i) interactions of PINA-baits, i.e., PINA/PINA and PINA/
PINB, were much stronger than those of PINB-baits, PINB/PINA and
PINB/PINB; (ii) PINA/PINB interactions were at least moderately
stronger than PINA/PINA; (iii) PINB/PINA and PINB/PINB interactions were similar to each other and signicantly weaker (30%)

Fig. 3. begalactosidase reporter activity of the interactions of PINAeR39G and

PINADTRD with wildetype PINA, PINB and GSP-1 proteins. The b-galactosidase activity,
presented in Miller units (MU), is the mean of two independent experiments, each
reaction in an experiment being conducted in triplicate. The values shown have been
corrected for the relevant empty vector control activities.

than the former two. Importantly, expression of PINA in the bait

and PINB in prey orientation seemed to enable their optimal associations. The GSP-1-bait showed weak binding with PINB (similar
in strength to PINB/PINA), but little with PINA (0.09 MU). In general
GSP-1, appeared to be the weakest interactor (Table S2).
3.3. Interactions of the PINAR39G mutant
All pairs with PINAR39G as bait or prey showed strong growth
on YSD-WLAH (Fig. S7A, spots 11, 17, 23, 26e30, 35). Interestingly,
the PINAR39G-bait pairs showed stronger growth on YSDWLAH3AT than PINA-baits, and all PINR39G-preys showed
moderate growth, except with PINB and GSP-1 (spot 17, 23) (as
above) (Fig. S7B). The enzyme assay results (Fig. 3, Table S2) for
PINAR39G-bait with PINA (13.31 MU), PINB (14.07 MU), GSP-1
(2.27 MU) or itself (12.76 MU) were all signicantly higher
(P 0.023, 0.027, 0.040, 0.003, respectively) than for PINA/PINA
(5.13 MU), PINA/GSP-1 (1.36 MU) or PINA/PINB (9.3 MU). Reporter
induction by PINB/PINAR39G was also higher than PINB/PINA
(P 0.036). Thus the strengths of PINAR39G interactions seemed to
be comparable to PINA.
3.4. Interactions of the PINADTRD mutant
The PINADTRD protein expressed in the bait orientation showed
strong growth with all partners on YSD-WLAH, similar to the WT

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

PINA-bait (Fig. S7A, spots 32e36), and stronger growth on YSDWLAH3AT than PINA-baits (Fig. S7B, spots 8, 9, 10). With
PINArTRD as prey, strong growth was noted with PINA, GSP-1 and
PINAR39G (Fig. S7A, spots 12, 24, 30), weak with PINB (spot 18), and
none on YSD-WLAH3AT. Interestingly, one control, the
PINADTRD/ev, exhibited strong growth (Fig. S7A, spot 21) and
enzyme assay results (10.9 MU) (Table S2), suggesting an interaction of the mutant fusion protein with an unknown protein encoded by pGADT7. This value was included in the correction average
applied to all relevant samples. No false-positive growth was seen
for ev/PINADTRD or any other controls. The enzyme activity values
conrmed the stronger induction by PINADTRD baits paired with
PINA (16.25 MU; P 0.005), PINB (20.43 MU; P 0.003), GSP-1
(8.18 MU; P 0.001) and self (12.46 MU; P 0.001), compared to
PINA/PINA and PINA/PINB (Fig. 3, Table S2). As prey, the value for
PINB/PINADTRD (1.82 MU) was low, similar to PINB/PINA (1.59 MU;
P 0.125), and PINA/PINADTRD (4.84 MU) was comparable to PINA/
PINA (5.13 MU; P 0.072). Thus PINADTRD as bait seemed to have
retained the strong activity of WT PINA baits, and stronger reactions with PINB-prey than with itself. Due to its weak interactions, GSP-1 was not used as an interacting partner in further
work.

327

(8.52 MU) (P 0.06) and PINB/PINADHD (2.23 MU) to PINB/PINA

(2.42 MU) (P 0.12). The results conrmed PINA as bait to be a
more efcient partner, and importantly, indicated strongly that the
HD deletion in this orientation has signicant effect on the binding
ability of PINA.
3.6. Interactions of the PINB-D1c mutant
For PINB-D1c as bait, the colony growth (Fig. S9A, spots 10e11)
was the same as for PINB/PINA and PINB/PINB (spots 7, 8), and the
PINB-D1c-prey pairs (spots 6, 9) also compared well with PINA/
PINB and PINB/PINB (spots 5, 8). The enzyme assay (Fig. 5, Table S4)
conrmed that PINB-c was more efcient as prey, as noted for PINB.
The PINA/PINB-D1c activity (3.84 MU) was moderately stronger
than PINA/PINB (3.13 MU; P 0.008) and much stronger than PINBD1c/PINA (0.91 MU; P 0.001) or PINB/PINA (0.78 MU; P 0.001).
Its self-association (1.39 MU) was also 2-fold higher than PINB/PINB
(0.53 MU; P 0.009). Overall, the Pro60Leu substitution in PINB did
not seem to adversely affect its interactions with other proteins.
4. Discussion

The PINADHD-bait pairs with PINA, PINB and itself showed

strong growth for YSD-WLAH (Fig. S8A; spots 14e16), while the
prey pairs with PINA and PINB showed moderate growth (spots 8,
12). All PINADHD-bait pairs grew strongly on YSD-WLAH3AT
(Fig. S8B), while the prey pairs with PINA and PINB showed weak
or no growth. The PINADHD in bait orientation thus seemed a
stronger interactor than as prey, as noted above for PINA and
PINADHD. The enzyme assays gave some interesting results. The
PINADHD-bait pairs with PINA (3.78 MU; P 0.001) or PINB (3.89
MU; P 0.002) and with itself (4.76 MU; P 0.001) showed
50e60% less activity compared to the WT PINA-bait pairs, PINA/
PINA (8.52 MU) and PINA/PINB (9.66 MU) (Fig. 4, Table S3). No such
decrease was found for any other mutants, even in their favourable
orientations, i.e., PINADTRD-baits and PINA R39G-baits (above) or
PINB-D1c-prey (see below). As prey, the differences were not signicant; PINA/PINADHD (10.55 MU) was comparable to PINA/PINA

The ndings of diverse mutations causatively associated with

hard grain textures of wheat have led to the Pin genes being a
signicant research focus over the last 15 years. The lipid-binding
nature of PINs has implications for grain texture as well as
possible in vivo roles in defence of the seed/seedling against microbial pathogens (Gautier et al., 1994). The lipid-binding and other
biochemical properties of PINs and effects on grain texture have
been reviewed (Bhave and Morris, 2008a; Nadolska-Orczyk et al.,
2009; Pauly et al., 2013). The TRD is long held as important for their
membrane active nature, through studies on microbial cells or
synthetic membranes, using puried or expressed proteins or
synthetic peptides (reviewed in Bhave and Morris, 2008b). Substitution of the Trp and Lys residues in the TRD of PINA or PINB led
to reduced interactions with the S. cerevisiae plasma membrane
(Evrard et al., 2008), and reduced or abolished the grain softening
effect of PINs (Feiz et al., 2009a). The PINs are suggested to stabilize
bound polar lipids on the surface of starch granules (remnants of
amyloplast), preventing lipid degradation, this process being central to the development of soft grains (Feiz et al., 2009b; Kim et al.,

Fig. 4. begalactosidase reporter activity of the interactions of the PINADHD with

wildetype PINA and PINB proteins. The b-galactosidase activity, presented in MU, is
the mean of two independent experiments, each reaction in an experiment being
conducted in triplicate. The values shown have been corrected for the relevant empty
vector control activities.

Fig. 5. begalactosidase reporter activity of the interactions of PINBeD1c with wildetype PINA and PINB. The b-galactosidase activity, presented in MU, is the mean of two
independent experiments, each reaction in an experiment being conducted in triplicate. The values shown have been corrected for the relevant empty vector control
activities.

3.5. Interactions of the PINADHD mutant

328

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

2012b). However, this rich literature does not fully explain a

remarkable peculiarity, i.e., each protein can individually associate
with the starch granule, but the soft endosperm texture requires
both WT PINs binding together to the starch granule surface (Swan
et al., 2006; Wanjugi et al., 2007; Feiz et al., 2009b). A leading hypothesis is that the PINs may interact at the starch granule surface
by direct binding of the TRD (Wall et al., 2010). However, this does
not adequately explain why each protein can only impart intermediate hardness. Dening the nature of PIN protein associations is
thus an important challenge, so as to exploit them for grain texture
selections/manipulations and perhaps for plant defence. The yeast
two-hybrid system is a most commonly used technique for studying physical interactions between diverse types of proteins, e.g., the
binding between thionin (an antimicrobial protein with structural
similarity to PINs) with a protein from a fungal pathogen (Asano
et al., 2013). We have provided evidence of in vivo proteineprotein interactions (PPI) between PINA and PINB using this system
(Ramalingam, 2012; Ziemann et al., 2008). This study probed these
interactions further by multiple approaches: (i) substituting the
Arg39; (ii) deleting the TRD; (iii) retaining the TRD but deleting a
predicted hydrophobic domain (HD); and (iv) analysing a natural
hardness-associated mutation in PINB, located distal to the TRD.
The physical interactions of the WT mature PINA and PINB
proteins shown previously were tested as controls for comparisons.
The screening of the 2n mating cultures on selective plates and the
corresponding reporter b-galactosidase assays conrmed that the
PINA/PINA and PINA/PINB (as bait/prey) interactions were the
strongest. The orientation of the expressed proteins also seemed
relevant, the reporter activation being strongest with PINA as bait
and PINB as prey. The mature PINA has a higher proportion of hydrophobic residues (Ala, Cys, Val, Ile, Leu, Met, Phe, Trp, Tyr)
(39.17%) (Bioedit v 7.1.11) compared to PINB (37.82%), which may
explain the stronger PPI of PINA. This may also explain the suggestion of a primary role for PINA in starch granule surface association and a co-operative role in the binding of PINB, while PINB
may have a reciprocal role in the binding of PINA and may be more
specic to starch-binding than PINA (Swan et al., 2006; Wanjugi
et al., 2007). GSP-1 shares a number of biochemical properties
with PINs, but there is little evidence for its contribution to the
hardness phenotype (reviewed in Bhave and Morris, 2008b). The
very weak self and cross-interactions noted for GSP-1 indicate only
a minor role for it, if any, in grain texture. If the TRD is (also)
involved in PPI, the ve Trps and three basic residues in the TRD of
PINA (Gautier et al., 1994) may impart stronger hydrophobic and
ionic interactions, respectively, compared to the TRD of PINB with
only three Trp and two basic residues, and that of GSP-1 with only
two Trp and no basic residues.
The TRD is located in a coiled loop between the rst two a-helices (Le Bihan et al., 1996) and is considered the most important
region for the afnity of PINs to membrane lipids (Evrard et al.,
2008; Jing et al., 2003) and direct interactions with the surface of
starch granules (Wall et al., 2010). PINA has been shown to form
cation channels in Xenopus oocytes and giant liposomes and also
form aggregates (oligomers), and the TRD has also been implicated
in formation of these (reviewed in Bhave and Morris, 2008b).
Oligomers are required for some antimicrobial proteins to form
pores in membranes (Jing et al., 2003). We have recently shown a
possible pore-forming mechanism for synthetic peptides based on
the TRD of PINA (Alfred et al., 2013). Considering the strong evidence for the mutual dependence of the two WT PINs in imparting
soft texture, it seems logical to contemplate whether they may
physically associate in this process. Hence dissecting the role of TRD
in the co-operative processes is a priority. Introduction of the
Arg39Gly substitution in the TRD of PINA, or the complete deletion
of its TRD, did not appear to decrease the interactions (as measured

by induction of the reporter b-galactosidase) between the mutant

PINA and WT PINB, expressed in bait or prey orientations. Rather, a
1.5e2-fold increase was observed in some cases, e.g., PINAR59G/
PINB compared to PINA/PINB (Fig. 3, Table S2). PINADTRD in the
bait orientation appears to interact more strongly with all partners,
including itself, as compared to WT PINA-bait, and there appears to
be no involvement of the TRD in any interactions of the mutated
protein. The trend of stronger interactions of PINADTRD-bait was
also observed for WT PINA-bait pairs, suggesting that correct
orientation is important for interactions of PINA proteins. The results thus suggest strongly that, despite its membrane-binding
properties outlined above, the TRD is unlikely to be involved in
any PPI of PINA with itself or PINB. If the PINs do form dimers/
oligomers for their functionality, the present results suggest that
the TRD of individual protein units may have a role in the seed lipid
or starch granule association, or microbial membrane disruption,
rather than in their higher order associations. Other areas of the PIN
proteins need some critical attention in this regard.
While the nature of PPIs among proteins can be complex, hydrophobicity has been identied as a major factor (reviewed in
Moreira et al., 2007). The above data, that the TRD is unlikely to
have strong contributions to PPI, indicated that other domains and/
or residues may be involved. One such candidate is the hydrophobic
domain (HD), predicted at positions 75e85 in the mature protein,
as a small loop between helix-3 and helix-4 (Fig. 2). The HD contains 5 hydrophobic residues including two Phe in PINA, and 4
hydrophobic residues (one being Phe) in PINB (Fig. S4, Fig. S6). The
interactions of the PINADHD mutant protein as baits, with PINA,
PINB and itself as preys showed a notable reduction in strength
compared to the WT pairs (Table S3). The deletion did not
completely abolish the PPIs, but resulted in a signicant (2e3 fold)
decrease (P 0.002) in interactions with PINA or PINB preys. Thus
the HD seems important, but not sufcient or entirely essential, for
the associations of PINA, and other regions/residues may also
contribute. Notably, despite the extensive research on PINs, this
domain is little-known except for a brief mention of a phenylalanine domain of undened length by Marion et al. (1994). Most
interestingly, we found this region to be nearly completely
conserved, including in all Pinb-2 alleles, which share both Phe of
PINA (Wilkinson et al., 2008; Ramalingam et al., 2012; Chen et al.,
2013) (Fig. S10). Further, the allele PINB-2v3b, associated with a
small increase in hardness compared to PINB-2v3a, has a substitution (Val to Ala) (Chen et al., 2013) just proximal to the predicted
HD (residue 74). These observations suggest that the HD needs
further investigations in all PIN proteins.
A number of mutations in PINB occur in its TRD (reviewed in
Bhave and Morris, 2008a). However, some do occur elsewhere; e.g.,
Leu60Pro (Pinb-D1c), whose effect on texture is marginally harder
(Lillemo and Morris, 2000) or softer (Takata et al., 2010) than the
TRD-based Gly46Ser (allele Pinb-D1b). Hence we queried the implications of this mutation in PPI, especially as it is located in an
alpha-helical section between the TRD and HD. However, it had no
detrimental effect on the interactions of PINB, suggesting its
hardness effect may have a different explanation. Ikeda et al. (2005)
reported lack of the mutant PINB-c protein in a Pinb-D1c genotype
(while a product was noted for Pinb-D1b), and suggested this to be
due to its inability to bind to lipids (hence its degradation and hard
texture).
Based on above results, we propose that two separate events
occur in the functionality of PINs (Fig. 6). One event is the association of the individual PINA and PINB proteins, via their TRD, with
the endosperm polar lipids and starch granule surfaces (or insertions into microbial membranes). The binding of TRD is enabled
or stabilised by a second event, i.e., formations of PIN homo- or
hetero-dimers/oligomers, via ionic, polar and/or hydrophobic

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

329

Fig. 6. Suggested model for the proteineprotein and proteinelipid interactions of PINs. A. WT-PINA and WT-PINB interact with each other and stabilise the interactions of each
other with lipids such as remnants of the amyloplast membrane at the surface of the starch granules. B. The Leu60Pro substitution in PINB alters the way WT-PINA and PINBLeu60Pro interact, impeding the TRD of both proteins from lipid interactions.

interactions between residues on exposed loops (such as the HD),

or helix surfaces. Mutations such as Leu60Pro may affect the proteineprotein and/or protein-lipid associations and thus indirectly
affect the binding efciency of TRD, leading to effects on grain
texture or antimicrobial defence. However, the sequence of the two
proposed events is currently unclear. The role of HD may be further
elucidated by introducing point mutations at the relevant residues.
The second copy of the Pinb gene, especially certain alleles which
have minor effects of texture (Chen et al., 2010, 2013) also warrant
investigations of their ability to interact with PINA and PINB, as do
the rye secaloindolines which have little effects on grain texture in
triticale (Gasparis et al., 2013). Investigations of the in planta interactions PINs by means of a system such as biomolecular uorescence complementation (BiFC) would help further explore their
in vivo roles and the effects of mutations.
5. Conclusions
The results strongly suggest that the TRD of PINA is unlikely to
be involved in any higher order associations of PINs. The hydrophobic domain seems more important in this regard, but also not
completely sufcient. A rigorous rethinking of the biochemical
functionality of PINs thus seems warranted, including considerations of non-TRD signatures such as conserved hydrophobic residues and glutamines.
Acknowledgements
The authors thank Dr Abirami Ramalingam (Swinburne University of Technology; present address ICRISAT, Hyderabad, India)
for providing the initial PINA and PINB clones for PCR mutagenesis.
The project was supported by the Australian Research Council
Linkage grant LP0989191.
Appendix A. Supplementary data
Supplementary data related to this article can be found at http://
dx.doi.org/10.1016/j.jcs.2014.06.001.
References
Alfred, R.L., Palombo, E.A., Panozzo, J.F., Bariana, H., Bhave, M., 2013. Stability of
puroindoline peptides and effects on wheat rust. World J. Microbiol. Biotechnol., 1409e1419.
Asano, T., Miwa, A., Maeda, K., Kimura, M., Nishiuchi, T., 2013. The secreted antifungal protein thionin 2.4 in Arabidopsis thaliana suppresses the toxicity of a
fungal fruit body lectin from Fusarium graminearum. PLoS Pathog. 9, e1003581.

Bhave, M., Morris, C.F., 2008a. Molecular genetics of puroindolines and related
genes: allelic diversity in wheat and other grasses. Plant Mol. Biol. 66, 205e219.
Bhave, M., Morris, C.F., 2008b. Molecular genetics of puroindolines and related
genes: regulation of expression, membrane binding properties and appliactions. Plant Mol. Biol. 66, 221e231.
Chen, F., Zhang, F., Cheng, X., Morris, C., Xu, H., Dong, Z., Zhan, K., Cui, D., 2010.
Association of puroindoline b-B2 variants with grain traits, yield components
and ag leaf size in bread wheat (Triticum aestivum L.) varieties of the yellow
and Huai Valleys of China. J. Cereal Sci. 52, 247e253.
Chen, F., Zhang, F., Li, H., Morris, C., Cao, Y., Shang, X., Cui, D., 2013. Allelic variation
and distribution independence of Puroindoline b-B2 variants and their association with grain texture in wheat. Mol. Breed. 32, 399e409.
Clifton, L.A., Green, R.J., Frazier, R.A., 2007. Puroindoline-b mutations control the
lipid binding interactions in mixed puroindoline-a:puroindoline-b systems.
Biochemistry 46, 13929e13937.
Evrard, A., Lagarde, V., Joudrier, P., Gautier, M.-F., 2008. Puroindoline-a and
puroindoline-b interact with the Saccharomyces cerevisae plasma membrane
through different amino acids present in their tryptophan-rich domain. J. Cereal
Sci. 48, 379e386.
Feiz, L., Beecher, B.S., Martin, J.M., Giroux, M.J., 2009a. In planta mutagenesis determines the functional regions of the wheat puroindoline proteins. Genetics
183, 853e860.
Feiz, L., Wanjugi, H.W., Melnyk, C.W., Altosaar, I., Martin, J.M., Giroux, M.J., 2009b.
Puroindolines co-localize to the starch granule surface and increase seed bound
polar lipid content. J. Cereal Sci. 50, 91e98.
Gasparis, S., Orczyk, W., Nadolska-Orczyk, A., 2013. Sina and sinb genes in Triticale
do not determine grain hardness contrary to their orthologs pina and pinb in
wheat. BMC Plant Biol. 13, 190.
Gautier, M.-F., Aleman, M.-E., Guirao, A., Marion, D., Joudrier, P., 1994. Triticum
aestivum puroindolines, two basic cystine-rich seed proteins: cDNA sequence
analysis and developmental gene expression. Plant Mol. Biol. 25, 43e57.
Ikeda, T.M., Ohnishi, N., Nagamine, T., Oda, S., Hisatomi, T., Yano, H., 2005. Identication of new puroindoline genotypes and their relationship to our texture
among wheat cultivars. J. Cereal Sci. 41, 1e6.
Jing, W., Demcoe, A.R., Vogel, H.J., 2003. Conformation of a bactericidal domain of
puroindoline a: structure and mechanism of action of a 13-residue antimicrobial peptide. J. Bacteriol. 185, 4938e4947.
Kim, K.H., Feiz, L., Martin, J.M., Giroux, M.J., 2012a. Puroindolines are associated
with decreased polar lipid breakdown during wheat seed development.
J. Cereal Sci. 56, 142e146.
Kim, K.H., Feiz, L., Dyer, A.T., Grey, W., Hogg, A.C., Martin, J.M., Giroux, M.J., 2012b.
Increased resistance to Penicillium seed rot in transgenic wheat over-expressing
puroindolines. J. Phytopathol. 160, 243e247.
sormeauz, A., Marion, D., Pe
zolet, M., 1996. DetermiLe Bihan, T., Blochet, J.-E., De
nation of the secondary structure and conformation of puroindolines by
infrared and ramen spectroscopy. Biochemistry 35, 12712e12722.
Lillemo, M., Morris, C.F., 2000. A leucine to proline mutation in puroindoline b is
frequently present in hard wheats from Northern Europe. Theor. Appl. Genet.
100, 1100e1107.
zolet, M., Forest, E., Clark, D.C.,
Marion, D., Gautier, M.-F., Joudrier, P., Ptak, M., Pe
Broekaert, W., 1994. Structure and function of wheat lipid binding proteins. In:
Wheat Kernal Proteins: Molecular and Functional Aspects. Universit
a Degli
Studi Della Tuscia - Consiglio Nazionale Delle Ricerche, Viterbo, pp. 175e180.
Moreira, I.S., Fernandes, P.A., Ramos, M.J., 2007. Hot spots e a review of the proteinprotein interface determinant amino-acid residues. Proteins Struct. Funct.
Genet. 68, 803e812.
Nadolska-Orczyk, A., Gasparis, S., Orczyk, W., 2009. The determinants of grain
texture in cereals. J. Appl. Genet. 50, 185e197.
Pauly, A., Pareyt, B., Fierens, E., Delcour, J.A., 2013. Wheat (Triticum aestivum L. and t.
turgidum L. ssp. durum) Kernel hardness: I. Current view on the role of puroindolines and polar lipids. Compr. Rev. Food Sci. Food Saf. 12, 413e426.

330

R.L. Alfred et al. / Journal of Cereal Science 60 (2014) 323e330

Phillips, R.L., Palombo, E.A., Panozzo, J.F., Bhave, M., 2011. Puroindolines, Pin alleles,
hordoindolines and grain softness proteins are sources of bactericidal and
fungicidal peptides. J. Cereal Sci. 53, 112e117.
Pickering, P.A., Bhave, M., 2007. Comprehensive analysis of Australian hard wheat
cultivars shows limited puroindoline allele diversity. Plant Sci. 172, 371e379.
Qi, D., Scholthof, K.-B.G., 2008. A one-step PCR-based method for rapid and efcient
site-directed fragment deletion, insertion, and substitution mutagenesis.
J. Virol. Methods 149, 85e90.
Ramalingam, A., 2012. Genetic Variability and Protein-protein Interactions of Puroindolines in Relation to Wheat Grain Texture and Antimicrobial Properties.
PhD thesis. Swinburne University of Technology, Melbourne, Australia.
Ramalingam, A., Palombo, E.A., Bhave, M., 2012. The Pinb-2 genes in wheat comprise
a multigene family with great sequence diversity and important variants.
J. Cereal Sci. 56, 171e180.
Swan, C.G., Meyer, F.D., Hogg, A.C., Martin, J.M., Giroux, M.J., 2006. Puroindoline B
limits binding of puroindoline A to starch and grain softness. Crop Sci. 46,
1656e1665.

Takata, K., Ikeda, T.M., Yanaka, M., Matsunaka, H., Seki, M., Ishikawa, N.,
Yamauchi, H., 2010. Comparison of ve puroindoline alleles on grain hardness
and our properties using near isogenic wheat lines. Breed. Sci. 60, 228e232.
Wall, M.L., Wheeler, H.L., Huebsch, M.P., Smith, J.C., Figeys, D., Altosaar, I., 2010. The
tryptophan-rich domain of puroindoline is directly associated with the starch
granule surface as judged by tryptic shaving and mass spectrometry. J. Cereal
Sci. 52, 115e120.
Wanjugi, H.W., Hogg, A.C., Martin, J.M., Giroux, M.J., 2007. The role of puroindoline
A and B individually and in combination on grain hardness and starch association. Crop Sci. 47, 67e76.
Wilkinson, M., Wan, Y., Tosi, P., Leverington, M., Snape, J., Mitchell, R.A.C.,
Shewry, P.R., 2008. Identication and genetic mapping of variant forms of
puroindoline b expressed in developing wheat grain. J. Cereal Sci. 48, 722e728.
Ziemann, M., Ramalingam, A., Bhave, M., 2008. Evidence of physical interactions of
puroindoline proteins using the yeast two-hybrid system. Plant Sci. 175,
307e311.