Neu Big 2011

Botanical Journal of the Linnean Society, 2012, 168, 117146.
With 12 figures
Generic recircumscriptions of Oncidiinae (Orchidaceae:

Cymbidieae) based on maximum likelihood analysis of
combined DNA datasets
KURT M. NEUBIG1,2, WILLIAM MARK WHITTEN1*, NORRIS H. WILLIAMS FLS1,2,
MARIO A. BLANCO1,2,3, LORENA ENDARA2, JOHN GORDON BURLEIGH2,
KATIA SILVERA4,5, JOHN C. CUSHMAN5 and MARK W. CHASE FLS6
1
Florida Museum of Natural History, University of Florida, PO Box 117800, Gainesville, FL
32611-7800, USA
2
Department of Biology, 220 Bartram Hall, PO Box 118525, University of Florida, Gainesville, FL
32611-8526, USA
3
Jardn Botnico Lankester, Universidad de Costa Rica, Apartado 1031-7050, Cartago, Costa Rica
4
Center for Conservation Biology, 3168 Batchelor Hall, University of California, Riverside, Riverside,
CA 92521, USA
5
Department of Biochemistry/ MS 200, University of Nevada Reno, NV 89557-0014, USA
6
Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3DS, UK
Received 18 May 2011; revised 28 August 2011; accepted for publication 27 September 2011
Phylogenetic relationships within the orchid subtribe Oncidiinae sensu Chase were inferred using maximum
likelihood analyses of single and multilocus DNA sequence data sets. Analyses included both nuclear ribosomal
internal transcribed spacer DNA and plastid regions (matK exon, trnH-psbA intergenic spacer and two portions of
ycf1 exon) for 736 individuals representing approximately 590 species plus seven outgroup taxa. Based on the well
resolved and highly supported results, we recognize 61 genera in Oncidiinae. Mimicry of oil-secreting Malpighi-
aceae and other floral syndromes evolved in parallel across the subtribe, and many clades exhibit extensive
variation in pollination-related traits. Because previous classifications heavily emphasized these floral features,
many genera recognized were not monophyletic. Our classification based on monophyly will facilitate focused
monographs and clarifies the evolution of morphological and biochemical traits of interest within this highly
diverse subtribe. 2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168,
117146.
ADDITIONAL KEYWORDS: elaiophores euglossine pollination hummingbird pollination matK

mimicry Neotropics oil-collecting bees nrITS trnH-psbA ycf1.
INTRODUCTION Neotropical flora, ranging from sea level to almost

4000 m a.s.l. in the Andes; several species of Brassia
Oncidiinae (Cymbidieae) are one of the most diverse
R.Br., Miltoniopsis God.-Leb. and Oncidium Sw. are
subtribes of Orchidaceae, with a wide range of floral
important ornamental crops. Oncidiinae are members
and vegetative morphologies. They include the great-
of a Neotropical clade that includes Coeliopsidinae,
est diversity of pollination systems and the widest
Maxillariinae, Stanhopeinae and Zygopetalinae; these
range of chromosome numbers known for Orchi-
five subtribes are each clearly monophyletic and
daceae (greater than the rest of the orchid family
collectively are sister to Eriopsidinae, although rela-
combined). They also form major components of the
tionships among the five subtribes still lack strong
bootstrap support; for an example, see the molecular
*Corresponding author. E-mail: whitten@flmnh.ufl.edu trees presented in Cribb (2009).
2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117146 117
118 K. M. NEUBIG ET AL.
Previous classifications of Oncidiinae were intu- phylogenetic hypotheses. Our goal is to use combined
itively based mainly on floral morphology and, to a plastid and nuclear ribosomal internal transcribed
lesser extent, chromosome number, and all were pro- spacer (nrITS) data to produce a densely-sampled
duced without cladistic methodology (Garay & Stacy, phylogenetic estimate of relationships within Oncidii-
1974; Dressler, 1993; Senghas, 1997). Recent molecu- nae and to use this to underpin a stable generic
lar studies have helped resolve and define Oncidiinae classification (Chase, 2009b) that can be used as a
and circumscribe many genera (Chase & Palmer, framework for more focused studies.
1987; Williams et al., 2001a; Williams, Chase &
Whitten, 2001b; Sandoval-Zapotitla et al., 2010).
Subtribes Ornithocephalinae and Telipogoninae, long POLLINATION AND FLORAL MIMICRY IN ONCIDIINAE
held separate on the basis of their four pollinia Historically, many of the difficulties with generic cir-
(versus two in Oncidiinae), plus the monopodial Pac- cumscription in Oncidiinae are probably the result of
hyphylliinae (two pollinia), were shown to nest within homoplasy and mimicry in flower shape and colour.
Oncidiinae. Dressler (1993) emphasized seed charac- Generic boundaries have long been contentious in
ters, velamen type and number of nodes per pseudob- both the botanical and horticultural communities
ulb in his concepts of Cymbidieae and Maxillarieae. (Garay, 1963; Braem, 2010). As in most orchid groups,
However, molecular data (van den Berg et al., 2005) generic concepts have traditionally emphasized floral
indicated that Cymbidieae (sensu Dressler, 1993) are characters and neglected vegetative ones. In Oncidii-
likely to be paraphyletic to Maxillarieae, and the two nae, floral traits and pollination systems appear to
might be regarded as a single tribe (Cymbidieae sensu be especially labile, which has undoubtedly fostered
Chase et al., 2003). In the current circumscription, much of the confusion in generic boundaries and
Oncidiinae include taxa with both two and four pol- resulted in many polyphyletic genera. Pollen is never
linia. Largely in accordance with the generic concepts offered as a reward, and pseudopollen and resin
of Chase (2009b), the subtribe includes 61 genera and rewards are unknown in Oncidiinae. Nectar is a
approximately 1600 species. Before molecular phylo- reward for bees, Lepidoptera and hummingbirds, and
genetic studies, subtribal delimitation varied widely, is usually presented in a nectariferous spur formed by
from the relatively broad concept of Dressler (1993) the lip or the adnation of lip and column. However,
to the narrow concepts of Szlachetko (1995), with nectar deceit is common, and the presence of a spur
the latter splitting out approximately 20 subtribes does not always indicate nectar. Relatively few
based largely on column morphology (including their species produce a fragrance reward consisting of
complex pollinaria). monoterpenes, sesquiterpenes and simple aromatics.
Oncidiinae exhibit an enormous diversity in form These fragrances are collected by male euglossine
and function that makes them attractive subjects for bees (Apidae: Euglossini), and they are considered
evolutionary studies. Floral size ranges several orders to serve a role in sexual selection by female eug-
in magnitude, and flowers evolved to utilize a diverse lossines (Bembe, 2004; Eltz, Roubik & Lunau, 2005;
array of pollinators. Floral rewards include nectar, Zimmermann et al., 2009). Most Oncidiinae species
oils and fragrances, although deceit flowers are the have flowers that either produce an oil reward or
most common pollination strategy (Chase, 2009b). are mimics of oil-producing flowers of Malpighiaceae;
Chromosome numbers range from the lowest known Figure 1 (Reis et al., 2000; Silvera, 2002; Sigrist &
in orchids (2n = 10) to 2n = 168 (Tanaka & Kamemoto, Sazima, 2004; Damon & Cruz-Lpez, 2006; Reis et al.,
1984) and genome size spans at least a seven-fold 2007; Carmona-Daz & Garca-Franco, 2009; Vale
range (Chase et al., 2005). Vegetatively, plants range et al., 2011). These oil flowers attract a variety of
from large, long-lived perennials with pseudobulbs of female bees of various sizes of several different genera
1 kg or more to highly reduced twig epiphytes the size in tribes Centridini, Tapinostapidini and Tetrapediini,
of a thumbnail with rapid life cycles (several months). of family Apidae (formerly assigned to a separate
Most species are epiphytes, and CAM photosynthesis family, Anthophoridae, and still occasionally referred
is considered to have arisen repeatedly (Silvera et al., to as anthophorid bees). The female bees collect oil
2009, 2010a, b). Understanding the evolution of this from specialized glands (elaiophores) on the flowers
range of form and function depends upon a reliable and use the oils as provisions and/or waterproofing for
phylogenetic hypothesis of relationships for hundreds larval cells (Cane et al., 1983; Roubik, 1989; Melo &
of species. Generic boundaries and relationships Gaglianone, 2005). Numerous species of Oncidiinae
within Oncidiinae have been highly contentious, and that are putative mimics of malpighs exhibit a suite
several genera have been viewed as taxa of conve- of characters that include bright yellow or purple
nience (non-monophyletic; Garay, 1963). Previous evo- flowers, elaiophores consisting of epidermal pads on
lutionary studies have been hampered by the choice lateral lobes of the lip or pads of trichomes on the lip
of non-monophyletic groups and by a lack of reliable callus and a tabula infrastigmatica (i.e. a fleshy ridge
2011 The Linnean Society of London, Botanical Journal of the Linnean Society, 2012, 168, 117146
ONCIDIINAE PHYLOGENETICS 119
Figure 1. Various genera of Oncidiinae displaying putative mimicry of yellow Malpighiaceae and/or Calceolaria flowers.
A, Malpighia sp. (model). B, Psychopsiella limminghei (Morren ex Lindl.) Lckel & Braem. C, Grandiphyllum auriculatum
(Vell.) Docha Neto. D, Trichocentrum splendidum (A.Rich. ex Duch.) M.W.Chase & N.H.Williams. E, Trichocentrum cebolleta
(Jacq.) M.W.Chase & N.H.Williams. F, Trichocentrum ascendens (Lindl.) M.W.Chase & N.H.Williams. G, Rossioglossum
ampliatum (Lindl.) M.W.Chase & N.H.Williams. H, Lockhartia lepticaula D.E.Benn. & Christenson. I, Fernandezia
ecuadorensis (Dodson) M.W.Chase. J, Vitekorchis excavata (Lindl.) Romowicz & Szlach. K, Oncidium cultratum Lindl. L,
Oncidium obryzatum Rchb.f. M, Oncidium sp. N, Oncidium sphacelatum Lindl. O, Oncidium heteranthum Poepp. & Endl.
P, Gomesa gardneri (Lindl.) M.W.Chase & N.H.Williams. Q, Gomesa insignis (Rolfe) M.W.Chase & N.H.Williams. R, Gomesa
longipes (Lindl. & Paxt.) M.W.Chase & N.H.Williams. S, Otoglossum harlingii (Stacy) N.H.Williams & M.W.Chase. T,
Otoglossum scansor (Rchb.f.) Carnevali & I.Ramrez. U, Erycina pusilla (L.) N.H.Williams & M.W.Chase. V, Nohawilliamsia
pirarense (Rchb.f.) M.W.Chase & Whitten. W, Zelenkoa onusta (Lindl.) M.W.Chase & N.H.Williams. X, Tolumnia urophylla
(Lodd. ex Lindl.) Braem. Y, Tolumnia quadriloba (C.Schweinf.) Braem. Photographs by W. Mark Whitten.
at the base of the column that is grasped by the Stpiczynska & Davies, 2008; Aliscioni et al., 2009;
mandibles of the bee, freeing their front and middle Davies & Stpiczynska, 2009; Pansarin, Castro &
legs to collect oil). Many Oncidiinae also possess Sazima, 2009). Parra-Tabla et al. (2000) reported
prominent elaiophores (Fig. 2FJ): Oncidium cheiro- that Trichocentrum ascendens (Lindl.) M.W.Chase
phorum Rchb.f., Oncidium sotoanum R.Jimnez & & N.H.Williams is pollinated primarily by female
Hgsater, Trichocentrum cavendishianum (Bateman) Trigona bees collecting the oily floral secrections for
M.W.Chase & N.H.Williams and various species of nest construction. Species with prominent elaiophores
Gomesa R.Br. (Stpiczynska, Davies & Gregg, 2007; represent legitimate oil reward flowers (Fig. 2FO).
Figure 2. Oncidiinae displaying various pollination syndromes. Row 1 (AE) Putative mimics of purple Malpighiaceae.
A, Malpighia glabra L. (model). B, Oncidium sotoanum R.Jimnez & Hgsater. C, Cyrtochilum edwardii (Rchb.f.) Kraenzl.
D, Tolumnia hawkesiana (Moir) Braem. E, Cyrtochilum ioplocon (Rchb.f.) Dalstrm. Rows 2 and 3 (FO) Oncidiinae that
secrete oil from localized elaiophores. F, Lockhartia longifolia (Lindl.) Schltr. G, H, Cyrtochilum serratum (Lindl.) Kraenzl.
(arrow denotes elaiophore). IJ, Oncidium cheirophorum Rchb.f. (arrow denotes elaiophore). K, Ornithocephalus cochle-
ariformis C.Schweinf. L. Ornithocephalus dalstroemii (Dodson) Toscano & Dressler. M, Ornithocephalus dressleri
(Toscano) Toscano & Dressler. N, Phymatidium falcifolium Lindl. O, Oncidium sp. (Sigmatostalix clade). Row 4 (PS)
Putative hummingbird-pollinated species. P, Fernandezia subbiflora Ruiz & Pav. Q, Brassia aurantiaca (Lindl.)
M.W.Chase. R, Brassia andina (Rchb.f.) M.W.Chase. S, Oncidium beyrodtioides M.W.Chase & N.H.Williams. Row 4 (TU)
Pseudocopulatory species. T, Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir. U, Trichoceros antennifer Kunth. Row 5
(VY) Species pollinated by nectar-foraging insects. V, Trichocentrum longicalcaratum Rolfe. W, Comparettia macroplec-
tron Rchb.f. & Triana. X, Rodriguezia sp. Y, Trichopilia rostrata Rchb.f. Row 5 (Z) Floral fragrance reward flower
pollinated by male euglossine bees. Z, Macroclinium dalstroemii Dodson. Photograph (E) courtesy Guido Deburghgraeve;
all others by W. Mark Whitten.
Some oil-secreting taxa with relatively small, green- visual similarity to sympatric species of Calceolaria.
ish white flowers (e.g. Ornithocephalus Hook., Phy- This extensive homoplasy in oil flower morphology
matidium Lindl.; Fig. 2KO) attract a subset of oil- has contributed to grossly polyphyletic classifications
foraging bees with smaller body sizes and do not of Oncidiinae, especially in clades that contain species
appear to be involved in mimicry. Perhaps a larger with bright yellow oncidioid flowers. Floral morphol-
percentage of Oncidiinae possess flowers with similar ogy, including the detailed structure of the column
malpigh-mimicking colour (bee-ultraviolet-green; (Szlachetko, 1995), is clearly unreliable as the sole
Powell, 2008), morphology and tabula infrastig- basis for generic circumscription. A robust phy-
matica, although they lack clearly demonstrable logenetic framework based on molecular data can
elaiophores. These species represent oil deceit flowers help diagnose polyphyletic groups and inform a new
that lure oil-collecting bees but fail to produce a clade-based classification.
legitimate reward (Fig. 1).
The floral morphology of Oncidiinae is probably the MATERIAL AND METHODS
result of a complex mixture of Batesian and Mlle- TAXON SAMPLING
rian mimicry (Roy & Widmer, 1999). Using spectral
reflectance analyses, Powell (2008) demonstrated that Specimens were obtained from wild-collected or cul-
many Oncidiinae with yellow flowers closely match tivated plants (see Supporting information, Appen-
the colour of yellow malpigh flowers [Byrsonima cras- dix S1); most taxon names follow the generic concepts
sifolia (L.) Kunth] and thus satisfy one of the criteria of Chase (2009b), except for genera we have now
for Batesian mimicry. By mapping these traits onto lumped (e.g. Brachtia Rchb.f., Ada Lindl. and Mesos-
an Oncidiinae phylogenetic tree, he estimated at least pinidium Rchb.f. into Brassia; Pachyphyllum Kunth
14 independent origins of putative malpigh mimicry and Raycadenco Dodson into Fernandezia Ruiz &
within Oncidiinae. Carmona-Daz & Garca-Franco Pav.) or split (Psychopsiella Lckel & Braem from
(2009) demonstrated that the rewardless Trichocen- Psychopsis Raf.). Sampling of Oncidiinae included 736
trum cosymbephorum (C.Morren) R.Jimnez & accessions from a total of 590 ingroup species. We
Carnevali is pollinated by the same oil-collecting included seven outgroup taxa from other subtribes
Centris bees that pollinate Malpighia glabra L., and of Cymbidieae (Cameron et al., 1999; Cameron, 2004).
the orchid has greater reproductive success in the We were unable to obtain DNA of the following
presence of the malpigh than in isolated clumps. rare, minor genera: Caluera Dodson & Determann
Further, Sazima & Sazima (1988) showed that some (three species), Centroglossa Barb.Rodr. (five species),
eglandular Malpighiaceae (lacking sepalar elaio- Cypholoron Dodson & Dressler (two species), Dunster-
phores) are possible mimics of glandular forms. There villea Garay (one species), Platyrhiza Barb.Rodr. (one
are probably complex mimicry relationships between species), Quekettia Lindl. (five species), Rauhiella
Malpighiaceae species, oil-producing Oncidiinae and Pabst & Braga (three species), Sanderella Kuntze
oil-deceit Oncidiinae. We also suspect that some Onci- (two species), Suarezia Dodson (one species) and
diinae mimic oil-producing Calceolaria L. (Calceolari- Thysanoglossa Porto & Brade (two species).
aceae) because they occur at high elevations where
malpighs are absent or rare and Calceolaria spp. are EXTRACTION, AMPLIFICATION AND SEQUENCING
common. For example, Otoglossum harlingii (Stacy) All freshly-collected material was preserved in
N.H.Williams & M.W.Chase (Fig. 1S) bears a striking silica gel (Chase & Hills, 1991). Genomic DNA was
extracted using a modified cetyl trimethylammonium trnH-psbA: This region was amplified with the
bromide (CTAB) technique (Doyle & Doyle, 1987), parameters 94 C for 3 min; 33 (94 C for 1 min;
scaled to a 1-mL volume reaction. Approximately 58 C for 1 min; 72 C for 1 min 20 s); 72 C for 6 min,
10 mg of dried tissue were ground in 1 mL of CTAB with the primers F and R sensu Xu et al. (2000).
2 buffer and 2 mL of either b-mercaptoethanol or ycf1: We sequenced two noncontiguous portions of
proteinase-K (25 micrograms/mL; Promega, Inc.). ycf1 (Neubig et al., 2009) including approximately
Some total DNAs were then cleaned with QIAquick 1200 bp from the 5 end and approximately 1500 bp
PCR (Qiagen) purification columns to remove inhibi- from the 3 end. Both were amplified using a touch-
tory secondary compounds. Amplifications were per- down protocol with the parameters 94 C for 3 min;
formed using an Eppendorf Mastercycler EP Gradient 8 (94 C for 30 s; 6051 C for 1 min; 72 C for
S thermocycler and Sigma brand reagents in 25-mL 3 min); 30 (94 C for 30 s; 50 C for 1 min; 72 C for
volumes with reaction components for ITS: 0.51.0 mL 3 min); 72 C for 3 min. Primers for the 5 portion are
of template DNA (approximately 10100 ng), 11 mL of 1F (ATGATTTTTAAATCTTTTCTACTAG) and 1200R
water, 6.5 mL of 5 M betaine, 2.5 mL of 10 buffer, (TTGTGACATTTCATTGCGTAAAGCCTT). Primers
3 mL of MgCl2 (25 mM), 0.5 mL of 10 mM dNTPs, for the 3 portion are 3720F (TACGTATGTAATGAAC-
0.5 mL each of 10 mM primers and 0.5 units of Taq GAATGG) and 5500R (GCTGTTATTGGCATCAAAC-
DNA polymerase. For the plastid regions, the reaction CAATAGCG). Additional internal sequencing primers
components used were: 0.51.0 mL of template DNA are intF (GATCTGGACCAATGCACATATT) and intR
(approximately 10100 ng), 1618 mL of water, 2.5 mL (TTTGATTGGGATGATCCAAGG).
of 10 buffer, 23 mL of MgCl2 (25 mM), 0.5 mL of PCR products were cleaned with Microclean (The
10 mM dNTPs, 0.5 mL each of 10 mM primers and 0.5 Gel Company) in accordance with manufacturers
units (0.2 mL) of Taq polymerase. instructions. Purified PCR products were then cycle-
The thermocycler programmes used to amplify each sequenced using the parameters 96 C for 10 s;
region comprised: 25 (96 C for 10 s; 50 C for 5 s; 60 C for 4 min).
nrITS (ITS 1 + 5.8S rDNA+ ITS 2): This region was The cycle sequencing mix consisted of 3 mL of water,
amplified with a touchdown protocol using the param- 1 mL of fluorescent Big Dye dideoxy terminator, 2 mL
eters 94 C for 2 min; 15 (94 C for 1 min; 76 C for of Better Buffer (The Gel Company), 1 mL of tem-
1 min, reducing 1 C per cycle; 72 C for 1 min); plate and 0.5 mL of primer. Cycle sequencing products
21 (94 C for 1 min; 59 C for 1 min; 72 C for were cleaned using ExoSAP (USB Corporation) in
1 min); 72 C for 3 min with the primers 17SE and accordance with the manufacturers instructions.
26SE sensu Sun et al. (1994). Betaine was added to Purified cycle sequencing products were directly
eliminate secondary structure typical of the ribosomal sequenced on an ABI 377, 3100 or 3130 automated
DNA, so that active ITS copies would predominate in sequencer accordance with the manufacturers
the PCR product. Except for nrITS, all other regions instructions (Applied Biosystems). Electropherograms
sequenced are plastid regions. were edited and assembled using SEQUENCHER,
matK-trnK: This region includes the entire matK version 4.9 (GeneCodes). All sequences were
gene and the flanking 3trnK spacer and is approxi- deposited in GenBank (see Supporting information,
mately 1800 bp in length. This region was amplified Appendix S1).
with the parameters 94 C for 3 min; 33 (94 C for
45 s; 60 C for 45 s; 72 C for 2 min); 72 C for 3 min,
with primers -19F (Molvray, Kores & Chase, 2000) DATA ANALYSIS
and trnK2R (Johnson & Soltis, 1994). Internal We constructed two data matrices. The first included
sequencing primers were matK intF (TGAGCGAACA- seven DNA regions (nrITS, trnH-psbA, 3ycf1, 5ycf1,
CATTTCTATGG) and matK intR (ATAAGGT- matK, rbcL and psbA) for 122 taxa. This smaller
TGAAACCAAAAGTG). Some samples were amplified restricted data set included several relatively con-
using the primers 56F and 1520R (Whitten, Williams served plastid genes (rbcL, psbA) with the goal of
& Chase, 2000) that yielded a shorter, although providing increased resolution and support for the
almost complete, sequence of the matK exon (missing deeper nodes of the tree. The outgroup for this data set
the 3 spacer). was Eulophia graminea Lindl. The second matrix
psaB: This region was amplified with the param- included five DNA regions (nrITS, trnH-psbA, 5ycf1,
eters 94 C for 3 min; 33 (94 C for 30 s; 55 C for 3ycf1 and matK) for 736 taxa. Outgroup taxa were
30 s; 72 C for 2 min); 72 C for 4 min, using the Eriopsis biloba Lindl., Eulophia graminea, Cyr-
primers NY159 and NY160 sensu Cameron (2004). tidiorchis stumpflei (Garay) Rauschert, a species of
rbcL: This region was amplified with the same Rudolfiella Hoehne, Stanhopea jenishiana F.Kramer
parameters as for psaB but with primers NY35 and ex Rchb.f., and Stanhopea tigrina Bateman ex Lindl.
NY149 from Cameron (2004). The trnH-psbA matrix contained many gaps of dubious
alignment, and we excluded 1259 positions out of 2027 few cases, samples from putatively the same species
aligned positions (62%). Data matrices are available do not fall together (e.g. Erycina pusilla (L.) N.H.Wil-
from W. Mark Whitten (whitten@flmnh.ufl.edu) and liams & M.W.Chase, Fig. 10; Cyrtochilum cimiciferum
at: ftp://ftp.flmnh.ufl.edu/Public/oncids/ (Rchb.f.) Dalstrm, Fig. 9). Some of these may be
Maximum likelihood (ML) phylogenetic analyses the result of errors in determinations but, usually,
were performed on both data sets using RaxML, these represent taxonomically confusing groups with
version 7.0.4 (Stamatakis, 2006). For each data set, poorly-defined species boundaries.
we ran analyses that included: (1) only ITS; (2) only
the plastid loci; and (3) all loci. All ML analyses
DISCUSSION
used the general time-reversible (GTR; Tavare,
1986) model of evolution with among-site rate varia- We recognize 61 clades in this tree (Figs 512) at
tion modeled using the CAT discrete rate categories generic level (Table 1). All of the clades that we rec-
option. For analyses of the plastid loci and all loci, ognize at generic level are strongly supported, and
we further partitioned the ML model based on DNA there is also strong support for almost all supra-
region. Specifically, we estimated substitution model generic nodes in the tree. Monotypic genera include
parameters for each region and for region-specific Zelenkoa M.W.Chase & N.H.Williams, Notyliopsis
branch lengths. To find the optimal tree for each P.Ortiz and Nohawilliamsia (Fig. 11). These taxa
data set, we performed five runs of the ML heuristic form a poorly supported grade that is sister to Tol-
searches and 200 nonparametric bootstrap replicates umnia and the twig epiphyte clade (all taxa in
to assess clade support in the tree (Felsenstein, Fig. 12). Other genera with weak support for generic
1985). topology include Schunkea Senghas, Trizeuxis Lindl.,
Seegeriella Senghas and Warmingia Rchb.f. Genera
are discussed in order of appearance in the cladogram
RESULTS (Figs 512). More detailed information for each genus
SEVEN-LOCUS DATA SET (FIGS 3, 4) is provided in Chase (2009b).
Both the plastid and the nrITS trees recover the same Psychopsis Raf. (five spp.; Fig. 5) ranges from
major clades, although there are some differences in Costa Rica south through the Andes to Peru. Chase
the topology along the spines of the trees. Based on (2005) lumped the monotypic Psychopsiella into Psy-
visual inspection of the trees, there appears to be chopsis on the basis of their sister relationship in
nuclear versus plastid conflict in the relationships unpublished nrITS trees to avoid creation of a mono-
of Psychopsis, Psychopsiella and Trichopilia Lindl. typic genus, although analysis of the combined data
Psychopsis and Psychopsiella are strongly supported sets place Psychopsiella sister to Trichopilia Lindl.
as sister in the nrITS tree, although Psychopsis is Chromosome numbers also differ: 2n = 38 for Psy-
strongly supported as sister to Psychopsiella and chopsis (Dodson, 1957) versus 2n = 56 for Psychop-
Trichopilia in the plastid tree. Vitekorchis Romowicz siella and Trichopilia (Charanasri & Kamemoto,
& Szlach. is isolated in both nuclear and plastid tree. 1975). Both Psychopsiella and Psychopsis have yellow
It is weakly supported as sister to Oncidium + all and brown flowers with a tabula infrastigmatica, sug-
remaining taxa in the plastid tree but is unresolved gestive of oil-reward flowers, although Dodson (2003)
at a deeper node in nrITS trees. Tolumnia reported pollination of Psychopsis by Heliconius but-
Raf. is strongly supported as sister to Erycina terflies but his observations have not been replicated.
Lindl. + Rhynchostele Rchb.f. in nrITS results, Psychopsiella Lckel & Braem (one sp.; Figs 1B,
although plastid data place Tolumnia as a well- 5) is monotypic and vegetatively resembles a dwarf
supported member of a derived clade (including Psychopsis, although it lacks the elongate dorsal sepal
Nohawilliamsia M.W.Chase & Whitten to Comparet- and petals of the latter. It is restricted to Brazil and
tia Poepp. & Endl.). The combined plastid + nrITS has been reported from Venezuela, near Caracas,
seven-region analysis (122 taxa; Fig. 4) is largely con- although this may have been an escape from cultiva-
sistent with the analysis of the larger five-locus data tion. It shares a chromosome number of 2n = 56 with
(736 taxa; Figs 512), although the addition of rbcL its sister, Trichopilia.
and psbA data provide slightly more support for the Trichopilia Lindl. (approximately 26 spp.;
spine of the tree. Figs 2Y, 5) is largely characterized by having a lip
that enfolds and is fused basally to the column, in
some species forming a deep tubular structure sug-
FIVE-LOCUS DATA SET (FIGS 512) gestive of nectar reward or deceit, although Dodson
Many species are represented by two or more (1962) reported pollination of one species by
samples. In most cases, multiple accessions of a single fragrance-collecting male euglossine bees. Some
species form a group (e.g. most Erycina; Fig. 10). In a species of Cattleya Lindl. and Sobralia Ruiz & Pav.
53 W1696 Comparettia heterophylla

A) Plastid 94 W2688 Comparettia falcata
W0869 Comparettia langkastii
B) nrITS
94
* 85 H8339 Comparettia bennettii
N422 Comparettia barkeri
N414 Comparettia schaeferi
* * 78
N041 Ionopsis minutiflora
64
* * W0881 Ionopsis minutiflora
W2346 Ionopsis utricularioides
**
98
* 74 N632 Pterostemma antioquiense
W2734 Pterostemma benzingii
N542 Warmingia zamorana
*
92 RLD6349 Macroclinium sp 76 66
70 W0961 Notylia ecuadorensis
50
N438 Macradenia rubescens
N415 Sutrina garayi *
* * W0830 Polyotidium huebneri
C129 Trizeuxis falcata
W1615 Rodriguezia batemanii
* *
99
W0287 Leochilus leiboldii
W0663 Leochilus inconspicuus
C017 Leochilus carinatus
* 60
82
C088 Leochilus leochilinus
59 99 N312 Tolumnia compressicaulis 94 54 88
80 * W3358 Tolumnia gundlachii
C655 Tolumnia calochila
W1622 Plectrophora cultrifolia
98
99 W0662 Zelenkoa onusta

W2674 Notyliopsis beatricis
89 C026 Capanemia superflua
W0898 Solenidium portillae
W3637 Nohawilliamsia pirarense
94
92 * C036 Gomesa planifolia
C151 Gomesa gomezoides
98 68 *
98 93 W2988 Gomesa radicans 56
62
*
W3535 Gomesa flexuosa
C058 Gomesa eleutherosepala
* 98
W3001 Gomesa lietzii
**
N089 Erycina cristagalli
W2520 Erycina glossomystax * * 58
* C052 Erycina hyalinobulbon
C019 Rhynchostele bictoniensis
C652 Rhynchostele londesboroughiana * 95
52 84
*
92
N091 Systeloglossum acuminatum
N336 Oliveriana brevilabia
W3262 Cischweinfia dasyandra
99
60 76 93
93 *
N548 Brassia horichii 73
W1644 Brassia elegantula 57 78
W2679 Brassia andina 87
* 60
W0083 Brassia arcuigera
N004 Aspasia lunata
99
98 W0091 Miltonia regnelii

99
W2966 Miltonia phymatochila
N017 Cyrtochilum serratum 98
* 54
90 W1553 Cyrtochilum myanthum
W1715 Caucaea phalaenopsis *
80
84
W99252 Miltoniopsis roezlii
C119 Cyrtochiloides ochmatochila
* 96
* B2856 Otoglossum globuliferum
W2723 Otoglossum coronarium *
W0905 Otoglossum harlingii
70 C053 Oncidium harryanum 74
94 *96 C054 Oncidium strictum
W1565 Oncidium epidendroides
96
69
81 90
59 W1662 Oncidium densiflorum
W1670 Oncidium peruvianoides 84
98
99
* N287 Oncidium morganii
N625 Oncidium lehmanniana
N178 Oncidium aff obryzatum
76 W2343 Oncidium obryzatum
* 96 N268 Oncidium hyphaematicum
W2676 Oncidium andradianum
82
98 99 93
80
* 86
C142 Oncidium toachicum
C031 Oncidium reichenheimii 78
N115 Oncidium ghiesbreghtianum
N235 Oncidium altissimum
* W1735 Oncidium heteranthum
W2518 Oncidium abortivum
W2694 Vitekorchis excavatus
82 *77*
W2375 Ornithocephalus bicornis
W2593 Ornithocephalus dressleri * *
W2374 Ornithocephalus suarezii
89 * W0513 Hintonella mexicana

W0887 Eloyella thienii
* 87
W2949 Chytroglossa marileoniae 99
* * N429 Zygostates alleniana
W2929 Zygostates apiculata *
98 N530 Phymatidium falcifolium 94
W0745 Fernandezia tica 81
98
* *
W2524 Fernandezia crystallina
98 W1701 Fernandezia ionanthera
W3285 Fernandezia ecuadorensis
* 80
87 71
* 60 * N560 Telipogon bombiformis
N643 Telipogon barbozae
*
98 *
* N440 Telipogon vargasii
W0868 Telipogon hystrix
82
57
W2692 Telipogon obovatus 95
* W2353 Trichoceros antennifer
W2690 Hofmeisterella eumicroscopica
81
B2558 Lockhartia micrantha
W1704 Lockhartia bennettii
89
* 78
N093 Cuitlauzina egertonii
68 * 66 C169 Cuitlauzina pendula
W3558 Cuitlauzina candida
80
62
80
C003 Rossioglossum ampliatum
* N096 Rossioglossum oerstedii
C007 Rossioglossum schlieperianum
85
98 *
* C013 Trichocentrum tigrinum
W1776 Trichocentrum lindenii 68 * 56
W3518 Trichocentrum stipitatum
* C156 Saundersia paniculata 88
* W0824 Grandiphyllum divaricatum
W0825 Grandiphyllum auricula *
96
**
C074 Trichopilia sanguinolenta 78
W1643 Trichopilia sanguinolenta 99
98 *
C079 Trichopilia brevis
* C150 Trichopilia subulata
W2396 Trichopilia fragrans
98
96
* W3561 Psychopsiella limminghei 93
* C034 Psychopsis sanderae
N052 Psychopsis papilio *
W1618 Rudolfiella sp.
Figure 3. Comparison of maximum likelihood bootstrap (BS) consensus trees resulting from analyses of the separate
[(A) plastid versus (B) nuclear ribosomal internal transcribed spacer (nrITS)] data sets for the seven-region data set for
122 taxa. Asterisks indicate 100% BS support.
have similar gullet flowers, and they also are visited clinandrial hood and similar pollinarium morphology
by nectar-seeking euglossine bees. Vegetatively, (Sosa et al., 2001).
plants of Trichopilia are similar to Psychopsis and Grandiphyllum Docha Neto (ten spp.; Figs 1C,
Psychopsiella. We include Helcia Lindl., Leucohyle 5) (Brazilian mule-ears) is restricted to Brazil and
Klotzch and Neoescobaria Garay, which are embedded northern Argentina, and the species were formerly
within Trichopilia. These differ primarily in the lack placed as members of two sections of Oncidium. They
of lip/column fusion and have previously been recog- have large leathery leaves and floral morphology
nized as members of Trichopilia. typical of Oncidium with an oil-bearing callus or
Rossioglossum (Schltr.) Garay & G.C.Kenn. dense pad of trichomes and a tabula infrastigmatica,
(ten spp.; Fig. 5), as circumscribed here, includes although they lack the complex tubularized polli-
Ticoglossum Lucas Rodr. ex Halb. and Chelyorchis narium stipe (Chase, 1986b) typical of Oncidium s.s.,
Dressler & N.H.Williams. This genus also includes Grandiphyllum and Saundersia Rchb.f. could be
considerable floral diversity, suggestive of pollination lumped into Trichocentrum, although doing so would
by a variety of bees, although pollination data are create a genus that is even more difficult to diagnose
mostly lacking. Rossioglossum ampliatum (Lindl.) morphologically.
M.W.Chase & N.H.Williams (Fig. 1G) has numerous Saundersia Rchb.f. (two spp.; Fig. 5) is restricted
bright yellow (bee-ultraviolet-green; Powell, 2008) to Brazil. These small plants have relatively leathery
Oncidium-like flowers that are malpigh mimics, mule-ear leaves and small flowers borne in a dense
whereas other Rossioglossum [e.g. R. insleayi (Baker pendent raceme with a short column that lacks a
ex Lindl.) Garay & G.C.Kenn. and Rossioglossum tabula infrastigmatica. The roots, ovary and sepals
grande (Lindl.) Garay & G.C.Kenn.] bear relatively bear dense indumentum, a feature unique within this
few, large flowers barred with yellow and brown. All clade and rare in the entire subtribe (but found in
species share vegetative similarities of rounded, some species of Ornithocephalus, which is not closely
ancipitous pseudobulbs topped by a pair of leathery related; Fig. 6).
leaves. Van der Pijl & Dodson (1966) reported Trichocentrum Poepp. & Endl. (70 spp.; Figs 1D,
pollination of R. grande by Centris bees. Their E, F, 2V, 5), as broadly circumscribed by Chase
floral features, particularly the presence of a tabula (2009b), also includes Lophiaris Raf. (mule-ear
infrastigmatica, indicates oil-bee pollination, oncidiums), Cohniella Pfitzer (rat-tail oncidiums)
although their floral absorbance has not been inves- and Lophiarella Szlach., Mytnik & Romowicz [Tricho-
tigated. Recognition of Chelyorchis, as a result of its centrum microchilum (Bateman ex Lindl.) M.W.Chase
floral distinctiveness within this clade, would result & N.H.Williams and Trichocentrum pumilum (Lindl.)
in a paraphyletic Rossioglossum. The genus ranges M.W.Chase & N.H.Williams]. This clade also includes
mostly from Mexico to Central America, with Chely- great floral diversity but the species are linked by
orchis pardoi Carnevali & G.A.Romero extending vegetative succulence. The leaves are thick and leath-
further south to Trinidad and Tobago, Colombia ery and, in one clade, the leaves are terete (rat-tail
and Venezuela (Fernandez-Concha et al., 2009). oncidiums). Most species have yellow to brown
This species currently lacks a combination in flowers that are either true oil- or resin-rewarding
Rossioglossum. species: Trichocentrum stipitatum (Lindl. ex Benth.)
Cuitlauzina Lex. (ten spp.; Fig. 5), as circum- M.W.Chase & N.H.Williams, visited by Centris and
scribed here, includes Dignathe Lindl., Osmoglossum Paratetrapedia bees (Silvera, 2002); T. ascendens
(Schltr.) Schltr. and Palumbina Rchb.f and ranges (Lindl.) M.W.Chase & N.H.Williams, pollinated by
from Mexico to Panama in Central America. Because Trigona and Centris (Parra-Tabla et al., 2000), and
floral morphology is so divergent within this genus, some are oil deceit-flowers. Species of Trichocentrum
the close relationships between Cuitlauzina s.s., s.s. typically have a spur (Fig. 2V), although nectar
Palumbina, Dignathe and Osmoglossum were previ- has never been observed. At least one species, Tricho-
ously unsuspected. All four genera were segregated by centrum tigrinum Linden & Rchb.f., has a strong
various workers from Odontoglossum. Cuitlauzina fragrance and attracts fragrance-collecting male
pendula Lex. has a tabula infrastigmatica, although euglossines (van der Pijl & Dodson, 1966). Most Tri-
its pollinator is unknown; its colour (white or pink) chocentrum s.s. with spurs might be deceit flowers,
makes it unlikely to be an oil-bee flower. Despite attracting nectar-foraging euglossine or other long-
their gross floral disparity, they share a prominent tongued bees. Chromosome number varies greatly
62 W1696 Comparettia heterophylla

90 W2688 Comparettia falcata
* * H8339 Comparettia bennettii
N422 Comparettia barkeri
* *
N414 Comparettia schaeferi
54
* W0881 Ionopsis minutiflora
*
80
N632 Pterostemma antioquiense
W2734 Pterostemma benzingii
RLD6349 Macroclinium sp
* 94 * W0961 Notylia ecuadorensis
* * W1615 Rodriguezia batemanii
N415 Sutrina garayi
67 W0830 Polyotidium huebneri
* * **
C088 Leochilus leochilinus
W0287 Leochilus leiboldii
50 C655 Tolumnia calochila
50 * W3358 Tolumnia gundlachii
N312 Tolumnia compressicaulis
W0662 Zelenkoa onusta
* 89
W3637 Nohawilliamsia pirarense
C026 Capanemia superflua
* *94
C036 Gomesa planifolia
* * W2988 Gomesa radicans
* * C058 Gomesa eleutherosepala
W3001 Gomesa lietzii
* N089 Erycina cristagalli
* * *
W2520 Erycina glossomystax
C052 Erycina hyalinobulbon
C652 Rhynchostele londesboroughiana
* 76 N548 Brassia horichii
W1644 Brassia elegantula
* 74
W2679 Brassia andina
* *
84 N091 Systeloglossum acuminatum
* N004 Aspasia lunata
* W0091 Miltonia regnelii
W2966 Miltonia phymatochila
*
92 N017 Cyrtochilum serratum
W1553 Cyrtochilum myanthum
**
W1715 Caucaea phalaenopsis
C119 Cyrtochiloides ochmatochila
* *
86 90 B2856 Otoglossum globuliferum
W2723 Otoglossum coronarium
W0905 Otoglossum harlingii
* C053 Oncidium harryanum
* **
C054 Oncidium strictum
84 W1662 Oncidium densiflorum
92 W1670 Oncidium peruvianoides
N178 Oncidium aff obryzatum
* *
W2343 Oncidium obryzatum
N287 Oncidium morganii
* 94
N625 Oncidium lehmanniana
* * * N268 Oncidium hyphaematicum

84 C031 Oncidium reichenheimii
* * N115 Oncidium ghiesbreghtianum
N235 Oncidium altissimum
* W1735 Oncidium heteranthum
W2518 Oncidium abortivum
W2694 Vitekorchis excavatus
88
78 * * W2375 Ornithocephalus bicornis
W2593 Ornithocephalus dressleri
W0513 Hintonella mexicana
* W0887 Eloyella thienii
* W2949 Chytroglossa marileoniae
* * N429 Zygostates alleniana
W2929 Zygostates apiculata
N530 Phymatidium falcifolium
94
* *
63 W0745 Fernandezia tica
W1701 Fernandezia ionanthera
* W2524 Fernandezia crystallina
W3285 Fernandezia ecuadorensis
* 52 * N560 Telipogon bombiformis
* * N440 Telipogon vargasii

* * W2353 Trichoceros antennifer

W2692 Telipogon obovatus
* * B2558 Lockhartia micrantha

W2690 Hofmeisterella eumicroscopica

* 88 N096 Rossioglossum oerstedii
* C007 Rossioglossum schlieperianum
C169 Cuitlauzina pendula
* N093 Cuitlauzina egertonii
W3558 Cuitlauzina candida
60
* * C013 Trichocentrum tigrinum
W1776 Trichocentrum lindenii
* W3518 Trichocentrum stipitatum
* *
C156 Saundersia paniculata
W0824 Grandiphyllum divaricatum
W0825 Grandiphyllum auricula
* C074 Trichopilia sanguinolenta
* ** * = 95-100% bootstrap support

W1643 Trichopilia sanguinolenta
C079 Trichopilia brevis
C150 Trichopilia subulata
* W2396 Trichopilia fragrans
* C034 Psychopsis sanderae
N052 Psychopsis papilio
W3561 Psychopsiella limminghei
W1618 Rudolfiella sp.
0.005 substitutions/site
Figure 4. Single maximum likelihood tree resulting from analysis of the combined [plastid + nuclear ribosomal internal
transcribed spacer (nrITS)] seven-region data set for 122 taxa. Asterisks indicate 100% bootstrap support (BS); values
above lines are BS percentages.
to Fig. 6 to Fig. 6
B1803 Lockhartia aff. grandibracteata
B2559 Lockhartia grandibractea
B2558 Lockhartia micrantha
*
67
73
87
94
B2574 Lockhartia serra
B2488 Lockhartia aff. chocoensis
B2653 Lockhartia parthenglossa * 61 *
B2567 Lockhartia acuta
68
B2286 Lockhartia hercodonta
B2572 Lockhartia obtusata *
B2563 Lockhartia oerstedii
B2667 Lockhartia verrucosa * *
B2554 Lockhartia bennettii
B2570 Lockhartia aff. parthenocomos
* 81
N350 Trichocentrum undulatum 84

W3252 Trichocentrum carthaginense 53
N447 Trichocentrum lindenii 59
W1776 Trichocentrum lindenii
65
N446 Trichocentrum x teaboanum
W0916 Trichocentrum sp.
N445 Trichocentrum oerstedii
73
*
N444 Trichocentrum cosymbephorum
W0915 Trichocentrum cosymbephorum
Lophiaris (in part)
80
*
C080 Trichocentrum bicallosum
W3553 Trichocentrum margalefii
N443 Trichocentrum straminium
* 65 85
N026 Trichocentrum lanceanum

W3229 Trichocentrum nanum * *
W0282 Trichocentrum morenoi
W3554 Trichocentrum pumilum Lophiarella * 94
N033 Trichocentrum pfavii
W2663 Trichocentrum cymbiglossum **
Fig. 5 C082 Trichocentrum panduratum
C013 Trichocentrum tigrinum Trichocentrum s.s. * * *
W0886 Trichocentrum pulchrum
W1695 Trichocentrum longicalcaratum * *
C025 Trichocentrum flavovirens
N031 Trichocentrum splendidum Lophiaris (in part) * *
N025 Trichocentrum stipitatum
W3518 Trichocentrum stipitatum **
W3602 Trichocentrum cepula
W3619 Trichocentrum cepula
Cohniella
* * *
C090 Trichocentrum jonesianum
C156 Saundersia paniculata
W0825 Grandiphyllum auriculum
W3567 Grandiphyllum auriculum Oncidium
59 *
N285 Grandiphyllum hians
C048 Grandiphyllum hians
sect. Oncidium *
W0823 Grandiphyllum pulvinatum Paucituberculata sect. Pulvinatum 71 *
W0824 Grandiphyllum divaricatum
W0826 Grandiphyllum robustissimum * 75
C018 Cuitlauzina pulchella
N141 Cuitlauzina pulchella
N093 Cuitlauzina egertonii
Osmoglossum ** 87
C169 Cuitlauzina pendula
W3545 Cuitlauzina pendula Cuitlauzina s.s. * *
C148 Cuitlauzina candida
W3558 Cuitlauzina candida Palumbina * *
N024 Rossioglossum ampliatum Chelyorchis *
C075 Rossioglossum krameri
N096 Rossioglossum oerstedii Ticoglossum
* *
C007 Rossioglossum schlieperianum
N187 Rossioglossum insleayi Rossioglossum s.s.
*
N034 Trichopilia turialvae
W2947 Trichopilia turialvae
W2396 Trichopilia fragrans
*
84
C001 Trichopilia suavis
W2957 Trichopilia leucoxantha *
C150 Trichopilia subulata
W1892 Trichopilia subulata Leucohyle * *
* * *
C399 Trichopilia laxa
C074 Trichopilia sanguinolenta
W1643 Trichopilia sanguinolenta Helcia 73
C079 Trichopilia brevis Neoescobaria
Psychopsis s.l.
* *
C034 Psychopsis sanderae
N052 Psychopsis papilio *
C267 Stanhopea tigrina
W3297 Stanhopea jenischiana
DT297 Cyrtidiorchis stumpflei
*
W1618 Rudolfiella sp
W0129 Zygopetalum maxillare Outgroups
W0472 Eriopsis biloba
W3609 Eulophia graminea
Figure 5. Portion (outgroups to Lockhartia) of single maximum likelihood tree resulting from analysis of the combined
five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support > 50%;
asterisks indicate 95100% BS support. Generic segregates that we do not recognize and have lumped are indicated in
the trees to the right of the accepted names.
within this clade, forming a continuum from condensation and does not involve polyploidy. Some
2n = 2472 that does not correlate well with sub- reports (Braem, 1993; Christenson, 1999; Fernandez-
clades. Chase & Olmstead (1988) hypothesized that Concha et al., 2010) have favoured a narrow circum-
the range of numbers is the result of chromosomal scription of Trichocentrum (restricted to those species
to Fig. 7
N560 Telipogon bombiformis 74
N576 Telipogon ampliflorus
to Fig. 7 N556 Telipogon chiriquensis
B2984 Telipogon glicensteinii
N579 Telipogon sp.
N557 Telipogon panamensis 91
N587 Telipogon personatus
N561 Telipogon maduroi 66
N583 Telipogon monticola
N553 Telipogon caulescens 60
N692 Telipogon caulescens
N578 Telipogon biolleyi
N585 Telipogon sp.
N559 Telipogon medusae
* 84
N554 Teliopgon griesbeckii 74
N582 Telipogon griesbeckii
N584 Telipogon olmosii
N589 Telipogon sp. * *67
N586 Telipogon parvulus
W0140 Telipogon parvulus
N558 Telipogon butcheri
* *
N645 Telipogon monteverdensis *
* *
Stellilabium
N644 Telipogon bullpenensis 63
N344 Telipogon acicularis
W2155 Telipogon smaragdinus
W2531 Telipogon sp.
W2703 Telipogon sp.
C123 Telipogon pogonostalix
* *
84 * 79
N440 Telipogon vargasii 94
Fig. 6 N442 Telipogon nervosus
*
N694 Telipogon klotzscheanus
N413 Telipogon pulcher
W2413 Telipogon sp. 76 *
N577 Telipogon ariasii
*
N588 Telipogon sp.
B2982 Telipogon urceolatus
W2412 Telipogon hartwegii * 54
*
W2692 Telipogon obovatus
B2977 Telipogon venustus
W0882 Trichoceros antennifer 94
*
**
W2353 Trichoceros antennifer
*
C138 Trichoceros parviflorus
*
N286 Trichoceros muralis
*
DT340 Trichoceros antennifer
W0883 Trichoceros muralis
DT375 Trichoceros sp.
C112 Hofmeisterella eumicroscopica
W2690 Hofmeisterella eumicroscopica *
W2592 Ornithocephalus dalstroemii
W2693 Ornithocephalus dalstroemii * 89
B2980 Ornithocephalus dalstroemii
N309 Ornithocephalus ecuadorensis Sphyrastylis **
* **
N337 Ornithocephalus dalstroemii
B2979 Ornithocephalus escobarianus
W2593 Ornithocephalus dressleri
W3242 Ornithocephalus cochleariformis
* * *
B2545 Ornithocephalus inflexus
N426 Ornithocephalus iridifolius * *
W2370 Ornithocephalus kruegeri
W2376 Ornithocephalus polyodon **
N428 Ornithocephalus myrticola
W2374 Ornithocephalus suarezii * * 52
85
*
N290 Hintonella mexicana
W0513 Hintonella mexicana
W0887 Eloyella thienii
* *
GG135 Chytroglossa aurata
W2949 Chytroglossa marileoniae *
**
N437 Zygostates obliqua 94
*
W2929 Zygostates apiculata
N429 Zygostates alleniana 56
N430 Zygostates lunata
W2792 Zygostates pellucida
C103 Zygostates grandiflora Dipteranthus * *
N530 Phymatidium falcifolium
W0860 Phymatidium falcifolium *
C113 Fernandezia sp.
W2537 Fernandezia cuencae
DT359 Fernandezia sp.
* 65 88
W0880 Fernandezia sp.
*
Pachyphyllum (in part) 84
** *
W2524 Fernandezia crystallina
W0879 Fernandezia hartwegii
H7178 Fernandezia sp.
DT366 Fernandezia ionanthera
** 73
*
W1701 Fernandezia ionanthera
W1700 Fernandezia sanguinea
DT350 Fernandezia breviconnata
N568 Fernandezia tica
Pachyphyllum (in part)
* *
W0745 Fernandezia tica
C217 Fernandezia sp.
W3285 Fernandezia ecuadorensis Raycadenco
* to Fig. 5
to Fig. 5
Figure 6. Continuation (Fernandezia to Telipogon) of single maximum likelihood tree resulting from analysis of the
combined five-region data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support
> 50%; asterisks indicate 95100% BS support. Generic segregates that we do not recognize and have lumped are
indicated in the trees to the right of the accepted names.
with a spur) and recognition of Lophiaris and etic. Chase (2009b) argued for lumping all these into
Cohniella. These generic segregates are monophyletic a broader Trichocentrum on the basis of pollinarium
with respect to our molecular data if one species of and vegetative characters (Sandoval-Zapotitla & Ter-
Lophiarella (T. pumilum) is included in Lophiaris, razas, 2001), which also avoids recognition of a large
although Lophiarella should also include Trichocen- number of genera.
trum flavovirens (L.O.Williams) M.W.Chase & Lockhartia Hook. (35 spp.; Figs 1H, 2F, 5) has
N.H.Williams and T. splendidum (A.Rich. ex Duch.) confused orchidologists for decades and has been
M.W.Chase & N.H.Williams if it is to be monophyl- placed in a number of suprageneric taxa. The genus
to Fig. 8 to Fig. 8
C089 Oncidium wydleri
N235 Oncidium altissimum *
*
N240 Oncidium baueri 67
N242 Oncidium volvox
N238 Oncidium reichenbachii 77
W3464 Oncidium panamense
W3243 Oncidium polycladium
W2797 Oncidium dichromaticum
*
N030 Oncidium sphacelatum
N237 Oncidium isthmi
W1773 Oncidium isthmii
* *
N241 Oncidium ensatum
N499 Oncidium leucochilum 87 53
W2961 Oncidium leucochilum
C030 Oncidium leucochilum
N239 Oncidium maculatum 92
*
87
*
W1779 Oncidium lindleyi
N642 Oncidium sp.
*
89
W0516 Oncidium incurvum
W2919 Oncidium incurvum
N500 Oncidium leleui
B2976 Oncidium imitans 88
C135 Oncidium warscewiczii
*
* *
N640 Oncidium storkii
Fig. 7 N637 Oncidium exalatum
W2622 Oncidium exauriculatum
N088 Oncidium bracteatum
**
N186 Oncidium schroderianum
W0309 Oncidium schroederianum Miltonioides (in part) **
C041 Oncidium hastilabium
N158 Oncidium cariniferum
N208 Oncidium hastatum
Miltonioides (in part) * * 79
C656 Oncidium endocharis
N634 Oncidium endocharis
C016 Oncidium oliganthum
* 91
52
C173 Oncidium reflexum
W0660 Oncidium durangense
W0895 Oncidium unguiculatum
**
76
*
C099 Oncidium gheisbreghtianum
W3440 Oncidium ghiesbreghtianum Mexicoa 86
N115 Oncidium ghiesbreghtianum
N636 Oncidium iricolor
W2903 Oncidium iricolor Vitekorchis (in part) *
54
70 *
N220 Oncidium oblongatum
C031 Oncidium reichenheimii 80
* * *
N142 Oncidium reichenheimii
C046 Oncidium laeve
C047 Oncidium stenoglossum
Miltonioides (in part)
*
H7292 Oncidium dactyliferum
W1691 Oncidium dactyliferum *
N097 Oncidium cheirophorum
N502 Oncidium cheirophorum
N027 Oncidium sotoanum
* *
86 93
*
N212 Oncidium aloisii
C121 Oncidium pardothyrsus 70
66
*
N263 Oncidium estradae
W2331 Oncidium cf. abruptum
W0517 Oncidium hyphaematicum 73
W2507 Oncidium hyphaematicum
*
*
N268 Oncidium hyphaematicum
93
*
C073 Oncidium fuscatum
N261 Oncidium fuscatum Chamaelorchis
84
**
W0725 Oncidium anthocrene
C004 Oncidium powellii
W1731 Oncidium sp. 55
C020 Oncidium retusum
W2427 Oncidium retusum
W2446 Oncidium retusum
** 86
N547 Oncidium aff. echinops
*
** *
W2539 Oncidium sp.
W1656 Oncidium echinops
*
W2518 Oncidium echinops
W2711 Oncidium echinops Heteranthocidium
*
W2426 Oncidium ariasii
**
(in part)
W1679 Oncidium heterodactylum
* **
W1735 Oncidium heteranthum
W1727 Oncidium cultratum
W2420 Oncidium lancifolium
N218 Oncidium retusum
92
*
*
N635 Vitekorchis excavatus
*
W2694 Vitekorchis excavatus Vitekorchis s.s.
DT373 Vitekorchis excavatus
W2428 Vitekorchis lucasianus
to Fig. 6
to Fig. 6 0.001 substitutions/site
Figure 7. Continuation (Vitekorchis to Oncidium) of single maximum likelihood tree resulting from analysis of the
ranges throughout much of the Neotropics. The linaria have elongate caudicles that partially replace
flowers are mostly bright yellow and bear oil- a stipe (similar to Pachyphyllum Kunth), and all but
secreting trichomes, similar to many Oncidiinae, one species have a braided vegetative habit with
although they lack a tabula infrastigmatica. The pol- pseudomonopodial stems lacking pseudobulbs and
to Fig. 9 to Fig. 9
B2529 Oncidium hallii
N295 Oncidium epidendroides
N190 Oncidium epidendroides
* 81
N152 Oncidium tripudians 69 76
N156 Oncidium spectatissimum
N149 Oncidium nobile 70
N132 Oncidium alexandrae 91
N164 Oncidium alexandrae
C1488 Oncidium luteopurpureum
N140 Oncidium aff. epidendroides 93
* 70
N215 Oncidium hauensteinii

N223 Oncidium sceptrum 59 62
W1766 Oncidium luteopurpureum
W1551 Oncidium lehmannii 72 65
N327 Oncidium lehmannii
W1767 Oncidium lehmannii 58
N136 Oncidium armatum
N176 Oncidium armatum
W1723 Oncidium kegekjani
* 90
N122 Oncidium hallii
N216 Oncidium cristatum
N117 Oncidium blandum
*
*
C060 Oncidium cirrhosum 80
Fig. 8 N150 Oncidium cirrhosum
N157 Oncidium reversoides
N217 Oncidium mirandum
C1357 Oncidium lindleyoides
Odontoglossum ** 78
N081 Oncidium crocidipterum 57
N135 Oncidium cinnamomeum 78
*
N145 Oncidium constrictum 63
N214 Oncidium gloriosum
W1765 Oncidium odoratum 53
C661 Oncidium nevadense
N104 Oncidium nevadense *
C062 Oncidium wallisii
C1490 Oncidium rhynchanthum * 51
N329 Oncidium portilloides
N198 Oncidium aspidorhinum
N328 Oncidium aspidorhinum
85 * 94
*
*
N175 Oncidium tenuoides
*
W1722 Oncidium tenuoides
W2391 Oncidium tenuoides 59 60
N213 Oncidium crinitum
N130 Oncidium portmannii
N139 Oncidium portmannii
W1612 Oncidium portmannii
* *
C054 Oncidium strictum
W1638 Oncidium strictum
N323 Oncidium praestanoides
Symphyglossum
* 77
93
N155 Oncidium velleum
N173 Oncidium wyattianum * 52
C053 Oncidium harryanum
N131 Oncidium harryanum
75
*
*
N079 Oncidium roseoides
77
**
N116 Oncidium vulcanicum
N305 Oncidium vulcanicum
W1680 Oncidium roseoides Cochlioda
C065 Oncidium noezlianum
W1662 Oncidium densiflorum
W2455 Oncidium beyrodtioides
* *
W0877 Oncidium peruvianoides
W1670 Oncidium peruvianoides * * 86
W1798 Oncidium tigroides
W2392 Oncidium tigroides
Solenidiopsis
*
C172 Oncidium multistellare
N129 Oncidium digitoides
N191 Oncidium astranthum Collare-stuartense
* * 93
93
78
N602 Oncidium manuelariasii

N599 Oncidium tenuifolium
N448 Oncidium povedanum Odontoglossum (in part)
N165 Oncidium chrysomorphum 62
W1671 Oncidium chrysomorphum
W1676 Oncidium cf schmidtianum
W2421 Oncidium cf schmidtianum
69 ** 90
73
*
N335 Oncidium trinasutum
N178 Oncidium sp.
N294 Oncidium tipuloides
W2505 Oncidium boothianum 94
W2506 Oncidium boothianum
W2447 Oncidium boothianum Vitekorchis (in part) **
*
W1732 Oncidium boothianum
N552 Oncidium zelenkoanum
N639 Oncidium obryzatoides
W2343 Oncidium obryzatum Vitekorchis (in part)
* *
N287 Oncidium morganii
W1631 Oncidium sp. ** 67
*
W1632 Oncidium minaxoides 91
N303 Oncidium sp.
W1577 Oncidium brevicornis
N432 Oncidium ibis
N434 Oncidium aristulliferum * * * 78
N431 Oncidium cuculligerum
W1633 Oncidium gramineum
W2706 Oncidium gramineum
N292 Oncidium gramineum Sigmatostalix
* * *
*
W2328 Oncidium weinmannianum
N435 Oncidium buchtienoides
C056 Oncidium poikilostalix
W1627 Oncidium sp.
W3520 Oncidium poikilostalix
* * *
N161 Oncidium unguiculoides
W2583 Oncidium auriculatoides * *
W1624 Oncidium oxyceras
W2340 Oncidium picturatissimum
N621 Oncidium sp.
**
N625 Oncidium lehmannianum
to Fig. 7 0.001 substitutions/site to Fig. 7
Figure 8. Continuation (Oncidium) of single maximum likelihood tree resulting from analysis of the combined five-region
data set for 736 individuals. The tree on the right side of the figure displays bootstrap (BS) support > 50%; asterisks
indicate 95100% BS support. Generic segregates that we do not recognize and have lumped are indicated in the trees
to the right of the accepted names.
to Fig. 10 to Fig. 10
H7586 Cyrtochilum cumandae 90
W2908 Cyrtochilum gargantua 81
*
DT311 Cyrtochilum cordatum
N118 Cyrtochilum halteratum 89
W1650 Cyrtochilum trifurcatum
H7245 Cyrtochilum trifurcatum * 56
N017 Cyrtochilum serratum
W3563 Cyrtochilum trilingue * 85
C032 Cyrtochilum serratum
N206 Cyrtochilum macranthum * 79
N076 Cyrtochilum ioplocon
N128 Cyrtochilum ioplocon * 68
*
C063 Cyrtochilum revolutum
W3565 Cyrtochilum villenaorum
Fig. 9 W1545 Cyrtochilum ramosissimum
C120 Cyrtochilum pardinum
N137 Cyrtochilum pardinum * 87
C665 Cyrtochilum pardinum
N339 Cyrtochilum angustatum
C140 Cyrtochilum angustatum
* *
N184 Cyrtochilum sp. 69
N433 Cyrtochilum graminoides
51
W1661 Cyrtochilum gracile
W2454 Cyrtochilum gracile
N144 Cyrtochilum fractum Dasyglossum + * 51
W1553 Cyrtochilum myanthum Trigonochilum

90
*
N527 Cyrtochilum hoeijeri in various
W0788 Cyrtochilum hoeijeri combinations 62
*
N601 Cyrtochilum longipes
W1678 Cyrtochilum viminale
N539 Cyrtochilum fidicularium 65
W2352 Cyrtochilum funis
*
C663 Cyrtochilum edwardii
W3556 Cyrtochilum edwardii
N018 Cyrtochilum flexuosum
*
N536 Cyrtochilum cf. porrigens
W3599 Cyrtochilum macasense
*
N293 Cyrtochilum cimiciferum
N299 Cyrtochilum tricostatum 89
N304 Cyrtochilum tricostatum 69
W1559 Cyrtochilum tricostatum 68
W1560 Cyrtochilum cocciferum
W3550 Cyrtochilum cocciferum
H7239 Cyrtochilum midas
* 70 64
C008 Cyrtochilum cimiciferum
* *
*
DT370 Cyrtochilum ovatilabium
W1682 Cyrtochilum cimiciferum
W0822 Cyrtochilum meirax
W2686 Cyrtochilum meirax
N106 Cyrtochilum murinum
* 86
*
W0878 Cyrtochilum murinum
C654 Cyrtochilum murinum
W2727 Cyrtochilum flexuosum
*
N418 Cyrtochilum aurantiacum
N419 Cyrtochilum caespitosum Rusbyella
* 58
* *
N053 Cyrtochilum rhodoneurum Neodryas
N540 Cyrtochilum ornatum
W1667 Cyrtochilum ornatum Buesiella 79
DT337 Cyrtochilum aureum
W2354 Cyrtochilum aureum
N138 Cyrtochilum aff. aureum
Siederella * * * *
N163 Cyrtochilum loxense
N421 Caucaea radiata
W2448 Caucaea radiata * 61
W0897 Caucaea rhodosticta
N143 Caucaea kennedyi
W1716 Caucaea cucullata
61**
N179 Caucaea cucullata 92 77
C022 Caucaea phalenopsis 58
W1715 Caucaea phalaenopsis
W1659 Caucaea nubigena
W1683 Caucaea andigena
* *
N569 Miltoniopsis vexillaria
58
*
W0896 Miltoniopsis bismarkii
W2722 Miltoniopsis bismarkii
*
* *
C1320 Miltoniopsis vexillaria
C014 Miltoniopsis warscewiczii
N174 Miltoniopsis phalaneopsis
*
C119 Cyrtochiloides ochmatochila 70
C653 Cyrtochiloides cardiochila
C136 Cyrtochiloides panduriformis
N593 Cyrtochiloides riopalenqueana
* * 86
C059 Otoglossum globuliferum
W3174 Otoglossum scansor **
*
N550 Otoglossum globuliferum Brevilongium
B2856 Otoglossum globuliferum 76
** *
W3155 Otoglossum globuliferum
H8090 Otoglossum sp.
*
W2723 Otoglossum coronarium Otoglossum s.s. 79
DT356 Otoglossum sp.
C061 Otoglossum chiriquense
W0905 Otoglossum harlingii Ecuadorella,
to Fig. 8 Brevilongium (in part) to Fig. 8
Figure 9. Continuation (Otoglossum to Cyrtochilum) of single maximum likelihood tree resulting from analysis of the
N121 Rhynchostele cordata
W3551 Rhynchostele cordata **
*
N134 Rhynchostele maculata 73
N205 Rhynchostele madrensis
N207 Rhynchostele candidula 91
N126 Rhynchostele rossii
N189 Rhynchostele ehrenbergii * *
N127 Rhynchostele cervantesii
N204 Rhynchostele galeottiana * 58
Fig. 10
C918 Rhynchostele beloglossa
N036a Rhynchostele beloglossa Amparoa
* 81
N119 Rhynchostele stellata
N120 Rhynchostele pygmaea * * *
*
N177 Rhynchostele majalis
N203 Rhynchostele uroskinneri
C652 Rhynchostele londesboroughiana Mesoglossum
*
W2515 Erycina glossomystax **
* *
Psygmorchis
N099 Erycina pumilio 89
W2341 Erycina pumilio
C042 Erycina pusilla
W0872 Erycina zamorensis * * * *
W1771 Erycina pusilla
N089 Erycina cristagalli
W0530 Erycina cristagalli
Stacyella
* *
C052 Erycina hyalinobulbon
W0512 Erycina hyalinobulbon
C1350 Erycina echinata
Erycina s.s. * *
W0511 Erycina echinata
*
W1685 Brassia sp.
W2695 Brassia ocanensis 71
N537 Brassia sp. 92
N549 Brassia sp.
Ada (in part) * 68
*
W1644 Brassia elegantula
W0085 Brassia sp.
W0093 Brassia aurantiaca 72
W1837 Brassia pozoi
*
N300 Brassia garayana 84
**
W1666 Brassia garayana
N541 Brassia sp. 78
* *
Mesospinidium
W1663 Brassia sp.
W0084 Brassia panamensis
N548 Brassia horichii
N528 Brassia allenii Ada (in part)
H8089 Brassia sp.
W3415 Brassia forgetiana
W3287 Brassia villosa
** 66
91
*
W0082 Brassia signata
W0086 Brassia aurorae Brassia s.s.
N006 Brassia caudata 92 *
*
N010 Brassia jipijapensis 82 85
N009 Brassia gireoudiana
C213 Brassia andina
W2679 Brassia andina
Brachtia
*
N003 Aspasia epidendroides
W0092 Aspasia principissa * *
N004 Aspasia lunata
N264 Aspasia silvana *
N529 Cischweinfia suarezii
*
*
N535 Cischweinfia sp. 67
*
N524 Cischweinfia popowiana
W3607 Cischweinfia popowiana
W2458 Cischweinfia sp.
*
*
N036 Cischweinfia dasyandra 93
* * **
W0876 Cischweinfia colombiana
N016 Cischweinfia pusilla
W3300 Cischweinfia pusilla
* *
W2824 Cischweinfia platychila
W2461 Cischweinfia pygmaea
N534 Oliveriana ecuadorensis *
N653 Oliveriana sp.
C134 Systeloglossum bennettii
N091 Systeloglossum acuminatum * *
C027 Miltonia candida
W0091 Miltonia regnelii
Anneliesia
**
N022 Miltonia flavescens
C208 Miltonia phymatochila
W2966 Miltonia phymatochila Phymatochilum
* *
to Fig. 9
Figure 10. Continuation (Miltonia to Rhynchostele) of single maximum likelihood tree resulting from analysis of the
tightly overlapping, unifacial, non-articulate leaves. phic traits common to many seedlings of Oncidiinae
The capsules have apical dehiscence instead of (Chase, 1986b). One species (Lockhartia genegeorgei
lateral. These unusual features led some workers to D.E.Benn. & Christenson) has prominent pseudob-
place Lockhartia in a separate subtribe, Lockhartii- ulbs with articulated, bifacial leaves; the lack of pae-
nae Schltr., although the molecular data strongly domorphic traits in this species led Senghas (2001) to
support its position within Oncidiinae. The unusual describe a new genus, Neobennettia Senghas. We
vegetative features are best explained as paedomor- were unable to obtain a DNA sample of this taxon
N373 Tolumnia tetrapetala
N386 Tolumnia sp. **
N351 Tolumnia pulchella
N376 Tolumnia triquetra 90*
*
N514 Tolumnia gauntlettii Olgasis
N234 Tolumnia prionochila 79 61
Fig. 11 N314 Tolumnia prionochila
N232 Tolumnia urophylla *
* *
N608 Tolumnia haitiensis 93
W0995 Tolumnia quadriloba
N049 Tolumnia henekenii Hispaniella
N233 Tolumnia guianensis
N272 Tolumnia guianensis
W2839 Tolumnia lemoniana
* * * 94
N312 Tolumnia compressicaulis 86
N318 Tolumnia arizajuliana Braasiella
N712 Tolumnia guibertiana
N310 Tolumnia sylvestris
*
* **
N395 Tolumnia leiboldii
N348 Tolumnia caymanensis 91
N406 Tolumnia sasseri 92
N274 Tolumnia scandens
N409 Tolumnia hawkesiana * 57 92
*
W0991 Tolumnia variegata 88
W0981 Tolumnia aff. variegata 87
W3358 Tolumnia gundlachii Antillanorchis
C655 Tolumnia calochila
N269 Tolumnia calochila
N050 Tolumnia tuerckheimii Gudrunia
*
C067 Zelenkoa onusta
W0662 Zelenkoa onusta
*
N638 Nohawilliamsia pirarense
N523 Solenidium lunatum
** 90
C026 Capanemia superflua
N671 Gomesa montana 75
N681 Gomesa sp.
N672 Gomesa warmingii 77 65
N699 Gomesa spiloptera 54
N682 Gomesa hydrophila
N683 Gomesa barbaceniae 77
C660 Gomesa warmingii
*
Coppensia
N702 Gomesa warmingii
N688 Gomesa sp.
*
N441 Gomesa viperina
C098 Gomesa flexuosa 63
78
*
N662 Gomesa flexuosa
C037 Gomesa macronyx
N678 Gomesa welteri
Rhinocerotidium
** * 93
N704 Gomesa varicosa
W3611 Gomesa varicosa
Coppensia
* *
69
C038 Gomesa ranifera
N698 Gomesa hookeri
Menezesiella
*
*
W2988 Gomesa radicans Ornithophora
N341 Gomesa concolor
W3544 Gomesa concolor Carenidium (in part) **
*
C210 Gomesa dasytyle
N701 Gomesa forbesii 56
W3610 Gomesa forbesii
W3620 Gomesa gardneri Brasilidium * *
C076 Gomesa imperatorismaximiliani
N669 Gomesa praetexta
N676 Gomesa crispa 67
* 88
N710 Gomesa recurva

*
* *
C036 Gomesa planifolia
*
N706 Gomesa sessilis 89
W3534 Gomesa sp.
N665 Gomesa chrysostoma
N705 Gomesa glaziovii
Rodrigueziella (in part)
* *84
N708 Gomesa handroi Rodrigueziella (in part)
C058 Gomesa eleutherosepala Rodrigueziopsis
N684 Gomesa amicta 76 88
N686 Gomesa kautskyi
N685 Gomesa sarcodes
N667 Gomesa cornigera
*
**
N697 Gomesa sp.
W3559 Gomesa widgrenii Baptistonia 74
W3560 Gomesa silvana
* * *
W3001 Gomesa lietzei
N661 Gomesa echinata
C006 Gomesa pubes
N522 Gomesa venusta Campaccia
GG154 Gomesa colorata Carriella
C137 Gomesa ciliata
N703 Gomesa barbata Alatiglossum **
* *
N687 Gomesa macropetala
N604 Gomesa longipes Kleberiella 64
*
N680 Gomesa longipes
N666 Gomesa cogniauxiana Neoruschia
N668 Gomesa gracilis Nitidocidium
to Fig. 10
Figure 11. Continuation (Gomesa to Tolumnia) of single maximum likelihood tree resulting from analysis of the
DT427 Notylia sp. 52

N424 Notylia buchtienii 54
B2972 Notylia pittieri
Fig. 12 W1530 Notylia sp.
W0961 Notylia ecuadorensis *
*
C012 Notylia barkeri
N570 Notylia sp.
* 71
*
W2823 Notylia albida
N265 Notylia barkeri
** *
W1544 Notylia sp.
W2509 Macroclinium dalestromii
**
W3005 Macroclinium aurorae
RLD6349 Macroclinium lineare 57
C024 Macroclinium bicolor
N425 Macroclinium robustum
N192 Warmingia eugenii
C028 Warmingia eugenii
* * 69

N654 Macradenia tridentata
C166 Macradenia brassavolae
* *
N416 Seegeriella pinifolia
W3351 Trizeuxis falcata
N417 Schunkea vierlingii
*
W0475 Rodriguezia delcastilloi 81
W0476 Rodriguezia satipoana
W1616 Rodriguezia sp. 79 *
*
W1615 Rodriguezia batemanii
N384 Rodriguezia arevaloi
C039 Rodriguezia lanceolata 67
N320 Rodriguezia venusta 83
W0889 Rodriguezia chasei
**
*
W0919 Rodriguezia pulchra
W2342 Rodriguezia lehmannii
W1775 Rodriguezia leeana
N415 Sutrina garayi
W0830 Polyotidium huebneri Polyotidium
52
*
W1694 Comparettia tungurahuae
W2691 Comparettia tungurahuae
*
N302 Comparettia jamiesonii
W0873 Comparettia hirtzii 89
W1696 Comparettia heterophylla
N533 Comparettia luerae * *
*
N297 Comparettia aff. gentryi 78
*
W1689 Comparettia sp.
N623 Comparettia sp. 79
*
W0918 Comparettia ottonis Scelochilus
H8381 Comparettia portillae
**
N420 Comparettia corydaloides 54
N616 Comparettia corydaloides
* * *
N619 Comparettia sp.
N083 Comparettia speciosa 58
* 69
W2688 Comparettia falcata 93
* *
N084 Comparettia falcata Comparettia s.s.
*
C110 Comparettia macroplectron
W3425 Comparettia macroplectron 58
H8339 Comparettia bennettii
N622 Comparettia bennettii
Stigmatorthos
* *
N422 Comparettia barkeri Diadenium,
* *
*
W0871 Comparettia micrantha Chaenanthe
N414 Comparettia schaeferi Pfitzeria 82
**
W2371 Ionopsis minutiflora Konantzia
*
W0881 Ionopsis minutiflora
N037 Ionopsis satyrioides
N352 Ionopsis satyrioides * *
*
C043 Ionopsis utricularioides Ionopsis s.s.
N632 Pterostemma antioquiense
W2734 Pterostemma benzingii Hirtzia * *
N051 Leochilus leiboldii
W0287 Leochilus leiboldii Papperitzia
**
W0663 Leochilus inconspicuus Hybochilus (in part) * *
*
N398 Leochilus labiatus
**
*
W3363 Leochilus tricuspidatus
C083 Leochilus oncidioides
C088 Leochilus leochilinus Goniochilus
N439 Plectrophora sp.
W1621 Plectrophora triquetra
N531 Plectrophora alata
* *
to Fig. 11 0.001 substitutions/site to Fig. 11
Figure 12. Continuation (Plectrophora to Notylia) of single maximum likelihood tree resulting from analysis of the
Table 1. Genera of Oncidiinae recognized in the present for inclusion in our analyses, although we feel its
study segregation into a monotypic genus is unwarranted.
It may be a natural intergeneric hybrid between
Figure number Lockhartia (probably Lockhartia lepticaula D.E.Benn.
(of Fig. 512) where
& Christenson) and a species of Oncidium or Viteko-
Genera recognized in this paper genus occurs in tree
rchis; the elongate, nonbifid pollinarium stipe of
Aspasia Lindl. 10 L. genegeorgei is very different from that of other
Brassia R.Br. 10 Lockhartia spp.
Caluera Dodson & Determann Not sampled The following seven genera include taxa formerly
Capanemia Barb.Rodr. 11
placed in the monopopodial subtribes Pachyphyllinae
Caucaea Schltr. 9
Chytroglossa Rchb.f. 6 (pollinia with two long stipes/caudicles) and Ornitho-
Cischweinfia Dressler & N.H.Williams 10 cephalinae (four pollinia).
Comparettia Poepp. & Endl. 12 Fernandezia Lindl. (approximately 50 spp.;
Cuitlauzina La Llave & Lex. 5
Figs 1I, 2P, 6) has recently been re-circumscribed to
Cyrtochiloides N.H. Williams & M.W.Chase 9
Cyrtochilum Kunth 9 include both Pachyphyllum and Raycadenco (Chase
Eloyella P.Ortiz 6 & Whitten, 2011). The monotypic Raycadenco has
Erycina Lindl. 10 yellow and brown flowers with a tabula infrastig-
Fernandezia Lindl. 6
matica typical of many oil-bee pollinated species of
Gomesa R.Br. 11
Grandiphyllum Docha Neto 5 Oncidium, although the plants are monopodial (and
Hintonella Ames 6 therefore lack pseudobulbs), a habit shared with
Hofmeisterella Rchb.f. 6 others in this clade. Raycadenco is sister to Fernan-
Ionopsis Kunth 12 dezia and Pachyphyllum. These latter two genera
Leochilus Knowles & Westc. 12
Lockhartia Hook. 5
were previously distinguished on the basis of flower
Macradenia R.Br. 12 size and colour. Pachyphyllum has tiny white or
Macroclinium Barb.Rodr. 12 yellow flowers for which pollinators are unknown,
Miltonia Lindl. 10 whereas Fernandezia s.s. has larger flowers that are
Miltoniopsis God.-Leb. 9
Nohawilliamsia M.W.Chase & Whitten 11
bright red or orange and are hummingbird pollinated.
Notylia Lindl. 12 The two genera are not reciprocally monophyletic in
Notyliopsis P.Ortiz 11 our trees, lending support to our decision to lump
Oliveriana Rchb.f. 10 them into Fernandezia. Given the rampant parallel-
Oncidium Sw. 7,8
Ornithocephalus Hook. 6
ism in floral morphology and, in particular, the fre-
Otoglossum (Schltr.) Garay & Dunst. 9 quent occurrence of oil-bee flowers in Oncidiinae, it
Phymatidium Lindl. 6 makes no sense to keep Raycadenco just because it
Platyrhiza Barb.Rodr. Not sampled has oil-bee flowers when we disregard different polli-
Plectrophora H.Focke 12
Polyotidium Garay 12
nation syndromes in other genera (e.g. Cyrtochilum
Psychopsiella Lckel & Braem 5 Kunth, Gomesa R.Br., Oncidium, etc.).
Psychopsis Raf. 5 The genera that we sampled comprising the former
Pterostemma Kraenzl. 12 Ornithocephalinae are monophyletic in our trees,
Rauhiella Pabst & Braga Not sampled
Rhynchostele Rchb.f. 10
although several are represented by only a single
Rodriguezia Ruiz & Pav. 12 sample (Figs 2KN, 6): Phymatidium Lindl. (ten
Rossioglossum (Schltr.) Garay & G.C.Kenn. 5 spp.), Zygostates Lindl. (20 spp.), Chytroglossa
Saundersia Rchb.f. 5 Rchb.f. (three spp.), Eloyella P.Ortiz (seven spp.),
Schunkea Senghas 12
Hintonella Ames (one sp.) and Ornithocephalus
Seegeriella Senghas 12
Solenidium Lindl. 11 Hook. (50 spp.). These genera possess tiny green to
Suarezia Dodson Not sampled white or yellow flowers that secrete oil via labellar
Sutrina Lindl. Not sampled elaiophores and are pollinated by smaller genera of
Systeloglossum Schltr. 10
oil-collecting bees (Buchmann, 1987). Toscano de
Telipogon Kunth 6
Thysanoglossa Porto & Brade Not sampled Brito & Dressler (2000) transferred all species of
Tolumnia Raf. 11 Sphyrastylis Schltr. into Ornithocephalus, and Dipter-
Trichocentrum Poepp. & Endl. 5 anthus Barb. Rodr. is not separable from Zygostates
Trichoceros Kunth 6
(Chase, 2009b). Genera of the former Ornithocepha-
Trichopilia Lindl. 5
Trizeuxis Lindl. 12 linae not sampled in our study include Centroglossa
Vitekorchis Romowicz & Szlach. 7 Barb.Rodr. (five spp.), Caluera Dodson & Deter-
Warmingia Rchb.f. 12 mann (three spp.), Rauhiella Pabst & Braga (three
Zelenkoa M.W. Chase & N.H.Williams 11
spp.), Platyrhiza Barb.Rodr. (one sp.) and Thys-
Zygostates Lindl. 6
anoglossa Porto & Brade (two spp.). An unpub-
lished analysis of nrITS data (Toscano de Brito, pers. baueri Lindl.). There are many chromosome counts of
comm.) shows that Centroglossa is embedded within 2n = 56 (Tanaka & Kamemoto, 1984).
Zygostates, and thus these two should be merged. His The circumscription of Oncidium has been highly
results also confirm the monophyly and inclusion in contentious, especially among horticulturalists. For
this clade of the other four genera. Although we do many years, the angle of attachment of the lip to
not recognize Centroglossa in this treatment, several column was used to distinguish Oncidium from Mil-
of the species still need to be transferred to tonia Lindl. and Odontoglossum Kunth, although
Zygostates. such angles form a continuum and use of this single-
Hofmeisterella Rchb.f. (one sp.; Fig. 6), Trichoc- character to define genera resulted in highly artificial
eros Kunth (nine spp.; Figs 2U, 6) and Telipogon classifications, as shown by Dressler & Williams
Kunth (170 spp.; Fig. 6) include species formerly (1975). Oncidium is perhaps the best example of our
placed in subtribe Telipogoninae on the basis of four contention that floral morphology must be foregone in
pollinia (versus two in Oncidiinae) and pseudocopu- Oncidiinae as a basis for generic characters. Floral
latory flowers with furry columns and lip calli that traits in Oncidiinae are highly plastic and reflect
are pollinated by male tachinid flies. Within this evolutionary shifts in pollinators. The traditional
clade, monotypic Hofmeisterella is sister to Trichoc- emphasis on floral features has resulted in many
eros (high elevation species with thick, succulent polyphyletic genera. Almost 50 years ago, Garay
leaves and pseudobulbs) and Telipogon (intermediate (1963) admitted the artificiality of many generic
to high elevation species with thin leaves with boundaries within Oncidiinae: To the taxonomist as
reduced or absent pseudobulbs). Previous molecular well as the horticulturalist, it appears to be a serious
studies of this clade showed that Stellilabium Schltr. and unpleasant thought to unite all these genera with
is biphyletic and embedded within Telipogon. One Oncidium, although this course seems to be inevi-
Central American clade of Stellilabium is sister to a table, since the information gained from experiments
Central American clade of Telipogon, and these are in hybridization and from cytological studies strongly
embedded in a South American grade (Williams, points in that direction. We feel that it is better to use
Whitten & Dressler, 2005). vegetative features in combination with a few floral
Vitekorchis Romowicz & Szlach. (six spp.; traits to define broader genera. The molecular analy-
Figs 1J, 7) is an Andean genus that is sister to ses demonstrate the high levels of homoplasy in
Oncidium in our trees but without strong bootstrap pollinator-related traits. Most members of Oncidium
support. The floral similarity to Oncidium and chro- s.s. are characterized by flowers adapted for pollina-
mosome counts of 2n = 56 are evidence supporting tion by relatively large oil-collecting bees (e.g.
their lumping into Oncidium but, without stronger Centris), and many species possess prominent elaio-
molecular support, we prefer to maintain generic phores on the side lobes of the lip together with a
status for this clade at present. Their most distin- tabula infrastigmatica (Fig. 2I, J). Cochlioda and
guishing features are relatively large, sharply ridged Symphyglossum represent adaptations for humming-
pseudobulbs with numerous subtending leaves, bird pollination, with bright red/pink/purple tubular
massive inflorescences and small stipes relative to the flowers (Fig. 2S). The lumping of Sigmatostalix within
pollinia. Our circumscription of Vitekorchis differs Oncidium seems initially inappropriate, although the
greatly from that of Szlachetko. His circumscription vegetative habit of the two taxa differs only in size,
includes several species that should be retained in and the flowers of Sigmatostalix are diminutive rela-
Oncidium (Oncidium boothianum Rchb.f., Oncidium tive to most Oncidium species (Fig. 2O), reflecting
iricolor Rchb.f., Oncidium obryzatum Rchb.f.) adaptations to different groups of smaller oil-
Oncidium Sw. (520 spp.; Figs 1KO, 2I, J, O, S, 7, collecting bees. Although many of the traditionally
8), as circumscribed broadly here, includes many pre- recognized segregate genera are monophyletic in our
viously recognized genera, including Odontoglossum trees (e.g. Sigmatostalix, one clade of Odontoglos-
Kunth, Sigmatostalix Rchb.f., Cochlioda Lindl., Sym- sum), they are embedded within a larger clade of
phyglossum Schltr., Mexicoa Garay, Miltonioides Oncidium species with diverse floral morphologies
Brieger & Lckel and Solenidiopsis Senghas, and a and pollination systems. Recognition of these segre-
number of recent, minor segregates such as Cha- gate genera would require creation of many new
maeleorchis Senghas & Lckel, Collare-stuartense genera to maintain monophyly, and these new genera
Senghas & Bockemhl and Heteranthocidium Szlach., would be difficult to diagnose using floral or vegeta-
Mytnik & Romowicz. With this broad circumscription, tive traits.
it is the largest genus of the subtribe. Oncidium A few species of Oncidium (e.g. Oncidium echinops
species range from Mexico and Florida through the Kniger, Oncidium heteranthum Poepp. & Endl.;
Caribbean, Central America south to Bolivia and Fig. 7) produce branched inflorescences with terminal
Peru, with only one species in Brazil (Oncidium normal flowers on the branches, although the proxi-
mal flowers are abortive and sterile, consisting of rhizomes as a local synapomorphy for the genus (this
only a cluster of yellow tepals that function as osmo- trait occurs elsewhere in Oncidiinae, e.g. some species
phores (W. M. Whitten, pers. observ.). In other species of Cyrtochilum, to which Otoglossum is close).
(Oncidium pentadactylon Lindl.), abortive flowers Cyrtochiloides N.H.Williams & M.W.Chase (four
are terminal, with all other proximal flowers being spp.; Figs 1J, 9) flowers have typical Oncidium-like
normal. Szlachetko, Mytnik-Ejsmont & Romowicz morphology and were considered members of
(2006) described Heteranthocidium to accommodate Oncidium until molecular data revealed their distinc-
these species, although their genus is not monophyl- tiveness (Williams et al., 2001b). Florally, they are
etic in our trees. Moreover, several of the 15 species only divergent from Oncidium in their pollinaria with
they placed in the genus do not possess dimorphic smaller stipes, larger pollinia and well developed,
flowers and are widely scattered in our trees (e.g. stalked caudicles. The generic names alludes to the
Oncidium boothianum, Oncidium exalatum Hgsater, vegetative similarity of the plants to Cyrtochilum;
Oncidium fuscans Rchb.f., Oncidium pollardii Dodson both have ovoid pseudobulbs rounded in cross-section
& Hgsater). All heteranthous species sampled here (not angled) with two to six leaf-bearing subtending
form a clade of 16 accessions (Oncidium retusum sheaths.
Lindl. to Oncidium heterodactylum Kraenzl., Fig. 7), Miltoniopsis God.-Leb. (six spp.; Fig. 9) was split
although not all the species in this clade bear dimor- from Miltonia, and the name reflects their similar
phic flowers consistently (O. retusum, Oncidium floral shapes. The species of Miltoniopsis are distrib-
cultratum Lindl., Oncidium lancifolium Lindl. ex uted from Central America, Venezuela south to Peru,
Benth.). Species delimitation is difficult within this although they are absent from Brazil, whereas Mil-
clade, and there appears to have been multiple loss or tonia spp. are predominately Brazilian (and all are
gains of the heteranthous trait, coupled with its non-Andean). The flowers have broad, flat lips, and at
erratic phenotypic expression. least one species is reported to be pollinated by night-
Otoglossum (Schltr.) Garay & Dunst. (15 spp.; flying ptiloglossine bees (Ptiloglossa ducalis; Dodson,
Fig. 1S, T, 9) was originally regarded as a subgenus of 1965), rather than by oil-collecting anthophorid bees.
Odontoglossum by Schlechter, although the floral Caucaea Schltr. (five to 20 spp.; Fig. 9) was pre-
characters agree most closely with Oncidium. Distri- viously known as the Oncidium cucullatum Lindl.
bution is primarily Andean, extending north to Costa group, a set of poorly defined, high-elevation Andean
Rica, with one species on tepuis of the Guyanan species with showy flowers. Their phylogenetic dis-
shield. It was probably their large, bright reddish tance from Oncidium and their relationships to
brown flowers and occurrence at higher elevations the small-flowered, monotypic Caucaea radiata
that caused them to be placed in Odontoglossum. As (Lindl.) Mansf. were unsuspected until molecular
broadly circumscribed here, Otoglossum includes data revealed their close relationship (Williams et al.,
Oncidium sections Serpentia (Kraenzl.) Garay, 2001b), and they were lumped into Caucaea. Despite
Brevilongium Christenson and Ecuadorella Dodson & the floral similarity to Oncidium, they are not closely-
G.A.Romero. Before molecular data, a close relation- related. Caucaea is sister to Cyrtochilum, a relation-
ship between Otoglossum s.s and Oncidium section ship that was unexpected on the basis of gross floral
Serpentia was totally unsuspected. Otoglossum s.s. shape. The two genera do share subtle traits, includ-
bear many-flowered inflorescences arising laterally ing pseudobulbs that are rounded (not strongly
from pseudobulbs widely spaced on woody rhizomes ancipitous or two-sided) and pollinaria with relatively
(Jenny, 2010), whereas Oncidium section Serpentia short stipes and large caudicles. Both genera also
exhibits a unique vining habit (many meters long) occur in cool, high-elevation Andean cloud forests.
that was interpreted by Christenson (2006) as an Cyrtochilum Kunth (120 spp.; Figs 2C, E, G, H, 9)
indeterminate inflorescence that periodically pro- is restricted to the high Andes of Colombia and Ven-
duces flowering plantlets at the nodes. We regard ezuela south to Peru, with a single species, Cyrtochi-
these elongate, vining structures as stems, not inflo- lum meirax (Rchb.f.) Dalstrm, occurring in the
rescences, making their habit that same as in Oto- Caribbean (Dalstrm, 2001). Many species have
glossum s.s. The molecular data strongly support long (34 m), vining inflorescences and large showy
Oncidium section Serpentia and Otoglossum s.s. as flowers (some with prominent elaiophores; Fig. 2G,
sister taxa, and together they are sister to Otoglos- H), although a few species have diminutive plants
sum harlingii (Stacy) N.H.Williams & M.W.Chase, an and flowers. Vegetatively, Cyrtochilum are distin-
unusual former Oncidium with an odd upright habit guished by dull pseudobulbs that are round or ovoid
with long internodes and dichotomously forking in cross section with two to four apical leaves and two
woody rhizomes. Dodson & Romero created the mono- to six leaf-bearing sheaths and relatively thick roots;
typic genus Ecuadorella for this taxon. The inclusion in contrast, Oncidium spp. have glossy, ancipitous
of all these clades in Otoglossum reveals elongate (two-edged) pseudobulbs and thin roots (Dalstrm,
2001). Dalstrm (2001) and Chase (2009b) discussed Williams et al. (2001b) and subsequently transferred
the tangled taxonomic history of the genus. Previous to a monotypic genus, Phymatochilum Christenson
workers relied almost exclusively on floral traits, (Christenson, 2005), who cited it as an aberrant
resulting in confusion with concepts of Odontoglos- member of Miltonia (a virtual round peg in a square
sum and Oncidium. Lindley, in a series of transfers hole; E. A. Christenson, pers. comm.) but, in our view,
over a period of years (18371842) in Sertum Orchi- it is no more or less aberrant than the other species
daceum, eventually sank both Odontoglossum and with unusual floral traits found in Miltonia.
Cyrtochilum into Oncidium, and Kraenzlin resur- Sister to Miltonia is a clade of the following three
rected the genus in 1922. Dasyglossum Kniger genera with relatively small flowers that have a
& Schildhauer and Trigonochilum Kniger & prominent clinandrial hood on the column and
Schildhauer were created to accommodate some of the strongly ancipitous pseudobulbs:
smaller flowered Cyrtochilum spp., although the Systeloglossum Schltr. (five spp.; Fig. 10) has
authors repeatedly transferred taxa between the two small, yellowgreen or brownishpurple flowers with
genera because they could not decide where they fit a prominent column foot and a simple hinged lip;
on the basis of floral morphology. Senghas (1997) pollination is presumably by nectar-foraging insects.
transferred all Dasyglossum into Trigonochilum Szlachetko (2006) created the monotypic Diadeniopsis
because he could not reliably distinguish them. Szlach. for Systeloglossum bennetii (Garay) Dressler
Neither genus is monophyletic in our DNA trees. & N.H.Williams. His emphasis on and interpretation
Similarly, Buesiella C.Schweinf., Neodryas Rchb.f., of gynostemial structure mistakenly placed it in the
Rusbyella Rolfe ex Rusby and Siederella Mytnik, twig epiphyte clade as a relative of Comparettia.
Grniak & Romowicz are simply diminutive and/or Oliveriana Rchb.f. (six spp.; Fig. 10) is a high-
brightly coloured taxa embedded within Cyrtochilum elevation, Andean genus with relatively flat, open
(Dalstrm, 2001), probably reflecting a shift in polli- flowers, and Chase (2009b) suggested the flowers are
nators, although there are few observations of pollinated by hummingbirds on the basis of polli-
pollination. narium morphology (two, widely spaced pollinia with
Miltonia Lindl. (ten spp.; Fig. 10) occurs in Argen- a wedge-shaped viscidium and a bilobed stigma,
tina, Brazil, Paraguay and Venezuela and is sister to which are otherwise features found in hummingbird-
a clade that includes Systeloglossum Schltr., Oliveri- pollinated species of Oncidiinae). Plants are scandent,
ana Rchb.f., Cischweinfia Dressler & N.H.Williams, in contrast to the mostly caespitose habit of other
Aspasia Lindl. and Brassia. Some Miltonia species genera in this clade.
(e.g. Miltonia regnellii Rchb.f and Miltonia spectabilis Cischweinfia Dressler & N.H.Williams (11 spp.;
Lindl.) have a short column and a broad, flat lip with Fig. 10) grows in middle-elevation forests (up to
a simple, reduced callus, although the floral morphol- 1500 m) from Costa Rica to Bolivia. Flowers have a
ogy varies a great deal among the species. Miltonia tubular lip enfolding the column and are reportedly
clowesii (Lindl.) Lindl. has typical Oncidium-like oil- pollinated by nectar-seeking euglossine bees (Will-
bee flowers, whereas Miltonia candida Lindl. and iams, 1982). Cischweinfia pygmaea (Pupulin, J.Valle
Miltonia russelliana (Lindl.) Lindl. have the lip partly & G.Merino) M.W.Chase has diminutive plants with
or completely encircling the column, giving them the small flowers and a simple lip. It was originally
appearance of a Cischweinfia (suggestive of pollina- described as an Ada, although the molecular data
tion by nectar-foraging bees). They also have the from this study clarified its generic placement (Chase
clinandrial and column arms found in many species of & Whitten, 2011).
Cischweinfia (see below). Miltonia flavescens (Lindl.) Aspasia Lindl. (seven spp.; Fig. 10) ranges from
Lindl. on the other hand resembles a species of Central America, northern South America and the
Brassia in its floral traits, with a similar bilobed lip Andes to coastal Brazil. It is vegetatively similar to
callus forming a nectar-cavity like chamber on the Brassia, although the flowers have a flat lip partially
lip base and elongate, spidery tepals. The above- adnate to a relatively long column and bent at a right
mentioned species with the author combination angle, forming a false nectary. Several species are
(Lindl.) Lindl. are the result of Lindley considering pollinated by euglossine bees, although there may be
these to be species of Cyrtochilum or Odontoglossum a mixture of nectar deceit and fragrance reward
when he first described them, again an indication of involved, depending upon the species (Zimmerman &
the floral diversity present in a small set of species Aide, 1987). Aspasia represents the only known occur-
that forms a clade in our analyses. Like M. clowesii, rence of fragrance-reward male euglossine pollination
M. phymatochila (Lindl.) N.H.Williams & M.W.Chase in this clade (Miltonia to Brassia, Fig. 10).
also has typical oncidioid oil-bee flowers with a large Brassia R.Br. (74 spp.; Figs 2Q, R, 10) includes
complex callus and tabula infrastigmatica. The latter Brachtia, Ada and Mesospinidium. Chase (2009b)
species was transferred from Oncidium to Miltonia by treated these separately but indicated this to be
unsatisfactory. These genera have been difficult to They transferred all these taxa into Rhynchostele, a
separate on the basis of floral and vegetative charac- move that is supported by our molecular data.
ters. Brachtia (seven spp., Andean) is sister to Gomesa R.Br. (125 spp.; Figs 1PR, 11) as circum-
Brassia s.s. (c. 35 spp., Mexico through Central scribed here is relatively broad and includes at least
America, Caribbean, to tropical South America). The 23 other generic concepts (Chase et al., 2009a; Chase,
two genera are vegetatively similar and basic polli- 2009b) with a great diversity of floral morphology and
narium and floral structures are similar. They share size. Gomesa has a centre of distribution in Brazil,
a simple lip with a pair of small basal keels. They especially the Mata Atlntica, where these species
differ mainly in the relative size of the flowers and largely replace Oncidium (the genus in which most of
floral bracts; Brachtia (Fig. 2R) has relatively small them were once included), although it extends to
flowers with large bracts partially enclosing the northern Argentina and Amazonian Peru. Almost all
flowers. These two genera are sister to Ada (approxi- species have fused lateral sepals, a trait that makes
mately 35 spp.) and Mesospinidium (approximately them easy to recognize despite their floral diversity.
seven spp.), both ranging from Central America south By contrast, Oncidium is largely absent from Brazil
through the Andes to Bolivia. Ada was originally (O. baueri is the sole representative), and their lateral
monotypic and composed of a single hummingbird- sepals are usually free. The two genera rarely
pollinated species with bright orange to red flowers produce hybrids in horticulture. Based on the enor-
(Fig. 2Q), although Williams (1972) realized that it mous floral diversity within Gomesa, Brazilian and
was morphologically similar to a clade of Brassia (the French workers have proposed a number of segre-
glumaceous brassias). He transferred this group into gates (Docha Neto, Baptista & Campacci, 2006),
Ada, greatly enlarging the genus. Ada is not mono- although several of these are not monophyletic
phyletic, with Ada allenii (L.O.Williams ex C.Sch- (e.g. Alatiglossum Baptista, Carenidium Baptista,
weinf.) N.H.Williams sister to Mesospinidium and Coppensia Dumort.). Several recent segregates are
remaining Ada. Florally, Mesospinidium are small monotypic: Campaccia venusta (Drapiez) Baptista,
versions of Ada. Given the shared suite of floral P.A.Harding & V.P.Castro; Hardingia paranaensis
morphologies and habits and aberrant phylogenetic (Kraenzl.) Docha Neto & Baptista (not included in our
position of Ada allenii, lumping them all into Brassia analyses); and Nitidocidium gracile (Lindl.) F.Barros
seems the simplest solution. & V.T.Rodriguez. To make matters worse, Szlachetko
The sister relationship between the following two and colleagues also segregated a number of genera
morphologically divergent genera was unsuspected from this same set of species, often using the same
prior to molecular studies. These genera are remark- type species but including different sets of species
ably different in size, habit and floral morphology. than the Brazilian workers (e.g. Concocidium Romow-
Erycina Lindl. (ten spp.; Figs 1U, 10), as broadly icz & Szlach. and Carenidium, both based on
defined by Williams et al. (2001a), includes Psyg- Oncidium concolor Hook.). Also, Szlachetko (2006)
morchis Dodson & Dressler and monotypic Stacyella segregated three species of Oncidium as the genus
Szlach. [= Erycina crista-galli (Rchb.f.) N.H.Williams Rhinocerotidium Szlach. (Oncidium longicornu
& M.W.Chase]. All three genera have bright yellow oil Mutel, Oncidium macronyx Rchb.f and Oncidium rhi-
reward/deceit flowers (Prez-Hrnandez et al., 2011) noceros Rchb.f.; most workers lump these into a single
and were at one time considered members of species). He based the genus mostly upon the large,
Oncidium. Although these three genera could be horn-like lip callus, although the callus is perhaps the
maintained, we favour lumping them to emphasize most variable floral feature within Oncidiinae. These
their similar floral morphology and modified habit species are closely related to G. varicosa (Lindl.)
(absence of an apical leaf on pseudobulbs, if pseudob- M.W.Chase & N.H.Williams, a species with a
ulbs are present). relatively large lip and small callus.
Rhynchostele Rchb.f. (13 spp.; Fig. 10), as circum- Capanemia Barb. Rodr. (seven spp.; Fig. 11) is
scribed here is primarily Mexican and includes represented in our analyses by only a single species,
Amparoa Schltr. and Mesoglossum Halb.; Cymbiglos- Capanemia superflua (Rchb.f.) Garay that is sister to
sum Halb. and Lemboglossum Halb. are later syn- Solenidium Lindl. Recent studies have reduced the
onyms of Rhynchostele. Lumping of these genera is number of species in the genus, although molecular
also supported by anatomical similarities (Rojas Leal, data are needed to confirm whether the seven recog-
1993). Most of these species were treated as members nized species form a monophyletic group (Buzatto,
of Odontoglossum until split out by Halbinger, first as Singer & van den Berg, 2010; Buzatto et al., 2011).
Cymbiglossum and later as Lemboglossum. Morpho- The genus is centred in south-eastern Brazil, extend-
logical analyses by Soto, Salazar & Rojas Leal (1993) ing to Argentina and Uruguay. Florally, the genus is
revealed a close relationship between these species similar to unrelated Leochilus Knowles & Westc.,
and the much reduced Rhynchostele pygmaea Rchb.f. although most species do not produce nectar, except
C. therezae Barb. Rodr. (Buzatto et al., 2011). Singer based on floral oddities; these include Olgasis Raf.,
& Cocucci (1999) reported visits by halictid bees and Antillanorchis (Wright ex Griesb.) Garay, Hispaniella
vespid wasps. Sanderella also falls here (C. van den Braem, Jamaiciella Braem, Braasiella Braem, Lckel
Berg, pers. comm.). Morphologically, Sanderella is & Russmann and Gudrunia Braem. Recognition of all
similar to Capanemia (the oldest name) and should these segregates would require at least a dozen
probably be combined with it. The exact status of genera to be carved from Tolumnia to maintain mono-
Sanderella cannot be determined until it and more phyly. We feel this is unwarranted. Tolumnia is sister
species of Capanemia are sampled. to all others in the remainder of the tree (twig epi-
Solenidium Lindl. (three spp.; Fig. 11) is an Ama- phytes), although this relationship is only weakly
zonian genus similar florally to its sister, Capanemia, supported. In contrast to most twig epiphytes, Tolum-
bearing small flowers with prominent column wings nia spp. occur on the larger axes of trees and live for
and an upturned tip of the anther cap; more detailed many years, rather than being restricted to terminal
studies of both may support their combination. twigs with extremely rapid life cycles, although they
Nohawilliamsia M.W.Chase & Whitten (one sp.; also have seeds with pronounced hooks or knob-like
Figs 1V, 11) was created to accommodate a single odd extensions (Chase, 1988).
species with no close or clear relatives based on
our analyses thus far. It was formerly known as
Oncidium pirarense Rchb.f. (synonym Oncidium THE TWIG EPIPHYTES
orthostates Ridl.) from southern Venezuela, Guyana, The clade comprising the remainder of the tree (Plec-
Suriname and Brazil (Whitten, 2009; Chase, 2009a; trophora H.Focke to Notylia; Fig. 12) has been infor-
Chase et al., 2009a). Although the flowers are similar mally referred to as the twig epiphyte clade. Chase
to many yellow species of Oncidium, they lack a (1988) first discussed the morphological and life-
tabula infrastigmatica. The leaves have a minutely history features that unite these taxa. Twig epiphytes
dentate margin, and plantlets (keikis) are produced often grow on the smallest branches ( 2.5 cm) in
on old inflorescences and on top of old pseudobulbs; exposed, high-light zones, have rapid life cycles (often
all these traits are unusual within Oncidiinae. reaching maturity in one season), produce hooks or
Notyliopsis P.Ortiz (one sp.; Fig. 11) from the wet projections on the seed testa (most likely for attach-
Colombian Choc has diminutive flowers that super- ment to small twigs and rapid uptake of water) and
ficially resemble those of Notylia Lindl., although the exhibit psygmoid (paedomorphic) habits and velamen
pseudobulbs are reminiscent of Zelenkoa. (root epidermis) cells much longer than wide with
Zelenkoa M.W.Chase & N.H.Williams (one sp.; evenly spaced secondary thickenings. Not all taxa in
Figs 1W, 11) was long considered an oddity when it this clade are extreme twig epiphytes restricted to
was included in Oncidium (often in its own monotypic terminal twig habitats, although the majority display
section), although molecular data revealed its distinc- many of these features. Twig epiphytes occur in other
tiveness. Like Nohawilliamsia, it has bright yellow clades of Oncidiinae (e.g. Erycina; Fig. 10), and in
flowers that lack a tabula infrastigmatica. Often epi- other subtribes (e.g. Dendrophylax porrectus (Rchb.f.)
phytic on cacti in dry coastal forests of Ecuador and Carlsward & Whitten, Angraecinae). None of the
Peru, the plants have mottled ovoid pseudobulbs that genera of the twig epiphyte clade (all genera in
resemble those of Notyliopsis, which is also a member Fig. 12) is known to secrete oil or mimic oil flowers.
of this grade relative to Tolumnia and other twig Instead, they attract either nectar-seeking animals or
epiphytes. are pollinated by fragrance-collecting male euglossine
Tolumnia Raf. (40 spp.; Figs 1X, Y, 2D, 11) has bees. Suarezia Dodson (one sp.) was not sampled,
long been recognized as a distinct group (equitant although it is presumed to be a member of this clade
oncidiums) based on their psygmoid fan of succulent on the basis of its morphology.
leaves and usual absence of pseudobulbs. There is Plectrophora H.Focke (nine spp.; Fig. 12) is a
extensive polyploidy within the genus (Braem, 1986), genus of diminutive plants with relatively large
resulting in some conflict between nuclear and plastid flowers with a funnel-shaped lip and a sepaline spur
phylogenetic trees (N. Williams, unpubl. data). Most without nectar horns. The presence of nectar has not
species have oil-bee flowers that do not secrete oil; been confirmed, although the flowers are probably
pollination by Centris bees is reported for several pollinated by long-tongued insects seeking nectar.
species (Nierenberg, 1972; Ackerman, Melndez- Leochilus Knowles & Westc. (12 spp.; Fig. 12) is
Ackerman & Salguero Faria, 1997; Vale et al., 2011). a genus of true twig epiphytes, occurring only on
Tolumnia henekenii (R.H.Schomb. ex Lindl.) Nir has a small branches and twigs. The small flowers of most
furry, insect-like lip and is reportedly pseudocopula- species have a simple lip with a shallow nectar cavity
tory (Dod, 1976). Braem and Garay have published or at the base. Chase (1986a) reported pollination of two
resurrected several (often monotypic) segregates species by nectar-foraging, short-tongued Stelopolybia
wasps and Lasioglossum bees. Three other monotypic terminal clade that includes Rodriguezia Ruiz & Pav.,
genera are now included in Leochilus on the basis of Macroclinium Barb. Rodr. and Notylia.
their position in phylogenetic studies: Goniochilus Sutrina Lindl. (two spp.; Fig. 12) consists of
Chase, Hybochilus Schltr. and Papperitzia Rchb.f. poorly known species from Amazonian Peru and
The floral structure of the first two is similar to that Bolivia. The yellowgreen flowers have simple, linear
of the other species of Leochilus, although that of tepals and lip that do not open widely, forming a
Papperitzia is highly divergent. Despite this, the tube-like structure. Nothing is known of pollination,
single species of Papperitzia was originally included although morphology suggests pollination by nectar-
in Leochilus. foraging insects.
Pterostemma Kraenzl. (two spp.; Fig. 12) is a Rodriguezia Ruiz & Pav. (48 spp.; Figs 2X, 12)
genus of diminutive, extreme Andean twig epiphytes ranges from Mexico south to Argentina, with one
with tiny flowers that are probably bee-pollinated. species (Rodriguezia lanceolata Ruiz & Pav.) found
Their habits are monopodial tufted plants or psymoid on many islands in the Caribbean. The flowers are
fans 12 cm in size. The flowers have a dorsal anther relatively large, brightly coloured and showy for
with long stipe and long, forward-sweeping column members of the twig epiphyte clade. The lip is often
arms. Both sequence data and morphology confirmed relatively large and flat, and the lateral sepals are
a close relationship of Hirtzia Dodson to Pterostemma, fused along one or both lateral margins to form a
so the two were lumped (Chase, Williams & Whitten, curved nectar spur. A projection from the column
2009b). base secretes nectar into this spur. Reported polli-
Ionopsis Kunth (three spp.; Fig. 12) ranges widely nators include hummingbirds, butterflies and nectar-
throughout the Neotropics. The white to pink flowers foraging bees (Dodson, 1965). There are two strongly
have a simple lip with a short sepalar spur without supported clades within Rodriguezia, and Chase
any obvious reward and are probably pollinated by (2009b) noted the non-monophyletic placement of
nectar-seeking bees. Rodriguezia decora Rchb.f. in nrITS trees published
Comparettia Poepp. & Endl. (60 spp.; Figs 2W, in Genera Orchidacearum. This unusual Brazilian
12) is broadly circumscribed here to include all species was not included our sampling, although it
species with sepalar nectar spur(s) furnished by a may warrant generic status. It has long, wiry rhi-
horn or pair of horns on the column base that secrete zomes between sympodia and lacks the spur found
nectar. Generic segregates lumped here include Dia- in other species.
denium Poepp. & Endl., Chaenanthe Lindl., Scelochi- Schunkea Senghas (one sp.; Fig. 12) is known
lus Klotzsch, Neokoehleria Schltr., Scelochiloides only from south-eastern Brazil; the small cream
Dodson & M.W.Chase, Stigmatorthos M.W.Chase & flowers have an open lip and an unusual pair of
D.E.Bennett, Pfitzeria Senghas and Scelochilopsis downward-pointing arms on the column apex.
Dodson & M.W.Chase. As more species in this clade Nothing is known of pollination. Its placement within
were discovered in recent years, generic limits this clade is unresolved, and Chase (2009b) hypoth-
became more obscure, and the amalgamation of all esized that it might be related to the monotypic
taxa with nectar horns into a single genus appears to Suarezia from eastern Ecuador. The latter was not
be the best solution. Scelochilus does not appear to be included in our sampling.
monophyletic. There is variation in vegetative habit Trizeuxis Lindl. (one sp.; Fig. 12) is wide ranging
within this clade from psygmoid fans to caespitose from Costa Rica south to Peru and also in eastern
plants with bifacial leaves and pseudobulbs. Some Brazil. Its flowers are perhaps the smallest of any
species can begin flowering as juvenile psygmoid Oncidiinae, only 23 mm across, yet they are outcross-
plants before transformation into adult plants with ing and often found growing on twigs of cultivated
pseudobulbs, and damage can cause a reversal to Citrus L and Psidium L. Pollinators are unknown,
psygmoid seedling habit. Pollination by humming- although presumed to be small nectar-foraging
birds (Amazalia sp., Chlorostilbon maugaeus) is insects.
documented for Comparettia falcata (Dodson, 1965; Seegeriella Senghas (two spp.; Fig. 12) is
Salguero-Faria & Ackerman, 1999). Pollination by restricted to Argentina and Brazil. Like Trizeuxis,
butterflies and long-tongued bees appears likely for the yellowgreen flowers are diminutive with a
some taxa. simple lip and sepals that do not open widely. Pol-
Polyotidium Garay (one sp.; Fig. 12) is reported linators are presumed to be nectar-seeking insects.
only from Ecuador, Venezuela, Brazil and the Orinoco The remaining four genera are all pollinated by
drainage of Colombia. The 5 mm, fleshy bright orange fragrance-collecting male euglossine bees, and all but
flowers have a simple lip and a dorsal anther, sug- Warmingia Rchb.f. have a narrow, slit-like stigma,
gestive of hummingbird pollination. Its phylogenetic pollinaria with a button-like viscidium and a long,
position is unresolved within a strongly supported narrow stipe and pollinia that are dorsiventrally
flattened and thin to match the opening of the CONCLUSION

slit-like stigmatic cavity. The narrow pollinia and
The present study presents well supported and highly
stigmatic slit probably act to reduce self-pollination.
resolved phylogenetic hypotheses of relationships of all
When first removed by a bee, the pollinia are too
major clades within Oncidiinae based on dense taxon
wide to fit easily into the stigmatic slit, and the
sampling. The deeper topology of this tree strongly
stigma is too narrow (W. M. Whitten, pers. observ.).
reflects the emphasis on plastid data. Additional
The stigma widens after pollinarium removal. Several
nuclear data sets such as Xdh (Grniak, Paun &
minutes to hours of drying are required to shrink the
Chase, 2010) would be useful to increase support for
pollinia before they will slip into the stigma, during
the topology and improve resolution of the spine of the
which time the bee is likely to have flown to another
tree. Our translation of this tree into a generic classi-
plant.
fication results in the first classification of Oncidiinae
Macradenia R.Br. (ten spp.; Fig. 12) ranges from
in which the genera are demonstrably monophyletic.
Mexico south throughout most of lowland South
Comparison of our trees with previous classifications
America. The pendent, unbranched inflorescence
reveals that most of the taxonomic disputes involve
bears numerous flowers that attract fragrance-
clades that contain large numbers of species with
collecting male euglossine bees. The anther is termi-
yellow oncidioid floral morphology. We hypothesize
nal and beaked, and the column and lip are twisted,
that widespread mimicry involving Malpighiaceae,
giving the flower a distinct asymmetry unique within
Oncidiinae and perhaps Calceolaria (Calceolariaceae)
Oncidiinae. This asymmetry may be related to polli-
has resulted in extensive homoplasy in gross floral
narium deposition on the side of the head or eye of
features within Oncidiinae. Previous noncladistic clas-
the bee.
sifications of Oncidiinae were largely based on floral
Warmingia Rchb.f. (three spp.; Fig. 12) has an
characters, and the homoplasy in oil flower-related
oddly disjunct distribution, including Costa Rica,
floral traits resulted in non-monophyletic generic con-
southern Ecuador and Brazil. Pollination has not
cepts. Clades with other pollination syndromes (e.g.
been reported, although their floral fragrance is
nectar reward/deceit or male euglossine fragrance
similar to some Macroclinium and is produced abun-
rewards) generally display fewer taxonomic disagree-
dantly during the morning, suggestive of pollination
ments. The generic scheme presented here paves the
by male euglossine bees.
way for monographic work and studies of character
Macroclinium Barb. Rodr. (40 spp.; Figs 2Z, 12)
evolution. Orchid taxonomists may still disagree on
ranges throughout much of the Neotropics from
which clades to recognize at generic level (e.g. within
Mexico south to Peru and Brazil. The plants are
Trichocentrum s.l.), although the phylogenetic hypoth-
diminutive extreme twig epiphytes, and are often
eses from the present study will be useful for framing
found on cultivated Citrus and Psidium. The flowers
such debates.
are similar in morphology and function to its sister
genus Notylia, although the two differ in inflorescence
and vegetative habit. Macroclinium species are often
ACKNOWLEDGEMENTS
monopodial, with small psygmoid fans generally
lacking pseudobulbs. The inflorescence is pendent, The authors thank the herbaria of the Pontificia
pseudo-umbellate, with clusters of numerous delicate Universidad Catlica de Quito (QCA), the Univer-
flowers with narrow sepals, petals and lip. Despite sidad de Panam (PMA), the Universidad de Costa
their small size, the fragrant flowers attract relatively Rica (USJ), the Ministerio del Ambiente of Ecuador,
large male euglossine bees. Pollinaria are deposited and the Autoridad Nacional del Ambiente of Panama
on the face (frons) of the bee during fragrance collec- for facilitating our research and issuing collecting and
tion (Dodson, 1967). CITES permits. We are especially grateful to the
Notylia Lindl. (60 spp.; Fig. 12) also range Portilla family and their staff at Ecuagenera Ltd.
throughout much of the Neotropics, similar to its (Ecuador), Andrs Maduro and staff at Finca Dracula
sister, Macroclinium. In contrast to the paedomorphic (Panama), Jardn Botnico Lankester (Costa Rica),
fans of Macroclinium, plants of Notylia mature to Marie Selby Botanical Gardens (Sarasota, FL, USA),
bear a pseudobulb and relatively large conduplicate Atlanta Botanical Garden (Atlanta, GA, USA), Steve
leaves. The flowers are similar to those of Macro- Beckendorf (Berkeley, CA, USA), Harry and Andy
clinium, although they are presented evenly spaced Phillips (Encinitas, CA, USA) and Gnter Gerlach
on a pendent, usually unbranched raceme. Pollination (Munich Botanical Garden, Munich, Germany) for
is also by fragrance-collecting male euglossine bees, allowing us generous access to their orchid collec-
with pollinarium deposition on the labrum or frons of tions. Delsy Trujillo contributed Peruvian specimens.
the bee (Warford, 1992; Singer & Koehler, 2003; Samantha Koehler, Universidade Federal de So
Prez-Hrnandez et al., 2011). Paulo, SP, Brazil and Aparacida de Faria, Univer-
sidade Estadual de Maring, PR, Brazil contributed A comparative survey of floral characters in Capanemia
data for Brazilian taxa. Robert L. Dressler and Barb. Rodr. (Orchidaceae:Oncidiinae). Annals of Botany doi:
Calaway H. Dodson helped to initiate this project 10.1093/aob/mcr241.
and provided access to specimens, taxonomic advice Buzatto CR, Singer RB, Romero-Gonzlez GA, van den
and assistance with field work. Stig Dalstrm pro- Berg C. 2011. Typifications and new synonymies in Capa-
vided invaluable determinations of many specimens nemia (Orchidaceae: Oncidiinae). Novon 21: 2833.
and stimulating discussions. Kent Perkins (FLAS) Buzatto CR, Singer RB, van den Berg C. 2010. O gnero
Capanemia Barb. Rodr. (Oncidiinae: Orchidaceae) na Regio
provided specimen curation and image databasing.
Sul do Brasil. Revista Brasileira de Biocincias 8: 309
DNA sequencing was performed by the ICBR core
323.
facility at University of Florida. This work was
Cameron KM. 2004. Utility of plastid psaB gene sequences
supported by NSF grants DEB-9815821 to N.H.W.,
for investigating intrafamilial relationships within Orchi-
DEB-9509071 to W.M.W., DEB-0234064 to N.H.W. daceae. Molecular Phylogenetics and Evolution 31: 1157
and W.M.W., and IOB-0543659 to J.C.C., N.H.W. and 1180.
W.M.W., by grants from the American Orchid Society Cameron KM, Chase MW, Whitten WM, Kores PJ,
Fund for Education and Research, the Florida Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman
Museum of Natural History, and the Royal Botanic DH. 1999. A phylogenetic analysis of the Orchidaceae: evi-
Gardens, Kew. Additional funding was provided by dence from rbcL nucleotide sequences. American Journal of
Furniss Foundation graduate student fellowships Botany 86: 208224.
from the American Orchid Society to M. A. Blanco Cane JH, Eickwort GC, Wesley FR, Spielholz J. 1983.
and L. Endara and by a RBG Kew Latin American Foraging, grooming and mate-seeking behaviors of Macropis
Research Fellowship to M. A. Blanco (to study speci- nuda (Hymenoptera, Melittidae) and use of Lysimachia
mens in European herbaria). ciliata (Primulaceae) oils in larval provisions and cell
linings. American Midland Naturalist 110: 257264.
Carmona-Daz G, Garca-Franco JG. 2009. Reproductive
REFERENCES
success in the Mexican rewardless Oncidium cosymbepho-
Ackerman JD, Melndez-Ackerman EJ, Salguero Faria rum (Orchidaceae) facilitated by the oil-rewarding Mal-
J. 1997. Variation in pollinator abundance and selection on pighia glabra (Malpighiaceae). Plant Ecology 203: 253261.
fragrance phenotypes in an epiphytic orchid. American Charanasri U, Kamemoto H. 1975. Additional chromosome
Journal of Botany 84: 13831390. numbers in Oncidium and allied genera. American Orchid
Aliscioni SS, Torretta JP, Bello ME, Galati BG. 2009. Society Bulletin 44: 686691.
Elaiophores in Gomesa bifolia (Sims) MW Chase & NH Chase MW. 1986a. Pollination biology of two sympatric,
Williams (Oncidiinae: Cymbidieae: Orchidaceae): structure synchonously flowering species of Leochilus in Costa Rica.
and oil secretion. Annals of Botany 104: 11411149. Lindleyana 1: 141147.
Bembe B. 2004. Functional morphology in male euglossine Chase MW. 1986b. A reappraisal of the oncidioid orchids.
bees and their ability to spray fragrances (Hymenoptera, Systematic Botany 11: 477491.
Apidae, Euglossini). Apidologie 35: 283291. Chase MW. 1988. Obligate twig epiphytes: a distinct subset
van den Berg C, Goldman DH, Freudenstein JV, Prid- of Neotropical orchidaceous epiphytes. Selbyana 10: 2430.
geon AM, Cameron KM, Chase MW. 2005. An overview Chase MW. 2005. Psychopsis limminghei. Curtiss Botanical
of the phylogenetic relationships within Epidendroideae Magazine 22: 5355.
inferred from multiple DNA regions and recircumscription Chase MW. 2009a. A new name for the single species of
of Epidendreae and Arethuseae (Orchidaceae). American Nohawilliamsia and corrections in Gomesa (Orchidaceae).
Journal of Botany 92: 613624. Phytotaxa 1: 5759.
Braem G. 1986. The taxonomy of plants formerly referred to Chase MW. 2009b. Subtribe Oncidiinae. In: Pridgeon AM,
Oncidium section Oncidium (Orchidaceae) in the Caribbean Chase MW, Cribb PJ, Rasmussen FN, eds. Genera Orchi-
islands. PhD dissertation, University of Newcastle Upon dacearum, Vol. 5. Epidendroideae (part two). Oxford: Oxford
Tyne. University Press, 211394.
Braem G. 1993. Studies in the Oncidiinae, discussion of some Chase MW, Cameron KM, Barrett RL, Freudenstein JV.
taxonomic problems with description of Gudrunia Braem, 2003. DNA data and Orchidaceae systematics: a new phy-
gen. nov., and the reinstatement of the genus Lophiaris logenetic classification. In: Dixon KW, Kell SP, Barrett RL,
Rafinesque. Schlecteriana 4: 829. Cribb PJ, eds. Orchid conservation. Kota Kinabalu: Natural
Braem G. 2010. Comments on plant taxonomy with special History Publications, 6989.
reference to Orchidaceae and monospecific genera. Richar- Chase MW, Hanson L, Albert VA, Whitten WM, Williams
diana 10: 101117. NH. 2005. Life history evolution and genome size in subtribe
Buchmann SL. 1987. The ecology of oil flowers and their Oncidiinae (Orchidaceae). Annals of Botany 95: 191199.
bees. Annual Review of Ecology and Systematics 18: 343 Chase MW, Hills HH. 1991. Silica gel: an ideal material for
396. field preservation of leaf samples for DNA studies. Taxon 40:
Buzatto CR, Davies KL, Singer RB, dos Santos RP. 2011. 215220.
Chase MW, Olmstead RG. 1988. Isozyme number in sub- Dodson CH. 2003. Native ecuadorian orchids, Vol. 5.
tribe Oncidiinae (Orchidaceae) an evaluation of polyp- Sarasota: The Dodson Trust.
loidy. American Journal of Botany 75: 10801085. Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure
Chase MW, Palmer JD. 1987. Chloroplast DNA systematics for small quantities of fresh leaf tissue. Phytochemical
of the subtribe Oncidiinae (Orchidaceae). American Journal Bulletin, Botanical Society of America 19: 1115.
of Botany 74: 728728. Dressler RL. 1993. Phylogeny and classification of the orchid
Chase MW, Whitten WM. 2011. Further taxonomic transfers family. Portland, OR: Dioscorides Press.
in Oncidiinae (Orchidaceae). Phytotaxa 20: 2632. Dressler RL, Williams NH. 1975. El Complejo Oncidoglos-
Chase MW, Williams NH, de Faria AD, Neubig KM, sum Confusum. Orqudea (Mxico) 4: 332352.
Amaral MDCE, Whitten WM. 2009a. Floral convergence Eltz T, Roubik D, Lunau K. 2005. Experience-dependent
in Oncidiinae (Cymbidieae; Orchidaceae): an expanded choices ensure species-specific fragrance accumulation in
concept of Gomesa and a new genus Nohawilliamsia. male orchid bees. Behavioral Ecology and Sociobiology 59:
Annals of Botany 104: 387402. 149156.
Chase MW, Williams NH, Whitten WM. 2009b. Oncidiinae Felsenstein J. 1985. Confidence limits on phylogenies an
nomenclature: generic changes in Genera Orchidacearum, approach using the bootstrap. Evolution 39: 783791.
Vol. 5. Orchids 78: 228238. Fernandez-Concha GC, de Stefano RD, Romero-
Christenson EA. 1999. The return of Cohniella (Orchi- Gonzlez GA, Balam R, Cetzal W, Tapia-Munoz JL,
daceae: Oncidiinae). Lindleyana 14: 176177. Ramirez IM. 2009. A reappraisal of the turtle-orchids,
Christenson EA. 2005. Phymatochilum, un nouveau genre genus Chelyorchis (Oncidiinae: Orchidaceae): molecular,
monotypique du Brsil (Orchidaceae: Oncidiinae). Richardi- phylogenetic, and morphometric approaches. Journal of the
ana 5: 194196. Torrey Botanical Society 136: 164185.
Christenson EA. 2006. Brevilongium, un nouveau genre Fernandez-Concha GC, Ix WRC, Narvaez R, Romero-
notropical (Orchidaceae: Oncidiinae). Richardiana 6: Gonzlez GA. 2010. A synopsis of Cohniella (Orchidaceae,
4549. Oncidiinae). Brittonia 62: 153177.
Cribb PJ. 2009. Tribe Cymbidieae. In: Pridgeon AM, Chase Garay LA. 1963. Oliveriana and its position in the Oncidieae.
MW, Cribb PJ, Rasmussen FN, eds. Genera Orchidacearum, American Orchid Society Bulletin 32: 1924.
Vol. 5. Epidendroideae (part two). Oxford: Oxford University Garay LA, Stacy JE. 1974. Synopsis of the genus Oncidium.
Press, 311. Bradea 1: 393429.
Dalstrm S. 2001. A synopsis of the genus Cyrtochilum Grniak M, Paun O, Chase MW. 2010. Phylogenetic rela-
(Orchidaceae: Oncidiinae): taxonomic reevaluation and new tionships within Orchidaceae based on a low-copy nuclear
combinations. Lindleyana 16: 5680. coding gene, Xdh: congruence with organellar and nuclear
Damon AA, Cruz-Lpez L. 2006. Fragrance in relation to ribosomal DNA results. Molecular Phylogenetics and
pollination of Oncidium sphacelatum and Trichocentrum Evolution 56: 784795.
oerstedii (Orchidaceae) in the Soconusco region of Chiapas, Jenny R. 2010. Otoglossum, una revisin taxonmica.
Mexico. Selbyana 27: 186194. Orquideologia 27: 6390.
Davies KL, Stpiczynska M. 2009. Comparative histology of Johnson LA, Soltis DE. 1994. matK DNA sequences and
floral elaiophores in the orchids Rudolfiella picta (Schltr.) phylogenetic reconstruction in Saxifragaceae s.st. System-
Hoehne (Maxillariinae sensu lato) and Oncidium ornitho- atic Botany 19: 143156.
rhynchum HBK (Oncidiinae sensu lato). Annals of Botany Melo GAR, Gaglianone MC. 2005. Females of Tapinota-
104: 221234. spoides, a genus in the oil-collecting bee tribe Tapinota-
Docha Neto A, Baptista DH, Campacci MA. 2006. Novos spidini, collect secretions from non-floral trichomes
generos baseadas nos Oncidium brasileiros. Coletna de (Hymenoptera, Apidae). Revista Brasileira De Entomologia
Orquideas Brasileiras 3: 2095. 49: 167168.
Dod DD. 1976. Oncidium henekenii bee orchid pollinated by Molvray M, Kores PJ, Chase MW. 2000. Polyphyly of
bee. American Orchid Society Bulletin 45: 792794. mycoheterotrophic orchids and functional influences of
Dodson CH. 1957. Chromosome number in Oncidium and floral and molecular characters. In: Wilson KL, Morrison
allied genera. American Orchid Society Bulletin 26: 323 DA, eds. Monocots: systematics and evolution. Collingswood:
330. CSIRO Publishing, 441448.
Dodson CH. 1962. The importance of pollination in the Neubig KM, Whitten WM, Carlsward BS, Blanco MA,
evolution of the orchids of tropical America. American Endara L, Williams NH, Moore M. 2009. Phylogenetic
Orchid Society Bulletin 31: 525534 641649,731735. utility of ycf1 in orchids: a plastid gene more variable than
Dodson CH. 1965. Agentes de polinizacin y su influencia matK. Plant Systematics and Evolution 277: 7584.
sobre la evolucin de la familia Orquidacea. Universidad Nierenberg L. 1972. The mechanism of the maintenance of
Nacional de la Amazona Peruana, Instituto General de the species integrity in sympatrically occurring equitant
Investigacin. oncidiums in the Caribbean. American Orchid Society Bul-
Dodson CH. 1967. Studies in orchid pollination: the letin 41: 873881.
genus Notylia. American Orchid Society Bulletin 36: Pansarin LM, Castro MD, Sazima M. 2009. Osmophore
209214. and elaiophores of Grobya amherstiae (Catasetinae, Orchi-
daceae) and their relation to pollination. Botanical Journal Silvera K, Neubig KM, Whitten WM, Williams NH,
of the Linnean Society 159: 408415. Winter K, Cushman JC. 2010a. Evolution along the cras-
Parra-Tabla V, Vargas CF, Magana-Rueda S, Navarro J. sulacean acid metabolism continuum. Functional Plant
2000. Female and male pollination success of Oncidium Biology 37: 9951010.
ascendens Lindey (Orchidaceae) in two contrasting habitat Silvera K, Santiago LS, Cushman JC, Winter K. 2010b.
patches: forest vs agricultural field. Biological Conservation The incidence of crassulacean acid metabolism in Orchi-
94: 335340. daceae derived from carbon isotope ratios: a checklist of the
Prez-Hrnandez H, Damon A, Valle-Mora J, Snches- flora of Panama and Costa Rica. Botanical Journal of the
Guillen D. 2011. Orchid polllination: specialization in Linnean Society 163: 194222.
chance? Botanical Journal of the Linnean Society 165: 251 Silvera K, Santiago LS, Cushman JC, Winter K. 2009.
266. Crassulacean acid metabolism and epiphytism linked to
van der Pijl L, Dodson CH. 1966. Orchid flowers: their adaptive radiations in the Orchidaceae. Plant Physiology
pollination and evolution. Coral Gables, FL: University of 149: 18381847.
Miami Press. Singer RB, Cocucci AA. 1999. Pollination mechanisms in
Powell MP. 2008. Evolutionary ecology of Neotropical four sympatric southern Brazilian Epidendroideae orchids.
orchids, with an emphasis on Oncidiinae. PhD dissertation, Lindleyana 14: 4756.
University of Reading. Singer RB, Koehler S. 2003. Notes on the pollination of
Reis MG, de Faria AD, Bittrich V, Amaral MDE, Mar- Notylia nemorosa (Orchidaceae): do pollinators necessarily
saioli AJ. 2000. The chemistry of flower rewards promote cross-pollination? Journal of Plant Research 116:
Oncidium (Orchidaceae). Journal of the Brazilian Chemical 1925.
Society 11: 600608. Sosa V, Chase MW, Salazar GE, Whitten WM, Williams
Reis MG, de Faria AD, dos Santos IA, Amaral MDE, NH. 2001. Phylogenetic position of Dignathe (Orchidaceae:
Marsaioli AJ. 2007. Byrsonic acid the clue to floral Oncidiinae): evidence from nuclear ITS ribosomal DNA
mimicry involving oil-producing flowers and oil-collecting sequences. Lindleyana 16: 94101.
bees. Journal of Chemical Ecology 33: 14211429. Soto M, Salazar GA, Rojas Leal A. 1993. Nomenclatural
Rojas Leal A. 1993. Anatoma foliar comparada de Lembo- changes in Rhynchostele, Mesoglossum, and Lemboglossum
glossum (Orchidaceae: Oncidiinae) y generos relacionados. (Orchidaceae, Oncidiinae). Orqudea (Mxico) 13: 145152.
Bilogo thesis, Universidad Nacional Autonoma de Mexico. Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-
Roubik DW. 1989. Ecology and natural history of tropical based phylogenetic analyses with thousands of taxa and
bees. New York, NY: Cambridge University Press. mixed models. Bioinformatics 22: 26882690.
Roy BA, Widmer A. 1999. Floral mimicry: a fascinating yet Stpiczynska M, Davies KL. 2008. Elaiophore structure and
poorly understood phenomenon. Trends in Plant Science 4: oil secretion in flowers of Oncidium trulliferum Lindl. and
325330. Ornithophora radicans (Rchb.f.) Garay & Pabst (Oncidiinae
Salguero-Faria JA, Ackerman JD. 1999. A nectar reward: : Orchidaceae). Annals of Botany 101: 375384.
is more better? Biotropica 31: 303311. Stpiczynska M, Davies KL, Gregg A. 2007. Elaiophore
Sandoval-Zapotitla E, Garca-Cruz J, Terrazas T, diversity in three contrasting members of Oncidiinae
Villasenor JL. 2010. Phylogenetic relationships of the (Orchidaceae). Botanical Journal of the Linnean Society
subtribe Oncidiinae (Orchidaceae) inferred from structural 155: 135148.
and DNA sequences (matK, ITS): a combined approach. Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994. Phylo-
Revista Mexicana De Biodiversidad 81: 263279. genetic analysis of Sorghum and related taxa using internal
Sandoval-Zapotitla E, Terrazas T. 2001. Leaf anatomy of transcribed spacers of nuclear ribosomal DNA. Theoretical
16 taxa of the Trichocentrum clade (Orchidaceae: Oncidii- and Applied Genetics 89: 2632.
nae). Lindleyana 16: 8193. Szlachetko DL. 1995. Systema orchidalium, fragmenta flo-
Sazima M, Sazima I. 1988. Oil-gathering bees visit flowers of ristica et geobotanica. Supplementum 3. Krakw: W. Szafer
eglandular morphs of the oil-producing Malpighiaceae. Institute of Botany, Polish Academy of Sciences.
Botanica Acta 102: 106111. Szlachetko DL. 2006. Genera et species orchidalium. 11.
Senghas K. 1997. Rudolf schlecters die orchideen, band i/c, Oncidieae. Polish Botanical Journal 51: 3941.
33-36. Berlin: Paul Parey. Szlachetko DL, Mytnik-Ejsmont J, Romowicz A. 2006.
Senghas K. 2001. Neobennettia, eine neue Gattung aus den Genera et species orchidalium. 14. Oncidieae. Polish Botani-
peruanischen Anden mit einem Uberblick zur Gattung cal Journal 51: 5355.
Lockhartia. Journal fr den Orchideenfreund 8: 354364. Tanaka R, Kamemoto H. 1984. Chromosomes in orchids:
Sigrist MR, Sazima M. 2004. Pollination and reproductive counting and numbers. In: Arditti J, ed. Orchid biology:
biology of twelve species of neotropical Malpighiaceae: reviews and perspectives, III. Ithaca, NY: Cornell University
stigma morphology and its implications for the breeding Press, 324410.
system. Annals of Botany 94: 3341. Tavare S. 1986. Some probabilistic and statistical problems
Silvera K. 2002. Adaptive radiation of oil-reward compounds in the analysis of DNA sequences. Lectures on Mathematics
among neotropical orchid species (Oncidiinae). MS Thesis, in the Life Sciences 17: 5686.
University of Florida. Toscano de Brito ALV, Dressler RL. 2000. New combina-
tions in Ornithocephalus (Ornithocephalinae: Orchidaceae) from four DNA sequence regions: expanded circumscriptions
and description of a new species from Mesoamerica. Lind- of Cyrtochilum, Erycina, Otoglossum, and Trichocentrum
leyana 15: 252256. and a new genus (Orchidaceae). Lindleyana 16: 113
Vale A, Navarro L, Rojas D, lvarez JC. 2011. Breeding 139.
system and pollination by mimicry of the orchid Tolumnia Williams NH, Chase MW, Whitten WM. 2001b. Phyloge-
guibertiana in Western Cuba. Plant Species Biology 26: netic positions of Miltoniopsis, Caucaea, a new genus,
163173. Cyrtochiloides, and Oncidium phymatochilum (Orchidaceae:
Warford N. 1992. Pollination biology: the reciprocal agree- Oncidiinae). Lindleyana 16: 272285.
ment between Notylia and Euglossa viridissima. American Williams NH, Whitten WM, Dressler RL. 2005. Molecular
Orchid Society Bulletin 61: 885889. systematics of Telipogon (Orchidaceae: Oncidiinae) and its
Whitten MW, Williams NH, Chase MW. 2000. Subtribal allies: nuclear and plastid DNA sequence data. Lankesteri-
and generic relationships of Maxillarieae (Orchidaceae) ana 5: 163184.
with emphasis on Stanhopeinae: combined molecular evi- Xu DH, Abe J, Sakai M, Kanazawa A, Shimamoto Y.
dence. American Journal of Botany 87: 18421856. 2000. Sequence variation of non-coding regions of chloro-
Whitten WM. 2009. Nohawilliamsia: a new genus honors plast DNA of soybean and related wild species and its
Norris H. Williams, PhD. Orchids 78: 552555. implications for the evolution of different chloroplast
Williams NH. 1972. A reconsideration of Ada and the haplotypes. Theoretical and Applied Genetics 101: 724
glumaceous brassias (Orchidaceae). Brittonia 24: 732.
93110. Zimmerman JK, Aide TM. 1987. Patterns of flower and
Williams NH. 1982. The biology of orchids and euglos- fruit production in the orchid Aspasia principissa Rchb.f.
sine bees. In: Arditti J, ed. Orchid biology: reviews and American Journal of Botany 74: 661661.
perspectives II. Ithaca, NY: Cornell University Press, 119 Zimmermann Y, Roubik DW, Quezada-Euan JJG,
171. Paxton RJ, Eltz T. 2009. Single mating in orchid bees
Williams NH, Chase MW, Fulcher T, Whitten WM. 2001a. (Euglossa, Apinae): implications for mate choice and social
Molecular systematics of the Oncidiinae based on evidence evolution. Insectes Sociaux 56: 241249.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article:
Appendix S1. List of voucher specimens and GenBank numbers. The DNA numbers correspond to individuals
sequenced in Figs 312.
Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting materials
supplied by the authors. Any queries (other than missing material) should be directed to the corresponding
author for the article.

Neu Big 2011

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Neu Big 2011

Uploaded by

Copyright:

Available Formats

Botanical Journal of the Linnean Society, 2012, 168, 117146.

Generic recircumscriptions of Oncidiinae (Orchidaceae:

ADDITIONAL KEYWORDS: elaiophores euglossine pollination hummingbird pollination matK

INTRODUCTION Neotropical flora, ranging from sea level to almost

53 W1696 Comparettia heterophylla

99 W0662 Zelenkoa onusta

98 W0091 Miltonia regnelii

89 * W0513 Hintonella mexicana

62 W1696 Comparettia heterophylla

* * * N268 Oncidium hyphaematicum

* * N440 Telipogon vargasii

* * W2353 Trichoceros antennifer

* * B2558 Lockhartia micrantha

C003 Rossioglossum ampliatum

* ** * = 95-100% bootstrap support

N350 Trichocentrum undulatum 84

N026 Trichocentrum lanceanum

N215 Oncidium hauensteinii

N602 Oncidium manuelariasii

W1553 Cyrtochilum myanthum Trigonochilum

N710 Gomesa recurva

DT427 Notylia sp. 52

N438 Macradenia rubescens

W2688 Comparettia falcata 93

to Fig. 11 0.001 substitutions/site to Fig. 11

flattened and thin to match the opening of the CONCLUSION

You might also like