Professional Documents
Culture Documents
GENERAL
BIOLOGY 1
SPECIALIZED SUBJECT | ACADEMIC-STEM
Writers: Doreen D. Domingo, Ph.D., Aileen C. dela This Teaching Guide by the
Cruz, Chuckie Fer A. Calsado, Doreen D. Commission on Higher Education is
Domingo, Janet S. Estacion, Justin Ray M. Guce, licensed under a Creative
Mary Jane C. Flores, Nolasco H. Sablan Commons Attribution-
NonCommercial-ShareAlike 4.0
Technical Editors: Annalee S. Hadsall, Ph.D. International License. This means
Published by the Commission on Higher Education, 2016 Copy Reader: Caroline H. Pajaron you are free to:
Chairperson: Patricia B. Licuanan, Ph.D. Share — copy and redistribute the
Illustrator: Ma. Daniella Louise F. Borrero
material in any medium or format
Commission on Higher Education
Cover Artists: Paolo Kurtis N. Tan, Renan U. Ortiz Adapt — remix, transform, and
K to 12 Transition Program Management Unit
build upon the material.
Office Address: 4th Floor, Commission on Higher Education, The licensor, CHED, cannot revoke
C.P. Garcia Ave., Diliman, Quezon City
Senior High School Support Team these freedoms as long as you
Telefax: (02) 441-0927 / E-mail Address: k12@ched.gov.ph CHED K to 12 Transition Program Management Unit follow the license terms. However,
Program Director: Karol Mark R. Yee under the following terms:
Attribution — You must give
Lead for Senior High School Support: appropriate credit, provide a link to
Consultants Gerson M. Abesamis the license, and indicate if changes
THIS PROJECT WAS DEVELOPED WITH THE PHILIPPINE NORMAL UNIVERSITY.
were made. You may do so in any
Lead for Policy Advocacy and Communications: reasonable manner, but not in any
University President: Ester B. Ogena, Ph.D.
Averill M. Pizarro way that suggests the licensor
VP for Academics: Ma. Antoinette C. Montealegre, Ph.D.
endorses you or your use.
VP for University Relations & Advancement: Rosemarievic V. Diaz, Ph.D. Course Development Officers:
NonCommercial — You may not use
John Carlo P. Fernando, Danie Son D. Gonzalvo
Ma. Cynthia Rose B. Bautista, Ph.D., CHED
the material for commercial
Bienvenido F. Nebres, S.J., Ph.D., Ateneo de Manila University
Teacher Training Officers: purposes.
Ma. Theresa C. Carlos, Mylene E. Dones ShareAlike — If you remix,
Carmela C. Oracion, Ph.D., Ateneo de Manila University
transform, or build upon the
Minella C. Alarcon, Ph.D., CHED Monitoring and Evaluation Officer: material, you must distribute your
Gareth Price, Sheffield Hallam University
Robert Adrian N. Daulat contributions under the same license
Stuart Bevins, Ph.D., Sheffield Hallam University as the original.
Administrative Officers:
Ma. Leana Paula B. Bato, Kevin Ross D. Nera,
Allison A. Danao, Ayhen Loisse B. Dalena
Printed in the Philippines by EC-TEC Commercial, No. 32 St.
Louis Compound 7, Baesa, Quezon City,
ectec_com@yahoo.com
Table of Contents
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1
Lesson 1: The Cell: Endomembrane System, Mitochondria, Lesson 12: Forms of Energy, Laws of Energy Transformation
Chloroplasts, Cytoskeleton, and Extracellular Components . . . 9 and Role of ATP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
Lesson 2: Mitochondria and Chloroplasts . . . . . . . . . . . . . . . . . 15 Lesson 13: Energy Transformation Part 1 . . . . . . . . . . . . . . . . . . . . 111
Lesson 3: Structure and Functions of Animal Tissues and Cell Lesson 14: Energy Transformation Part 2 . . . . . . . . . . . . . . . . . . . . 120
Modification . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28 Lesson 15: Energy Transformation Part 3 . . . . . . . . . . . . . . . . . . . . 128
Lesson 4: Cell Cycle and Cell Division . . . . . . . . . . . . . . . . . . . . 36 Lesson 16: Cellular Respiration Part 1 . . . . . . . . . . . . . . . . . . . . . . 133
Lesson 5: Transport Mechanisms Part 1 . . . . . . . . . . . . . . . . . . . 46 Lesson 17: Cellular Respiration Part 2 . . . . . . . . . . . . . . . . . . . . . . 150
Lesson 6: Transport Mechanisms Part 2 . . . . . . . . . . . . . . . . . . . 50 Lesson 18: Cellular Respiration Part 3 . . . . . . . . . . . . . . . . . . . . . . 165
Chapter 2: Biological Molecules Lesson 19: ATP in Cellular Metabolism and Photosynthesis . . . . . 176
The SHS for SHS Framework, which stands for “Saysay-Husay-Sarili for Senior High School,” is at the
core of this book. The lessons, which combine high-quality content with flexible elements to
SHS for SHS accommodate diversity of teachers and environments, promote these three fundamental concepts:
Framework
SAYSAY: MEANING HUSAY: MASTERY SARILI: OWNERSHIP
Why is this important? How will I deeply understand this? What can I do with this?
Through this Teaching Guide, Given that developing mastery When teachers empower
teachers will be able to facilitate goes beyond memorization, learners to take ownership of
an understanding of the value teachers should also aim for their learning, they develop
of the lessons, for each learner deep understanding of the independence and self-
to fully engage in the content subject matter where they lead direction, learning about both
on both the cognitive and learners to analyze and the subject matter and
affective levels. synthesize knowledge. themselves.
Biology I is a Science, Technology, Engineering and Mathematics (STEM) Specialized Subject
About this
taken in the first half of Grades 11/12. Learners go on a journey geared toward the deeper
Teaching Guide understanding and appreciation of life processes at the cellular and molecular levels
previously introduced in Grades 7-10. They will also apply basic chemistry and physics
principles as they examine the transformation of energy in organisms.
Implementing this course at the senior high school level is subject to numerous challenges
with mastery of content among educators tapped to facilitate learning and a lack of
resources to deliver the necessary content and develop skills and attitudes in the learners,
being foremost among these.
In support of the SHS for SHS framework developed by CHED, these teaching guides were
crafted and refined by biologists and biology educators in partnership with educators from
focus groups all over the Philippines to provide opportunities to develop the following:
1. Saysay through meaningful, updated, and context-specific content that highlights
important points and common misconceptions so that learners can connect to their real-
world experiences and future careers;
2. Husay through diverse learning experiences that can be implemented in a resource-
poor classroom or makeshift laboratory that tap cognitive, affective, and psychomotor
domains are accompanied by field-tested teaching tips that aid in facilitating discovery and
development of higher-order thinking skills; and
3. Sarili through flexible and relevant content and performance standards allow
learners the freedom to innovate, make their own decisions, and initiate activities to fully
develop their academic and personal potential.
These ready-to-use guides are helpful to educators new to either the content or biologists
new to the experience of teaching Senior High School due to their enriched content
presented as lesson plans or guides. Veteran educators may also add ideas from these
guides to their repertoire. The Biology Team hopes that this resource may aid in easing the
transition of the different stakeholders into the new curriculum as we move towards the
constant improvement of Philippine education.
2
This Teaching Guide is mapped and aligned to the DepEd SHS Curriculum, designed to be highly
Parts of the
usable for teachers. It contains classroom activities and pedagogical notes, and is integrated with
Teaching Guide innovative pedagogies. All of these elements are presented in the following parts:
1. Introduction
• Highlight key concepts and identify the essential questions
• Show the big picture
• Connect and/or review prerequisite knowledge
• Clearly communicate learning competencies and objectives
• Motivate through applications and connections to real-life
2. Motivation
• Give local examples and applications
• Engage in a game or movement activity
• Provide a hands-on/laboratory activity
• Connect to a real-life problem
3. Instruction/Delivery
• Give a demonstration/lecture/simulation/hands-on activity
• Show step-by-step solutions to sample problems
• Give applications of the theory
• Connect to a real-life problem if applicable
4. Practice
• Discuss worked-out examples
• Provide easy-medium-hard questions
• Give time for hands-on unguided classroom work and discovery
• Use formative assessment to give feedback
5. Enrichment
• Provide additional examples and applications
• Introduce extensions or generalisations of concepts
• Engage in reflection questions
• Encourage analysis through higher order thinking prompts
6. Evaluation
• Supply a diverse question bank for written work and exercises
• Provide alternative formats for student work: written homework, journal, portfolio, group/individual
projects, student-directed research project
On DepEd Functional Skills and CHED College Readiness Standards
As Higher Education Institutions (HEIs) welcome the graduates of On the other hand, the Commission declared the College
the Senior High School program, it is of paramount importance to Readiness Standards that consist of the combination of knowledge,
align Functional Skills set by DepEd with the College Readiness skills, and reflective thinking necessary to participate and succeed -
Standards stated by CHED. without remediation - in entry-level undergraduate courses in
The DepEd articulated a set of 21st century skills that should be college.
embedded in the SHS curriculum across various subjects and tracks. The alignment of both standards, shown below, is also presented in
These skills are desired outcomes that K to 12 graduates should this Teaching Guide - prepares Senior High School graduates to the
possess in order to proceed to either higher education, revised college curriculum which will initially be implemented by AY
employment, entrepreneurship, or middle-level skills development. 2018-2019.
Produce all forms of texts (written, oral, visual, digital) based on:
1. Solid grounding on Philippine experience and culture;
2. An understanding of the self, community, and nation; Visual and information literacies, media literacy, critical thinking
3. Application of critical and creative thinking and doing processes; and problem solving skills, creativity, initiative and self-direction
4. Competency in formulating ideas/arguments logically, scientifically, and creatively; and
5. Clear appreciation of one’s responsibility as a citizen of a multicultural Philippines and a
diverse world;
Interact meaningfully in a social setting and contribute to the fulfilment of individual and Media literacy, multicultural literacy, global awareness,
collaboration and interpersonal skills, social and cross-cultural
shared goals, respecting the fundamental humanity of all persons and the diversity of
skills, leadership and responsibility, ethical, moral, and spiritual
groups and communities values
4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Subject Description: This subject is designed to enhance the understanding of the principles and concepts in the study of biology, particularly life processes at the cellular
and molecular levels. It also covers the transformation of energy in organisms.
Cell The learners demonstrate an The learners shall be able The learners...
understanding of: to:
1. explain the postulates of the cell theory STEM_BIO11/12
1. construct a 3D model of
1. Cell Theory -Ia-c-1
a plant/animal/
2. Cell Structure and 2. describe the structure and function of major and STEM_BIO11/12
bacterial cell using
Functions subcellular organelles -Ia-c-2
recyclable materials
3. Prokaryotic vs Eukaryotic
3. distinguish prokaryotic and eukaryotic cells according to STEM_BIO11/12
Cells
2. construct a cell their distinguishing features -Ia-c-3
4. Cell Types
membrane model from
5. Cell Modifications 4. classify different cell types (plant/animal tissues) and STEM_BIO11/12
indigenous or recyclable
materials specify the function(s) of each -Ia-c-4
5. describe some cell modifications that lead to adaptation
to carry out specialized functions (e.g., microvilli, root STEM_BIO11/12
hair) -Ia-c-5
6. Cell Cycle 1. characterize the phases of the cell cycle and their control STEM_BIO11/12
a. Mitosis points -Id-f-6
b. Meiosis
2. describe the stages of mitosis/meiosis given 2n=6 STEM_BIO11/12
-Id-f-7
3. discuss crossing over and recombination in meiosis STEM_BIO11/12
-Id-f-8
4. explain the significance or applications of mitosis/meiosis STEM_BIO11/12
-Id-f-9
5. identify disorders and diseases that result from the STEM_BIO11/12
malfunction of the cell during the cell cycle -Id-f-10
7. Transport Mechanisms 1. describe the structural components of the cell STEM_BIO11/12
a. Simple Diffusion -Ig-h-11
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 1 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 3 of 4
K to 12 BASIC EDUCATION CURRICULUM
SENIOR HIGH SCHOOL – SCIENCE, TECHNOLOGY, ENGINEERING AND MATHEMATICS (STEM) SPECIALIZED SUBJECT
Sample: STEM_BIO11/12-IIa-j-12
LEGEND SAMPLE
Domain/Content/
Uppercase Letter/s General Biology
Component/ Topic
Roman Numeral
Quarter Second Quarter II
*Zero if no specific quarter
Lowercase Letter/s
*Put a hyphen (-) in between letters to indicate Week Weeks one to ten a-j
more than a specific week
-
K to 12 Senior High School STEM Specialized Subject – General Biology 1 December 2013 Page 4 of 4
General Biology 1 60 MINS
• illustrate the structure of the endomembrane system, label its parts, and Materials microscope (slide, cover slip), hand-held
understand how the system works lens, work books, methylene blue, plastic
• illustrate the structure of the mitochondria, label its parts, and understand spoon/popsicle stick, Hydrilla plansts,
the importance of the enfolding of the inner mitochondrial membrane colored chalk/white board marker
• illustrate the structure of the chloroplast, label its parts, and relate these
Resources (continued at the end of Teaching Guide)
parts to photosynthesis (1) (n.d.). Retrieved from <http://www.phschool.com/science/
• understand the connection of the endomembrane system to other cell biology_place/biocoach/cells/common.html>
parts such as the lysosomes, peroxisomes, endosomes, and cell membrane (2) (n.d.). Retrieved from <http://biology.tutorvista.com/animal-and-plant-
• understand how the extracellular components or matrix determine the (3) (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-
appearance and function of the tissues
cell-as-a-system/>
INTRODUCTION (5 MINS) Teacher Tip
10
MOTIVATION (5 MINS) Teacher tip
Briefly review the differences between prokaryotic and eukaryotic cells by asking questions to the
If the number of available microscopes is
learners.
limited, ask the learners to group
Sample question: What cell parts can be found in both prokaryotic and eukaryotic cells? Discuss themselves according to the number of
the function/s of each part. microscopes available or set-up a
demonstration scope for the whole class
Sample Responses: and facilitate the examination of cells so
• DNA that all the learners will get a chance to
observe the cells under the microscope.
• Cell membrane
• Protoplasm (nucleoloid region and cytosol) Orient the learners on the proper use and
care of the microscopes, particularly on
• Ribosomes focusing first on LPO before shifting to
HPO.
Compare the cell to a big city. Ask the learners what the requirements of the city would be in order for Cheek cells are very transparent. Adjust the
it to function. Relate these requirements to the parts of the cell. Relate the learners’ responses to the iris diaphragm or add a small amount of dye
functions of the different parts of a cell. (i.e., methylene blue) to the scrapings.
Sample responses: The learners will only see the cell membrane
• The city will need power. What generates power for the city? Relate this to the function of and the nucleus. Remind the learners to
draw what they observe. Students may
the mitochondria and the chloroplast.
observe cytoplasmic streaming in the plant
• The city generates waste. How does it minimize its waste? How does the city handle its cell.
garbage? Relate this to the function of the lysosome.
• The city requires raw materials to process into food, clothing, and housing materials. Where
are these raw materials processed? Relate this to the functions of the Golgi Apparatus.
Compare animal cells from plant cells. For the animal cells, scrape cheek cells using a toothpick. Ask
the learners to place the scrapings on a microscope slide and add a drop of water to the scrapings.
Tease the scrapings into a thin layer and cover with a slip. Examine under HPO. Instruct the learners to
draw the cells on their workbooks and to label the cell parts that they were able to observe under the
microscope.
For the plant cells, instruct the learners to obtain a Hydrilla leaf and place it on a microscope slide.
Examine under LPO. Ask the learners to draw the cells on their workbooks and to label the cell parts
that they were able to observe under the microscope.
INSTRUCTION/PRACTICE (30 MINS) Teacher tip
Use chalk or white board markers with
different colors. Explain the structure and
1. Draw the cell membrane on one end of the board. function of each cell part as you draw them.
2. Draw the double membrane of the nucleus (nuclear membrane) on the other end of the board.
Explain to the learners that a more detailed
3. From the nuclear membrane, draw the reticulated structure of the endoplasmic reticulum. Ask the discussion of the structure and functions of
learners what the two types of endoplasmic reticulum are and their corresponding functions. the cell membrane, mitochondria, and
chloroplast will be given in succeeding
4. Draw the ribosomes as separate units.
lessons.
5. Draw a DNA and an mRNA. Explain that the mRNA is a copy of the DNA that will be sent to the
cytoplasm for protein synthesis.
6. Explain to the learners that the mRNA leaves the nucleus and goes to where the ribosomes are
located (i.e., mRNA + functional ribosome)
7. Explain the possible ‘pathways’ for protein synthesis (e.g., within the cytosol or the endoplasmic
reticulum)
8. Draw the mRNA + functional ribosome on the endoplasmic reticulum. With a lot of these, the
endoplasmic reticulum becomes a rough endoplasmic reticulum.
9. Draw the formed polypeptide inside the rough endoplasmic reticulum. Discuss the formation of a
cisternae and pinching off as a vesicle.
10. Draw the Golgi Apparatus and then a vesicle from the rough endoplasmic reticulum that travels to
the Golgi Apparatus and attaches to the part which is nearest the rough endoplasmic reticulum.
11. Ask the learners what the function of the Golgi Apparatus is. Synthesize their answers and compare
the Golgi Apparatus to a factory with an assembly manufacturing line.
12. Draw the polypeptide travelling along the Golgi Apparatus stack; pinching off as a vesicle to travel
to the next stack. Repeat the process while increasing the complexity of the polypeptide drawing.
13. On the last stack, explain the ‘pathways’ that the vesicle may follow: become a lysosome through
fusion with an endosome (i.e., formed by endocytosis), or travel to the cell membrane, fuse with it,
and empty its contents.
14. Present the composition of the endomembrane system and discuss how these parts are connected
to each other by structure and by function.
15. Draw the mitochondria and label its parts. Explain the importance of the enfolding (cristae) in
increasing the surface area of the inner mitochondrial membrane. Further explain to the class that
enfolding is a common structural strategy to increase surface area. As an example, you may draw a
cross-sectional structure of the small intestine.
16. Draw the chloroplast and label its parts. Explain the function that each part performs in the process
of photosynthesis.
17. Discuss the similarities of the mitochondria and chloroplast (e.g., both are involved in energy
transformation, both have DNA, high surface area, and double membranes).income accounts and
lastly, expenses accounts.
Group the learners into pairs. Ask one to draw the endomembrane system as he/she explains it to
his/her partner. Reshuffle the groupings and repeat until all learners have performed the exercise.
• (n.d.). Retrieved from< http://study.com/academy/exam/topic/cell-biology.html> This strategy is aimed at ensuring that the
Assign a research assignment on this question: How do environmental toxins like lead and mercury learners have read the topic rather than just
affect the functions of the cell? The assignment shall be submitted one week after this lesson. copying and printing from a source.
RESOURCES (CONTINUED):
(4) (n.d.). Retrieved from <http://www.schools.manatee.k12.fl.us/072JOCONNOR/celllessonplans/
lesson_plan__cell_structure_and_function.html>
(5) (n.d.). Retrieved from <http://www.phschool.com/science/biology_place/biocoach/cells/endo.html>
(6) (n.d.). Retrieved from <http://study.com/academy/lesson/the-endomembrane-system-functions-
components.html>
(7) (n.d.). Retrieved from <http://www.ncbi.nlm.nih.gov/books/NBK26907/>
(8) (n.d.). Retrieved from <http://staff.um.edu.mt/acus1/01Compart.pdf>
ASSESSMENT
Learning Competency Assessment Tool Exemplary Satisfactory Developing Beginnning
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during answer all the question/s the main question without answer the questions able to answer the
1. describe the structure and lecture) without referring to his/ referring to his/her notes but he/she referred question/s
function of major and her notes but was not able to answer to his/her notes (2) Learner read notes
subcellular organelles follow-up question/s of his/her classmate
(STEM_BIO11/12-Ia-c-2)
Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
assignment beyond the comprehensive and well- well written report submit an assignment
requirements written assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
The learners shall be able Learner Learner was able to Learner was able to answer Learner was able to (1) Learner was not
to: participation (during concisely answer all the the main question without answer the questions able to answer the
2. describe the structural practice) questions referring to his/her notes but he/she referred question/s
components of the cell but was not able to answer to his/her notes (2) Learner read notes
membrane follow-up question/s of his/her classmate
(STEM_BIO11/12-Ig-h-11)
Laboratory Learner submitted Learner submitted drawings Learner submitted (1) Learner was not
(Examination of drawings that were that fulfilled the drawings that were able to submit
Animal and Plant beyond the requirements requirements (complete incomplete drawings
Cells) and detailed) (2) Learner’s drawings
were haphazardly
done
The learners shall be able Examination Learner obtained 90% to Learner obtained 70% to Learner obtained Learner obtained less
to: 100% correct answers in 89.99% correct answers in 50% to 69.99% that 50% correct
3. relate the structure and the examination the examination correct answers in the answers in the
composition of the cell examination examination
membrane to its function Research Learner submitted a Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ig-h12) Assignment research assignment comprehensive and well- well written report submit an assignment
beyond the requirements written research assignment but some responses (2) Learner submitted
lack details a partially-finished
assignment
14
General Biology 1 60 MINS
At the end of the lesson, the learners shall be able to: (2) http://www.britannica.com/list/6-cell-organelles)
(3) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
• illustrate the structure of the mitochondria, label its parts, and understand
(4) http://www.britannica.com/list/6-cell-organelles
the importance of the enfolding of the inner mitochondrial membrane
(5) http://www.nature.com/scitable/topicpage/mitochondria-14053590)
• illustrate the structure of the chloroplast, label its parts, and relate these
(6) http://biology.tutorvista.com/animal-and-plant-cells/chloroplasts.html
parts to photosynthesis
(7) ttp://www.nature.com/scitable/topicpage/mitochondria-14053590
INTRODUCTION (5 MINS)
Facilitate a review of the following concepts:
• Differences between prokaryotic and eukaryotic cells
• Definition of an ‘organelle’
• Differences between membrane-bound organelles and non-membrane-bound organelles
• Functions of the different parts of a cell
• The endomembrane system
Smooth ER Centrioles
Rough ER Cytoskeleton
Golgi Apparatus
Mitochondria
Lysosomes
Peroxisomes
Explain that in eukaryotic cells, the machinery of the cell is compartmentalized into organelles. The compartmentalization of the cell into
membrane-bound organelles:
• allows conflicting functions (i.e., synthesis vs. breakdown) and several cellular activities to occur simultaneously without interference from
each other
• separates the DNA material of the nucleus, mitochondria, and chloroplast
• increases the surface area-volume ratio of the cell
16
Encourage the learners to look at the cell as both a system and subsystem. They should develop an
understanding of how the parts of a cell interact with one another and how these parts help to do the
‘work’ of the cell (Source: (n.d.). Retrieved from <http://sciencenetlinks.com/lessons/cells-2-the-cell-as-
a-system/>)
Emphasize to the learners that energy transformation is one of the characteristics of life. This refers to
the ability to obtain and use energy. This characterizes the main function of the mitochondria and the
chloroplasts.
MOTIVATION (5 MINS)
Ask the learners how they understand the concept of compartmentalization. Relate the concept to how
the cell is compartmentalized into organelles.
Compare compartmentalization to the division of a house into a receiving room or sala, kitchen, dining
room, comfort rooms, bedrooms, etc.
Teacher tip
Explain to the learner that this is how the
Ask the learners why they think a house is divided into several rooms.
cell is able to allow conflicting functions
A possible response is that partitioning of the house into different parts facilitates the simultaneous (e.g., synthesis vs breakdown) and several
occurrence of several activities without interfering with one another. Also, materials needed for each cellular activities to occur simultaneously
without interference from each other.
activity can be stored at their specific areas. For example, pots and pans are being stored in the kitchen
and not in the bedroom. Beds and pillows are found in the bedroom and not in the toilet/bath.
Explain to the learners that the mitochondria and chloroplasts have a small amount of DNA. Although
most of the proteins of these organelles are imported from the cytosol and are thus programmed by
the nuclear DNA, their DNA programs the synthesis of the proteins made on the organelles’ ribosomes
(Source: Campbell et al). Compartmentalization separates the DNA material of the nucleus,
mitochondria, and chloroplast.
Ask the learners if they have experienced going to a city/municipal hall and if they have observed that
the Mayor, Vice-Mayor, and the City/Municipal Administrator have separate offices. You can use other
examples such as the University President, VP for Academic Affairs, VP for Finance; Philippine
President, Vice President, Senators, etc.
Compare the nuclear DNA to the Mayor and the mitochondrial DNA and chloroplast DNA to the Vice
Mayor. The Mayor runs the city/municipality but the Vice Mayor also performs functions that are Teacher tip
specific to their positions. They need different offices (or compartments) to avoid conflict in their
functions. Select a fruit that can be easily peeled like
calamansi or dalandan
Introduce the concept of surface area-volume ratio/relationship to the learners. Show a fruit to the
learners and explain that the outer surface of the fruit is the surface area. Peel the fruit and show them
what’s inside, explaining that the inside of the fruit is the volume.
Explain to the learners that surface area (SA) and volume (V) do not increase in the same manner. As an
object increases in size, its volume increases as the cube of its linear dimensions while surface area
increases as the square of its linear dimensions.
Example: If the initial starting point is the same: SA = 2; Volume = 2 (Ratio = 1:1)
A one-step increase will result to: SA = 22 = 4 while V = 23 = 8 (Ratio = 1:2)
Teacher tip
Ask questions to the learners while giving
INSTRUCTION/DELIVERY (30 MINS) the lecture.
18
Illustration 1: Energy release in Hydrolysis (Source: (n.d.). Retrieved from http://scienceaid.co.uk/biology/biochemistry/atp.html)
Illustration 2: Chemical Energy and ATP (Source: (n.d.). Retrieved from http://winklebiology.weebly.com/chemical-energyatp.html)
Synthesis of ATP
• ADP + Pi → ATP + H2O
• requires energy: 7.3 kcal/mole
• occurs in the cytosol by glycolysis
• occurs in mitochondria by cellular respiration
• occurs in chloroplasts by photosynthesis
Consumption of ATP
ATP powers most energy-consuming activities of cells, such as:
• anabolic (synthesis) reactions, such as:
• joining transfer RNAs to amino acids for assembly into proteins
• synthesis of nucleoside triphosphates for assembly into DNA and RNA
• synthesis of polysaccharides
• synthesis of fats
• active transport of molecules and ions
• conduction of nerve impulses
• maintenance of cell volume by osmosis
• addition of phosphate groups (phosphorylation) to different proteins (e.g., to alter their activity in cell
signaling)
• muscle contraction
• beating of cilia and flagella (including sperm)
• bioluminescence
Extracellular ATP
In mammals, ATP also functions outside of cells. ATP is released in the following examples:
• from damaged cells to elicit inflammation and pain
• from the carotid body to signal a shortage of oxygen in the blood
• from taste receptor cells to trigger action potentials in the sensory nerves leading back to the brain
• from the stretched wall of the urinary bladder to signal when the bladder needs emptying
In eukaryotic cells, the mitochondria and chloroplasts are the organelles that convert energy to other
forms which cells can use for their functions.
20
Mitochondria (singular, mitochondrion)—Mitochondria are the sites of cellular respiration, the
metabolic process that uses oxygen to drive the generation of ATP by extracting energy from sugars,
fats, and other fuels.
The mitochondria are oval-shaped organelles found in most eukaryotic cells. They are considered to be
the ‘powerhouses’ of the cell. As the site of cellular respiration, mitochondria serve to transform
molecules such as glucose into an energy molecule known as adenosine triphosphate (ATP). ATP fuels
cellular processes by breaking its high-energy chemical bonds. Mitochondria are most plentiful in cells
that require significant amounts of energy to function, such as liver and muscle cells.
Figure 1: Structure of the Mitochonsdria (Source: (n.d.). Retrieved from http://www.britannica.com/list/
6-cell-organelles)
The mitochondria has two membranes that are similar in composition to the cell membrane:
• Outer membrane—is a selectively permeable membrane that surrounds the mitochondria. It is the
site of attachment for the respiratory assembly of the electron transport chain and ATP Synthase. It
has integral proteins and pores for transporting molecules just like the cell membrane
• Inner membrane—folds inward (called cristae) to increase surfaces for cellular metabolism. It
contains ribosomes and the DNA of the mitochondria. The inner membrane creates two enclosed
spaces within the mitochondria:
• intermembrane space between the outer membrane and the inner membrane; and
• matrix that is enclosed within the inner membrane.
Ask questions to the learners on the structure of the mitochondria. A sample question could be: What
is the importance of the enfolding of the mitochondria? The response would be to increase the surface
area that can be ‘packed’ into such a small space.
22
As mentioned, the mitochondria has two membranes: the outer and inner mitochondrial membranes.
• Outer Membrane Teacher tip
• fully surrounds the inner membrane, with a small intermembrane space in between
• has many protein-based pores that are big enough to allow the passage of ions and
molecules as large as a small protein Lecture on mitochondrial membranes can
be accessed at (n.d.). Retrieved from
• Inner membrane
<http://www.nature.com/scitable/
• has restricted permeability like the plasma membrane topicpage/mitochondria-14053590>.
• is loaded with proteins involved in electron transport and ATP synthesis
• surrounds the mitochondrial matrix, where the citric acid cycle produces the electrons that
travel from one protein complex to the next in the inner membrane. At the end of this
electron transport chain, the final electron acceptor is oxygen, and this ultimately forms
water (H20). At the same time, the electron transport chain produces ATP in a process called
oxidative phosphorylation
During electron transport, the participating protein complexes push protons from the matrix out to the
intermembrane space. This creates a concentration gradient of protons that another protein complex,
called ATP synthase, uses to power synthesis of the energy carrier molecule ATP.
Figure 4: The Electrochemical Proton Gradient and the ATP Synthase (Source: (n.d.). Retrieved from
http://www.nature.com/scitable/topicpage/mitochondria-14053590)
Chloroplasts—Chloroplasts, which are found in plants and algae, are the sites of photosynthesis. This
process converts solar energy to chemical energy by absorbing sunlight and using it to drive the
synthesis of organic compounds such as sugars from carbon dioxide and water.
The word chloroplast is derived from the Greek word chloros which means ‘green’ and plastes which
means ‘the one who forms’. The chloroplasts are cellular organelles of green plants and some
eukaryotic organisms. These organelles conduct photosynthesis. They absorb sunlight and convert it
into sugar molecules. They also produce free energy stored in the form of ATP and NADPH through
photosynthesis.
Chloroplasts are double membrane-bound organelles and are the sites of photosynthesis. The
22
chloroplast has a system of three membranes: the outer membrane, the inner membrane, and the
thylakoid system. The outer and the inner membranes of the chloroplast enclose a semi-gel-like fluid Teacher tip
known as the stroma. The stroma makes up much of the volume of the chloroplast. The thylakoid
system floats in the stroma. If an LCD projector is not available, draw
the structure of the chloroplast on the
board.
Structure of the Chloroplast
• Outer membrane—This is a semi-porous membrane and is permeable to small molecules and ions
which diffuse easily. The outer membrane is not permeable to larger proteins.
• Intermembrane Space—This is usually a thin intermembrane space about 10-20 nanometers and is
present between the outer and the inner membrane of the chloroplast.
• Inner membrane—The inner membrane of the chloroplast forms a border to the stroma. It Lecture on structure and functions of the
chloroplast can be accessed at (n.d.).
regulates passage of materials in and out of the chloroplast. In addition to the regulation activity,
Retrieved from <http://
fatty acids, lipids and carotenoids are synthesized in the inner chloroplast membrane. biology.tutorvista.com/animal-and-plant-
• Stroma—This is an alkaline, aqueous fluid that is protein-rich and is present within the inner cells/chloroplasts.html>.
membrane of the chloroplast. It is the space outside the thylakoid space. The chloroplast DNA,
chloroplast ribosomes, thylakoid system, starch granules, and other proteins are found floating
around the stroma.
• Thylakoid System
The thylakoid system is suspended in the stroma. It is a collection of membranous sacks called
thylakoids. Thylakoids are small sacks that are interconnected. The membranes of these thylakoids are
the sites for the light reactions of the photosynthesis to take place. The chlorophyll is found in the
thylakoids. The thylakoids are arranged in stacks known as grana. Each granum contains around 10-20
thylakoids.
The word thylakoid is derived from the Greek word thylakos which means 'sack'.
Important protein complexes which carry out the light reaction of photosynthesis are embedded in the
membranes of the thylakoids.
Thylakoids are of two types: granal thylakoids and stromal PRACTICE (10 MINS)
thylakoids. Granal thylakoids are arranged in the grana. These
Group the learners into pairs. Ask one to draw the mitochondria and
circular discs that are about 300-600 nanometers in diameter. The
label its parts while the other does the same for chloroplast. Once
stromal thylakoids are in contact with the stroma and are in the form
done, the partners exchange tasks (i.e., the learner that drew the
of helicoid sheets.
mitochondria now does the same for the chloroplast).
24
ENRICHMENT (30 MINS)
1. Using the figure below, ask learners to compute surface area vs. volume.
2. Draw the table on the board and instruct the learners to write their measurements.
Teacher tip
EVALUATION (60 MINS) Clarify to the learners the
misconception that the appearance of
Ask the learners to answer practice questions on the following electronic resources:
organelles are static and rigid.
• http://www.mcqbiology.com/2013/03/multiple-choice-questions-on_25.html#.Vl7Uq3YrLrc
• http://www.uic.edu/classes/bios/bios100/summer2004/samples02.htm
• http://www.tutorvista.com/content/science/science-i/fundamental-unit-life/question-answers-1.php
• http://www.buzzfeed.com/kellyoakes/the-mitochondria-is-the-powerhouse-of-the-cell#.fajAl0b6o
• http://global.oup.com/uk/orc/biosciences/cellbiology/wang/student/mcqs/ch10/
What are the characteristics shared by these two energy transforming organelles?
Instruct the learners to write an essay on probable reasons for these the shared characteristics of the
mitochondria and the chloroplast. Learners shall submit a handwritten essay on the Endosymbiotic Theory
and how it explains the similarity between the mitochondria and chloroplast.
26
EVALUATION
The learners shall be Learner Learner was able to Learner was able to Learner was able to (1) Learner was not
able to describe the participation answer all the question/ answer the main question answer the able to answer the
following: (during lecture) s without referring to without referring to his/ questions but he/ question/s
his/her notes her notes but was not she referred to his/ (2) Learner read
able to answer follow-up her notes notes of his/her
1. structure and question/s classmate
function of major and
subcellular organelles Assignment Learner submitted an Learner submitted a Learner submitted a (1) Learner did not
(STEM_BIO11/12-Ia- assignment beyond the comprehensive and well- well written report submit an
c-2) requirements written assignment but some responses assignment
lack details (2) Learner
submitted a
partially-finished
assignment
Examination Learner obtained 90% Learner obtained 70% to Learner obtained Learner obtained
to 100% correct 89.99% correct answers 50% to 69.99% less that 50% correct
answers in the in the examination correct answers in answers in the
examination the examination examination
Essay Assignment Learner submitted an Learner submitted an Learner submitted a (1) Learner did not
essay beyond the essay that was well-written essay submit an essay
requirements comprehensive and well- some details are (2) Learner
written lacking submitted a
partially-finished
essay
General Biology 1 180 MINS
28
INTRODUCTION (5 MINS) Teacher tip
Introduce the following learning objectives by flashing these on the board: For this particular lesson, start with the
Motivation first (i.e., class activity on Pinoy
• classify different cell types (plant/animal tissue) and specify the functions of each (STEM_BIO11/12- Henyo Classroom Edition). After the game,
Ia-c-4) proceed to the Introduction by
• describe some cell modifications that lead to adaptation to carry out specialized functions (e.g., communicating the learning objectives to
the learners.
microvilli, root hair) (STEM_BIO11/12-Ia-c-5)
For the part when the learners have to state
the learning objectives using their own
words, ask the learners to face their
Ask the learners to work in pairs and write the learning objectives using their own words. seatmates and work in pairs. If the learners
are more comfortable in stating the learning
objectives in Tagalog or In their local
dialect, ask them to do so.
Teacher tip
MOTIVATION (10 MINS) Prior to this lesson, assign a reading
material or chapter for this topic. This shall
aid in the facilitation of the class activity.
PINOY HENYO CLASSROOM EDITION
Divide the class into two groups. In choosing the mystery words for the
game, do not limit yourself with the four
types of animal tissues. You may choose
Explain to the learners that instead of having the typical one-on-one Pinoy Henyo, only one terms that describe the tissue type or even
body parts wherein the tissues are located.
representative from each group shall be asked to go to the front and have the mystery word card on
You may also include diseases that are
his/her forehead. Only three words shall be allowed from the groups: “Oo”, “Hindi”, or “Pwede”. caused by certain malfunctions on the
Violation of the rules of the game (e.g., communicating the mystery word to the guesser) shall merit tissues.
corresponding penalties or disqualification. Assign three representatives per group to guess the
Make sure to mention the chosen mystery
mystery words. Each guesser shall be given one minute and 30 seconds.
words in the discussion. This shall help the
learners to understand the connection of
the game with the lesson.
At the end of the activity, ask one or two learners what they think the learning objectives of the lesson
will be. Immediately proceed with the Introduction. Check how the class behaves during the
activity. If the learners get rowdy, you may
choose to stop the game. Make sure to
warn the learners of the consequences first
before the start of the activity.
INSTRUCTION/DELIVERY (95 MINS)
Teacher tip
Facilitate a five-minute review on the Hierarchy of Biological Organization and on the concept of “form
Do not use too much time for the review.
fits function”, the unifying theme in Biology. Just make sure to guide or lead the learners
in remembering past lessons. Provide clues
if necessary.
Review on Hierarchy of Biological Organization
1. Discuss that new properties arise with each step upward the hierarchy of life. These are called
emergent properties.
2. Ask the class what the levels of biological organization are. The learners should be able to answer
this since this is just a review. In case the class does not respond to the question, you may facilitate
the discussion by mentioning the first level of the hierarchy.
3. Start with the cell since it is the most basic unit of life that shows all life properties.
Illustrate this by showing photos of the actual hierarchy using animals that are endemic in the
Philippines (e.g., pilandok, dugong, and cloud rat). Teacher tip
For the review on “form fits function”, if the
class does not respond well, start giving
your own examples for the students to
Review on the unifying theme in Biology: “form fits function”
figure out this unifying theme.
30
Facilitate a class activity (i.e., observation of cells under a microscope) to illustrate that animals are Teacher tip
made up of cells. This shall be the foundation of the definition of and discussion on animal tissues. The If microscopes are available for this activity,
whole activity and discussion shall last for 90 minutes. allot 20-30 minutes for the observation of
cells. If microscopes are not available, allot
only 10-15 minutes.
If microscopes are available for this activity, set up the equipment and the slides that were prepared
Prior to the activity, prepare the slides that
prior to the activity. Each slide should show one type of tissue (i.e., epithelial tissue, connective tissue,
will be put under the microscopes. The
muscle tissue, and nervous tissue). Make sure that the labels are covered because the learners will be slides shall contain the different types of
asked to name the tissues based on their observations during the discussion. tissue. Make sure to focus the slides so that
the learners can observe them clearly.
If there are no microscopes available for the activity, prepare cut-out images, photos, or illustrations Give the learners enough time to observe
that show the different types of tissues (i.e., epithelial tissue, connective tissue, muscle tissue, and the specimens and then ask them to draw
on their notebooks what they were able to
nervous tissue). Make sure that the images, photos, or illustrations are not labeled because the learners
observe under the microscopes. Encourage
will be asked to name them. the learners to write down the description
and function of the specific tissue type as
you go through the discussion.
Also, do not immediately identify the type of tissue based on the descriptions that you will be
presenting to the class. The learners will be asked to identify which among the slides under the If microscopes are not available and you
microscope or which image, photo, or illustration matches the description of the structure and function have shown photos, images, or illustrations
instead, ask the learners to draw them on
that will be given during the discussion.
their notebooks and encourage them to
write down the description and function of
the specific tissue type as you go through
After the class activity, proceed with the actual lecture. If a computer, laptop, or projector is available,
the discussion.
show a PowerPoint presentation that shows the description and function of tissues. If there is no
available equipment, you may use flash cards or manila paper where description of structure and
function of the different tissue types are written down. Ask the learners which among the microscope
Teacher tip
slides, image, photo, or illustration fits the given information on description and function. After the Prepare the lecture in such a way that you
learners’ responses, you can flash or show the next slide which shall reveal the image of the specimen do not immediately reveal the label of the
with the corresponding label or type of tissue. images or the terms that are being
described. The learners should first be
asked to identify the images or slides that fit
Epithelial Tissue—This type of tissue is commonly seen outside the body as coverings or as linings of the description of the structures and
functions. This will make the students more
organs and cavities. Epithelial tissues are characterized by closely-joined cells with tight junctions (i.e., a
engaged in the discussion. Always remind
type of cell modification). Being tightly packed, tight junctions serve as barriers for pathogens, the learners to take down notes while you
mechanical injuries, and fluid loss.
flash information for each tissue type.
Teacher tip
Cells that make up epithelial tissues can have distinct arrangements: Take note that the part on cell modifications
is incorporated in the discussion on the
• cuboidal—for secretion structure of the respective cells that make
• simple columnar—brick-shaped cells; for secretion and active absorption up the tissue that is being discussed. Give
• simple squamous—plate-like cells; for exchange of material through diffusion emphasis on the differences on the features
of the cells that make up the tissue type.
• stratified squamous—multilayered and regenerates quickly; for protection
• pseudo-stratified columnar—single layer of cells; may just look stacked because of varying height; For examples or illustrations of the different
for lining of respiratory tract; usually lined with cilia (i.e., a type of cell modification that sweeps the types of tissues, it is better to use an animal
mucus). that is endemic in the Philippines or in your
specific region so that the learners can
relate more in the discussion.
Figure 1: Epithelial Tissue (Source: Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco (CA):.)
32
Connective Tissue—These tissues are composed of the
following:
BLOOD —made up of plasma (i.e., liquid extracellular matrix);
contains water, salts, and dissolved proteins; erythrocytes that
carry oxygen (RBC), leukocytes for defense (WBC), and platelets
for blood clotting.
36
INTRODUCTION (5 MINS) Teacher tip
Introduce a simplified life cycle of a human being or plant. Let the learners identify the changes
Explain to the learners that these eukaryotic
throughout the different stages and how these organisms grow and develop.
organisms follow a complex sequence of
events by which their cells grow and divide.
This sequence of events is known as the Cell
Cycle.
Figure 1: Life Cycle of Man and Higher Plants (Source: (n.d.). Retrieved from http://
www.vcbio.science.ru.nl/en/virtuallessons/cellcycle/postmeio/) Teacher tip
You can download the video prior to this
session or if internet connection is available
MOTIVATION (5 MINS) during class, you can just make use of the
hyperlink to play the video. To access the
video through the hyperlink, simply hold the
1. Play the video on ‘Cell Cycle and Cell Division’. This video can be accessed at http:// Control (Ctrl) Key on the keyboard and click
www.youtube.com/watch?v=Q6ucKWIIFmg.Divide the class into two groups. on the hyperlink.
38
INSTRUCTION/DELIVERY (30 MINS) Teacher tip
Core Concepts:
• All organisms consist of cells and arise from preexisting cells.
• Mitosis is the process by which new cells are generated.
• Meiosis is the process by which gametes are generated for reproduction.
• The Cell Cycle represents all phases in the life of a cell.
• DNA replication (S phase) must precede mitosis so that all daughter cells receive the same
complement of chromosomes as the parent cell.
• The gap phases separate mitosis from S phase. This is the time when molecular signals mediate the
switch in cellular activity.
• Mitosis involves the separation of copied chromosomes into separate cells.
• Unregulated cell division can lead to cancer.
• Cell cycle checkpoints normally ensure that DNA replication and mitosis occur only when conditions
are favorable and the process is working correctly.
• Mutations in genes that encode cell cycle proteins can lead to unregulated growth, resulting in
tumor formation and ultimately invasion of cancerous cells to other organs.
The Cell Cycle control system is driven by a built-in clock that can be adjusted by external stimuli (i.e.,
chemical messages).
Checkpoint—a critical control point in the Cell Cycle where ‘stop’ and ‘go-ahead’ signals can regulate
the cell cycle.
• Animal cells have built-in ‘stop’ signals that halt the cell cycles and checkpoints until
overridden by ‘go-ahead’ signals.
• Three major checkpoints are found in the G1, G2, and M phases of the Cell Cycle.
38
The G1 Checkpoint—the Restriction Point
• The G1 checkpoint ensures that the cell is large enough to divide and that enough nutrients are available to support the
resulting daughter cells.
• If a cell receives a ‘go-ahead’ signal at the G1 checkpoint, it will usually continue with the Cell Cycle.
• If the cell does not receive the ‘go-ahead’ signal, it will exit the Cell Cycle and switch to a non-dividing state called G0.
• Most cells in the human body are in the G0 phase.
The G2 Checkpoint—ensures that DNA replication in S phase has been successfully completed.
The Metaphase Checkpoint—ensures that all of the chromosomes are attached to the mitotic spindle by a kinetochore.
Kinase—a protein which activates or deactivates another protein by phosphorylating them. Kinases give the ‘go-ahead’ signals at the
G1 and G2 checkpoints. The kinases that drive these checkpoints must themselves be activated.
• The activating molecule is a cyclin, a protein that derives its name from its cyclically fluctuating concentration in the cell.
Because of this requirement, these kinases are called cyclin-dependent kinases or CDKs.
• Cyclins accumulate during the G1, S, and G2 phases of the Cell Cycle.
• By the G2 checkpoint, enough cyclin is available to form MPF complexes (aggregations of CDK and cyclin) which initiate
mitosis.
• MPF functions by phosphorylating key proteins in the mitotic sequence.
• Later in mitosis, MPF switches itself off by initiating a process which leads to the destruction of cyclin.
• CDK, the non-cyclin part of MPF, persists in the cell as an inactive form until it associates with new cyclin molecules
synthesized during the interphase of the next round of the Cell Cycle.
Mitosis (apparent division)—is nuclear division; the process by which the nucleus divides to produce two new nuclei. Mitosis results in two
daughter cells that are genetically identical to each other and to the parental cell from which they came.
Cytokinesis—is the division of the cytoplasm. Both mitosis and cytokinesis last for around one to two hours.
Prophase—is the preparatory stage, During prophase, centrioles move toward opposite sides of the nucleus.
• The initially indistinct chromosomes begin to condense into visible threads. Teacher tip
• Chromosomes first become visible during early prophase as long, thin, and
intertwined filaments but by late prophase, chromosomes are more compacted and You may show diagrams or a video
demonstrating animal and plant mitosis. The
can be clearly discerned as much shorter and rod-like structures.
video can be accessed at http://
• As the chromosomes become more distinct, the nucleoli also become more www.vcbio.science.ru.nl/en/virtuallessons/
distinct. By the end of prophase, the nucleoli become less distinct, often mitostage/
disappearing altogether.
Metaphase—is when chromosomes become arranged so that their centromeres become aligned in
one place, halfway between the two spindle poles. The long axes of the chromosomes are 90 degrees
to the spindle axis. The plane of alignment is called the metaphase plate.
Anaphase—is initiated by the separation of sister chromatids at their junction point at the centromere.
The daughter chromosomes then move toward the poles.
Telophase—is when daughter chromosomes complete their migration to the poles. The two sets of
progeny chromosomes are assembled into two-groups at opposite ends of the cell. The chromosomes
uncoil and assume their extended form during interphase. A nuclear membrane then forms around
each chromosome group and the spindle microtubules disappear. Soon, the nucleolus reforms.
Meiosis—reduces the amount of genetic information. While mitosis in diploid cells produces
daughter cells with a full diploid complement, meiosis produces haploid gametes or spores with only
one set of chromosomes. During sexual reproduction, gametes combine in fertilization to reconstitute
the diploid complement found in parental cells. The process involves two successive divisions of a
diploid nucleus.
40
Prophase I—has been subdivided into five substages: leptonema, zygonema, pachynema, diplonema, and diakinesis.
• Leptonema—Replicated chromosomes have coiled and are already visible. The number of chromosomes present is the same
as the number in the diploid cell.
• Zygonema—Homologue chromosomes begin to pair and twist around each other in a highly specific manner. The pairing is
called synapsis. And because the pair consists of four chromatids it is referred to as bivalent tetrad.
• Pachynema—Chromosomes become much shorter and thicker. A form of physical exchange between homologues takes
place at specific regions. The process of physical exchange of a chromosome region is called crossing-over. Through the
mechanism of crossing-over, the parts of the homologous chromosomes are recombined (genetic recombination).
• Diplonema—The two pairs of sister chromatids begin to separate from each other. It is at this point where crossing-over is
shown to have taken place. The area of contact between two non-sister chromatids, called chiasma, become evident.
• Diakinesis—The four chromatids of each tetrad are even more condensed and the chiasma often terminalize or move down
the chromatids to the ends. This delays the separation of homologous chromosomes.
In addition, the nucleoli disappear, and the nuclear membrane begins to break down.
Metaphase I—The spindle apparatus is completely formed and the microtubules are attached to the centromere regions of the homologues.
The synapsed tetrads are found aligned at the metaphase plate (the equatorial plane of the cell) instead of only replicated chromosomes.
Anaphase I—Chromosomes in each tetrad separate and migrate toward the opposite poles. The sister chromatids (dyads) remain attached at
their respective centromere regions.
Telophase I—The dyads complete their migration to the poles. New nuclear membranes may form. In most species, cytokinesis follows,
producing two daughter cells. Each has a nucleus containing only one set of chromosomes (haploid level) in a replicated form.
growth
42
Meiosis I compared to Mitosis Meiosis II compared to Mitosis Teacher tip
Significance of Meiosis for Diversity:
Meiosis I Mitosis Meiosis II Mitosis One of the benefits of sexual reproduction
is the diversity it produces within a
Prophase I Prophase Prophase II Prophase population. That variety is a direct product
of meiosis. Every sex cell made from meiosis
Pairing of homologous No pairing of No pairing of No pairing of
has a unique combination of chromosomes.
chromosomes chromosomes chromosomes chromosomes This means that no two sperm or egg cells
Metaphase I Metaphase Metaphase II Metaphase are genetically identical. Every fertilization
event produces new combinations of traits.
Bivalents at metaphase Duplicated Haploid number of Diploid number This is why siblings share DNA with parents
plate chromosomes at duplicated of duplicated and each other, but are not identical to one
metaphase plate chromosomes at chromosomes at another.
metaphase plate metaphase plate
Anaphase I Anaphase Anaphase II Anaphase
Homologues of each Sister chromatids Sister chromatids Sister chromatids Teacher tip
You may show a video that demonstrates
bivalent separate and separate, becoming separate, becoming separate how crossing over and recombination of
duplicated daughter daughter becoming chromosomes occur. The video can be
chromosomes move to chromosomes that chromosomes that daughter accessed at http://
poles move to the poles move to the poles chromosomes highered.mheducation.com/sites/
that move to the 9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html.s
poles
Telophase I Telophase Telophase II Telophase
Two haploid daughter Two diploid Four haploid Two diploid
cells not identical to the daughter cells, daughter cells not daughter cells,
parent cell identical to the genetically identical identical to the
parent cell parent cell
Table 2: Meiosis compared to Mitosis
Facilitate a discussion on disorders and diseases that result from the malfunction of the cell during the
cell cycle. Present some diagrams or illustrations on some errors in mitosis and allow the learners to
predict possible outcomes, diseases, or disorders that may happen:
• incorrect DNA copy (e.g., cancer)
• chromosomes are attached to string-like spindles and begin to move to the middle of the cell (e.g.,
Down Syndrome, Alzheimer’s, and Leukemia)
Other chromosome abnormalities:
• arise from errors in meiosis, usually meiosis I;
• occur more often during egg formation (90% of the time) than during sperm formation;
• become more frequent as a woman ages.
• Aneuploidy—is the gain or loss of whole chromosomes. It is the most common chromosome
abnormality. It is caused by non-disjunction, the failure of chromosomes to correctly separate:
• homologues during meiosis I or
• sister chromatids during meiosis II
44
ADDITIONAL RESOURCES:
Books:
1. Raven, P. a. (2001). Biology 6th Ed. The McGraw Hill Company, USA
2. Reece, J. B. (2013). Campbell Biology, 10th Ed. Pearson Education, Inc. United States of America.
Electronic Resources:
3. (n.d.). Retrieved from Bright Hub Education: http://www.brighthubeducation.com/middle-school-science-lessons/94267-three-activities-for-
teaching-cell-cycles/#
4. (n.d.). Retrieved from http://www.uic.edu/classes/bios/bios100/lecturesf04am/lect16.htm
5. (n.d.). Retrieved from MH Education: http://highered.mheducation.com/sites/9834092339/student_view0/chapter11/
meiosis_with_crossing_over.html
6. (n.d.). Retrieved from http://www.vcbio.science.ru.nl/en/virtuallessons/meiostage/
7. (n.d.). Retrieved from http://csls-text.c.u-tokyo.ac.jp/active/12_05.html
8. (n.d.). Retrieved from http://education.seattlepi.com/biological-significance-mitosis-meiosis-sexual-reproduction-5259.htm
General Biology 1 480 MINS
Learning Competencies
Practice Answering practice/guide questions 45
The learners:
• describe the structural components of the cell membrane
(STEM_BIO11/12–Ig-h-11) Enrichment Essay and concept map writing 45
• relate the structure and composition of the cell membrane to its function
(STEM_BIO11/12-Ig-h-12) Evaluation Designing a model of a plasma 180
• explain transport mechanisms in cells (diffusion, osmosis, facilitated membrane using recyclable or
transport, active transport) (STEM_BIO11/12–Ig-h-13) indigenous materials
• differentiate exocytosis and endocytosis (STEM_BIO11/12-Ig-h-14)
Materials
Specific Learning Outcomes pen, paper, salt, water, recycled or indigenous materials
At the end of the lesson, the learners shall be able to:
• describe and compare diffusion, osmosis, facilitated transport and active Resources
(1) Campbell, N. J. (n.d.).
transport
(2) Campbell, N. e. (2008). Biology 8th edition. Pearson International
• explain factors that affect the rate of diffusion across a cell membrane Edition. Pearson/Benjamin.
• predict the effects of hypertonic, isotonic, and hypotonic environments on (3) Freeman, S. (2011). Biological Science 4th edition International Edition.
osmosis in animal cells Benjamin Cummings Publishing.
• differentiate endocytosis (phagocytosis and pinocytosis) and exocytosis
(4) Hickman, C. L. (2011). Integrated Principles of Zoology 15th edition.
McGraw Hill Co., Inc.
46
INTRODUCTION (30 MINS)
1. Before this lesson, ask the learners to read about the topic on transport of materials across
membranes.
2. Introduce the topic by providing the learners with background information.
In order for the cell to stay alive, it must meet the characteristics of life which include taking
nutrients in and eliminating wastes and other by-products of metabolism. Several mechanisms allow
cells to carry out these processes. All of the cell’s activities are in one way or another tied to the
membrane that separates its interior from the environment.
3. Ask the learners how they understand and visualize a plasma membrane and what characteristics
are essential for it to perform its function.
4. Ask the learners to identify the different mechanisms on how materials are transported in and out of
the cell.
Teacher tip
MOTIVATION (60 MINS) Different responses to the question will be
1. Divide the learners into groups and ask them the following question: “What comes to your mind drawn from students. Their responses will
when you see a 20 year old man who is 7.5 ft. tall and 3.5 ft. tall man of the same age?” Among depend on what aspect they are looking
their respective groups, let the learners discuss the similarities and differences between the two. into.
(Hint: Give students a clue by giving them the giant and pygmy as examples). Acknowledge the responses of the learners.
2. Ask a representative from each group to report the result of their discussion to the whole class. Point out and explain that the two men are
3. Before the start of the lesson on diffusion, spray an air freshener in one corner of the room and ask both abnormal. Their growths are abnormal
the learners to raise their hands if they have smelled the scent of the spray. such that one is too big in size and the
other one is too small. Both men have
4. Ask the learners what they have observed. Who smelled the scent first? Who are the last ones to defective membranes. Insufficient amount
smell the scent? How would you explain the phenomenon wherein learners in the same classroom of growth hormones pass through a
smelled the spray at different times? pygmy’s body while an excessive amount of
growth hormones is released in a giant.
7. Ask the learners to enumerate the different transport interior to accommodate the natural inward movement. Most
mechanisms. plants are hypertonic with respect to their immediate
8. Differentiate between diffusion and osmosis. environment. Osmotic pressure within the cell pushes the
cytoplasm against the cell wall and makes a plant cell rigid.
9. Compare and contrast facilitated diffusion and active transport.
10. Present photos of plant and animal cells immersed in an
To control the entrance and exit of particular molecules,
isotonic, hypotonic, and hypertonic solution.
selective transport of materials is necessary. One simple process
11. Describe solution and solute movement in and out of the cell is facilitated diffusion that utilizes protein transmembrane
under hypertonic, hypotonic, and isotonic conditions. channels that are specific to certain molecules. It is a passive
12. Explain the effects of the different solutions to the cells. Ask process driven by the concentration of molecules both inside
which among the three solutions is the best for plants? How and the outside of the membrane. Certain molecules are
about for animals? Explain to the learners the water requirement transported in and out of the cell, independent of concentration.
in plants.
This process requires the expenditure of energy in the form of
ATP and is called active transport.
Diffusion is the natural tendency for molecules to move 13. Differentiate among endocytosis, phagocytosis, pinocytosis,
constantly. Their movement is random and is due to the energy receptor-mediated endocytosis, and exocytosis.
found in the individual molecules. Net diffusion occurs when the
materials on one side of the membrane have a different Large molecules enter the cell by generalized nonselective
concentration than the materials on the other side.
process known as endocytosis. Phagocytosis is endocytosis of a
particulate material while endocytosis of liquid material is called
Osmosis is a special type of diffusion specifically associated with pinocytosis. Exocytosis is the reverse process. Receptor-
the movement of water molecules. Many cells are isotonic to the mediated endocytosis is a complicated mechanism involving the
environment to avoid excessive inward and outward movement transport of materials via coated vesicles.
of water. Other cells must constantly export water from their
48
PRACTICE (45 MINS) EVALUATION (180 MINS)
Ask the learners to design and a model of a plasma membrane
Ask the learners to answer the following practice or guide using recyclable or indigenous materials.
questions: Divide the learners into groups and assign different concentrations
• What is the difference between diffusion and facilitated of salt solution to be used in making salted eggs.
diffusion? Ask the learners to answer the following questions:
• How do endocytosis and exocytosis allow movement of • Why does putting salt on meat preserve it from bacterial
materials in and out of the cell? spoilage?
• What solution is best for a plant cell? How about for an animal • Compare specific transport processes (i.e., diffusion, osmosis,
cell? facilitated transport, active transport, endocytosis, and
• Explain the orientation of the phospholipid molecules in the exocytosis) in terms of the following:
presence of water. • concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
ENRICHMENT (45 MINS)
Let the learners recognize the effect of a defective membrane in
normal body functioning. Ask them to write an essay about the
possible effects of a faulty plasma membrane aside from the
examples given earlier.
Ask the learners to individually submit a concept map about plasma
membrane and the different transport mechanisms.
General Biology 1 240 MINS
50
INTRODUCTION (15 MINS) Teacher tip
Prior to this lesson, instruct the learners to read up on the transport of materials across membranes. Ask After the learners have enumerated the
different transport mechanisms, ask them
the learners to identify the different mechanisms on how materials are transported in and out of the
why they think there is a need to have
cell. different kinds of processes that allow
Introduce the topic by providing the learners with background information. materials to be transported in and out of
the cell.
In order for the cell to stay alive, it must meet the characteristics of life which include taking nutrients in
and eliminating wastes and other by-products of metabolism. Several mechanisms allow cells to carry Learners will describe the plasma
out these processes. All of the cell’s activities are, in one way or another, tied to the membrane that membrane in different ways. Ask them how
they think the structures found within the
separates its interior from the environment.
membrane help in performing its function
Ask the learners how they visualize a plasma membrane and what characteristics do they think are and what might happen in the absence of
essential for it to perform its function. the these structures
Teacher tip
MOTIVATION (15 MINS) Allow some time for the learners to smell
Before the start of the lesson on diffusion, conduct this simple class activity. Spray an air freshener in the spray until everyone has already smelled
one corner of the room and instruct the learners to raise their hands if they have smelled the scent of the scent. Remember to instruct the
the spray. learners to raise their hand once they smell
the scent.
Ask the learners the following questions:
• Who among the class were able to smell the air freshener first? The learners might give varying responses
to the question depending on what aspect
• Who among the class were the last ones to smell the air freshener? they are looking into. Give hints by
• How would you explain the phenomenon wherein people in the same classroom smelled the providing the giant and pygmy as examples.
scent of the air freshener at different times?
Acknowledge the learners’ responses and
point out that the two men are similar in the
Divide the learners into groups and ask them the question: What comes to your mind when you see sense that they are both abnormal. Growth
two men who are of the same age but one is 7.5 feet tall and the other is 3.5 feet tall? in both men is abnormal such that one is
too big in size while the other one is too
Allow the learners to discuss the similarities and differences between the two among their groups. small.
The nonpolar tails face toward the water. Transmembrane proteins float within the bilayer and serve as
channels through which various molecules can pass. They function as ‘identification tags’ on cells
which enable the cell to determine if the other cells that it encounters are like itself or not. It also
permits cells of the immune system to accept and reject foreign cells such as disease-causing bacteria.
Many membrane proteins function as enzymes that speed up reactions in cells. Others act like paste or
glue-forming cell junctions where adjacent cells stick together. Membranes also contain cholesterol
which reduces the cell’s permeability to substances and make the bilayer stronger.
Transport Mechanisms
1. Ask the learners to enumerate the different transport mechanisms.
2. Differentiate between diffusion and osmosis.
52
Molecules and substances move in several ways that fall within two categories: passive transport and active transport. In passive transport,
heat energy of the cellular environment provides all of the energy, hence, this is not energy-costly to the cell. Active transport, however, requires
the cell to do work, requiring the cell to expend its energy reserves.
Diffusion is a type of passive transport described as the natural tendency for molecules to move constantly. Their movement is random and is
due to the energy found in the individual molecules. Net diffusion occurs when the materials on one side of the membrane have a different
concentration than the materials on the other side. Osmosis is a special type of diffusion specifically associated with the movement of water
molecules.
A solution with a higher concentration of solutes is said to be hypertonic while a solution with a lower concentration of solutes is hypotonic.
Water crosses the membrane until the solute concentrations are equal on both sides. Solutions of equal solution concentration are said to be
isotonic. This only occurs when the solute concentration are the same on both sides of the membrane.
Compare and contrast facilitated diffusion and active transport. Then present photos of plant and animal cells immersed in an isotonic,
hypotonic, and hypertonic solution. In addition, describe a solution and solute movement into and out of the cell under hypertonic, hypotonic
and isotonic conditions.
Explain the effects of the different solutions to the cells. Ask which among the three solutions is the best for plants? For animals? Let them
understand water requirement in plants.
Many cells are isotonic to the environment in order to avoid excessive inward and outward movement of water. Other cells must constantly
export water from their interior to accommodate the natural inward movement. Most plants are hypertonic with respect to their immediate
environment. Osmotic pressure within the cell pushes the cytoplasm against the cell wall and makes a plant cell rigid.
When an animal cell such as red blood cell is immersed in an isotonic solution, the cell gains water at the same rate that it loses it. The cell’s
volume remains constant in this situation.
What will happen to the red blood cell when immersed in a hypotonic solution which has a lower solute concentration than the cell? The cell
gains water, swells, and may eventually burst due to excessive water intake. When placed in a hypertonic solution, an animal cell shrinks and
can die due to water loss.
Water requirement for plant cells is different due to their rigid cell walls. A plant cell placed in an isotonic solution is flaccid and a plant wilts in
this condition. In contrast with animal cells, a plant cell is turgid and healthy in a hypotonic solution. In a hypertonic solution, a plant cell loses
water, shrivels, and its plasma membrane detaches from the cell wall. This situation eventually causes death in plant cells.
To control the entrance and exit of particular molecules, selective transport of materials is necessary. One simple process is facilitated diffusion
that utilizes protein transmembrane channels that are specific to certain molecules. It is a passive process driven by the concentration of
molecules on the inside and the outside of the membrane. Certain molecules are transported in and out of the cell, independent of
concentration. This process requires the expenditure of energy in the form of ATP and is called active transport.
Differentiate endocytosis, phagocytosis, pinocytosis, receptor-mediated endocytosis, and exocytosis.
Large molecules enter the cell by generalized non-selective process known as endocytosis. Phagocytosis is endocytosis of a particulate
material while pinocytosis is endocytosis of liquid material. In this process, the plasma membrane engulfs the particle or fluid droplet and
pinches off a membranous sac or vesicle with a particular fluid inside into the cytoplasm.
Exocytosis is the reverse process where a membrane-bound vesicle filled with bulky materials moves to the plasma membrane and fuses with
it. In this process, the vehicle’s contents are released out of the cell.
Receptor-mediated endocytosis is a complicated mechanism involving the transport of materials through coated vesicles. Cells take up
molecules more efficiently in this process due to the receptor proteins on their surfaces. Each receptor protein bears a binding site for a
particular molecule. If the right molecule contacts a receptor protein, it attaches to the binding site, forming a pocket and eventually pinching
off into the cytoplasm.
54
• How do diffusion and facilitated diffusion differ?
• How do endocytosis and exocytosis allow movement of materials in and out of the cell?
• What solution is best for a plant cell? How about for an animal cell?
• Give two ways by which one could determine whether active transport is going on.
• Compare and contrast the effects of hypertonic and hypotonic solutions on plant and animal cells.
• What role do vacuoles play in endocytosis and exocytosis?
• phospholipid bilayer
• hydrophilic heads
• hydrophobic tails
• cholesterol
• membrane proteins
Concept mapping Teacher tip
Ask the learners to individually submit a concept map about the different transport mechanisms. You You can provide the learners with key words
can provide them with sample words for their concept map or allow them to come up with their own:
or allow them to come up with their own
key words for their concept map.
• plasma membrane • phagocytosis
• transport mechanisms • pinocytosis
• passive transport • receptor-mediated
• active transport endocytosis
• diffusion • hypotonic
• facilitated diffusion • hypertonic
• endocytosis • isotonic
• exocytosis
Assessment questions:
Instruct the learners to answer the following questions to assess their knowledge and understanding of
the lesson:
• Why does putting salt on meat preserve it from spoilage by bacteria?
• Compare specific transport processes (i.e., diffusion, osmosis, facilitated transport, active transport,
endocytosis, and exocytosis) in terms of the following:
• concentration gradient
• use of channel or carrier protein
• use of energy
• types or sizes of molecules transported
56
General Biology 1 120 MINS
Performance Standard
The learners shall be able to explain the role and significance of carbohydrates Instruction/ Discussion, as a class and among groups, on 60
Delivery/ the structure and importance of
and lipids in biological systems.
Practice carbohydrates and lipids.
Learning Competencies
The learners:
Enrichment Laboratory activity on testing the 20
• categorize the biological molecule as a carbohydrate or lipid according to
presence of carbohydrates and lipids on
their structure and function (STEM_BIO11/12-Ii-j-15)
common food products
• explain the role of each biological molecule in specific metabolic processes
(STEM_BIO11/12-Ii-j-16)
• detect the presence of carbohydrates and lipids in food products using Evaluation Group activity on making molecular 20
simple tests models of carbohydrates and lipids
58
You may ask the following questions to facilitate the Teacher tip
discussion and call on several groups to present in front of
the class: For the food labels, local products that are
familiar to the learners will make the best
•How many servings are in this container? samples. Make sure that the labels have
carbohydrates, fats, and fibers in them. If
•Would you agree that this is the reasonable amount of there are no food labels available, you may
do an image search and print some sample
food you would consume per serving? How many total
food labels from the internet.
food calories (C) are in this container?
Division into small groups of two or three
•How much fat is present in one serving? What kind of fat? may facilitate sharing. Only call on two or
three groups to present if there is limited
What is the importance of consuming fats in our diet?
time.
•How much carbohydrates are present in one serving? Expect the responses to vary depending on
What kind of carbohydrates? What is the importance of how realistic the serving sizes are. You can
also discuss about how advertisers can
consuming carbohydrates in our diet?
influence how people perceive food.
Take note that a food calorie is the same as
•Decide on whether this food sample can be eaten often 1 kcal or 1000 calories. A young adult would
or sparingly and justify. often need to take 1800-2500C per day
depending on their size and level of activity.
3.Recall that human beings, like all animals, are Responses may include saturated,
heterotrophs that need to take in energy and organic unsaturated, and trans fats. Explain to the
learners that these fats will be discussed in
molecules (carbohydrates, fats, and proteins) from plant
more detail during the lesson. Regarding its
and animal matter. importance, expect responses ranging from
energy source, insulation, for flavor, for aid
4.Explain to the learners that this lesson will describe the in cooking, for heart health, skin health, etc.
structure of carbohydrates and lipids and explain the role that these biomolecules play in important
Possible responses include sugar, fibers, etc.
biological processes. Regarding its importance, responses may
include energy source, for aid in regular
bowel movement, for provision of building
blocks for biosynthesis, etc.
INSTRUCTION/DELIVERY (60 MINS)
Present a diagram similar to the one below.
Point out that the bulk (i.e., more than 90%) of the human body weight is provided by only three
elements: oxygen, carbon, and hydrogen. We get these elements primarily from the food we eat, from
the water we drink, and from the air we inhale around us.
Explain to the learners that biogeochemical cycles such as the carbon-oxygen cycle and the water cycle
play important roles in ensuring that we have access to these important elements. All forms of life, not
only that of humans, are made up of four kinds of important large molecules: carbohydrates, lipids,
60
proteins, and nucleic acids. All of these have carbon atoms as their backbones since carbon is capable of forming up to four chemical bonds
with atoms of other elements.
Carbohydrates are usually good sources of raw materials for other organic molecules and energy. One gram of carbohydrates provides
four food calories or 16 kJ of energy. In the human diet, carbohydrates mainly come from plants although they are found in all
organisms.
These monomers, called monosaccharides, form covalent bonds when one monomer loses a hydroxyl group and the other loses a hydrogen
atom in dehydration or condensation reactions, forming disaccharides. This reaction requires energy to occur. The bond formed is called a
glycosidic linkage.
Teacher tip
Longer polysaccharide chains are formed by monomer addition through succeeding dehydration If a projector is available, you may also use
animations like the ones found at <http://
reactions. These reactions can occur in the human liver as carbohydrates are stored as polysaccharides www.cengage.com/biology/
called glycogen or in ground tissues of plants where these are stored as starch. discipline_content/animations/
reaction_types.swfto> to help in
visualization.
Polysaccharides are broken down into simpler components through the use of water to break covalent
bonds and release energy. The process, known as hydrolysis (hydro means water and lysis means split), Correct response: 999 water molecules
is the opposite of dehydration reactions and often occurs in the digestive tract during chemical and
During the discussion, invite the learners to
mechanical digestion. Here, enzymes break bonds within polysaccharides. With the aid of water, one – find different kinds of carbohydrates in their
H group attaches to a monosaccharide while another –OH group attaches to the other. food labels.
Comprehension question: How many molecules of water are needed to completely hydrolyze a
polysaccharide that is one thousand monosaccharides long?
62
How are carbohydrates classified?
Carbohydrates can be classified into three main categories, according to increasing complexity:
• monosaccharides (monos means single and sacchar means sugar)
• disaccharides (di means two)
• polysaccharides (poly means many)
Some notes on their structures and functions are found in the following table:
66
ENRICHMENT (20 MINS) Teacher tip
Divide the class into groups. Instruct the learners to prepare the following materials that are needed for This activity may be done as a class if time
does not permit for the activity to be done
the laboratory activity:
in separate groups. If Benedict’s solution is
• eight glass droppers, medicine droppers, or caps • ethanol solution not available, you may only perform the last
• 12 test tubes • glucose solution two tests.
• test tube holders or tongs • flour or cornstarch
In the absence of laboratory grade
• beaker • cooking oil
chemicals, you may improvise with store-
• alcohol lamp • sample of student- bought chemicals like iodine and 70% ethyl
• Benedict’s solution brought food or drink alcohol for medical use. Make sure to test
• iodine solution • mortar and pestle
the procedure before performing the
activity in the class.
• categorize the biological molecule (i.e., protein) according to their structure Enrichment Constructing of physical or computer- 15
and function (STEM_BIO11/12-Ii-j-15) generated protein models; Identification
• explain the role of each biological molecule in specific metabolic processes of surface features of proteins (e.g.,
(STEM_BIO11/12-Ii-j-16) hydrophobic patches, positively or
• determine how factors such as pH, temperature, and substrate affect negatively charged domains, etc.)
enzyme or protein activity (STEM_BIO11/12-Ii-j-19)
Evaluation Examination and Model Accuracy 60
Evaluation
Specific Learning Outcomes
Materials
At the end of the lesson, the learners shall be able to:
recyclable materials for construction of protein models,
• discuss the different levels of protein structure (i.e., primary, secondary, software for molecular modelling (available for free
tertiary, and quaternary) download)
• discuss how protein structural features may influence their interactions
• discuss how protein structural features may influence their functions
Resources
(1) SwissPDB Viewer software (available for free download)
(2) Protein Data Bank (can be accessed at www.db.org
70
INTRODUCTION (20 MINS) Teacher tip
Communicate learning objectives and important terms Prepare a genetic code table. Teach the
1. Review the Genetic Code. In particular, have the learners translate codons to their corresponding learners how to use the genetic code table
amino acids. to translate an mRNA sequence.
2. Stress the importance of how mutations may alter the type of amino acid coded by a given
Clarify the misconception on mutations in
sequence. the mRNA sequence. Stress how not all
3. Discuss how some mutations may be ‘silent’. mutations in the mRNA sequence may lead
4. Discuss how some mutations may be considered ‘conservative’ (e.g., AA changed to another with a to changes in amino acid sequence.
similar functional group type) or ‘non-conservative’ (e.g., AA changed to another with a different
functional group type).
5. Discuss the importance of the translation reading frame. Stress how frameshift mutations may lead
to changes in the amino acid sequence translation as well as changes in the termination of the
protein.
72
General Biology 1 60 MINS
Molecular Biology
Content Standard
The learners demonstrate an understanding of the structures and functions of Motivation Class activity on the important functions of 5
biological molecules (i.e., carbohydrates, lipids, nucleic acids, and proteins) biological molecules`
Materials
Specific Learning Outcomes
recyclable materials for construction of models of biological
At the end of the lesson, the learners shall be able to:
molecules, software for molecular modelling (available for
• discuss key structural features of DNA, RNA, and proteins free download)
• discuss structural and functional differences between DNA and RNA
• discuss the different levels of protein structure (i.e., primary, secondary, Resources
(1) SwissPDB Viewer software (available for free download)
tertiary, and quaternary)
(2) Protein Data Bank (can be accessed at www.db.org
• discuss how protein structural features may influence their functions
INTRODUCTION (5 MINS) Teacher tip
1. Facilitate a review on the cell and its organelles. Emphasize that the specific functions for each
Relate the Central Dogma of Molecular
organelle type are compartmentalized and that the functions of each organelle are defined by its
Biology to real world situations.
physical properties.
2. Explain to the learners that the lesson will focus on understanding the important physical properties For example, in cooking, the cook book
of certain biomolecules (i.e., DNA, RNA and proteins) and how these properties allow the functions like the DNA (Genome). The
specific recipe functions like the mRNA
biomolecules to serve specific functions within the cell.
while the desired dish is the protein.
3. Discuss the Central Dogma of Molecular Biology: DNA RNA Protein
Provide two more examples of everyday life
activities that can illustrate the Central
Dogma of Molecular Biology.
Teacher tip
MOTIVATION (5 MINS) Note the following expected responses:
1. Divide the class into groups and instruct them to identify or enumerate the most important • DNA—repository of genetic
functions of DNA, RNA, and proteins. information
2. Consolidate the learners’ responses on the board. • RNA—transcripts and
regulators of expressed
INSTRUCTION/DELIVERY (30 MINS) genetic information
Elaborate on the main functions of the biomolecules: • protein—functional products
• DNA—is the repository of genetic information and executors of cellular
• RNA—serve as the transcripts and regulators of expressed genetic information functions
• Proteins—are the functional products and executors of cellular functions
DNA Complementary Base Pairs Allows each strand to serve as a template for replication and
transcription
Ci-1 : Carbonyl C of
previous AA
Ni : Amide Nitrogen of current AA
Cαi: Alpha Carbon of current AA
Ci : Carbonyl C of
current AA
a. non-polar
i. aliphatic
(G,A,V, L, I, M)
ii. aromatic
(Y,W,F)
b. polar, uncharged (S,T,C,P,Q)
76
ENRICHMENT (5 MINS) Teacher tip
Convert the given coding sequence into an mRNA transcript: The correct responses are the following:
Complementary Non-coding / Template sequence: 3’ TACGTATCTAATCCTATAGGGTCTATC 5’ For no. 1, the coding sequence ~ mRNA
transcript is 5’
AUGCAUAGAUUAGGAUAUCCCAGAUAG
2. Translate the given mRNA transcript into a polypeptide sequence: 3’
Coding sequence ~ mRNA transcript: 5’ AUGCAUAGAUUAGGAUAUCCCAGAUAG 3’
For no. 2, the polypeptide sequence is
N-Met-His-Arg-Leu-Gly-Tyr-Pro-Arg-C
Template sequence
A similar exercise of generating non-coding sequences (DNA), transcripts (RNA), and translated 3’ TAC_ _ _TCT_ _ _ CCTATAGGGTCT 5’
polypeptides may be performed to test the learners’ understanding of the topic. 5’ _ _ _CAUAGAUUA_ _ _UAU_ _ _AGA 3’
General Biology 1 150 MINS
78
INTRODUCTION (5 MINS) Teacher Tip:
Introduce the following learning objectives using any of the suggested protocols (e.g., verbatim, own Prominently display the learning objectives
words, or read-aloud): and important terms prominently on one
side of the classroom and frequently refer to
• I can describe the components of an enzyme. them during discussion. You may place a
• I can determine how factors such as pH, temperature, and substrate affect enzyme activity. check-mark beside a term in the wordlist
after defining it so that the learners have an
Introduce the list of important terms that the learners will encounter: idea of their progress.
• cofactor
• coenzyme
• competitive inhibitor
• noncompetitive inhibitor
80
Proceed to the lecture proper.
• Can you imagine what would happen if it takes many years for our body to hydrolyze the starch in Teacher Tip:
A visual aid may be used to show the
the food that we eat? Starchy food comprises an important part of our diet and our bodies use
contortion. For example, a string of paper
enzymes called amylase to quickly hydrolyze starch into simple sugars. clips or a bunch of keys on a key ring can
stand for starch. The contortions involved in
• What are enzymes? detaching one paper clip or removing one
key can serve as analogies for the process.
• Enzymes are organic or biological catalysts. Catalysts are substances that speed up a reaction
without being used up, destroyed, or incorporated into the end product. They are vital to the
regulation of the metabolic processes of the cell. Many enzymes are proteins. We will focus on this
type of enzymes in this discussion. RNA enzymes called ribozymes will be discussed later.
Figure 1 (on the right): Energy profile for a spontaneous exergonic reaction: AB+CDAC+BD (Source: Reece, J. U (2011 ).
Campbell Biology, 9th ed. . San Francisco, CA: Pearson Benjamin Cummings)
• The reaction shown in Figure 1 is spontaneous but the activation energy provides a barrier that
determines the rate of the reaction. Reactants have to absorb enough energy from their
environment to surmount this barrier before the reaction can proceed. Teacher tip
• Knowing this, how can you cause reactants to absorb more energy from their environment? Relate the discussion with the hypothetical
reactions in Figures 1 and 2.
The active site and functional groups of its amino acids may lower activation energy by:
• acting as a template for substrate orientation
• stressing the substrates and stabilizing the transition state
• providing a favorable microenvironment
• participating directly in the catalytic reaction
82
View http://www.wiley.com/college/boyer/0470003790/animations/enzyme_binding/
enzyme_binding.htm. Click on ‘Binding Models’. Ask the learners to answer the following questions Teacher tip
The video links provided here may be given
and call on a small group to explain their responses using their own words:
as a pre-lecture assignment to stimulate
• How does the shape of an enzyme enable it to perform its function? prior knowledge and give the learners an
• What is the difference between Emil Fisher’s lock-and-key model and Daniel Koshland’s induced-fit idea of the topics to be discussed.
model? Describe the current model.
If a computer is not available, you may ask
the learners to answer the questions based
Factors that affect enzyme action
on your discussion. Provide constructive
Given what the learners know about enzyme action, ask them to predict how the following factors will feedback and correct misconceptions. You
affect the action of an enzyme by completing the table below. This may be done by group or by the may use models or analogies to better
class as a whole. If the entire class is involved, invite a small group to fill in each row. illustrate the concepts. Here are some
suggestions:
Table 1: Factors that affect enzyme action. • a handshake to demonstrate induced fit
• two pieces of a jigsaw puzzle to
illustrate components of a substrate
• roleplay to show the interactions
between enzymes and substrates
Provide constructive feedback and clarify the reasons for the observed changes to reaction rates and
enzyme function.
View http://web.biosci.utexas.edu/psaxena/MicrobiologyAnimations/Animations/Enzyme-Substrate/micro_enzyme-substrate.swf. Ask the
learners to answer the following question and call on a small group to explain their response in their own words:
The presence of non-protein helpers called co-factors and of organic molecules like co-enzymes may activate apoenzymes to produce
holoenzymes by binding to their active sites. Common examples may be found in popular supplements such as ions of iron, copper, zinc, or in
vitamins like vitamins A, C, and B-complex.
Explain that many living tissues contain catalase or peroxidase that catalyzes the reaction conversion of
H2O2 → H2O + O2.
Cut the liver into equal-sized cubes and demonstrate the effect of placing the liver in a 2mL solution of
hydrogen peroxide. Evolution of gas (i.e., bubbling) will be observed. Groups of learners may prepare
solutions that they can test using the different factors.
Instruct the learners to rank the different solutions based on the rates of reactions.
84
EVALUATION (20 MINS)
Making models of enzyme-catalyzed reactions Teacher tip
Before this session, inform the learners that
they will be making models of enzyme-
1. Divide the class into small groups. catalyzed reactions next meeting and ask
them bring recyclable materials that they
2. Distribute different examples of important enzyme-catalyzed reactions to the groups. can use for this activity.
3. Ask the groups to create models using common or recyclable materials and label the following
In grading the models, check to see if the
components: enzyme, substrate, product, and active site. learners were able to label the parts
4. Ask the learners to demonstrate how this enzyme works. correctly. Demonstrate that the substrate
goes into the active site, gets contorted and
moves out as a product. Check if the
Written Task substrate and the products are consistent
with the reaction being modeled (e.g.,
1. Divide the class into small groups. anabolic, catabolic, or recombination)
2. List the materials for Enrichment (See previous section).
3. Ask the learners to design their own experiment in order to explore the effect of one factor on
enzyme activity. Explain that the experimental design should include:
• a testable hypothesis
• complete list of dependent and independent variables
• complete list of controlled variables
• logical procedure in a flowchart format
• short and accurate explanation of what you expect to happen and why
• sufficient replicates
General Biology 1 240 MINS
Content Standard Motivation Post questions on the board and ask the 5
The learners demonstrate an understanding of photosynthesis and cellular students to identify the processes involved in
respiration energy transformation
• Describe the major features and chemical events in photosynthesis and Enrichment Similarity of photosynthesis and cellular 25
cellular respiration (STEM_Bio11/12-IIa-j-1) respiration and connecting the concepts with
the biological systems
86
INTRODUCTION (5 MINS) Teacher Tip:
Review with the class that oxidation-reduction (redox) reactions involve electrons passing from one Note: This lesson merely describes the
major features of (or an overview)
molecule to another. Oxidation (also splitting) is the loss of electrons while reduction is the gain of
photosynthesis and cellular respiration. A
electrons. You can show this picture to your students and try to ask questions so that you can generate more detailed concept and deeper
critical-thinking skills from them. To help them visualize the concept, a diagram of redox reactions is explanation will be presented in another set
also shown below. Ask your students which organisms (in the picture below) photosynthesize and which of learning competencies.
respire (take note that plants both photosynthesize ad respire at the same time). Then show the
Emphasize that the flow of energy starts
equation of redox reactions after your students have given their responses. You may also ask examples with the sun. There are two organelles that
of oxidation reactions (e.g., browning of peeled potato, banana, and eggplant). For redox reactions participate in the energy flow from the sun
examples are rusting of iron, burning of combustible material (e.g., wood, coal, etc.) through living things. You can now motivate
your students by posting two questions
relating to energy transformation. Redox
NOTE: Energy transformation (e.g., photosynthesis and cellular respiration is one of the difficult topics reactions is one type of chemical reaction.
in biology. To capture the general picture of the topic, students have to be encouraged to read and re-
Emphasize to students the importance of
read the key concept, write and re-write, outline and re-outline, draw and re-draw, and to recite orally if understanding the processes rather than
they want the ideas to sink in their system. Patience and steadfastness are important virtues that should memorizing all the various reactions.
be included as you study this concept.
Remember that plants both
photosynthesize and do on aerobic
respiration.
For additional information, tell the class that ATP is also involved in rigor mortis—a temporary stiffness
of the body that happens soon after death of a person.
Teacher tip
MOTIVATION (5 MINS) Suggested answers:
1. Through photosynthesis
2. Through cellular respiration
Post these two questions on the board. Ask them to identify the process involved in each question so
that food is manufactured and energy is released. A.
1. Components that are utilized: Carbon
dioxide, water, sunlight (and chlorophyll can
• How do plants harness light energy to manufacture food? be mentioned)
• How do living organisms harness energy from food? 2. Groups that come out: Carbohydrate
(glucose) and oxygen
Then show to them the overall equation for each process as follows: B.
• Chemical reactions for photosynthesis: 1. Groups that go in: Carbohydrate, oxygen
and 38 ADP molecules
6 CO2 + 6 H20 + sunlight C6H12O6 + 6 O2 2. Groups that are released: Carbon
• Which groups participate in the reaction?
dioxide, water and 38 ATP molecules
88
• Which groups are released?
• Chemical reactions for cellular respiration:
C6H12O6 + 6 O2 + about 38 molecules of ADP 6 CO2 + 6 H20 + about 38 molecules of ATP
• Which groups participate in the reaction?
• Which groups are released?
Processing Questions:
1. What are the two kinds of reactions in photosynthesis?
2. What are the basic stages of the Calvin cycle?
3. What are the reactants and products of photosynthesis?
4. In which part of the cell glycolysis happens? What about the citric acid cycle and electron transport
chain?
5. How many metabolic pathways are there in cellular aerobic respiration? In anaerobic respiration?
6. What are the reactants and products of cellular respiration?
7. About how many ATP molecules does a cell obtain from the breakdown of one molecule of glucose
in cellular respiration?
8. Given the glucose, carbon dioxide and water, which one(s) is/are called high-energy molecule and
which one(s) is/are called low-energy molecule?
Suggested Answers:
1. Light-dependent reaction and light-independent reaction (also known as Calvin cycle reaction or
carbon fixation reaction).
2. The basic stages of Calvin cycle reaction are: carbon dioxide fixation, carbon dioxide reduction,
RuBP regeneration.
3. Reactants: carbon dioxide and water; products: carbohydrates and oxygen
4. Glycolysis happens in the cytoplasm of the cell; citric acid cycle (Krebs cycle) and ETC are in the
mitochondrion of the eukaryotic cell.
5. In cellular aerobic respiration: three; in anaerobic respiration: one
6. Reactants: carbohydrates, oxygen, and about 38 ADP molecules; products: carbon dioxide, water
and about 38 ATP molecules
7. About 36 to 38 ATP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ATP molecules produced depending on the shuttle used to transport the electrons
and on the kind of species.)
8. High-energy molecules: glucose; low-energy molecules: carbon dioxide and water
Directions:
Fill-in the two tables below for the major events and features of photosynthesis and cellular respiration,
respectively. The option tables are given for you to answer the needed materials and end products of
photosynthesis and cellular respiration.
90
Major Events and Features of Photosynthesis
2. Preparatory reaction
a. Pyruvate, ATP, NADH b. NADH, FADH2, c. Glucose, ATP, NAD d. Pyruvate, Coenzyme
O2, ADP Pi +, ADP P
i A, NAD+
e. Acetyl CoA, H2O, f. Acetyl CoA, CO2, g. CO2, NADH, h. ATP, H2O, NAD+,
NAD+, FAD, ADP Pi NADH FADH2, ATP FAD
Suggested Answers:
Light-dependent reactions
(take place in the thylakoid a. Light-energy; pigments (chlorophyll) a. Electrons
membrane) b. NADPH, O2
b. Electrons, NADP+, H2O, electron acceptors
a. Photochemical reactions
c. Proton gradient, ADP + P, ATP synthase c. ATP
b. Electron transport
1. Glycolysis (in cytosol) Glucose, ATP, NAD+, ADP Pi Pyruvate, ATP, NADH
3. Citric acid cycle Acetyl CoA, H2O, NAD+, FAD, CO2, NADH, FADH2, ATP
ADP Pi
4. Electron transport and NADH, FADH2, O2, ADP Pi ATP, H2O, NAD+, FAD
chemiosmosis
92
Activity: Gaseous Products of Photosynthesis
NOTE: If there is enough time and the materials are available, let the class do this activity.
Materials needed:
1000 mL beaker, 3 grams of sodium bicarbonate, Hydrilla or Elodea, funnel, test tube
Procedure:
1. Half-fill a 1000 mL beaker with tap water.
2. Add 3 grams of sodium bicarbonate.
3. Place Hydrilla or Elodea in the bottom of the beaker.
4. Put a funnel over the plant.
5. Fill the test tube with water up to the brim. Secure the mouth of the test tube with your thumb. Invert
the tube and place it on top of the funnel.
6. Place the beaker under direct sunlight. Count the bubbles that appear in the test tube after 30, 60,
90, 120, 150, 180, and 210 seconds.
7. After several minutes, slowly remove the test tube from the funnel. Place your thumb over its mouth.
Turn the tube right up and insert a glowing match to the test the presence of the oxygen in the tube.
Adapted from: Science and Technology II for the Modern World. (2003). Makati City: Diwa Scholastic
Press, Inc.
Note: An illustration of the set-up will help teachers and students to visualize how the experiment
should be performed.
ENRICHMENT (25 MINS)
Directions: Show the basic similarity and differences between photosynthesis and cellular respiration.
The options are provided for in the other table below.
PART I
1. Raw materials
2. End products
3. Electron transfer compound
4. Location of electron transport chain
5. Organelle involved
6. ATP production
7. Source of electron for ETC
8. Type of metabolic reaction
9. Terminal electron acceptor for
electron transport chain
Available Choices
a) O2 b) Anabolism
c) Glucose, oxygen d) Carbon dioxide, water
e) NADP+ is turned to NADPH f) NAD+ is turned to NADH+
94
Suggested Answers
Photosynthesis Cellular Respiration
1. Use of Membrane
Electron Transport Chain
In chloroplast
2. Electron Transport Chain • An ETC is located on the thylakoid
membrane. Electrons passed down the ETC
3. Enzyme have been energized by the sun; The ETC
establishes an electrochemical gradient of H
+ with subsequent ATP production by
SET B: Photosynthesis versus cellular respiration
chemiosmosis.
Directions: Using the following descriptions for photosynthesis and cellular respiration, bring out your In mitochondrion
long bond paper or Oslo paper, pencil, ruler, ballpen and coloring materials. Show an illustration/ • An ETC is located on the cristae of
mitochondrion. Energized electrons have
diagram comparing the structure and function of chloroplasts and mitochondria. Label the parts of the
been removed from glucose and glucose
organelles. The rubric for the drawing is given below. products. The ETC establishes an
electrochemical gradient of H+ with
subsequent ATP production by
In Photosynthesis: chemiosmosis.
• Water is oxidized and oxygen is released
Enzymes
• Has electron transport chain located within the grana of chloroplasts, where ATP is produced by In chloroplast
chemiosmosis • The stroma contains the enzymes
• Has enzyme-catalyzed reactions within the semi-fluid interior of the Calvin cycle. In the Calvin cycle,
NADPH and ATP are used to reduce carbon
• Carbon dioxide is reduced to a carbohydrate
dioxide to carbohydrate.
In mitochondrion
In Cellular respiration: • The matrix contains the enzymes of
the citric acid cycle. In citric acid cycle, the
• Oxygen is reduced to water oxidation of glucose products occurs as
• Has electron transport chain located within the cristae of the mitochondria, where ATP is produced NADH and ATP are produced.
by chemiosmosis
• Has enzyme-catalyzed reactions within the semi-fluid interior
• A carbohydrate is oxidized to carbon dioxide
96
Rubrics for the Drawing
Contrast and Shows exceptional artistic and skillful Shows generally acceptable artistic Shows generally vague color contrasts;
intensity of drawing color contrast; and meaningful color and skillful color contrasts; and and indiscernible sense of color
concentration meaningful color concentration concentration
Blending of colors Color mix is exceptionally creative, Color mix is generally creative, Color mix needs improvement
appropriate and meaningful appropriate and meaningful
Neatness Completely free from mess Almost free from mess Too messy
PART III
Directions: Group the class into triad. Make each group construct a concept map to help them develop their understanding of photosynthesis
and cellular respiration. Prepare a rubric for easy scoring.
Content knowledge Information is complete and Information is mostly complete and Information is mostly incomplete and
accurate accurate inaccurate
Originality in Exceptionally well organized and Generally well-organized and Fairly understandable
organization of ideas understandable understandable
Neatness Completely free from mess Almost free from mess Too messy
PART IV
Directions: Arrange the following to get the right energy flow sequence in aerobic respiration.
NADH Electron Transport Chain Glucose ATP
Suggested Answers:
Suggested Answers:
1. Cellular respiration
2. Photosynthesis
98
General Biology 1 120 MINS
Evaluation Quiz 20
Specific Learning Outcomes
At the end of the lesson, the learners shall be able to:
Reflection End of topic question
• Identify different forms of energy in their surroundings.
• Present and explain a real life analogy of the ATP=ADP cycle.
• Relate the experiment done and the game to free energy and equilibrium; Materials Laboratory equipment needed, raw
and ATP cycle respectively. materials, school supplies
• Explain the topics discussed in their small groups (peer learning). Resources
Another set of analogies may include putting together the ingredients of a dish to create a palatable
viand as an example of anabolism. Or removing one by one the parts of an engine to fix a broken car
as an example of catabolism.
100
INSTRUCTION/DELIVERY (60 MINS)
Teacher tip
In the start of the lesson, since the terms
Start the discussion by establishing that living organisms are open systems (energy and matter can be metabolism, catabolism, anabolism were
already used in the motivation, the teacher
transferred between the system and its surroundings). Remind the students that this was already
can explain it further by the use of the
mentioned in one of the characteristics of living organisms. Obtain and use materials for Energy, and in downhill and uphill metabolic avenues.
the unifying theme- interaction with the environment. This way students will clearly understand that Downhill avenue (Catabolism)- releases
processes (Bioenergetics) that happen within a living organism is still influenced and affects the energy that will be used, enabling energy
be stored. While Uphill avenue (Anabolism)
surroundings. The teacher may directly involve students by pointing out that humans breath the carbon
uses energy to build complex materials.
dioxide needed by plants as raw materials to produce food via photosynthesis, the teacher may use the
figure below. Solicit other examples from your students.
Engage your students by giving examples
Emphasize as well the role of oxygen as final electron acceptor in cellular respiration. Students should
first.
appreciate why they need to breathe in oxygen and not other form of gases.
If computers/laptops or lcd projectors are
not available, the teacher may adjust the
discussion by preparing materials written on
a manila paper. The teacher may pave the
discussion in such a way that the students
will be answering or completing tables or
having the students research (homework)
about the topic. This will ensure that the
students have something in line with the
topic that will be discussed. Instead of
pictures, the teacher can ask the students to
do actual processes that will depict the
different forms of energy
Teacher tip
Make sure that for every form of energy,
you will be able to show a solid example in
living systems how energy forms exists and
transformed.
Energy Flow and Chemical Recycling in Ecosystems
Energy flows into ecosystem as sunlight and ultimately leaves as heat, while the chemical elements
essential to life are recycled.
Forms of Energy Teacher Tip
Energy is the capacity to cause change. It is also the ability to rearrange a collection of matter. In the This part of the topic will really be the least
of interest of the students. That’s why
environment different forms of energy exist: Kinetic, Light and Potential energy.
exploring the trend in terms of the “hugot-
• Kinetic- energy associated with relative motion of objects lines” may help you in engaging students.
• Thermal energy-type of kinetic energy associated with random movement of atoms. When thermal Inform your students that at the end of the
discussion you will be having the “hugot
energy is transferred in the form of heat.
line” activity that will be based on the laws
• Light Energy- main energy source is the sun and powers photosynthesis (anabolic process). of thermodynamics. So they can start
• Potential Energy- possessed energy of a matter at rest (non- moving form) preparing for their “hugots” as you discuss
• Chemical energy- potential energy released in a chemical reaction the laws of thermodynamics.
102
Laws of Energy Transformation Teacher Tip
Thermodynamics is the study of energy transformations that occurs in a system (collection of matter). Use the figure used, but make sure to note
that an individuals’ contribution to the
Living systems are considered as open systems because energy and matter are transferred between
disorder in surrounding is not obviously felt,
systems and the surroundings. but as a group it is. Use the idea of having
lots of people inside the room compared to
an individual inside the room.
1st Law: The energy of the universe is constant: Energy can be transferred and transformed but it
cannot be created nor destroyed. Plants do not produce energy, but transforms energy from the sun. The teacher must take note that there is
Some energy becomes unavailable to do work because most is lost as heat. Transfer of energy and unstoppable trend towards randomization
of the universe as a whole.
transformation makes the matter more disordered. Disorder of matter is measured through entropy.
∆G = ∆H – T∆S, where ∆H is enthalpy (total
energy), T is absolute temperature and ∆S is
2nd Law: Every energy transfer or transformation increases the energy of the universe.
the change in entropy.
• i.e In a room full of people, breathing increases entropy since all are exhaling carbon dioxide.
• Organisms as open system increase order as long as the order in their surroundings decreases. This If it is possible to show the concentrated
dye experiment (diffusion of dye in water), it
shows that as living organism transfers/transforms energy to its surroundings, the disorder
will be a big help. But before asking the
increases, thus increases entropy. students to do it, make sure that you
prepare questions that will be answered to
lead the students in the discussion of free
Free Energy
energy.
• Energy that can do work under cellular conditions
• Gibbs free energy is the energy in the system that can perform work when temperature and NOTE: You may have the first two bullets
answered by the students before doing your
pressure are uniform throughout the system: ∆G = ∆H – T∆S
discussion. Then after the discussion have
• Also known as free energy change the last 3 bullets answered.
• Measure of system’s instability (trend: tendency to change to a more stable state) • Describe the free energy (G) of the
concentrated dye? Does it have high or low
• Increase in G: UNSTABLE i.e. concentrated dye
free energy? Is it stable or unstable?
• Decrease in G: STABLE i.e. dye dispersed in water • When do we say that the dye reached the
• In chemical reactions: as reaction precedes equilibrium, the free energy of reactants and products stable state?
• Is there a way for the diffused dye system to
decreases (decreases free energy). If products will be removed free energy will increase
undergo spontaneous change? How will you
• When systems reach maximum stability, the system reaches the state of equilibrium. If equilibrium is do it?
reached there is NO WORK. In chemical reactions proceeding equilibrium NO NET CHANGE in the • How will you relate the closed hydroelectric
system to the set up of the dye diffusion
relative concentration of reactants and products. experiment?
• • How will you relate the multistep
hydroelectric system to the dye diffusion
experiment?
Free Energy and Metabolism
Teacher Tip:
Do the game before discussing the ATP hydrolysis and ATP cycle. Make sure that you read the game
mechanics and do the adjustments to fit your classes. At the end of the activity discuss how it is related
to ATP hydrolysis and ATP cycle.
• Calamansi: water (for hydrolysis)
• Students: phosphates that is cleaved
• Students exerting effort to reach the other end: energy releasing process to allow ADP + P to Teacher Tip
produce ATP (phosphorylation) As for supplementary resource, you may
look for videos that clearly explains the
• Bonus/incentive for the winner: energy
hydrolysis of ATP and the ATP Cycle. You
• 2 groups: ATP and ADP may ask your students to view it before the
class (HW) or have it shown in class as you
discuss it.
Hydrolysis of ATP
• process of breaking down bonds between the phosphate groups Teacher Tip
Look for videos showing the 3 cellular work
• this happens when a water molecule breaks the terminal phosphate bond
powered by ATP. For the students to
• HOPO32-, abbreviated P I leaves ATP appreciate these processes more and for
• Forming Adenosine diphosphate (ADP) them to clearly see that its really happening
• Energy is released. This comes from the chemical change of the system state of lower free energy in living systems.
compressed spring.
106
How the Hydrolysis of ATP Perform Work
• Proof that ATP releases heat: in a test set up, the hydrolysis of ATP releases energy in the form of heat in the surrounding water.
• Most of the time when an animal is exposed in a cold environment, the reaction of the body is through shivering. In this reaction of the
organism, shivering uses ATP during muscle contraction to warm the body. Since it will also be a disadvantage for organisms to generate
heat during ATP hydrolysis, in order to maintin the living conditions inside the cell, the energy released during ATP hydrolysis is used by
proteins to perform work: chemical, transport and mechanical
• Hydrolysis of ATP leads to change in the shape of protein and in its ability to bind to another molecule. Phosphorylation (ADP to
ATP) and dephosphorylation (ATP to ADP) promote crucial protein shape changes during important cellular process
The Regeneration of ATP
• ATP is a renewable it can be regenerated by the addition of phosphate to ADP
• Catabolism (exergonic) provides the free energy to phosphorylate ADP.
• ATP formation is not spontaneous, so there is a need to use free energy for the process to work.
• ATP cycle is the shuttling of inorganic phosphate and energy.
• It couples the cell’s energy yielding processes (exergonic) to energy consuming process (endergonic)
• ATP regeneration happens very fast (10M molecules of ATP used ad regenerated per second)
• If ATP could not be regenerated by phosphorylation of ADP, HUMANS would use nearly their body weight in ATP each day.
108
PRACTICE (10 MINS)
A. “Hugot-lines”. Create “hugot-lines” based on the laws of transformation of energy. Ask your
students to create 3 “hugot-lines” per law under the transformation of energy. The student must give
justification for each “hugot-line” they’ll create. Make sure that the “hugot-lines” are in tune with the
scientific concepts of the law of thermodynamics.
B. ATP in everyday life. Ask your students to make an analogy relating the concepts under ATP (ATP
cycle, ATP hydrolysis, How ATP allows organisms to do work) or the relevance of ATP in our lives. After
listing the analogies or the relevance of ATP in our lives, ask the students to write their reflection/
realization regarding the topic.
Teacher Tip
Encourage your students to answer this
REFLECTION (HOMEWORK FOR THE NEXT MEETING) section truthfully as it will also help you
• Which of the topics interest you the most? Why? improve the lesson and your approach.
• Which of the topics interest you the least? Why?
• Did the activities help you understand the topic (Y/N)? Explain your answer.
• Did you see the significance/ connection of the topic in your life?
110
General Biology 1 240 MINS
Materials
• laboratory materials and supplies for the chromatography
experiment (i.e., chromatography or filter paper,
glassware, acetone/solvent, spinach leaf, coleus leaf, coin,
pencil, aluminum foil, ruler, and coffee stirrer)
• prism
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition. Pp.92
– 98. Belmont, California: Brooks/Cole-Tomson Learning.
INTRODUCTION (10 MINS) Teacher Tip:
1. Assess the learners’ prior knowledge of the topic by facilitating a class activity on clustering or word By assessing the learners’ prior knowledge,
you will be able to gauge what they already
webbing. Write the word CHLOROPHYLL on the board. This will serve as the ‘nucleus word’.
know and what they still need to learn from
2. Ask the learners to think of words or images associated with the ‘nucleus word’ and let them write the lesson. This will help you design and
the words or sketch the images around the ‘nucleus word’. determine the topics that you need to
3. Encircle each word or image and draw a line from each item to the ‘nucleus word’. include and those that you need to reiterate
and emphasize in your discussions.
4. Ask the learners to write how each word or image is related to the ‘nucleus word’ CHLOROPHYLL
and have them write the relation above or below the line that you drew. Posing essential questions at the start of a
5. Ask the learners to summarize the word web formed by the class. lesson helps stimulate thoughts, promotes
6. After the summary, present the following questions to the class: inquiry, and motivates the learners to find
and formulate ways to be able to come up
• Why are chlorophyll and other plant pigments important?
with the correct responses.
• How do chlorophyll and other plant pigments help in carrying out photosynthesis?
These essential questions shall help the learners focus in finding the correct responses.
Teacher Tip:
Use the following guidelines in performing
MOTIVATION (50 MINS) the laboratory activity:
To help the learners acquaint themselves with different plant pigments, instruct them to perform a
• Make sure that the learners have
laboratory activity on chromatography of plant pigments. This activity will allow them to visually knowledge of safety practices in the
demonstrate that leaves contain different colored pigments. laboratory.
• Let the learners work in groups in order
Before performing the experiment, provide a brief description of chromatography.
to smoothly carry out the experiment.
Chromatography—is a separation technique used to identify various components of mixtures based • Prepare the materials a day before the
on the differences in their structure and/or composition. It involves a stationary phase (e.g., paper or activity.
any thin layer of an absorbent surface) and a mobile phase (i.e., solvent containing the dissolved
substances). The solvent will move up the paper through capillary action carrying with it the dissolved
substances. These substances will be carried along at different rates because they are not equally
soluble in the solvent and they will be attracted in different degrees to the paper.
Provide the learners with a copy of the instructions for the activity. Guide them as they perform the
experiment.
112
Extracting Plant Pigments through Chromatography
114
Light, as it encounters an object, is either reflected, transmitted, or absorbed. Visible light, with a Teacher Tip:
wavelength of 380–750nm, is the segment in the entire range of electromagnetic spectrum that is most Encourage participation from the students
important to life on earth. It is detected as various colors by the human eye. The color that is not while discussing these concepts.
absorbed by pigments of objects is transmitted or reflected and that is the color of the object that we
see.
!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!Figure'1:!The!Electromagnetic!Spectrum!
Pigments are the means by which plants capture sun’s energy to be used in photosynthesis. However,
since each pigment absorbs only a narrow range of wavelength, there is usually a need to produce
several kinds of pigments of different colors to capture more of sun’s energy.
Chlorophyll
Chlorophyll is the greenish pigment found in the thylakoid membrane inside the chloroplast of a plant
cell. The figure below shows the location and structure of a chloroplast.
Chlorophyll absorbs blue and red light while it transmits and reflects green light. This is why leaves Teacher tip
appear green. For this part, you may ask some learners to
volunteer to show the location of
chlorophyll in a leaf of a plant. They may do
There are several kinds of chlorophyll. Among these, chlorophyll a plays the most important role in this through drawings or sketches in the
photosynthesis. It directly participates in converting solar energy to chemical energy. board.
Other pigments in the chloroplast play the part of accessory pigments. These pigments can absorb
light and transfer the energy to chlorophyll a. One of these accessory pigments is chlorophyll b. Some
carotenoids also contribute energy to chlorophyll a. Other carotenoids, however, serve as protection for
chlorophyll by dissipating excessive energy that will otherwise be destructive to chlorophyll.
Structure of chlorophyll
• Head—a flat hydrophilic head called porphyrin ring. It has a magnesium atom at its center. Different
chlorophylls differ on the side groups attached to the porphyrin.
• Tail—a lipid-soluble hydrocarbon tail.
116
Teacher tip
Reiterate the importance of the formation
of photosystem. The formation of the
photosystem prevents the excited electrons
from going back to the ground state, thus
preventing the loss of energy which is
essential for photosynthesis to occur.
Photosystem
A photosystem is an aggregate of pigments and proteins in the thylakoid membrane responsible for
the absorption of photons and the transfer of energy and electrons. It is composed of:
• Light-harvesting complex— is also called the ‘antenna’ complex and is consisted of several different
pigments (chlorophyll a, chlorophyll b, and carotenoids) bounded with proteins. When a pigment
molecule absorbs a photon, energy is passed on from one pigment molecule to another pigment
molecule until the energy reaches the reaction center.
• Photosystem II—was discovered later after the discovery of Photosystem I, but functions first in the
light reaction of photosynthesis. The chlorophyll a in the reaction-center of Photosystem II
effectively absorbs light with a wavelength of 680nm and thus called P680.
• Photosystem I—was discovered first. Its reaction-center has a chlorophyll a called P700 because it is
effective in absorbing light with a wavelength of 700nm.
118
EVALUATION (20 MINS)
Give the students a short quiz to assess their understanding of the topics discussed in the lesson.
You may formulate other questions that can gauge their learning.
Materials
• samples and photos of plant products (e.g. fruits and
vegetables)
• materials for the role-playing activity (e.g. tennis balls or
soft balls, lids, and labels)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. pp. 190 – 194. San
Francisco(CA): Pearson Benjamin Cummings.
(2) Starr, C. (2003 ). Biology: Concepts and Applications 5th edition. Pp.98
- 100. Belmont, California: Brooks/Cole-Tomson Learning.
120
INTRODUCTION (20 MINS) Teacher Tip:
1. Communicate the learning competencies and learning outcomes of this lesson to the class. Communicating the learning competencies
and learning outcomes shall give the
2. Give the learners enough time to research on the definition and description of the following
learners an idea on what they can expect to
keywords: learn from the lesson.
• light reactions
• noncyclic electron flow You may also opt to establish prior
understanding of the topic or lesson. You
• cyclic electron flow
can ask the learners to show specific hand
• plastoquinone (Pq) signals depending on how familiar they are
• plastocyanin (Pc) on the topics to be discussed. For example,
• ATP they can do a ‘thumbs up’ to indicate
extensive understanding of the specific
• photophosphorylation
topic, a ‘thumb to the side’ to signify
• ferredoxin enough understanding of the topic, and a
• NADP+ ‘thumbs down’ to show little or no
• NADPH understanding at all.
• chemiosmosis
Ask learners to make conclusions on the role played by plants in converting the sun’s energy to a
form of energy that the human body can use.Using a pencil, draw a base line that is 2cm from the
bottom of the paper strip. Be careful in handling the chromatography paper as oil from the human
skin can alter the results. Lift the paper only by its sides and be careful not to touch its front.
INSTRUCTION/DELIVERY (60 MINS) Teacher Tip:
You may the students to write on the board
the chemical reaction for photosynthesis.
Review the chemical reaction for photosynthesis:
• Light reactions—use sunlight to initiate electron transfer, thereby reducing NADP+ to NADPH and
splitting water to give off oxygen as a by-product.
• form ATP through phosphorylation
• take place in the thylakoids of the chloroplast
• Calvin Cycle—sometimes referred to as ‘dark reactions’ because it does not require light energy for
its processes to take place
• incorporates CO2 into organic molecules through carbon fixation
• uses NADPH and ATP to produce carbohydrate from the fixed carbon
• takes place in the stroma of chloroplast
• returns ADP, inorganic phosphate, and NADP+ to the light reactions
Show an image of the light reactions similar to the one shown in Figure 2 below:
122
Teacher Tip:
While discussing the events in the light
reaction, make sure to engage the learners
and encourage them to participate by
asking questions before proceeding with
the discussion on each step or event.
Teacher Tip:
You may review the concept of redox
reaction in this part.
In an oxidation reaction, a molecule loses
one or more electrons and becomes more
positively charged.
In a reduction reaction, a molecule gains
one or more electrons and becomes more
Figure 2: The Light Reactions negatively charged.
Oxidation and reduction reactions are most
often paired, resulting to a redox reaction.
From the image or diagram of the light reactions, ask the learners to identify the key players involved in As a molecule is oxidized, the molecule that
the process. accepts the electrons is reduced.
Teacher Tip:
Proceed to an in-depth discussion of the steps or events in light reactions. Integrate the First Law of Thermodynamics
which states that energy can be transferred
or transformed from one form into another
but cannot be created nor destroyed. Ask
Light Reactions Events
the students how the First Law of
Thermodynamics is applied in
1. Light energy or photon is absorbed by a pigment molecule of the light-harvesting complex of Photosynthesis. Ask the learners to cite
Photosystem II and is passed on to other pigment molecules nearby until the energy makes it to the specific events in the process that illustrates
the law.
reaction center. In the reaction center, it is absorbed by the P680 pair of chlorophyll a.
2. The electron in this pair of chlorophyll a is raised to an excited state and is transferred to the
primary electron acceptor. P680 loses its electron and becomes positively charged (P680+).
3. The positively charged molecule attracts electrons from a water molecule, resulting to the splitting
up of H20 into two electrons, two hydrogen ions (H+), and an oxygen atom with the provision of
light energy. The oxygen atom immediately combines with another oxygen atom to form an oxygen
molecule (O2) which is then released outside the leaf through the stomata.
4. The excited electrons are then passed on from the primary electron acceptor to the electron carrier
molecules through the electron transport chain until they reach Photosystem I. The electron carrier
molecules involved here are plastoquinone (Pq), a cytochrome complex, and plastocyanin (Pc).
5. At each transfer, the electrons release small amounts of energy. This energy is used to pump
hydrogen ions across the membrane. The splitting up of water molecules results to an uneven
distribution of hydrogen ions in the stroma and the lumen. The H+ ions tries to equalize their
distribution by moving from the lumen to the stroma through the aid of a membrane protein called
ATP synthase. This is referred to as chemiosmosis. The movement of hydrogen ions through the
ATP synthase channel triggers the synthesis of ATP from ADP. The ATP contains high-energy
phosphate bonds.
6. Meanwhile, photon is also absorbed and energy is passed on from one pigment molecule to
another until the energy reaches the reaction center complex of Photosystem I. The energy excites
the electron present in the pair of P700 chlorophyll a located here. The excited electron is then
transferred to a primary electron acceptor, making the P700 positively charged and now seeking
electrons to fill up the missing ones. This is filled up by the electrons from Photosystem II that are
passed on through the electron transport chain.
7. The photo-excited electron from the primary electron acceptor of Photosystem I enters another
electron transfer chain, passing the electron to an iron-containing protein called ferredoxin (Fd).
8. An enzyme, the NADP+ reductase, then transfers the electron to NADP+ and stabilizes it by adding
a proton (H+) to form NADPH. NADPH is then released to the stroma and becomes part of the
Calvin Cycle.
• lids or any material that will serve as light energy or photon Through this activity, you shall have an idea
• labeled cards for the following roles: of how well the learners understood the
topics you discussed. It shall give you the
• sun chance to correct any misunderstandings
• pigment molecules (several learners) and misconceptions they might have
regarding the lesson.
• water molecule (i.e., oxygen atom and hydrogen ions)
• P680
• primary electron acceptors
• electron carriers (i.e., Pq, cytochrome complex, Pc, and Fd)
• ADP
• P700
• NADP+ reductase
• NADP+
5. Ask the class present their simulation of the light reactions.
6. After the presentation, provide feedback, if there is any.
126
ENRICHMENT (60 MINS) Teacher tip
You may also opt to formulate questions to
Think-Pair-Share be answered as a quiz. The quiz may be
1. First, instruct the learners to determine what event/s in the light reactions they consider to be the done individually or in pairs.
most significant to humans.
2. Next, ask the learners to look for a partner and share their response.
3. Then, ask the pairs to share their responses to the whole class. Pair: Look for a partner and discuss
your answers.
Materials
• materials for making three-dimensional models of the
Calvin Cycle (e.g., clay, Styrofoam balls, beads, and art
materials)
Resources
(1) Reece JB, U. L. (2010). Campbell Biology 10th. San Francisco(CA):
Pearson Benjamin Cummings.
(2) Starr, C. (2003). Biology: Concepts and Applications 5th edition.
Belmont, California: Brooks/Cole-Tomson Learning.
128
INTRODUCTION (10 MINS) Teacher tip
1. Present the learning competency and learning outcomes for this lesson. Let the learners provide the overview or
description of the Calvin cycle.
2. Describe the significant events of the Calvin cycle.
You may refer to the equation of
3. Review the basic features of the Calvin cycle. photosynthesis in introducing the topic.
2. Explain to the learners that these terms are the key players in the Calvin cycle that they need to
familiarize themselves with.
3. Instruct the learners to research the meaning and description of the molecules involved in Calvin
cycle.
INSTRUCTION/DELIVERY (60 MINS)
Give a lecture-discussion on Calvin cycle.
Reduction
• A phosphate group (from ATP) is then attached to each 3-phosphoglycerate by an enzyme,
forming 1,3-phosphoglycerate.
• NADPH swoops in and reduces 1,3-biphosphogycerate to G3P.
• For every six G3Ps produced by the Calvin Cycle, five are recycled to regenerate three
molecules of RuBP. Only one G3P leaves the cycle to be packaged for use by the cell.
• It will take two molecules of G3P to make one molecule of glucose.
• The ADP and NADP+ that is formed during the Calvin Cycle will be transported back to the
thylakoid membrane and will enter the light reactions. Here, they will be ‘recharged’ with
energy and become ATP and NADPH.
130
Regeneration of RuBP
• Five molecules of G3P undergo a series of complex enzymatic reactions to form three molecules of RuBP. This costs the cell another
three molecules of AT, but also provides another set of RuBP to continue the cycle.
132
General Biology 1 360 MINS
Resources
• Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA:
McGraw-Hill
• Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
• Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill
• Reece, Jane B. et al., (2011). Campbell Biology 9th Edition. San
Francisco USA: Pearson Education, Inc.
• Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
INTRODUCTION (5 MINS)
As part of learning exploration, let your students define cellular respiration. You may also ask students to describe process happening when
they respire using their respiratory system then connect this process of respiration to what is happening inside the cell (cellular respiration).
Cellular respiration by technical definition includes both aerobic and anaerobic respiration processes. But today cellular respiration is often used
to refer to aerobic processes.
134
Teacher tip
Teacher Tip:
Courtesy: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill
(Retrieved August 13, 2015.)
PROCEDURE
1. To extend and refine your students’ knowledge on cellular respiration, tell them to do the sample
graphic organizer below.
2. Fill-out the table and distinguish how the two types of respiration are alike and different. Then tell
them to write their conclusion based on the similarities and differences they have listed.
3. You may form three groups for this activity. Each group has to present the output(s) to the class
using any kind of visual learning materials.
Comparing Graphic Organizer
How alike?
How different?
136
AEROBIC RESPIRATION ANAEROBIC RESPIRATION
How alike?
Both undergo glycolysis in the cytoplasm of the cell
Both undergo substrate-level phosphorylation and oxidative phosphorylation and chemiosmosis in producing ATP molecules
Both split the 6-carbon glucose into two molecules of pyruvate, the three-carbon molecule
Both involve a series of enzyme-controlled reactions that take place in the cytoplasm
Both use NAD+ (nicotinamide adenine dinucleotide), a redox coenzyme that accepts two electrons plus a hydrogen (H+) that becomes NADH
Both performed by eukaryotic and prokaryotic cells
AEROBIC RESPIRATION ANAEROBIC RESPIRATION
How different?
Maximum yield of 36 to 38 ATP molecules per glucose Maximum yield of 2 ATP molecules per glucose for obligate anaerobes
Complete breakdown of glucose to carbon dioxide and water with the use of Partial degradation of glucose without the use of oxygen (obligate
oxygen anaerobes)
Multiple metabolic pathways Single metabolic pathway (in fermentation)
Pyruvate proceeds to acetyl formation in the mitochondrion Pyruvate is broken down to ethanol and carbon dioxide or lactate (in
fermentation)
The presence of enough oxygen in the cell makes the cell perform its job Cause burning sensation in the muscle during strenuous exercise
smoothly without burning sensation (in fermentation)
More efficient in harvesting energy from glucose with estimated 39% energy Less efficient in harvesting energy from glucose with 2% energy efficiency
efficiency (36-38 ATP) in eukaryotic organisms but much higher ATP (for obligate anaerobes)
production (38 to 40 ATP) in prokaryotic organisms
Outputs are carbon dioxide, water and ATP Outputs are lactate, alcohol and carbon dioxide (in fermentation); but
reduced inorganic compound in anaerobic respiration
Products produce are for biochemical cycling and for the cellular processes Produce numerous products with economic and industrial importance
that require energy through fermentation
Slow glucose breakdown Rapid breakdown of glucose
Electrons in NADH are transferred to electron transport chain Electrons in NADH are transferred to electron transport chain; but in
fermentation electrons in NADH are transferred to organic molecule
Mechanism of ATP synthesis is by substrate-level and oxidative Mechanism of ATP synthesis is by substrate-level and oxidative
phosphorylation/chemiosmosis phosphorylation/chemiosmosis; but in fermentation substrate-level
phosphorylation only during glycolysis
O2 is the final electron acceptor of the electron transport system In anaerobic respiration, inorganic substances like NO3- or SO42- are
the final acceptor of the electron transport system; but in
fermentation, there is no electron acceptor because it has no
electron transport system.
Brain cells in the human body can only live aerobically. They die if Some organisms like yeasts (eukaryotic), many bacteria (prokaryotic)
molecular oxygen is absent. and the human muscle cells (eukaryotic) can make enough ATP to
survive in facultative anaerobes (can live in the absence or presence
of oxygen). But under anaerobic conditions lactic acid fermentation
occurs. A facultative anaerobe needs to consume the nutrient at a
much faster rate when doing the fermentation or anaerobic process.
Summary and/or Conclusion
Aerobic respiration requires molecular oxygen to happen in the cells of most eukaryotes and prokaryotes. Here, nutrients are split into a series
of enzyme-controlled reactions producing an estimated 36 to 38 ATP per glucose complete breakdown. Molecular oxygen is the final
acceptor of the low-energy level electron at the end of the electron transport system that results in the production of water. In anaerobic
respiration on the other hand does not require oxygen in splitting nutrients. Some prokaryotes that live in oxygen-free environments such as
water logged soil, in ponds where water does not flow, and in the intestines of animals transfer glucose to NADH and then pass the electrons
down the electron transport chain that is joined to ATP synthesis by chemiosmosis. Nitrate and sulfate are the final acceptors of electrons. The
end products are carbon dioxide, reduced inorganic substances and ATP. In fermentation (as type of anaerobic respiration) there is no
electron acceptor because it has no electron transport chain. Its products are either alcohol (and carbon dioxide) or lactate.
Note: Clarify how many minutes should be allotted for this activity
ETC: A Metaphor
PROCEDURE
1. To describe how the electron transport system performs its function along the cristae (folds) of the mitochondrion, the students will prepare
the following materials: coloring materials, Manila paper(s), color papers, markers, pencil, and ruler.
2. The learners will make an analogy or a metaphor on how the electrons are being passed on to electron transport chain that result in the
release of water.
3. In their drawing, they have to illustrate the participation of NADH, FADH2, hydrogen proton ion, electrons and oxygen along the electron
transport system. Review your students that the simultaneous cooperation of these carrier molecules and hydrogen atoms are being used to
run ATP production by chemiosmosis. They have to show that ATP and water are two of the products of ETC.
138
4. To facilitate their understanding, you can give them metaphoric examples such as bucket relay for ETC and a stair. A sample illustration is
given below for your reference.
5. Form four groups for this activity. You may form rubric for this part focusing on appropriateness of illustration with all key ideas and elements
are put together correctly.
Stair image courtesy of: Mader, Sylvia S. (2013). Biology 10th Edition. USA: McGraw-Hill (Retrieved August 15, 2015.)
Directions: The pictures below describe the pathways of electron in the absence of oxygen. Analyze it by arranging the seven metabolic
pathways from numbers 1 to 7 provided for you in the opposite table. The same procedure is followed in another table for fermentation with
numbers 1 to 6.
Images courtesy of: Mader, Sylvia S. (2013). Biology 11th Edition. USA: McGraw-Hill (Retrieved August 17, 2015.)
140
Metabolic Pathways Outside the Mitochondria: Glycolysis Metabolic Pathways Outside the Mitochondria: Glycolysis
(Note: This is not sequenced.) (Note: Arrange the pathways in order from 1 to 7.)
Metabolic Pathways Outside the mitochondria: Metabolic Pathways Outside the Mitochondria:
Fermentation (Note: This is not sequenced.) Fermentation (Note: Arrange the pathways in order from
1 to 6.)
G3P is oxidized as NAD+ receives high energy-electrons
coming from the hydrogen atoms of C6H12O6.
NAD+ is “freed” to return to the glycolytic pathway to
pick up more electrons.
Two ATP molecules are used to start glycolysis.
Suggested Answers:
1. NAD+ accepts electrons and delivers them to the ETS. Pyruvate is the product of glycolysis. It is converted to acetyl-CoA and transferred to
the Krebs cycle. Oxygen is the final electron acceptor of the ETS and combines with hydrogen to form water. ATP is used in glycolysis to get
the process going but ultimately it is the most valuable molecule produced by aerobic respiration. All parts of aerobic respiration result in a
net yield of ATP.
2. Oxygen molecule is the final acceptor of electrons from ETC. It receives the low energy electron from the last of the carriers (that is,
cytochrome oxidase). After receiving electrons, the oxygen molecule combines with hydrogen ions, and water is formed.
3. The members of the chain in sequence are the following: NADH-Q reductase, coenzyme Q, cytochrome reductase, cytochrome c,
cytochrome oxidase. These are the members of the chain which accept high-energy level electrons which they pass from one molecule to
another.
4. The cristae contain the chain members (carrier molecules and protein complexes, ATP synthase complex and ATP channel protein (bulk of
ATP is produced by chemiosmosis).
5. The complexes of the ETC use the released energy to pump these hydrogen ions from the matrix into the intermembrane space of
mitochondria.
6. If you want to earn, you really need to invest, and therefore you need a capital of some amount. During the energy-investment step, 2 ATPs
are used to split glucose into 2 pyruvate molecules. The split of glucose produces a gross of 4 ATPs and 2 NADH. 4 ATP- 2 ATP = 2 ATP net
in the glycolysis.
7. Prokaryotic organisms do not have mitochondria. These organisms use a slightly different way to perform the Krebs cycle and ETC that
results in slightly more ATP than is produced by eukaryotic organisms.
142
8. The electron transport chain consists of a series of molecules which accept electrons and transfer them from one molecule to another. As
electron is passed on along the series, energy is released to run ATP production. As this happens, protons are pumped from one location to
another in the mitochondrion. Protons begin to build up in their new location. This creates a chemical gradient producing a bulk of ATP by
chemiosmosis. These ATP molecules can be used by the cell to do work.
9. Glucose G3P BPG 3PG PEP pyruvate
10. ATP can still be produced without oxygen. This can be done through anaerobic fermentation. A net of 2 ATP molecules are produced
during glycolysis. Glucose proceeds through the glycolysis pathway, producing pyruvate. This process “frees” NAD+ and it returns to the
glycolytic pathway to up more electrons to become NADH again.
Main function
Site of Reaction
Production of ATP
Sustainability
Production of lactic acid
Oxygen requirement
Recycling of NADH
Participating cells
Suggested Answers:
Main function Production of ATP from food such as Production of ATP without the use of oxygen
carbohydrate, lipid and protein
Site of Reaction Cytoplasm and mitochondrion Cytoplasm
Production of ATP 36 to 38 ATP per glucose molecule 2 ATP per glucose molecule
Sustainability Long-term Short-term
Production of lactic acid Does not produce Produces
Oxygen requirement Yes No
Recycling of NADH Through the electron transport system In lactic acid fermentation (i.e., muscle cells;
in alcohol fermentation (pyruvate is
converted to carbon dioxide and ethanol)
Participating cells Most cells Yeast, other fungi, prokaryotes, muscle cells
144
Directions: Compare aerobic and anaerobic respiration by accomplishing the Venn diagram below.
Diagram courtesy of: Enger, Eldon D. et. al., (2012). Concepts in Biology 14th Edition. USA: McGraw-Hill (Retrieved August 13, 2015)
1. What are the three kinds of enzyme-controlled reactions so that the chemical-bond energy from a certain nutrient is released to the cell in
the form of ATP?
2. What are the hydrogen electron acceptors for aerobic and anaerobic respiration as well as in fermentation?
3. These are the by-products of aerobic respiration that are considered low-energy molecules.
4. What are the outputs produced by anaerobic respiration? What about in fermentation?
5. What are two general metabolic mechanisms by which certain cells can oxidize organic fuel and generate ATP without the use of oxygen?
146
Suggested Answers:
1. Aerobic respiration, anaerobic respiration, and fermentation
2. aerobic respiration — molecular oxygen, anaerobic respiration — nitrate or sulfate, fermentation – pyruvate
3. Water and carbon dioxide
4. Anaerobic respiration—ATP, water reduced acceptor (nitrate or sulfate), fermentation, ATP, carbon dioxide, alcohol or lactate
5. Anaerobic respiration and fermentation
Directions: This is a multiple-choice task. Encircle the letter of the correct answer.
3. The positively charged hydrogen ions that are released from the glucose during cellular respiration eventually
combine with _________ ion to form ______
a. another hydrogen, a gas
b. a carbon, carbon dioxide
c. an oxygen, water
d. a pyruvic acid, lactic acid
4. The Krebs cycle (also known as citric acid cycle or tricarboxylic acid) and ETC are biochemical pathways
performed in which eukaryotic organelle?
a. nucleus
b. ribosome
c. chloroplast
d. mitochondrion
5. Anaerobic pathways that oxidize glucose to generate ATP energy by using an organic molecule as the ultimate
hydrogen acceptor are called
a. fermentation.
b. reduction.
c. Krebs cycle.
d. Electron pumps
6. When skeletal muscle cells function anaerobically, they accumulate the compound________, which causes
muscle soreness.
a. pyruvic acid
b. malic acid
c. carbon dioxide
d. lactic acid
7. Each molecule of fat can release ______ of ATP, compared with a molecule of glucose.
a. smaller amounts
b. the same amount
c. larger amount
d. only twice the amount.
148
8. In complete accounting of all ATPs produced in aerobic respiration, there a total of ________ATPs: ______
from the ETC, _____ from glycolysis, and _______ from the Krebs cycle.
a. 36, 32, 2, 2
b. 38, 34, 2, 2
c. 36, 30, 2, 4
d. 38, 30, 4, 4
9. The chemical activities that remove electrons from glucose result in the glucose being
a. reduced.
b. oxidized.
c. phosphorylated.
d. hydrolyzed.
10. Which of the following is NOT true of the citric acid cycle? The citric acid cycle
a. includes the preparatory reaction
b. produces ATP by substrate-level ATP synthesis
c. occurs in the mitochondria
d. is a metabolic pathway, as is glycolysis
Suggested Answers:
of 3) Motivation
products of cellular respiration
http://highered.mheducation.com/sites/0073403466/student_view0/
chapter7/image_powerpoint.html
http://highered.mheducation.com/sites/0073525502/student_view0/
chapter7/index.html
150
INTRODUCTION (5 MINS) Teacher tip
Communicate to the class the learning competencies. Then go over the reactants and products of Emphasize that both prokaryotic and
cellular respiration. eukaryotic organisms need food in order to
get the energy needed to adapt to many
things in the environment and to perform
bodily processes such as growth, repair,
reproduction, maintenance of homeostasis,
You may ask them the following questions: etc.
1. How many molecules of ADP as reactant are needed to produce about 38 molecules of ATP for
eukaryotic organisms?
2. Which groups in the cellular respiration equation go in?
3. Which groups are released?
Suggested Answers:
1. About 36 to 38 ADP molecules (NOTE: This number is just a ratio. Some biology authors say there
are 30, 32 or 34 ADP (or ATP) molecules depending on the shuttle used to transport the electrons
and on the kind of species.)
2. Groups that go in: carbohydrate and molecular oxygen
3. Groups that are released: carbon dioxide, water and energy (ATP)
NOTE: Cellular respiration is one of the more difficult topics in biology. To capture the general picture
of the topic, students have to be encouraged to read and re-read the key concept, write and re-write,
outline and re-outline, draw and re-draw, and to recite orally if they want the ideas to sink in their
system. Patience and steadfastness are important virtues that should be included as you study this
concept.
152
Activity 2: Drawing, Coloring and Labeling
Teacher tip
1. Inform your students to bring the following materials: Oslo paper (or long bond paper), coloring
̌For the drawing, coloring and labeling of
materials, pencil and a ballpen. the parts of a mitochondrion, you may print
2. Let them draw and color, and label the model picture of a mitochondrion below. the picture in color and post it on the board
3. The rubric for the drawing and coloring is given to help in the objective scoring of the output for everyone to see.
Contrast and intensity Shows exceptional artistic Shows generally acceptable Shows generally vague
of drawing and skillful color contrast; artistic and skillful color color contrasts; and
and meaningful color contrasts; and meaningful indiscernible sense of
concentration color concentration color concentration
Blending of colors Color mix is exceptionally Color mix is generally Color mix needs
creative, appropriate and creative, appropriate and improvement
meaningful meaningful
Neatness Completely free from Almost free from mess Too messy
mess
Model Picture of a Mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole
(Retrieved July 20, 2015)
Procedure: Insight:
1. Group the class into three. Fill-in the missing information to make the graphic organizer complete.
The reason why we humans breathe is to
Few examples are given. get the oxygen into our cells. Recall that at
2. Report the output to the class. You will be graded according to the following rubric. the end of the electron transport chain,
hydrogen ions are being welcomed by the
NOTE: Students might find this difficult to accomplish. To facilitate better understanding for this
oxygen molecules to produce a by-product
called water.
154
activity, tell them to research on the major events of cellular respiration (e.g. how glucose gets into the cell and how it becomes converted into
ATP). Your students should be able to see the major events (though the events are happening simultaneously). You may also prepare a set of
reading materials (including diagrams and/or pictures) given to each group and let every member of the group analyze the text and be able to
sequence and narrate the major events of cellular respiration.
Suggested Rubrics
During this stage, glucose (the six-carbon molecule) is split into two
molecules of pyruvate (which contains three carbons). A net of two ATP
molecules is produced by substrate-level phosphorylation during glycolysis.
In addition, there are four hydrogen atoms are removed and are used to
produce two NADH (an electron-carrier molecule that enters mitochondrion
Courtesy: Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson Brooks/Cole (Retrieved August 2, 2015)
STAGE 2: ____________________
STAGE 3: ____________________
This is what happens:
156
STAGE 4: ______________________
Activity 4: Watch Summary Video for Aerobic Respiration (If materials are available)
Directions: With the help of your instructional materials (e.g. in tarpaulin form, PowerPoint Presentation or even simple pictures that are visually
attractive and accurate) ask the following processing questions. Allow the pictures and the boardwalk to speak to your students.
Processing Questions:
1. How many metabolic pathways are present in aerobic respiration?
2. Where in the cell part does glycolysis take place? What about the formation of Acetyl CoA, Krebs cycle and the electron transport chain and
chemiosmosis?
3. How many reduced NADH molecules are produced after the glucose has been completely broken down to ATP? And what stage of the
aerobic respiration is glucose completely broken down to carbon dioxide?
4. As glucose is split in the cytosol of the cell, is there a release of carbon dioxide as by-product of the reaction?
5. What molecule accepts the hydrogen atoms at the end of electron transport chain?
6. What is the major goal of NADH and FADH2 in aerobic respiration?
7. Why do you think the cell needs to digest glucose or any other nutrients such as protein and fats?
8. Among the metabolic pathways of cellular respiration, which phase is the major contributor of ATP?
9. What happens to pyruvate if oxygen is not available in the cell?
10. How many acetyl-CoAs are produced from each glucose molecule?
Suggested Answers:
1. Three metabolic pathways
2. Glycolysis takes place in the cytoplasm or cytosol; formation of acetyl CoA, Krebs cycle, ETC and chemiosmosis all take place in the
mitochondrion
3. 10 NADH molecules; glucose is completely broken down carbon dioxide at the Krebs cycle
4. No
5. Oxygen molecule
6. The goal of NADH and FADH2 is to transport the electrons coming from the hydrogen atoms (in glucose) to the electron transport chain
7. The cell has to digest glucose, fat, and protein in order to convert them into usable form of energy molecule called adenosine triphosphate.
This ATP is the only molecule that is recognized by the cell for all of its cellular activities.
8. Among the metabolic pathways in aerobic respiration, the electron transport chain (or oxidative phosphorylation) makes about 90 per cent
of ATP per glucose molecule.
9. The pyruvate will not proceed to the formation of acetyl CoA. The pyruvate will become lactic acid in animal and alcohol in plant.
10. Two
158
ENRICHMENT (90 MINS) Teacher tip
Directions: Read the procedures below on how the jigsaw and expert groups are formed. • Encourage each member to ask
PART I: Jigsaw Activity question(s) for clarifications.
• Provide cellular respiration handouts/
Procedure: diagrams for each group to discuss.
• For this part, provide a rubric for the
1. Form a group having four members. Each student-member in the group will be assigned to a
presentation that each group has to
certain phase of cellular respiration (1. glycolysis, 2. preparatory reaction, 3. citric acid cycle, make.
4.electron transport chain). Each group will be called “jigsaw group”. • Writing the definitions of the terms can
2. Each group will be given handouts (with texts and pictures/diagrams—samples of these pictures are help your students better understand
the concept.
shown below) with the help of its leader and distribute them to his/her group mates. The handouts • Glycolysis – means “sugar-
contain information about cellular respiration. Other helpful tools such as biology textbook, Internet splitting” that occurs in the
can be used to facilitate their learning of the topic. cytosol of the cell. It does not
require oxygen to breakdown
3. All the members in each group will be given enough time to read over their assigned topic for them glucose into pyruvate.
to become familiar with it. • Krebs cycle – completes the
4. From the “jigsaw group” previously formed, the so-called “expert group” will then be formed. metabolic breakdown of glucose
to carbon dioxide and produces
Those assigned in glycolysis from each group will be grouped as “expert group” in glycolysis. The 2 ATP.
same procedure will be done to preparatory reaction, citric acid cycle and electron transport chain • Oxidative phosphorylation – a
— “expert groups” will be formed from these remaining topics. process occurring in
mitochondria and accounts for
5. These “expert groups” will be given enough time to discuss the main points of their assigned topic majority of the ATP production.
and to rehearse for the presentation. • Electron Transport Chain –
6. After a certain amount of time, each student from the “expert group” will go back to his/her contains the chain members
(carrier and protein complexes,
“jigsaw group”. ATP synthase complex and ATP
7. Each member from the “jigsaw group” will this time begin to present his/her topic to the whole channel protein. These
class. membrane proteins shuttle
electrons during the redox
reactions. The electrons will be
used to produce ATP by
chemiosmosis.
• NADH and FADH2 – these are
electron acceptor molecules
that contain high-energy
electrons. They transport the
electrons to ETC to produce
many more ATPs by oxidative
phosphorylations.
• ATP synthase – is an enzyme
that is responsible for the great
production of ATPs. This
happens when it uses the
energy coming from H+ ions to
bind ADP and phosphate group
together to produce ATP.
Teacher Tip
The diagram on the left shows the total
energy produced from the complete
breakdown of glucose by aerobic
respiration.
160
PART II
People Hunt
1. Prepare four sets of paper strips. Set A contains the four stages of cellular respiration. Set B contains the summary for each stage. Set C
contains starting materials for each stage. Set D contains end products for each stage.
2. Twelve students will be asked to volunteer. Randomly, each of these volunteers will be given strips of paper
(NOTE: tell them not to read yet the information written on the strip of paper).
3.Student-volunteers will be asked to scatter around the room. After this, instruct them that there are four stages of cellular respiration (please
refer back to the procedure number 1). The student-volunteers will be given time to find their group mates correctly for each specific stage
based on the paper strip(s) they are holding.
4. Tell each group for each stage to line up at the four corners of the room (north, south, east, west side of the room) and check if each
member has found their group mates correctly.
1. Glycolysis (in cytosol) Series of reactions in which glucose is degraded to pyruvate; net Glucose, ATP, NAD+, Pi Pyruvate, ATP, NADH
profit of 2 ATPs; hydrogen atoms are transferred to carriers; can
proceed anaerobically
2. Formation of acetyl CoA Pyruvate is degraded and combined with coenzyme A to form Pyruvate, coenzyme A, Acetyl CoA, CO2,
(in mitochondria) acetyl CoA; hydrogen atoms are transferred to carriers; CO2 is NAD+ NADH
released
3. Citric acid cycle (in Series of reactions in which the acetyl portion of acetyl CoA is Acetyl CoA, H2O, NAD+, CO2, NADH, FADH2,
mitochondria) degraded to CO2; hydrogen atoms are transferred to carriers; ATP FAD, ADP, Pi ATP
is synthesized
4. Electron transport and Chain of several electron transport molecules; electrons are passed NADH, FADH2, O2, ADP, Pi ATP, H2O, NAD+, FAD
chemiosmosis (in along chain; released energy is used to form a proton gradient; ATP
mitochondria) is synthesized as protons diffuse down the gradient; oxygen is final
electron acceptor
Applying Knowledge of Biochemical Pathways
As scientists have developed a better understanding of the processes of aerobic cellular respiration and anaerobic cellular respiration, several
practical applications of this knowledge have developed:
• Although for centuries people have fermented beverages such as beer and wine, they have often plagued by sour products that were
undrinkable. Once people understood that there were yeasts that produce alcohol under anaerobic conditions and bacteria that converted
alcohol to acetic acid under aerobic conditions, it was a simple task to prevent acetic acid production by preventing oxygen from getting to
the fermenting mixture.
• When it was discovered that the bacterium that causes gas gangrene uses anaerobic respiration and is, in fact, poisoned by the presence of
oxygen, various oxygen therapies were developed to help cure patients with gangrene. Some persons with gangrene are placed in
hyperbaric chambers, with high oxygen levels under high pressure. In other patients, only the affected part of the body is enclosed. Under
such conditions, the gangrene-causing bacteria die or are inhibited.
• Spoilage, or putrefaction, is the anaerobic respiration of proteins with the release of nitrogen and sulfur-containing organic compounds as
products. Protein fermentation by the bacterium Clostridium produces foul-smelling chemicals such as putrescine, cadavarine, hydrogen
sulfide, and methyl mercaptan. Clostridium perfringens and C. sporogenes are the two anaerobic bacteria associated with the disease gas
gangrene. A gangrenous wound is a foul-smelling infection resulting from the fermentation activities of those two bacteria.
• Because many disease-causing organisms are prokaryotic and have somewhat different pathways and enzymes than do eukaryotic
organisms, it is possible to develop molecules, antibiotics that selectively interfere with the enzymes of prokaryotes without affecting
eukaryotes, such as us humans.
• When physicians recognized that the breakdown of fats releases ketone bodies, they were able to diagnose diseases such as diabetes and
anorexia more easily, because people with these illnesses have bad breath.
• In starvation and severe diabetes mellitus, the body does not metabolize sugars properly, and it shifts to using fats as its main source of
energy. When this occurs, the Krebs cycle is unable to perform as efficiently and the acetyl CoA does not move into the mitochondria. It
accumulates in the blood. To handle this problem, the liver converts acetyl CoA to ketone bodies (e.g., acetoacetic acid). As ketone bodies
accumulate in the blood, the pH decreases and the person experiences ketosis, or ketoacidosis, with symptoms such as an increased
breathing rate; in untreated cases, it can lead to depression of the central nervous system, coma, and death.
Adapted from: Enger, Eldon D. et al., Concepts in Biology 14th edition. USA: McGraw-Hill
162
EVALUATION (60 MINS) Teacher tip
Table 1 Suggested Answers:
Directions: Complete the tables below by filling-in the necessary information for aerobic respiration.
Glycolysis outputs:
• 2 pyruvate
Table 1: Inputs and Outputs of Glycosis • 2 NADH
• 2 ADP
• 4 ATP total
Glycosis • 2 ATP net gain
164
General Biology 1 240 MINS
Cellular Respiration (Part 3 Introduction Discuss the nature of science with regard
to cellular respiration. Raise several
15
of 3) Motivation
questions for the students to think about
Show a diagram of metabolic pool 5
Content Standard concept and ask few questions
The learners demonstrate an understanding of cellular respiration.
Instruction/ Let the students do activities on 15
Performance Standard Delivery advantages and disadvantages of
The leaners prepare simple fermentation setups using common fruits to aerobic and anaerobic respiration and
produce wine or vinegar via microorganisms fermentation together with their
Learning Competency similarities and differences; prepare
The learners: homemade virgin coconut oil and
fermentation
• 1. Explain the advantages and disadvantages of fermentation and aerobic
respiration (STEM_Bio11/12-IIa-j-12) Practice Answer the guide questions 160
Enrichment Prepare materials for vinegar making 5
Specific Learning Outcomes
Evaluation Compare and explain aerobic 40
At the end of this lesson, the students must be able to:
respiration, anaerobic respiration and
1. Tabulate and explain the advantages and disadvantages of fermentation, fermentation, their advantage and
anaerobic respiration and aerobic respiration; disadvantage
2. Show the similarities and differences of fermentation, anaerobic respiration
and aerobic respiration; Resources
• Alumaga, Maria Jessica B. et al., (2014). Science and Technology 9.
3. Compare the pathways of carbohydrate, fat, and protein catabolism.
Quezon City: Vibal Publishing House
• Bawalan, Divina D. and Chapman, Keith R. (2006). Virgin Coconut Oil:
Production Manual for Micro- and Village-scale Processing. Thailand:
FAO Regional Office for Asia and the Pacific
• Mader, Sylvia S. (2010). Biology 10th Edition. USA: McGraw-Hill
• Rabago, Lilia M. et al., (2014). Science and Technology Laboratory
Manual and Workbook for Grade 9 Quezon City: Vibal Group, Inc.
• Solomon, Eldra P. et al., (2008). Biology 8th Edition. China: Thomson
Brooks/Cole
INTRODUCTION (15 MINS)
Communicate the learning competencies for this topic. You can enumerate some products (or show
pictures) of fermentation. You may opt to insert and discuss the nature of science with regard to cellular
respiration. For instance, athletes and trainers today are constantly finding ways to improve their
performance in a particular event such as in triathlon by boosting cellular respiration. Why is meant by
carbo-loading?
Or as you go to the supermarket, you will see several kinds of energy drinks, are they safe to drink?
What are the health implications if a person drinks them excessively? What about energy-boosting
vitamins, are they really beneficial for the body? Or is it safe to drink an energy-boosting fluid rich in
vitamin B-complex and other related substances when your stomach is empty? If you want to jump-start
your mitochondria, would you rely on alternative medicine? These are interesting issues to discuss and
bring to the whole class to think about.
MOTIVATION (5 MINS)
Show a metabolic pool concept to the class and ask the following questions:
1. What are the three kinds of food that provide the building blocks for the cells, and that all can
provide energy?
2. What are the basic metabolic pathways organisms use to extract energy from carbohydrates in
aerobic respiration? What about for proteins and fats? Are the pathways the same or not?
3. To which pathway do glycerol and fatty acids of fat enter?
Suggested Answers:
1. Carbohydrates, proteins, and fats.
2. Glycolysis, Krebs cycle, electron transport chain—for carbohydrates, proteins and fats. The
metabolic pathways for these three kinds of food are the same except that for proteins and fats,
there are additional steps to get fats and proteins ready to enter the specific pathway as shown in
the diagram.
3. Glycerol enters glycolysis; fatty acids enter preparatory reaction.
166
INSTRUCTION/DELIVERY (15 MINS)
Directions: Tabulate and explain the advantages and disadvantages of fermentation, anaerobic respiration and aerobic respiration. Show their
similarities and differences.
Procedure:
1. Form five groups. Each group has an assigned topic to work on. The following groups are as follows:
• GROUP 1: To work on the differences among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 2: To work on the similarities among aerobic, anaerobic and fermenting organisms. List all the possible answers as they can
as long as the description written fits for the particular organism.
• GROUP 3: To work on and explain the advantages and disadvantages of aerobic respiration.
• GROUP 4: To work on and explain the advantages and disadvantages of anaerobic respiration.
• GROUP 5: To work on and explain the advantages and disadvantages of fermentation.
2. Show to the class a sample table on how you want them to display, outline and report the information to the whole class.
3. Tell them to prepare Manila papers, marker, or any visual materials.
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Differences Similarity
Suggested Answers:
Table 1: Activity: Differences and Similarities of Aerobic, Anaerobic and Fermenting Organisms
Table 2: Activity: Advantages and Disadvantages of Aerobic Respiration, Anaerobic Respiration and Fermentation
Differences Similarity
Directions: Compare aerobic respiration, anaerobic respiration and fermentation in terms of the following factors
listed in the first column.
170
Suggested Answers:
cheese cloth. Set aside the milk obtained using your clean fermentation container(s). Prepare the
Also the ‘virgin’ in the virgin coconut oil
coconut residue (sapal) for the second round of milk extraction. implies that there is no substance added to
4. Second milk extraction — the ratio of mixing is 2 cups of milk residue (sapal) is to 1 cup of water make the oil.
coming from the first milk extraction.
5. Mixing of first and second milk extracts — mix well the first and second coconut milk extracts for 10
minutes.
6. Preparing for the fermentation containers — place the coconut milk extract in clean fermentation
container(s). Cover the container(s) loosely as shown below. Place the container(s) in a place where
temperature is 35 to 40oC. Allow the coconut milk mixture to settle for 16 to 24 hours for natural
fermentation of the coconut milk extract to occur.
7. Separating the oil and fermented curd layers — separate the oil from the fermented curd by using
ladle to scoop the oil off the top. Note: dispose of the water phase and gummy portion by diluting
with water before draining into a grease trap. The fermented curd can be heated to remove the
residual class B oil that can be used for making skin care and herbal soap products. The toasted
curd can also be mixed with other compost material and use as organic fertilizer.
8. Filtering the oil — filter the VCO to remove adhering particles of fermented curd.
9. Packaging and storage — the recommended packaging material for VCO is glass. PET bottles can
be used in cases where the VCO is immediately consumed. Note: Class A VCO is always water-
clear. Class B VCO is yellow. The latter happens when the process of coconut milk extraction is
invaded by unwanted microorganisms or sanitary protocols are not followed strictly such as washing
the hands with antibacterial soap or washing the materials with antibacterial detergent soap.
10. Tell them to report their output to the class.
172
Modified Natural Fermentation Method
ENRICHMENT (5 MINS)
Teacher Tip:
Activity Title: Vinegar Making This can be done at home as group
assignment. Just give your students
precautionary measures. Instructions can be
Materials needed: given for five minutes. Tell them to
document their output and submit it via
YouTube or Facebook.
9 cups of coconut water, 2 cups of brown sugar, ½ teaspoon yeast, 2 clean cheesecloth, transparent
Vinegar is a sour-tasting condiment and
bottles for transferring the mixture, gas stove, rubber bands, cooking pan, funnel, 2 cups of mother preservative. It can be prepared by two
vinegar, jar(s) spoon for mixing successive microbial processes. The first
phase is done through alcoholic
fermentation by a eukaryotic organism
Procedure: called yeast. The second phase is by
oxidation of alcohol by a prokaryotic
organism called Acetobacter aceti. This
SET A: Preparation and alcoholic fermentation bacterium is responsible for converting the
1. Using cheesecloth, filter the coconut water and place it a clean cooking pan. Then add 2 cups of alcohol in wine to acetic acid or vinegar.
Since coconut is abundant in our country,
brown sugar. Mix thoroughly using a spoon until the sugar crystals are dissolved completely. use this example to show the principle of
2. Heat the mixture at low fire for 20 minutes. As you do this, do not cover the cooking pan and do fermentation process involving
not boil the mixture. After 20 minutes, let the mixture cool for 30 minutes to 1 hour. microorganisms and the series of reactions
that take place as coconut water is
3. Add ½ teaspoon of yeast. Mix very well. Afterwards, transfer the mixture to clean transparent
converted into vinegar.
174
4. bottle(s). Cover the bottle(s) with cheesecloth. The small pores in the cheesecloth will allow the gas from inside the bottle to exit.
5. Place the mixture in a safe place to allow the process of fermentation.
Note: From the day you added yeasts to the mixture you will observe alcoholic fermentation that is characterized by the release of bubbles.
The bubbles indicate the presence of carbon dioxide. When bubbles no longer appear in the mixture, then alcoholic fermentation has ceased
already. The formation of bubbles will be observed for approximately one week. To ferment means to break the sugar in the absence of oxygen.
After one week, transfer the mixture to a jar. Then add 2 cups of mother vinegar to a jar. Cover the jar with cheesecloth to allow oxygen to enter
into the jar. Place the jar in a safe place. Wait for one month to allow acetous fermentation.
Directions: Compare and explain aerobic respiration, anaerobic respiration and fermentation in terms of the following:
1. Immediate fate of electron transfer
2. Terminal electron acceptor of electron transport chain
3. Reduced product(s) formed
4. Mechanism of ATP synthesis
Tabulate your answers. Then give at least three advantages and at one disadvantage for aerobic respiration, anaerobic respiration and
fermentation.
General Biology 1 120 MINS
Resources
Specific Learning Outcome Shown/presented on the different parts of the Teaching
At the end of the lesson, the learners shall be able to compute the number of Guide
ATPs needed or gained in photosynthesis and respiration
176
INTRODUCTION (30 MINS)
Clearly communicate learning competencies and objectives. At the end of the session, the learners shall be able to compute the number of
ATPs needed or gained in photosynthesis and respiration. Also, allow the readers to connect and/or review prerequisite knowledge. Review
structure of ATP (Adenosine Triphosphate) and how it is used as the energy currency of the cell.
During PHOTOSYNTHESIS:
• Energy from sunlight is harvested and used to drive the synthesis of glucose from CO2 and H2O. By converting the energy of sunlight to a
usable form of potential chemical energy, photosynthesis is the ultimate source of metabolic energy for all biological systems.
• Photosynthesis takes place in two distinct stages.
(A) In the light reactions, energy from sunlight drives the synthesis of ATP and NADPH, coupled to the formation of O2 from H2O.
(B) In the dark reactions (named because they do not require sunlight), the ATP and NADPH produced by the light reactions drive
glucose synthesis.
• In eukaryotic cells, both the light and dark reactions of photosynthesis occur within chloroplasts—the light reactions in the thylakoid
membrane and the dark reactions within the stroma.
Reactants C6H12O6 and 6O2 6O2 and 12H2O and light energy
Requirement of sunlight Sunlight not required; cellular respiration occurs at Can occur only in presence of sunlight
all times.
Chemical Equation (formula) 6O2 + C6H12O6 --> 6CO2 +6H2O + ATP (energy) 6CO2 + 12H2O + light --> C6H12O6 + 6O2 + 6H20
Process Production of ATP via oxidation of organic sugar The production of organic carbon (glucose and
compounds. [1] glycolosis: breaking down of starch) from inorganic carbon (carbon dioxide) with
sugars; occurs in cytoplasm [2] Krebs Cycle: occurs the use of ATP and NADPH produced in the light
in mitochondria; requires energy [3] Electron dependent reaction
Transport Chain-- in mitochondria; converts O2 to
water.
Fate of oxygen and carbon dioxide Oxygen is absorbed and carbon dioxide is Carbon dioxide is absorbed and oxygen is
released. released.
Energy required or released? Releases energy in a step wise manner as ATP Requires energy
molecules
Main function Breakdown of food. Energy release. Production of food. Energy Capture.
Chemical reaction Glucose is broken down into water and carbon Carbon dioxide and water combine in presence of
dioxide (and energy). sunlight to produce glucose and oxygen.
Stages 4 stages: Glycolysis, Linking Reaction (pyruvate 2 stages: The light dependent reaction, light
oxidation), Krebs cycle, Electron Transport Chain independent reaction. (AKA light cycle & calvin
(oxidative phosphorylation). cycle)
What powers ATP synthase H+ proton gradient across the inner mitochondria H+ gradient across thylakoid membrane into
membrane into matrix. High H+ concentration in stroma. High H+ concentration in the thylakoid
the intermembrane space. lumen
Products 6CO2 and 6H20 and energy(ATP) C6H12O6 (or G3P) and 6O2 and 6H2O
Cellular Respiration Photosynthesis
What pumps protons across the membrane Electron transport chain. Electrochemical gradient Electron transport chain
creates energy that the protons use to flow
passively synthesizing ATP.
Occurs in which organisms? Occurs in all living organisms (plants and animals). Occurs in plants, protista (algae), and some
bacteria.
Catalyst - A substance that increases the rate of No catalyst is required for respiration reaction. Reaction takes places in presence of chlorophyll.
a chemical reaction
High electron potential energy From breaking bonds From light photons.
MOTIVATION (5 MINS)
Teacher asks students “Why study photosynthesis and cellular respiration?”
Photosynthesis - Lead discussion into the importance of
1. Photosynthesis in selection of plants/trees for reforestation, agriculture and biodiversity conservation. (http://bioenergy.asu.edu/photosyn/
study.html)
2. Cellular Respiration in food production (pretzels, beer, soy sauce, pickles, vinegar, yeast-risen bread, or any other product that requires
fermentation or microbial breakdown of compounds in food), athletics (sports nutrition and event-specific training) and others.
INSTRUCTION/DELIVERY/PRACTICE (60 MINS)
Lecture on Photosynthesis and ATP Production
ATP is formed by the addition of a phosphate group to a molecule of adenosine diphosphate (ADP); or to state it in chemical terms, by the
phosphorylation of ADP. This reaction requires a substantial input of energy, much of which is captured in the bond that links the added
phosphate group to ADP. Because light energy powers this reaction in the chloroplasts, the production of ATP during photosynthesis is referred
to as photophosphorylation.
The light reaction uses the energy from photons to create ATP and NADPH, which are both forms of chemical energy used in the dark reaction
(=Calvin Cycle). Calvin Cycle, through a series of chemical reactions, takes the carbon from carbon dioxide and turns it into glucose, which is a
sugar that cells use as energy.
Carbon dioxide is a fully oxidized molecule. What that means is basically it does not have a lot of chemical energy. The Calvin Cycle turns
carbon dioxide into the much more reduced molecule, glucose, which has much more energy.
Where ATP comes into play is that it functions as a reduced molecule that provides the chemical energy that transforms the carbons in the
carbon dioxide molecules into progressively more reduced molecules until you get glucose. Thus, ATP is used to power the change from 3-
phosphoglycerate to 1,3-bisphosphoglycerate, which is then turned into 2 glyceraldehyde 3-phosphate (G3P) molecules with NADPH (an
energy source similar to ATP). One of these G3P molecules gets turned into glucose. The other one is transformed by ATP into ribulose
bisphosphate (RuBP), which then picks up carbon dioxide and the cycle begins again.
Substrate-level phosphorylation – is the formation of ATP by the direct transfer of a PO3 group to ADP.
(Source: https://quizlet.com/11951424/metabolism-final-exam-flash-cards/)
Oxidative phosphorylation – is the process that explains how molecules of FADH2 and NADH are used to make ATP. The term “oxidative” is
used because oxygen accepts an electron while the gradient made by the movement of electrons powers the creation ATP.
(Source: http://www.dbriers.com/tutorials/2012/04/substrate-level-vs-oxidative-phosphorylation/)
Other references that can be used: https://online.science.psu.edu/biol110_sandbox_8862/node/8924
http://www.neshaminy.k12.pa.us/Page/20741
180
Review Stages of Cellular Metabolism and the products produced at each stage (ATP by substrate level phosphorylation, CO2, NADH and
FADH2)
Four Major Reaction Pathways
1. Glycolysis
2. Conversion of Pyruvate to Acetyl CoA (also called Oxidation of Pyruvate, Pyruvate Processing, Pyruvate Grooming)
3. Kreb’s Cycle (Citric Acid Cycle, Tricarboxylic Acid Cycle)
4. Electron Transport Chain (Chemiosmosis)
Stage of Cellular Metabolism Substrate-Level Phosphorylation Oxidative Phosphorylation through ETC Total
Glycolysis 2 2 4-6 2
Pyruvate Grooming 0 2 6
(Decarboxylation of Pyruvate)(x2)3
Subtotal 4 28-30 4
SUMMARY TABLE – Number of ATP molecules formed from 1 molecule of glucose
The amount of ATP produced is estimated from the number of protons than passes through the inner mitochondrial membrane (via the electron
acceptors of the electron transport chain (ETC) and the number of ATP produced by ATP Synthase.
1. Assumption = Each NADH will generate 3 ATPs while FADHs will generate 2 ATPs.
2. The number of ATP produced depends on the acceptor that receives the hydrogen ions and electrons from the NADH formed during
glycolysis in the cytoplasm.
3. Glycolysis results in formation of 2 molecules of pyruvic acid/pyruvate thus values are multiplied by 2.
Glycolysis
Pyruvate Processing/
Grooming
Citric Acid Cycle
Oxidative
Phosphorylation
Practice Questions
(Available at the following sites: Students are asked to watch a video and answer questions after watching the video).
Photosynthetic Electron Transport and ATP Synthesis
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/photosynthetic_electron_transport_and_atp_synthesis.html
182
Calvin Cycle
• https://highered.mheducation.com/sites/9834092339/student_view0/chapter39/calvin_cycle.html
RUBRICS/ASSESSMENT GUIDE
The learners shall be Student participation Student was able to Student was able to Student was able to (1) Student was not able
able to describe the (During lecture) answer the question answer the question answer the question but to answer the question.
following: without referring to his/her without referring to his/ read from his/her notes. (2) Student read from
notes plus the follow-up her notes; Was not able notes of his/her
Compute the number
question. to answer follow up classmate..
of ATPs needed or
question.
gained in
photosynthesis and Student participation Students in the team Student listened to the Student was a passive Student was interested
respiration (During Practice) equally contributed to the discussion but participant and in other matters not
discussion and the contribution to the team contribution was related to the exercise.
answering of the table was lesser than the minimal.
provided other members
Examination Obtained 90-100% correct Obtained 70-80.99% Obtained 50-69.99% Obtained percentile
answers in the exam correct answers in the correct answers in the <50% correct answers in
exam exam the exam
Biographical Notes
FLORENCIA G. CLAVERIA, Ph.D. DAWN T. CRISOLOGO
Team Leader Team Leader
Ms. Dawn Crisologo is a Special Science Teacher at the
Dr. Florencia G. Claveria is the current Chair of the CHED Philippine Science High School-Main Campus in Diliman, Quezon
Technical Panel for Biology and Molecular Biology. She is also City and specializes in advanced topics in Ecology, Evolution and
member of the Commission’s Technical Panel for Math and Biodiversity, Anatomy, Physiology, and Methods in Science and
Science. She is currently Vice Chancellor for Academics, Technology Research. She is a member of the Asian Association
Research, and Operations at the De La Salle Araneta University. of Biology Educators, Wildlife Conservation Society of the
Philippines, and Biology Teachers Association of the Philippines.
She is a full professor at the De La Salle University-Manila Her works are included in The Philippine BIOTA Journal and
where she served as Dean of the College of Science for 6 three editions of the Science Blast textbook. Ms. Crisologo is
academic years. Dr Claveria finished her doctorate in Biological currently finishing her master’s in Environmental Science at the
Sciences at the University of Cincinnati, through a Fulbright-Hays University of the Philippines Diliman. She completed her
grant. She completed her master’s in Zoology at the Ghen State bachelor’s degree in Biology at the same university.
University, through a grant from the Government of Belgium. She
earned her bachelor’s degree in Biology at St. Louis University. CHUCKIE FER CALSADO
Her written scholarly works include contributions to academic Writer
publications such as the Philippine Textbook of Medical Mr. Chuckie Fer Calsado is Special Science Teacher IV at
Parasitology, Journal of Protozoology Research, and The Journal the Philippine Science High School Main Campus where he has
of Veterinary Medical Science. been teaching for 8 years. He is a member of biological
organisations like the Biology Teachers Association of the
Philippines, the Asian Association for Biology Education, and
Concerned Artists of the Philippines among many others. He has
published academic papers such as Implication of Students’
Cognitive Style, Personal Demographics, Values and Decision
Making in Environmental Education and the Role of Education in
the Prevention of Child Trafficking in Nepal. Mr. Calsado finished
his Master’s in Bioethics at the Monash University and his
bachelor’s degree in Biology at the University of the Philippines
DIliman.
184
AILEEN C. DELA CRUZ JANET S. ESTACION, Ph.D.
Writer Writer
Ms. Aileen Dela Cruz has been serving as the Science Dr. Janet Estacion is current Officer-in-Charge at the
Research Analyst at the Philippine Science High School - Main Institute of Marine and Environmental Science in Silliman Unive
Campus since 2004. Her academic interests range from rsity where she has been teaching for 30 years now. She headed
microbiology, food safety and nutrition, and laboratory safety and researches on marine conservation and the recovery of reefs. Her
she has been involved in trainings and conferences on the same scholarly works appeared on different publications such as the
fields of study. Her published scholarly works include series of Philippine Science Letters and the Silliman Journal. Dr. Estacion
textbooks on 21st Century Learning. Ms. Dela Cruz earned her earned her doctorate degree in Zoology at the James Cook
bachelor’s degree in Biology at the University of the Philippines University of North Queensland. She completed her master’s
Baguio. degree in Marine Biology at the University of the Philippines
Diliman and her bachelor’s degree in Biology at the Silliman
DOREEN D. DOMINGO, PH.D. University.
Writer
Dr. Doreen D. Domingo is a Professor at the Mariano MARY JANE C. FLORES, Ph.D.
Marcos State University where she teaches both in the graduate Writer
and undergraduate levels. She is currently the Chief of Alumni
Relations for the university. Dr. Domingo finished her doctorate in Dr. Mary Jane C. Flores is Assistant Professor 3 at the
Biology (magna cum laude) at St. Louis University through a College of Science in the De La Salle University where she has
research grant from CHED and the Microbial Forensics and been teaching for 20 years now. Her published works include
Biodefense Laboratory, Indiana University. She completed her researches on parasitology, climatology, and community
Doctor of Education on Educational Management, her master’s nutrition. Dr Flores has conducted and attended seminars on
degree in Education major in Biology, and her bachelor’s degree Biology in the country and abroad, including the Training on
in Biology at the Mariano Marcos State University. Dr. Domingo’s Biological Control at the US Department of Agriculture-
scholarly works were published on the International Referred Agricultural Research Service and Congress meetings on
Journal and the National Referred Journal. Parasitology. She is a two-time recipient of the Don Ramon J.
Araneta Chair in Ecology among other citations. Dr. Flores
earned her Doctorate, Master’s, and Bachelor’s degrees in
Biology at the De La Salle University.
JUSTIN RAY M. GUCE JOHN DONNIE RAMOS, Ph.D.
Writer Technical Editor
Mr. Justin Ray Guce is a Special Science Teacher I at the
Dr. John Donnie Ramos is a Member of CHED’s Technical
Philippine Science High School Main Campus in DIliman, Quezon
Panel for Biology and Microbiology and Board Member of the
City where he teaches for 9 years. He has served as a Trainer of
Philippine Society for Biochemistry and Molecular Biology. He is
student representatives for Science Olympiad competitions and
currently the Dean of the College of Science at the University of
has delivered presentations in a number of Biology workshops
Santo Tomas where he teaches molecular biology, immunology
and conventions. Mr Guce is a member of the Wildlife
and genetics, and allergology. Dr. Ramos completed his
Conservation Society of the Philippines and the Biology Teachers
doctorate in Molecular Biology at the National University of
Association of the Philippines. Mr Guce is currently finishing his
Singapore. He finished his master’s degree in Biological Sciences
master’s in Biology Education at the University of the Philippines
at the University of Santo Tomas and his bachelor’s degree in
Diliman where he also graduated his bachelor’s degree in
Biology at the Philippine Normal University. Dr. Ramos is
Biology.
recipient of the NAST-TWAS Prize for Young Scientist in the
Philippines in 2010, and Outstanding Young Scientist by the
NOLASCO H. SABLAN National Academy of Science and Technology in 2005.
Writer
Mr. Nolasco Sablan is Teacher III at the Parada National JOY R. JIMENA
High School and is a DepEd teacher for 11 years now. He has Copyreader
worked as resource speaker, trainer, and writer for different
Ms. Joy Jimena is currently Planning Officer II at the
institutions in the education sector, including the Ateneo de
Information Management Bureau of the Department of Social
Manila University, Metrobank Foundation Inc., and the
Welfare and Development. She also previously worked with other
Department of Education. Mr. Nolasco Sablan earned his
government agencies such as the Department of National
master’s degree in Biology Education at the Ateneo de Manila
Defense and Philippine Commission on Women, and Social
University and completed his bachelor’s degree in Education
Security System. Ms. Jimena graduated at the University of the
major in General Science at the Philippine Normal University.
Philippines Diliman with a degree in Public Administration.
186
RENAN U. ORTIZ
Illustrator
Mr. Renan Ortiz is a teacher and visual artist who has
collaborated in local and international art exhibitions such as the
SENSORIUM at the Ayala Museum, Populus in Singapore,
Censorship_2013 Move On Asia in South Korea, and the Triumph
of Philippine Art in New Jersey, USA. Mr. Ortiz’s solo exhibitions
include versereverse at the Republikha Art Gallery. He first
completed his bachelor’s degree in Political Science at the
University of the Philippines Manila before finishing his bachelor’s
degree in Fine Arts major in Painting at the University of the
Philippines Diliman. Mr. Ortiz is an awardee of the Cultural
Center of the Philippines’ CCP Thirteen Artists Awards in 2012.
DANIELA LOUISE B. GO
Illustrator
Ms Daniela Louise Go is a freelance illustrator and graphic
designer, specializing on graphic design, brand and campaign
design, and copywriting. She has worked as illustrator for Stache
Magazine, Philippine Daily Inquirer, and Summit Media Digital.
Ms Go is a member of organisations such as the UP Graphic and
UP Grail in which she also served as designer and illustrator. Her
works have been part of art exhibitions including Freshly Brewed,
Wanton Hypermaterialism, and Syntheses 2014: Graduate
Exhibit. Ms. Go graduated her bachelor’s degree in Fine Arts
Major in Visual Communication at the University of the Philippine
Diliman.