Journal of Functional Foods 66 (2020) 103803

Contents lists available at ScienceDirect

Journal of Functional Foods

journal homepage: www.elsevier.com/locate/jff

Anti-hyperuricemic effects of three theaflavins isolated from black tea in T

hyperuricemic mice
Lingling Taia,c,1, Zenghui Liub,1, Minghui Suna,c,1, Qianjin Xiea,c, Xiaqiang Caia,c, Ying Wanga,c,
⁎
Xu Donga,c, Yan Xua,c,
a
State Key Laboratory of Tea Plant Biology and Utilization, Anhui Agricultural University, Hefei 230036, China
b
Anhui Academy of Medical Science, Hefei 230061, China
c
International Joint Laboratory on Tea Chemistry and Health Effects of Ministry of Education, Hefei 230036, China

A R T I C LE I N FO A B S T R A C T

Keywords: Theaflavins are characteristic ingredients of black tea which are correlated with their qualities and functions.
Theaflavins The study aimed to evaluate the effects and mechanism of major theaflavin monomers reducing serum uric acid
Isolation and purification (SUA) in hyperuricemic mice. Three theaflavin monomers of TF, TFDG and TF-3-G were isolated and purified
Lowering uric acid from black tea. The results showed that they have obvious SUA-lowering effect on hyperuricemic mice. They
Hyperuricemia
suppressed the activities of ADA and XOD, down-regulated the genes and proteins expression of GLUT9 and
URAT1, up-regulated the gene and protein expression of OAT1 and the genes expression of ABCG2, OCTN1,
OCT1/2, and OAT2. They could also decrease serum BUN and Cr values and improve renal damages of hy-
peruricemic mice. The mechanism might be correlation with reducing the amount of inflammatory cells and
activating Nrf2/HO-1 pathway. These findings indicated that TF, TFDG and TF-3-G could have potential ap-
plication prospects in prevention and therapy of hyperuricemia.

1. Introduction J99745 (Qin et al., 2018; Zhang et al., 2017).

People's diets have changed in recent years with the rapid economy
development and their living standards elevating. The amount of sugar,
fat and protein intakes increased significantly. The incidence of hy-
peruricemic (HUA) has been increasing year by year in world-wide,
such as China (Liu, Zhang, Wang, & Liu, 2014), the United States
(Kumar, Khalsa, & Carmody, 2016), Italy (Gianluca et al., 2013) and so
on. HUA is the main pathological basis of gout, about 5–12% of patients
with HUA will develop into gout (Ragab, Elshahaly, & Bardin, 2017).
HUA is significantly in correlation with metabolic syndrome, diabetes
(Changgui, Ming-Chia, & Shun-Jen, 2013), hypertension, kidney dis-
eases (Noone & Marks, 2013), cardiovascular diseases, and so on
(Acevedo et al., 2016). It is a kind of metabolic diseases which are
seriously harmful to human health.
At present, allopurinol and benzbromarone have been used in the
therapy of HUA in clinical, but they are accompanied by many toxic
and side effects in decreasing SUA (Andrea et al., 2014; Lee,
Ariyasinghe, & Thirumoorthy, 2008).
Studies have shown that some natural products have the effect of
reducing SUA such as dioscin and mangiferin aglycon derivative
Teas are processed from fresh leaves of Camellia sinensis (L.)
O.Kuntze. Black tea, a kind of fermented tea, is an important member of
tea family and accounts for 78% in global markets (Singh & Prateeksha,
2015).
Black tea is not only rich in nutrients of carbohydrates, lipids,
proteins, and vitamins C, K, A, but also contains many bioactive sub-
stances known as catechins, theaflavins (TFs) and thearubigins (TRs)
(Naveed et al., 2018).
TFs is a class of important quality and functional components of
black tea. The content of TFs in black tea is about 2% (dry weight).
They contribute to the organoleptic qualities of black tea infusion
(Wang et al., 2011).
TFs were first found by Roberts E.A.H in 1957. They are a class of
compounds of benzotropolone skeletons with multiple phenolic hy-
droxyl groups which are formed by oxidation of polyphenols.
31 kinds of TFs have been discovered and identified so far
(Huadong, Kelly, Tinchung, & Shengmin, 2012; Tanaka, Inoue,
Betsumiya, Mine, & Kouno, 2001). They are mainly theaflavin (TF),
theaflavin-3-gallate (TF-3-G), theaflavin-3′-gallate (TF-3′-G)and thea-
flavin-3-3′-gallate (TFDG) (Fig. 1).

⁎
Corresponding author at: State Key Laboratory of Tea Plant Biology and Utilization, Hefei 230036, China.
E-mail address: yanxu@ahau.edu.cn (Y. Xu).
1
These authors contributed equally.

https://doi.org/10.1016/j.jff.2020.103803
Received 23 September 2019; Received in revised form 16 January 2020; Accepted 20 January 2020
Available online 07 February 2020
1756-4646/ © 2020 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/BY-NC-ND/4.0/).
L. Tai, et al.
Fig. 1. Structures of theaflavins.
Studies have shown that TFs have various biological activities such
as anti-oxidation, anti-tumor (Tan et al., 2019), prevention cardiovas-
cular disease, antibacterial, anti-viral, anti-inflammatory and so on
(Bahorun et al., 2012; Fu, Wang, Cai, Zhao, & Fu, 2018; Mai et al.,
2016; Nakayama et al., 2015).
In previous study, we have reported black tea extract has anti-hy-
peruricemic effect on hyperuricemic mice (Zhu, Tai, et al., 2017). To
further explore the lowering SUA active constituents of black tea ex-
tract, we carried out separation and purification of theaflavins, mean-
while, the effect and mechanism of different dosages of 20, 50 and
100 mg/kg of TF, TF-3-G and TFDG on SUA in hyperuricemic mice were
studied (investigated, evaluated).
2. Materials and methods
2.1. Material and reagents
Keemun Tea was purchased from Anhui Province Qimen County
Keemun Tea Industry Co., Ltd. (China). D101 macroporous resin and
the theaflavins standards of TF, TF-3-G, TF-3′-G and TF-3, 3′-DG were
purchased from Shanghai Yuanye Biotechnology Co., Ltd (China). GE
Sephadex LH-20 was purchased from Beijing Yuanbaoshan
Chromatography Technology Co., Ltd.
HE staining kit was purchased from Boster Biological Technology
Co., Ltd (China); RNA store reagent was purchased from Tiangen
Biochemical Technology (Beijing) Co., Ltd (China); the Total RNA
Extraction Reagent and the HiScript® II 1st Strand cDNA Synthesis Kit
was purchased from Nanjing Vazyme Biotechnology Co., Ltd (China);
RIPA protein extraction reagent was purchased from solarbio science &
technology (Beijing) co., ltd. (China); polyvinylidene difluoride (PVDF)
membranes was purchased from Beijing Labgic Technology Co., Ltd.
(China).; GAPDH, GLUT9, OAT1 and URAT1 were purchased from
Wuhan Fine Biotech Co., Ltd. (China); ECL kit was purchased from
Vazyme Biotech (Nanjing) Co., Ltd., (China); Goat anti-rabbit IgG an-
tibody and DAB Peroxidase Substrate Kit were purchased from Beijing
Zhongshan Jinqiao Biotechnology Co., Ltd. (China); F4/80 (D2S9R) was
purchased from Cell Signaling Technology. Other regents and kits were
the same as the literature (Zhu, Tai, et al., 2017).
2.2. Animals
Kunming male mice of SPF were purchased from Beijing Vital River
Laboratory Animal Technology Co., Ltd (China), production license
number: SCX (Beijing) 2016-0011, 25 ± 2 g. Mice were fed for
5–7 days under the conditions of 12 h light/12 h dark cycle, 23 ± 2 °C
temperature and 50 ± 10% relative humidity. All animal experiments
2
Journal of Functional Foods 66 (2020) 103803
in the study were in obedience to the regulations and guidelines for the
care of laboratory animals. The protocol was approved by the ethics
committee of Anhui Agricultural University.
2.3. Experimental methods
2.3.1. Preparation of three theaflavins
Keemun Tea (1 kg) was brewed three times with boiling water. The
infusions were combined and concentrated under vacuum. The re-
maining water extract was then extracted successively with di-
chloromethane (CH2Cl2) and ethyl acetate (EtOAc). The EtOAc portion
was chromatographed on a D101 macroporous adsorbent resins column
eluted with pure water, 30%, 50% and 95% ethanol (EtOH) succes-
sively. The eluted fraction of 95% EtOH was further subjected to a
Sephadex LH-20 column eluted with methanol (MeOH) to get three
theaflavins (TF, TF-3-G and TFDG). Each fraction was analyzed by
HPLC. The samples of three theaflavins were then stored at −20 °C for
use after vacuum freeze-dried.
2.3.2. HPLC analysis of theaflavins
The content of three theaflavins was analyzed on a Luna 5u C18
(250 × 4.60 mm, 5 µm, Phenomenex, USA) using the Waters 2489
series HPLC system. The flow rate was 1 mL/min, the column tem-
perature was 30 °C, the injection volume of sample solution was 10 µL
and the UV detector wavelength was at 278 nm. The elution gradient
was same as HPLC analysis of black tea extract (Zhu, Tai, et al., 2017).
2.3.3. The model of hyperuricemic mice building and experimental protocol
The model of hyperuricemic mice was established by intragastric
administration of yeast extract (250 mg/kg) and intraperitoneal injec-
tion of Potassium oxonate (PO, 7.5 g/kg).
After adaptation feeding, 72 mice were randomly divided into
groups (n = 6) as follows: normal control group (NC), model control
group (MC), allopurinol group (AP, 5 mg/kg), TF groups, TF-3-G groups
and TFDG groups (20, 50 and 100 mg/kg). All groups were con-
tinuously (successive) administrated for 7 days, once a day. Mice were
fasted for 12 h before administration. Normal control group and model
group were orally administrated 0.5 mL of physiological saline solution.
Allopurinol group was intraperitoneally injected with allopurinol
(5 mg/kg). TF, TF-3-G and TFDG were intragastrically administered to
mice at difference dosages of 20, 50 and 100 mg/kg respectively. On the
seventh day, except normal control group, other groups were admini-
strated with yeast extract (250 mg/kg) and PO (7.5 g/kg) before one
hour of the last administration. After one hour of the last administra-
tion, mice were anesthetized by chloral hydrate. The eyeballs were
taken out for collecting blood samples. Finally mice were euthanized by
L. Tai, et al.
cervical dislocation. The livers and kidneys were separated on ice bath
immediately. Blood samples were centrifuged at 5000 r/min for 10 min
at 4 °C to obtain serum samples. Serum samples and livers were stored
at −20 °C until assay. One kidney was kept in RNA store regent, and the
other one was stored in 10% formaldehyde.
2.3.4. Biochemical indicators determination of serum samples and livers of
experimental mice
The values of SUA, blood urea nitrogen (BUN) and creatinine (Cr)
were determined according to related kit instructions. The liver tissues
were homogenized with 9 volumes saline on ice bath and centrifuged at
3000 r/min for 10 min at 4 °C. The supernatant was used to assay the
activities of adenosine deaminase (ADA) and xanthine oxidase (XOD).
The activities of ADA and XOD were analyzed according to kit in-
structions.
2.3.5. RT-PCR assay for the genes expression levels and western blot
analysis of the protein expression
The mRNA levels of genes in kidney tissues associated with uric acid
absorption and secretion were measured by RT-PCR. Total RNA ex-
traction, reverse transcription RNA into cDNA, cDNA amplification on a
CFX System were all according to the manufacturer’s instructions.
GAPDH was employed as internal reference gene. The sequences of
gene-specific PCR primers are shown in Table 1.
Briefly, kidney tissues were collected and lysed using RIPA protein
extraction reagent with a protease inhibitor cocktail. Equal amounts of
protein were electrophoresed on 10% SDS-PAGE gels and then trans-
ferred to PVDF membranes, which were then blocked in buffer (5%
free-fat milk in TBST) before being incubated with the primary anti-
body: GLUT9, OAT1, URAT1 at 4 °C for 12 h. GAPDH antibody was used
as a loading control. ECL kit was used to visualize the bands and Image
Lab software was performed to quantify the band intensity, and ana-
lyzed using the ChemicDocTM MP Imaging System (Bio-Rad, Hercules,
CA, USA)
2.3.6. Pathological observation of kidney tissues
The kidney tissues fixed in 10% formalin were dehydrated in
ethanol and embedded with paraffin, then sliced into 4 µm thick. The
sections were dyed with hematoxylin-eosin (HE) according to HE
staining kit instruction and observed under optical microscope at
magnification of 400 times. The immunohistochemical staining (IHC)
steps follow the reagent instructions, five non-overlapping areas were
photographed under a microscope and the area of the positive area was
calculated using Image J.
2.3.7. Statistical analysis
The data are presented as means ± standard deviation and statis-
tically analyzed by GraphPad Prism 5 software (San Diego, CA, USA).
Significant differences between groups were judged by One-way ana-
lysis of variance (ANOVA), followed by Student’s t test. Differences
were significant when P < 0.05.
Table 1
The sequences of gene-specific PCR primers.
Genes (protein) Forward primer
GAPDH AGGTCGGTGTGAACGGATTTG
GLUT9 CTTCCTGTGGACTCTGCCTC
URAT1 ATGGCTGGGTTTACGACCAC
ABCG2 TCTCAACTCCACTGCAAGC
OCTN1 GGGCCAGATCTCCAACTACG
OCT1 TCCATGTTGCTCTTTCGCCT
OCT2 ACAGGTTTGGGCGGAAGT
OAT1 GCAGCCTATGCACCCAACTA
OAT2 ACCCTGGTTGGGTACCTGAT
Nrf2 GACGGGACTATTGAAGGCTGTGA
HO-1 TCAGAAGGGTCAGGTGACCAGA
3
Journal of Functional Foods 66 (2020) 103803
3. Results and analysis
3.1. Qualitative and quantitative analysis of three theaflavins
HPLC chromatogram of standards of theaflavins and catechins are
shown in Fig. 2A, peaks 1, 2, 3, and 4 were TF, TF-3-G, TF-3′-G and
TFDG, respectively. Under the same chromatography condition, the
isolated three theaflavins from black tea were qualitative and quanti-
tative analyzed by HPLC. The purity of TF was 95.75 ± 1.81%
(Fig. 2B). The purity of TF-3-G was 88.49 ± 1.38% (Fig. 2C). The
purity of TFDG was 99.70 ± 0.38% (Fig. 2D).
3.2. Effect of TF, TFDG, and TF-3-G on SUA in hyperuricemic mice
As shown in Fig. 3, SUA values of model control group increased
significantly than that of normal control group (P < 0.001). This in-
dicated hyperuricemic mice established successfully. Compared with
model control group, SUA values of AP, 50 and 100 mg/kg TF groups
decreased notably (P < 0.001). SUA values of TF 20 mg/kg, TFDG
50 mg/kg, TFDG 100 mg/kg and TF-3-G 100 mg/kg groups also re-
markably lowered than that of model control group (P < 0.01). While,
SUA values of TFDG 20 mg/kg and TF-3-G 100 mg/kg groups reduced
obviously compared to model control group (P < 0.05). The results
indicated that TF, TFDG and TF-3-G could markedly reduce SUA levels
in hyperuricemic mice, and moreover, the hypouricemic effect of TF
was superior to TFDG and TFDG was superior to TF-3-G at same dosage.
3.3. Effect of three theaflavins on activities of BUN, Cr, ADA and XOD in
hyperuricemic mice
Fig. 4 showed that the serum BUN and Cr values of model control
group were higher than those of normal control group (P < 0.001).
The serum BUN values of TF, TFDG and TF-3-G groups, as well as AP
group were reduced significantly (P < 0.01 or P < 0.001) except
TFDG and TF-3-G groups (20 mg/kg) (Fig. 4A). Fig. 4B displayed that
the serum Cr values of TFDG, TF-3-G groups and AP group were de-
creased notably than that of model control group besides TF group
(50 mg/kg) (P < 0.01 or P < 0.001). TF-3-G group showed better
effect on decreasing the serum Cr levels than that of TF and TFDG
groups.
The activities of ADA and XOD in model control group were sig-
nificantly increased compared to normal control group (P < 0.001).
Compared with model control group, the activities of ADA in AP, TF,
TFDG and TF-3-G groups were suppressed obviously (P < 0.05,
P < 0.01 or P < 0.001) (Fig. 4C). The activities of XOD in TF, TF-3-G,
TFDG (20 and 50 mg/kg) and AP groups were also suppressed sig-
nificantly (P < 0.01 or P < 0.001) compared with model control
group (Fig. 4D).
Reveres prime
TGTAGACCATGTAGTTGAGGTCA
GACGAGCGAGAAGGACCATT
GCCCAAACCTATCTGAGGCA
ACGTGGTCATTACTGGAAGACA
GATGATGCGAACCGACTTGC
CACTAGCCCCACTGTGAAGG
CACCAGAAATAGAGCAGGAAG
AACTGGCCCAAGCTGTAGAC
AGAAGCCATCGTGCAGACTC
TCGGCTGGGACTCGTGTTCA
GCATAGACTGGGTTCTGCTTGTT
L. Tai, et al.
Fig. 2. HPLC chromatogram. A: HPLC chromatogram of standards of theaflavins and catechins Peaks: 1 (TF), 2 (TF-3-G), 3 (TF-3′-G), 4 (TFDG). Isolated TF (B),
isolated TF-3-G (C), isolated TFDG (D).
Fig. 3. Influences of TF, TFDG and TF-3-G on SUA levels. NC, normal control
group. MC, model control group. AP, allopurinol group. ###P < 0.001 vs
normal control group, *P < 0.05, **P < 0.01, ***P < 0.001 vs model control
group.
3.4. RT-PCR assay for the genes expression levels and western blot analysis
of the protein expression
Fig. 5A and B show that the mRNA expressions of glucose trans-
porter 9 (GLUT9) and urate transporter 1 (URAT1) in model control
group were significantly up-regulated compared to normal control
group (P < 0.05 or P < 0.01). Compared with model control group,
4
Journal of Functional Foods 66 (2020) 103803
the mRNA expression of GLUT9 and URAT1 in AP, TF, TFDG and TF-3-
G groups were down-regulated notably (P < 0.05, P < 0.01, or
P < 0.001) while TFDG groups (20 and 50 mg/kg) couldn’t down-
regulated the mRNA expression of URAT1 significantly (P > 0.05).
Fig. 5 indicated that the mRNA expression levels of ATP-binding
cassette superfamily G member 2 (ABCG2), organic cation/carnitine
transporter 1(OCTN1), organic cation transporter 1/2 (OCT1/2), or-
ganic anion transporter 1/2 (OAT1/2) were down-regulated obviously
in model control group compared to normal control group (P < 0.05,
P < 0.01, or P < 0.001).
As shown in Fig. 5C, TF and TFDG groups up-regulated significantly
the mRNA expression levels of ABCG2 compared with model control
group (P < 0.001). The mRNA expression levels of OCTN1, OAT1 and
OAT2 in TF, TFDG and TF-3-G groups were up-regulated notably
compared to model control group (P < 0.001) (seen in Fig. 5D, G and
H).
Compared to model control group, the results (Fig. 5E) showed that
TF, TFDG and TF-3-G groups could up-regulated remarkably the mRNA
expression levels of OCT1 except TF-3-G group (20 mg/kg) (P < 0.01
or P < 0.001). The mRNA expression levels of OCT2 was only up-
regulated markedly by TF (100 mg/kg) and TF-3-G (20 and 50 mg/kg)
groups compared to model control group (P < 0.001) (shown in
Fig. 5F).
As shown in the Fig. 5 Ⅱ, the protein expression of GLUT9 and
L. Tai, et al.
Fig. 4. Effects of TF, TFDG and TF-3-G on serum BUN (A), Cr (B), hepatic ADA (C) and XOD (D) levels. NC, normal control group. MC, model control group. AP,
allopurinol group. ###P < 0.001 vs normal control group, **P < 0.01, ***P < 0.001 vs model control group.
URAT1 in MC group was higher than that of NC group (P < 0.001). TF-
3-G could down-regulate the protein expression of GLUT9 and URAT1
(P < 0.01 or P < 0.001) while it could up-regulate the protein ex-
pression of OAT1 with a dose-dependent manner (P < 0.01 or
P < 0.001).
3.5. Renal histopathology assay
The size and shape of the glomeruli in NC group were normal. The
borders of them were clear. The Bowman’s capsule cavity was obvious
(Fig. 6A). In MC group, the glomeruli were deformed and the volumes
of them increased full of blood cells, the glomerular capillaries were
dilation. The Bowman’s capsule cavities were becoming smaller and
even adhesion with the glomeruli. The tubular epithelial cells were
degeneration and necrosis (tubular epithelial cell vacuolar degenera-
tion) (Fig. 6B). In AP group, the Bowman’s capsule cavities became
obvious, partial adhesion with the glomeruli. The glomerular capillaries
were dilation and full of blood cells. The lumen of the renal tubules
becomes larger and blood cells infiltration (Fig. 6C).
Compared with model group, the size and shape of the glomeruli
were near to normal. Tubular epithelial cell vacuolar degeneration was
decreased (Fig. 6D, E and G). The glomeruli were more near to normal,
tubular pathological structure tended to normal compared to black
control group (Fig. 6F, H and J). Small amount of renal tubular epi-
thelial cells shedding, some renal tubular cavities became larger. Pa-
thological structures of the glomeruli trended to normal. The glo-
merular size is uniform, the shape is normal, and the boundary is clear
(Fig. 6I, K and L). The results indicated that TF, TFDG and TF-3-G could
improve the kidney damage of hyperuricemic mice with dosage in-
creasing.
3.6. Immunohistochemical staining
The inflammatory cells infiltration of the kidney tissues in each
treatment group were shown in Fig. 7 I and Fig. 7 II . It can be seen that
there was almost no inflammatory cells in the normal group, but the
inflammatory cell in the model group was significantly more than that
in the normal group (P < 0.001). TF (20, 50 and 100 mg/kg), TF-3-G
5
Journal of Functional Foods 66 (2020) 103803
(20, 50 and 100 mg/kg), TFDG (20, 50 and 100 mg/kg) and AP groups
all can effectively reduce the infiltration of inflammatory cells com-
pared with MC group. The amount of inflammatory cells decreased
notably at the doses of 20, 50 and 100 mg/kg in a dose-dependnt
manner in TF, TF-3-G and TFDG groups.
As shown in the Fig. 7 III, compared with the NC group, the mRNA
expressions of nuclear factor erythroid 2-related factor 2 (Nrf2) and
heme oxygenase-1 (HO-1) in the MC group were significantly down-
regulated (P < 0.001). Compared with the MC group, the mRNA ex-
pressions of Nrf2 and HO-1 in the AP, TF, TFDG and TF-3-G groups
were significantly up-regulated (P < 0.05, P < 0.01 or P < 0.001)
except TFDG (20 mg/kg) group could not significantly up-regulated the
mRNA expression of HO-1 (P > 0.05). Therefore, the mechanism of
TF, TFDG and TF-3-G could improve the kidney damage of hyperur-
icemic mice might be through Nrf2/HO-1 pathway.
4. Discussion
Our group has found that the black tea extract and EGCG have
obvious anti-hyperuricemic effect on hyperuricemic mice (Zhu, Tai,
et al., 2017; Zhu, Xu, et al., 2017). TFs are the main quality and
functional ingredients of black tea. Therefore, this study further ex-
plored hypouricemic active compounds in the black tea extract and
their mechanism. The results showed that TF, TFDG and TF-3-G could
markedly decrease SUA levels in hyperuricemic mice (P < 0.05,
P < 0.01 or P < 0.001) except TF-3-G (20 mg/kg).
Uric acid (UA) is the end product of purine metabolism in human.
The level of SUA depends on UA production in the liver and UA ex-
cretion in the kidney. In the liver, adenine nucleotides are deaminated
to become hypoxanthines by ADA, hypoxanthines are oxidized to be-
come xanthines by XOD, and xanthines were further oxidized to be-
come UA by XOD. ADA and XOD are the key enzymes in UA production
(Maiuolo, Oppedisano, Gratteri, Muscoli, & Mollace, 2016). The results
showed that three theaflavins could significantly inhibit the activities of
ADA and XOD that could reduce UA generation.
UA excretion in the kidney is correlated with UA reabsorption and
secretion. Almost 100% UA is filtered from glomeruli. The filtered UA is
reabsorbed and secretion in proximal tubule, approximately 90% is
L. Tai, et al. Journal of Functional Foods 66 (2020) 103803

Fig. 5. I Effects of TF, TFDG and TF-3-G on mRNA expression levels of renal transporters genes. NC, normal control group. MC, model control group. AP, allopurinol
group. A: GLUT9, B: URAT1, C: ABCG2, D: OCTN1, E: OCT1, F: OCT2, G: OAT1, H: OAT2. #P < 0.05, ##P < 0.01 and ###P < 0.001 vs normal control group,
*P < 0.05, **P < 0.01, ***P < 0.001 vs model control group. Ⅱ Effects of TF-3-G on the protein expression levels of renal transporters.

6
L. Tai, et al.
Fig. 6. Histopathology assay of the kidneys (HE, 400×). Note: A: normal control group; B: model control group; C: allopurinol group (5 mg/kg/d); D: TF 20 mg/kg; E:
TF 50 mg/kg; F: TF 100 mg/kg; G: TFDG 20 mg/kg; H: TFDG 50 mg/kg; I: TFDG 100 mg/kg; J: TF-3-G 20 mg/kg; K: TF-3-G 50 mg/kg; L: TF-3-G 100 mg/kg.
reabsorbed into blood and about 10% appears in the urine. The urate
transports of GLUT9 and URAT1 are mostly associated with UA re-
absorption (Auberson et al., 2018; Zhou & Liu, 2015). The ABCG2
transporter (Woodward, 2015) and organic cation/anion transporters
of OCTN1, OCT1/2 (Ishiguro et al., 2005; Jonker, Wagenaar, Van, &
Schinkel, 2003), and OAT1/2 (Otani, Ouchi, Hayashi, Jutabha, & Anzai,
2016) are mainly correlated with UA secretion. The results showed TF
and TFDG groups could up-regulate the mRNA expression levels of
ABCG2 and OAT2 significantly compared to model control group
(P < 0.001). TF, TFDG and TF-3-G groups could up-regulate the mRNA
expression levels of OCTN1, OCT1 and OAT1 notably compared with
model control group (P < 0.01 or P < 0.001). TF (100 mg/kg) and
TF-3-G (20, 50 mg/kg) groups could up-regulate the mRNA expression
level of OCT2 remarkably compared to model group (P < 0.001).
Serum BUN and Cr are important two indicators of renal damages
(Hoffmann et al., 2010). This study found that three theaflavins could
decrease serum BUN and Cr values of hyperuricemic mice and alleviate
the damages of kidney according to the results of histopathology assay
of the kidneys. The data indicated that TF, TFDG and TF-3-G could have
potential application prospects in prevention and therapy of HUA. This
study provides a theoretical basis of further development and research
of black tea resources.
Macrophages can secrete different inflammatory factors, change the
local microenvironment of the kidney and cause glomerular damage
(Tesch, 2017). Theaflavins can significantly reduce the number of
macrophages and protect the kidneys. Nrf2 is a key transcription factor
that regulates the antioxidant response. Nrf2 transfers to the nucleus
can induce the mRNA expression of HO-1, thereby eliminating reactive
7
Journal of Functional Foods 66 (2020) 103803
oxygen radicals and reducing oxidative damage (Tu, Wang, Li, Liu, &
Sha, 2019). Compared with the model control group, TF, TFDG, and TF-
3-G groups could up-regulated the mRNA expressions of Nrf2 and HO-1
notably (P < 0.05, P < 0.01 or P < 0.001). The mechanism of TF,
TF-3-G and TFDG ameliorating the kidney damage might be through
reducing the amount of inflammatory cells and activating Nrf2/HO-1
pathway. Maybe there are other mechanisms in lowering uric acid
which still need to be further explored.
5. Conclusion
TF, TFDG and TF-3-G were isolated and purified from black tea.
Three theaflavins have obvious anti-hyperuricemic effects on hyperur-
icemic mice. They suppressed the activities of ADA and XOD, down-
regulated the genes and proteins expression of GLUT9 and URAT1, up-
regulated the gene and protein expression of OAT1 and the genes ex-
pression of ABCG2, OCTN1, OCT1/2, and OAT2. The kidney tissue
sections showed that three theaflavins could improve the kidney injury
induced by HUA with dosage-dependent. The mechanism of theaflavin
lowering uric acid may be related to reducing the number of in-
flammatory cells and activating the Nrf2 / HO-1 pathway.
Ethics statement
All animal experiments in the study were in obedience to the reg-
ulations and guidelines for the care of laboratory animals. The protocol
was approved by the ethics committee of Anhui Agricultural University.
L. Tai, et al. Journal of Functional Foods 66 (2020) 103803

Fig. 7. I. Immunohistochemical staining

images of the kidneys (IHC, 400 × ). Note:
A: normal control group; B: model control
group; C: allopurinol group (5 mg/kg/d); D:
TF, 20 mg/kg; E: TF, 50 mg/kg; F: TF,
100 mg/kg; G: TFDG, 20 mg/kg; H: TFDG,
50 mg/kg; I: TFDG, 100 mg/kg; J: TF-3-G,
20 mg/kg; K: TF-3-G, 50 mg/kg; L: TF-3-G,
100 mg/kg. The macrophages (F4/80) in the
kidneys are brown, and the nuclear are
stained with hematoxylin. II. Quantification
of the mean area % of F4/80 im-
munostaining area. #Significantly different
from Control group (P < 0.05).
*Significantly different from Model group
(P < 0.05). III. Effects of TF, TFDG and TF-
3-G on mRNA expression levels of renal
transporters genes.NC, normal control
group. MC, model control group. AP, allo-
purinol group. A: Nrf2, B: HO-1.
###P < 0.001 vs normal control group,
*P < 0.05, **P < 0.01, ***P < 0.001 vs
model control group.

CRediT authorship contribution statement Software, Formal analysis. Ying Wang: Data curation. Xu Dong:
Supervision. Yan Xu: Project administration.
Lingling Tai: Conceptualization, Validation. Zenghui Liu:
Validation, Investigation. Minghui Sun: Data curation, Writing - re-
view & editing. Qianjin Xie: Writing - original draft. Xiaqiang Cai:

8
L. Tai, et al.
Declaration of Competing Interest
The authors declare that they have no known competing financial
interests or personal relationships that could have appeared to influ-
ence the work reported in this paper.
Acknowledgements and Funding
The study was financially supported by the Project of Education
Department of Anhui (KJ2017A128), the earmarked fund for China
Agriculture Research System (CARS-19), Chang-Jiang Scholars and the
Innovative Research Team in University (IRT15R01).
References
Acevedo, A., Benavides, J., Chowdhury, M., Lopez, M., Pena, L., Montenegro, A., ...
Lombo, B. (2016). Hyperuricemia and cardiovascular disease in patients with hy-
pertension. Connecticut Medicine, 80(2), 85.
Andrea, F., Lindinger, P. W., Dominik, S., Kratschmar, D. V., Alex, O., Suzette, M., ...
Stephan, K. H. (2014). Hepatocellular toxicity of benzbromarone: Effects on mi-
tochondrial function and structure. Toxicology, 324(10), 136–146.
Auberson, M., Stadelmann, S., Stoudmann, C., Seuwen, K., Koesters, R., Thorens, B., &
Bonny, O. (2018). SLC2A9 (GLUT9) mediates urate reabsorption in the mouse
kidney. Pflügers Archiv - European Journal of Physiology, 470(12), 1739–1751.
Bahorun, T., Luximon-Ramma, A., Neergheen-Bhujun, V. S., Gunness, T. K., Googoolye,
K., Auger, C., ... Aruoma, O. I. (2012). The effect of black tea on risk factors of car-
diovascular disease in a normal population. Preventive Medicine, 54(5), S98–S102.
Changgui, L., Ming-Chia, H., & Shun-Jen, C. (2013). Metabolic syndrome, diabetes, and
hyperuricemia. Current Opinion in Rheumatology, 25(2), 210–216.
Fu, G., Wang, H., Cai, Y., Zhao, H., & Fu, W. (2018). Theaflavin alleviates inflammatory
response and brain injury induced by cerebral hemorrhage via inhibiting the nuclear
transcription factor kappa β-related pathway in rats. Drug Design Development &
Therapy, 12, 1609.
Gianluca, T., Paolo, M., Lorenzo, C., Carmen, F., Serena, P., Monica, S., ... Caputi, A. P.
(2013). Epidemiology of gout and hyperuricaemia in Italy during the years
2005–2009: A nationwide population-based study. Annals of Rheumatic Diseases,
72(5), 694–700.
Hoffmann, D., Fuchs, T. C., Henzler, T., Matheis, K. A., Herget, T., Dekant, W., ... Mally, A.
(2010). Evaluation of a urinary kidney biomarker panel in rat models of acute and
subchronic nephrotoxicity. Toxicology, 277(1), 49–58.
Huadong, C., Kelly, S., Tinchung, L., & Shengmin, S. (2012). Structural identification of
theaflavin trigallate and tetragallate from black tea using liquid chromatography/
electrospray ionization tandem mass spectrometry. Journal of Agricultural & Food
Chemistry, 60(43), 10850–10857.
Ishiguro, N., Saito, A., Yokoyama, K., Morikawa, M., Igarashi, T., & Tamai, I. (2005).
Transport of the dopamine D2 agonist pramipexole by rat organic cation transporters
OCT1 and OCT2 in kidney. Drug Metabolism & Disposition, 33(4), 495–499.
Jonker, J. W., Wagenaar, E., Van, E. S., & Schinkel, A. H. (2003). Deficiency in the organic
cation transporters 1 and 2 (Oct1/Oct2 [Slc22a1/Slc22a2]) in mice abolishes renal
secretion of organic cations. Molecular & Cellular Biology, 23(21), 7902–7908.
Kumar, R., Khalsa, D. D. K., & Carmody, J. B. (2016). Serum uric acid and hyperuricaemia
in US adolescents: 40-year trends. Clinical and Experimental Rheumatology, 34(1),
S22–S23.
Lee, H. Y., Ariyasinghe, J. T., & Thirumoorthy, T. (2008). Allopurinol hypersensitivity
syndrome: A preventable severe cutaneous adverse reaction? Singapore Med J, 49(5),
Journal of Functional Foods 66 (2020) 103803
384–387.
Liu, H., Zhang, X. M., Wang, Y. L., & Liu, B. C. (2014). Prevalence of hyperuricemia
among Chinese adults: A national cross-sectional survey using multistage, stratified
sampling. Journal of Nephrology, 27(6), 653–658.
Mai, O., Oka, T., Ando, T., Arahata, S., Ikegaya, A., Takagi, H., ... Kawamori, F. (2016).
Antiviral effect of theaflavins against caliciviruses. Journal of Antibiotics, 70(4).
Maiuolo, J., Oppedisano, F., Gratteri, S., Muscoli, C., & Mollace, V. (2016). Regulation of
uric acid metabolism and excretion. International Journal of Cardiology, 213, 8–14.
Nakayama, M., Shimatani, K., Ozawa, T., Shigemune, N., Tomiyama, D., Yui, K., ... Ikeda,
K. (2015). Mechanism for the antibacterial action of epigallocatechin gallate (EGCg)
on Bacillus subtilis. Journal of the Agricultural Chemical Society of Japan, 79(5),
845–854.
Naveed, M., Bibi, J., Kamboh, A. A., Suheryani, I., Kakar, I., Fazlani, S. A., ... Kakar, M. U.
(2018). Pharmacological values and therapeutic properties of black tea (Camellia
sinensis): A comprehensive overview. Biomedicine & pharmacotherapy = Biomedecine
& pharmacotherapie, 100(2018), 521.
Noone, D. G., & Marks, S. D. (2013). Hyperuricemia is associated with hypertension,
obesity, and albuminuria in children with chronic kidney disease. Journal of
Pediatrics, 162(1), 128–132.
Otani, N., Ouchi, M., Hayashi, K., Jutabha, P., & Anzai, N. (2016). Roles of organic anion
transporters (OATs) in renal proximal tubules and their localization. Anatomical
Science International, 92(2), 1–7.
Qin, Z., Wang, S., Lin, Y., Zhao, Y., Yang, S., Song, J., ... Du, G. (2018). Antihyperuricemic
effect of mangiferin aglycon derivative J99745 by inhibiting xanthine oxidase ac-
tivity and urate transporter 1 expression in mice. Acta Pharmaceutica Sinica B, 8(2),
306–315.
Ragab, G., Elshahaly, M., & Bardin, T. (2017). Gout: An old disease in new perspective- A
Review. Journal of Advanced Research, 8(5), 495.
Singh, B. N., Prateeksha, Rawat, A. K. S., Bhagat, R. M., & Singh, B. R. (2015). Black tea:
Phytochemicals, cancer chemoprevention, and clinical studies. C R C Critical Reviews
in Food Technology, 57(7), 1394–1410.
Tan, Q., Peng, L., Huang, Y., Huang, W., Bai, W., Shi, L., ... Chen, T. (2019). Structure-
activity relationship analysis on antioxidant and anticancer actions of theaflavins on
human colon cancer cells. Journal of Agricultural and Food Chemistry.
Tanaka, T., Inoue, K., Betsumiya, Y., Mine, C., & Kouno, I. (2001). Two types of oxidative
dimerization of the black tea polyphenol theaflavin. Journal of Agricultural & Food
Chemistry, 49(12), 5785–5789.
Tesch, G. H. (2017). Diabetic nephropathy-is this an immune disorder? Clinical Science,
131(16), 2183–2199.
Tu, W. J., Wang, H., Li, S., Liu, Q., & Sha, H. (2019). The anti-inflammatory and anti-
oxidant mechanisms of the Keap1/Nrf2/ARE signaling pathway in chronic diseases.
Aging and Disease, 10(3), 637–651.
Wang, K., Liu, Z., Huang, J., Bekhit, A. E. D., Liu, F., Dong, X., ... Donghe, F. U. (2011).
The inhibitory effects of pure black tea theaflavins on the growth of four selected
human cancer CELLS. Journal of Food Biochemistry, 35(6), 1561–1567.
Woodward, O. M. (2015). ABCG2: The molecular mechanisms of urate secretion and gout.
American Journal of Physiology - Renal Physiology, 309(6), F485.
Zhang, Y., Jin, L., Liu, J., Wang, W., Yu, H., Li, J., ... Wang, T. (2017). Effect and me-
chanism of dioscin from Dioscorea spongiosa on uric acid excretion in animal model
of hyperuricemia. Journal of Ethnopharmacology, 214, 29.
Zhou, Q., & Liu, S. M. (2015). Advance in treatment of hyperuricemia by Chinese med-
icine based on uric acid transporterome. China Journal of Chinese Materia Medica,
40(22), 4346–4350.
Zhu, C., Tai, L. L., Wan, X. C., Li, D. X., Zhao, Y. Q., & Xu, Y. (2017). Comparative effects
of green and black tea extracts on lowering serum uric acid in hyperuricemic mice.
Pharmaceutical Biology, 55(1), 2123–2128.
Zhu, C., Xu, Y., Liu, Z. H., Wan, X. C., Li, D. X., & Tai, L. L. (2017). The anti-hyperuricemic
effect of epigallocatechin-3-gallate (EGCG) on hyperuricemic mice. Biomedicine &
Pharmacotherapy Biomedecine & Pharmacotherapie, 97, 168.