Activity Restriction Enzyme Scissors of GE

Activity
Restriction Enzymes: The Scissors of Genetic Engineering

(by LMRubio)
Introduction:
The direct manipulation of genes for practical purposes, or genetic engineering,
was made possible by the discovery of restriction enzymes that cut DNA molecules at a
limited number of specific locations. These enzymes were discovered in the late 1960s by
researchers studying bacteria. Restriction enzymes naturally protect the bacteria against
intruding DNA from other organisms, such as phages or other bacterial cells. They work
by cutting up the foreign DNA, a process called restriction. Most restriction enzymes are
very specific recognizing short nucleotide sequences (ranging form four to eight
nucleotides) in DNA molecules and cutting at specific points with these sequences.
This activity allows you to simulate how a restriction enzymes works.
Objectives:
At the end of the activity, the students are expected to:
1. Simulate the role of a restriction enzyme.
2. Describe the restriction fragments produced by restriction enzymes.
3. Compare the number of restriction fragments produced by a specific restriction
enzyme used in cutting the same molecules of DNA.
Materials:
 Single stranded DNA samples
 Scissors
 Restriction enzyme and its sequence of recognition site
 Pencil
Procedure:
1. Get the single stranded DNA samples of one kind to your teacher together with
the restriction enzyme assigned to your group.
2. Construct the complementary strand of each single stranded DNA samples of one
kind by following the base-pairing rule. You can do it simultaneously (since you
are a group) or one DNA strand at a time.
3. Locate on your the DNA molecule the restriction site which matches the
sequences of bases on your restriction enzyme.
4. Mark with a pen each restriction site that you have located. Copy the mark where
you should cut the DNA molecule.
5. Cut the DNA molecule into restriction fragments based on the restriction enzyme
assigned to you. Repeat Steps 2 to 4 for the remaining DNA molecules (if you do
it one DNA molecule at a time).
6. Label the number of base pairs that each fragment has. Write the number at the
back of each fragment.
7. Arrange the fragments you obtained from each DNA molecule from the longest to
the shortest and indicate the number of base pairs opposite each fragment as
shown below:
Restriction Enzymes 1
DNA molecule 1 DNA molecule 2 DNA molecule 3
_______________ 8 _______________ 8 _________________ 8

_____________ 5 ___________ 5 ___________ 5
_________ 2 _________ 2 ________ 2
Questions:
1. How many restriction fragments did you get from each DNA molecule?
2. How many base pairs are present in each fragment from the longest to the
shortest?
3. Describe the structure of the restriction fragments produced by restriction
enzymes from the DNA molecule.
Group I
Restriction Enzyme Sequence of Recognition Site Microbial Origin
Eco R1 5’ – G/AATTC – 3’ Escherichia coli

3’ – CTTAA/G – 5’
Single Stranded DNA:
5’ 3’
GAACGCCTGCGAATTCTTACGGCTGAATTCGTAACGTACTGAATTCCAAGATC
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
Group 2
Rsa 1 5’ – GT/AC – 3’ Rhodopseudomonas

3’ – CA/TG – 5’ sphaeroides
5’ 3’
TAAGTACCCGATCACGTACTCACTGACGTACACGTGTACTCGACTTGTACTAC
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
Group 3
Bam H1 5’ – G/GATCC – 3’ Bacillus amyloliquefaciens H.

3’ – CCTAG/G – 5’
5’ 3’
CCGATGCAAGGATCCGTAATGCCATAGGATCCACGGATCCACTGAAGGATCT
_______________________________________________________________________
3’ 5’
5’ 3’
_______________________________________________________________________
3’ 5’
5’ 3’
_______________________________________________________________________
3’ 5’
Group 4
Taq 1 5’ – T/CGA – 3’ Thermus aquaticus YT1

3’ – AGC/T – 5’
5’ 3’
GCTATCGAATCGTAGTCGACCCTGCTTCGATCCGGTGACATCGAAACCGTCG
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
Group 5
Hind III 5’ – A/AGCTT – 3’ Haemophilus influenzae

3’ – TTCGA/A – 5’
5’ 3'
ATCGCAAGCTTTCAATCGCAAGCTTCGATAAGCTTTACGAACTTGCTCATAAG
________________________________________________________________________
3’ 5’
5’ 3'
________________________________________________________________________
3’ 5’
5’ 3'
________________________________________________________________________
3’ 5’
Group 6
Sau 3A1 5’ - /GATC – 3’ Staphylococcus aureus 3A

3’ – CTAG/ - 5’
5’ 3’
ACTGATCCGTAACCGATCGAACTGCAGATCGTCAGCGATCACGGGATCATCG
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
Group 7
Cla 1 5’ – AT/CGAT – 3’ Caryophanonlatum

3’ – TAGC/TA – 5 ‘
5’ 3’
GCATCGATCAAGCTGCATCGATTCAATCGGAATCGATCCGGAGATCGATACT
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
Group 8
Kpn 1 5’ – GGTAC/C- 3’ Klebsiella pneumoniae

3’ – C/CATGG – 5’
5’ 3’
AAGGTACCGTCAACGGGTACCATCGACCGGTACCATCCAGGTACCACGTAC
_______________________________________________________________________
3’ 5’
5’ 3’
_______________________________________________________________________
3’ 5’
5’ 3’
_______________________________________________________________________
3’ 5’
Group 9
Bss HII 5’ – G/CGCGC – 3’ Bacillus stearothermophilus

3’ – CGCGC/G – 5’
5’ 3’
TAGCTAGCCGTAGCGCGCACGTAGCGCGCCTCGCGCGTGCGCGCCCGGACTG
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’
5’ 3’
________________________________________________________________________
3’ 5’

Activity Restriction Enzyme Scissors of GE

Uploaded by

Document Information

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

Activity Restriction Enzyme Scissors of GE

Uploaded by

Copyright:

Available Formats

Activity

Restriction Enzymes: The Scissors of Genetic Engineering

_______________ 8 _______________ 8 _________________ 8

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Eco R1 5’ – G/AATTC – 3’ Escherichia coli

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Rsa 1 5’ – GT/AC – 3’ Rhodopseudomonas

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Bam H1 5’ – G/GATCC – 3’ Bacillus amyloliquefaciens H.

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Taq 1 5’ – T/CGA – 3’ Thermus aquaticus YT1

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Hind III 5’ – A/AGCTT – 3’ Haemophilus influenzae

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Sau 3A1 5’ - /GATC – 3’ Staphylococcus aureus 3A

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Cla 1 5’ – AT/CGAT – 3’ Caryophanonlatum

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Kpn 1 5’ – GGTAC/C- 3’ Klebsiella pneumoniae

Single Stranded DNA:

Restriction Enzyme Sequence of Recognition Site Microbial Origin

Bss HII 5’ – G/CGCGC – 3’ Bacillus stearothermophilus

Single Stranded DNA:

You might also like

_______ 8 _ 8 ___________ 8