Paraglomaceae | Davis - INVAM | West Virginia University http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.

html

Davis College (http://davis.wvu.edu)

WVU Home (http://wvu.edu)

Search this site...

INTERNATIONAL CULTURE COLLECTION OF
(VESICULAR) ARBUSCULAR MYCHORRHIZAL Search this site Search WVU
FUNGI

(/)

Home (http://invam.wvu.edu/home) About (http://invam.wvu.edu/about)

Collection (http://invam.wvu.edu/collection) Cultures (http://invam.wvu.edu/cultures)

The Fungi (http://fungi.invam.wvu.edu) Methods (http://invam.wvu.edu/methods)

Home (../../index.html) » The Fungi (../../the-fungi.html) » Classification (../classification.html) »

Paraglomaceae (paraglomaceae.html)

PARAGLOMERACEAE J.B. Classification

(/the-
Morton & Redecker fungi/classification.html
Nomenclature
(/the-
Studies of biochemical characters, such as monoclonal antibody fungi/nomenclature.html
specificities (Wright et al., 1987) and fatty acid profiles (Graham et al., Species
1995) have led to the long-held suspicion that members of this family Descriptions (/the-
fungi/species-
were phylogenetically distant from species in Acaulosporaceae
descriptions.html)
(acaulosporaceae.html) and Glomeraceae (glomaceae.html), but all of
these data did not contain enough phylogenetic information to determine
it’s position relative to other glomeromycotan taxa. Small subunit
ribosomal DNA sequences (SSU) provided the character set to position
this family is ancestral to both families (Redecker et al., 2000; Sawaki et
al., 1997).

1 of 6 7/7/19, 11:32 AM
Paraglomaceae | Davis - INVAM | West Virginia University http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.html

Vegetative structures consist of those inclusive in the . However, some

states of mycorrhizal structures are unique to this family.

Molecular characters which appear to be diagnostic for members of this

family:

1. Monoclonal antibody cell lines B5 and F8, maintained in the laboratory

of Sara Wright (Wright et al., 1987).

2. Signature DNA sequence at the 3’ end of the 5.8S ribosomal gene:

GGCATGTCTGTTTGAGGGCACCA separates members of this family
from those of Glomeraceae.

3. The primer sequence TGCTAAATAGCCAGGCTGY (ARCH1311) also

will selectively amplify species of this family.

(../../slate-assets/resources
/1254/1338490994.JPG) Arbuscules stain
very faintly or are almost invisible in
conventional acidic stains. In at least one
species (P. brasilianum), staining properties
are more variable, with some regions of moderate staining intensity.
Trunks < 4 µm wide, with fine branching near tips. Contrast in photo at
right digitally enhanced to better see structure.

Vesicles are poorly characterized. None are observed in

any isolates of P. occultum, but lipid containing structures
(possibly spores) have been detected with sporadic
distribution in roots containing P. brasilianum.

2 of 6 7/7/19, 11:32 AM
Paraglomaceae | Davis - INVAM | West Virginia University http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.html

(../../slate-assets/resources
/1254/1338491219.JPG)

Intraradical hyphae stain faintly, but usually

less so than arbuscules; intracellular hyphae
often tightly coiled, 3-10 µm wide; intracellular hyphae with some surface,
coiling more infrequent and looser, irregular branching, more variable
widths of 2-8 µm.

(../../slate-assets/resources
/1254/1338490992.JPG)

Extraradical hyphae staining darkly, 2-6 µm

wide, often in profuse abundance around
roots with attached spores.

Species produce asexual spores

spores which:
(../../slate-assets/resources
/1254/1338490995.JPG) Produced singly,
more rarely in loose aggregates of 2-3
spores; subcellular structure is identical to
that of Glomus species, with layers of the
spore wall continuous with layers of the subtending hypha.

3 of 6 7/7/19, 11:32 AM
Paraglomaceae | Davis - INVAM | West Virginia University http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.html

Develop terminally on a cylindrical to slightly

flared subtending hypha.

Spore is occluded in species described to

date by thickening of the innermost spore
wall layer.

Germination is poorly characterized in this group, but assumed to be like

that in species of Glomeraceae: germ tube emergence through the lumen
of the subtending hypha or more rarely through the spore wall.

GENERA
Only one genus has been classified so far in this family.

Paraglomus

4 of 6 7/7/19, 11:32 AM
Paraglomaceae | Davis - INVAM | West Virginia University http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.html

(paraglomaceae/paraglomus.1.html)

REFERENCES
Graham, J.H., N. C. Hodge, and J. B. Morton. 1995. Fatty acid methyl
ester profiles for characterization of glomalean fungi and their
endomycorrhizae. Applied and Environmental Microbiology 61:58-64.

Morton, J. B. and G. L. Benny. 1990. Revised classification of

arbuscular mycorrhizal fungi (Zygomycetes): A new order, Glomales,
two new suborders, Glomineae and Gigasporineae, and two new
families, Acaulosporaceae and Gigasporaceae, with an emendation of
Glomaceae. Mycotaxon 37:471-491.

Morton, J. B. and D. Redecker. 2001. Two new families of Glomales,

Archaeosporaceae and Paraglomaceae, with two new genera
Archaeospora and Paraglomus, based on concordant molecular and
morphological characters. Mycologia 93:181-195.

Redecker, D., J. B. Morton, and T. D. Bruns. 2000. Ancestral lineages

of arbuscular mycorrhizal fungi (Glomales). Molecular Phylogenetics
and Evolution 14:276-284.

Sawaki, H, K. Sugawara, and M. Saito. 1998. Phylogenetic position of

an arbuscular mycorrhizal fungus, Acaulospora gerdemannii , and its
synanamorph Glomus leptotichum, based upon 18S rRNA gene
sequence. Mycoscience 39:477-480.

Wright, S. F., J. B. Morton, and J. E. Sworobuk. 1987. Identification of

a vesicular-arbuscular mycorrhizal fungus by using monoclonal
antibodies in an enzyme-linked immunosorbent assay. Applied and
Environmental Microbiology 53:2222-2225.

5 of 6 7/7/19, 11:32 AM
Paraglomaceae | Davis - INVAM | West Virginia University
Davis College of Agriculture, Natural Resources and Design 
4100 Agricultural Sciences Building | PO Box 6108 
Morgantown, WV 26506-6108 
Phone:  304-293-2395 (tel:3042932395) x: 304-293-3740 | Contact Us (mailto:davisinfo@mail.wvu.edu)
Accreditations (http://about.wvu.edu/wvu-facts) | Web
Standards (http://brand.wvu.edu/web-standards) | Questions
or Comments? (mailto:web_services@mail.wvu.edu)
© 2017 West Virginia University. West Virginia University is an
Equal Opportunity/Affirmative Action institution.
6 of 6
http://fungi.invam.wvu.edu/the-fungi/classification/paraglomaceae.html
A-Z Site Index (http://www.wvu.edu/SiteIndex/) | Campus
Map (http://www.wvu.edu/CampusMap/) | Jobs
(http://www.hr.wvu.edu/wvu_jobs) | Directory
(http://directory.wvu.edu/)
Give (http://www.wvuf.org/) | MyAccess
(http://myaccess.wvu.edu/) | MountaineerTRAK
(http://careerservices.wvu.edu/mountaineertraklogins) | WVU
Alert (http://emergency.wvu.edu/alert/) | WVU Today
(http://wvutoday.wvu.edu) | MIX (http://mix.wvu.edu/)
7/7/19, 11:32 AM