VIRUS-CELL INTERACTIONS

crossm

Comparative Analysis of African and Asian Lineage-Derived

Zika Virus Strains Reveals Differences in Activation of and
Sensitivity to Antiviral Innate Immunity
Katharina Esser-Nobis,a Lauren D. Aarreberg,a Justin A. Roby,a Marian R. Fairgrieve,a Richard Green,a Michael Gale, Jr.a

a
Center for Innate Immunity and Immune Disease, Department of Immunology, University of Washington School of Medicine, Seattle, Washington, USA

ABSTRACT In recent years, Asian lineage Zika virus (ZIKV) strains emerged to cause
pandemic outbreaks associated with a high rate of congenital ZIKV syndrome
(CZVS). The reasons for the enhanced spread and severe disease caused by newly
emerging strains are not fully understood. Here we compared viral sequences, viral
replication, and innate immune signaling induction of three different ZIKV strains
derived from African and Asian lineages and West Nile virus, another flavivirus. We
found pronounced differences in activation of innate immune signaling and inhibi-
tion of viral replication across ZIKV strains. The newly emerged Asian ZIKV strain Brazil
Fortaleza 2015, which is associated with a higher rate of neurodevelopmental disorders
like microcephaly, induced much weaker and delayed innate immune signaling in in-
fected cells. However, superinfection studies to assess control of innate immune signal-
ing induced by Sendai virus argue against an active block of IRF3 activation by the Bra-
zilian strain of ZIKV and rather suggest an evasion of detection by host cell pattern
recognition receptors. Compared to the Asian strain FSS13025 isolated in Cambodia,
both ZIKV Uganda MR766 and ZIKV Brazil Fortaleza appear less sensitive to the
interferon-induced antiviral response. ZIKV infection studies of cells lacking the different
RIG-I-like receptors identified RIG-I as the major cytosolic pattern recognition receptor for
detection of ZIKV.
IMPORTANCE Zika Virus (ZIKV), discovered in 1947, is divided into African and Asian
lineages. Pandemic outbreaks caused by currently emerging Asian lineage strains are
accompanied by high rates of neurological disorders and exemplify the global
health burden associated with this virus. Here we compared virological and innate
immunological aspects of two ZIKV strains from the Asian lineage, an emerging Bra-
zilian strain and a less-pathogenic Cambodian strain, and the prototypic African lin-
eage ZIKV strain from Uganda. Compared to the replication of other ZIKV strains, the
replication of ZIKV Brazil was less sensitive to the antiviral actions of interferon (IFN), Citation Esser-Nobis K, Aarreberg LD, Roby JA,
while infection with this strain induced weaker and delayed innate immune re- Fairgrieve MR, Green R, Gale M, Jr. 2019.
Comparative analysis of African and Asian
sponses in vitro. Our data suggest that ZIKV Brazil directs a passive strategy of in- lineage-derived Zika virus strains reveals
nate immune evasion that is reminiscent of a stealth virus. Such strain-specific prop- differences in activation of and sensitivity to
erties likely contribute to differential pathogenesis and should be taken into antiviral innate immunity. J Virol 93:e00640-19.
https://doi.org/10.1128/JVI.00640-19.
consideration when choosing virus strains for future molecular studies.
Editor Susana López, Instituto de
Biotecnologia/UNAM
KEYWORDS RIG-I-like receptors, Zika virus, flavivirus, innate immunity Copyright © 2019 American Society for
Microbiology. All Rights Reserved.
Address correspondence to Michael Gale,

Z ika virus (ZIKV) is a positive-sense RNA virus belonging to the Flavivirus genus
within the Flaviviridae family. It was first identified in Africa in 1947 (1). Two
different lineages exist: an African lineage with the prototype strain MR766 isolated in
mgale@uw.edu.
Received 16 April 2019
Accepted 18 April 2019
Accepted manuscript posted online 24
Uganda and an Asian lineage which has caused increasing public health concern due
April 2019
to epidemic outbreaks in Micronesia (2007) and French Polynesia (2013) and which is Published 14 June 2019
now emerging within South and Central America (from 2014 on) (2, 3). ZIKV is

July 2019 Volume 93 Issue 13 e00640-19 Journal of Virology jvi.asm.org 1

Esser-Nobis et al. Journal of Virology

transmitted mainly by Aedes sp. mosquitoes, but during recent outbreaks, sexual and
maternal-to-fetal transmission have also been reported (4, 5). In adult humans, infection
is usually asymptomatic or causes mild febrile illness (3). However, during recent
outbreaks, an increase in neurological diseases has been observed. In particular, Asian
lineage ZIKV has been associated with Guillain-Barré syndrome during the French
Polynesian outbreak, and high case numbers of microcephaly have been reported for
newborns during its spread throughout Brazil in 2015/2016 (3, 6, 7). Thus, African and
Asian lineage ZIKV strains appear to differ in various aspects, with the newly evolved
Asian/American lineage posing an increasing global health concern.
Like other members of the Flaviviridae family, ZIKV induces rearrangements of the
endoplasmic reticulum to establish viral replication sites within the host cell (8). During
flavivirus infection, viral RNA replication occurs via a negative-strand intermediate
produced by the viral RNA-dependent RNA polymerase (RdRp). This replication inter-
mediate forms a double-stranded RNA (dsRNA) complex with the viral genomic RNA
template. Viral RNAs accumulate in the infected cells, including dsRNA and single-
stranded RNA (ssRNA) products (9), and can be detected by host cell pattern recogni-
tion receptors (PRRs) as pathogen-associated molecular patterns (PAMPs). PRRs relevant
to flavivirus infection include Toll-like receptor 3 (TLR3), TLR7 (10–13), and the RIG-I-like
receptors (RLRs), including retinoic acid-inducible gene I (RIG-I) and melanoma
differentiation-associated gene 5 (MDA5) (14, 15). PRR signaling activates downstream
transcription factors, including interferon regulatory factor 3 (IRF3), IRF7, and nuclear
factor kappa B (NF-␬B), to drive innate immune activation and the expression of
antiviral genes, including type I and III interferon (IFN) (9). In particular, during infection
by West Nile virus (WNV), an emerging flavivirus related to ZIKV, TLR signaling has a
minor role in PAMP recognition and innate immune signaling in vitro and in vivo (10,
13). In contrast, RLR signaling by RIG-I and MDA5 is essential for recognition of viral RNA
to trigger innate immune activation from within the infected cell, ultimately driving
systemic protection against infection and disease (14). The RLRs have also been shown
to play a direct and essential role in the recognition of other flaviviruses, including
dengue virus and Japanese encephalitis virus (16, 17). A recent study revealed that RNA
isolated from cells infected with a ZIKV isolate from Brazil could trigger innate immune
activation through RIG-I and the RLR signaling adaptor protein, mitochondrial antiviral-
signaling protein (MAVS) (18). Flaviviruses, including ZIKV, overcome the actions of IFN
induced by PRR signaling by targeting and regulating the Jak-STAT signaling pathway
(19–21). In this context of Jak-STAT regulation, the processes of PRR signaling and IRF
activation impart the major antiviral defense program against flaviviruses and play
essential roles in controlling flavivirus infection and immunity (9).
In the present study, we conducted comparative viral genomic, virologic, and innate
immune activation phenotype analyses of human cell culture infection by African and
Asian lineage ZIKV strains, including the African lineage prototype MR766 (MR766;
ZIKV/Uganda), the Asian lineage strain FSS13025 isolated in Cambodia in 2010
(FSS13025; ZIKV/Cambodia), and the newly emerging Asian lineage strain Brazil For-
taleza 2015 isolated in northeastern Brazil in 2015 (Brazil Fortaleza 2015; ZIKV/Brazil), an
area where the majority of ZIKV-associated microcephaly cases were reported (22). We
reveal differences in viral sequences, viral replication, and innate immune activation
dynamics between ZIKV strains. By viral sequence analysis, ZIKV/Brazil was assigned to
clade Z and identified as a carrier of the NS1 S139N mutation that is linked to
microcephaly (23, 24). We further demonstrate that innate immune signaling induced
by ZIKV infection is dependent upon RIG-I.

RESULTS
Sequence comparison of distinct ZIKV strains suggests different association
with CZVS. We evaluated the properties of three ZIKV strains, including ZIKV/Uganda
(GenBank no. NC_012532), ZIKV/Cambodia (GenBank no. MH368551), and ZIKV/Brazil
(GenBank no. KX811222). To phylogenetically assign these strains, we first subjected
RNA isolated from each virus stock to next-generation deep sequencing analysis. After

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 2

Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

6
A
44

3V
N

A
3-
39

82

14
44
<1

<9

<1
*
C pr M E NS1 2A 2B NS3 4A 4B NS5
2K
ZIKV polyprotein, (*): 4 aa deletion in ZIKV/Uganda: E153-156, (<): specific mutations referred to inside the manuscript

B C
ORF comparison - nucleotides ORF comparison - amino acids

% identity % identity
1 2 3 4 1 2 3 4
% divergence

% divergence
1 98.4 88.7 59.7 1 Brazil (10272 nt) 1 99.5 96.8 57.4 1 Brazil (3423 aa)
2 1.7 88.7 59.5 2 Cambodia (10272 nt) 2 0.5 96.8 57.4 2 Cambodia (3423 aa)
3 12.7 12.6 59.7 3 Uganda (10260 nt) 3 3.3 3.3 57.9 3 Uganda (3419 aa)
4 58.4 58.8 58.4 4 WNV Tx (10302 nt) 4 62.0 62.0 60.9 4 WNV Tx (3433 aa)

D
8

7
ZIKV/Uganda
compared to ZIKV/Brazil

6 ZIKV/Cambodia
% divergent aa

2
1

0
C
prM
M
E
NS1
NS2B
NS3

2K
NS4B
NS5
C
prM
M
E
NS1
NS2B
NS3

2K
NS4B
NS5
NS2A

NS4A

NS2A

NS4A

FIG 1 Sequence comparison of African and Asian lineage ZIKV strains. (A) Schematic of the ZIKV polyprotein. An
asterisk indicates the position of a deletion in ZIKV/Uganda E protein. Arrowheads indicate positions of mutations
referred to in Results. (B and C) After deep sequencing of viral stocks and contig generation, nucleotides from the
open reading frames (ORFs) (B) or amino acid sequences (C) of ZIKV strains and WNV TX were aligned by the Jotun
Hein method using MegAlign software (DNASTAR). The matrix presents percent identity and percent divergence,
as well as nucleotide (B) or amino acid (aa) sequence (C) length. (D) Amino acid sequence comparison of single
proteins of ZIKV/Uganda and ZIKV/Cambodia to ZIKV/Brazil depicted as percent divergence.

contig assembly and sequence alignment, we confirmed the presence of a previously

described deletion within the E glycoprotein coding region of the ZIKV/Uganda E
protein (E153-156, corresponding to positions 443 to 446 in the polyprotein) (Fig. 1A).
This region contains a glycosylation site (E154) that has been reported to correlate with
enhanced in vivo infectivity (25, 26). Furthermore, alignment of the viral polyprotein
open reading frame (ORF) of each strain demonstrated a nucleotide divergence of
12.7% between the sequence of ZIKV/Uganda and those of ZIKV/Cambodia and ZIKV/
Brazil, which translated into a 3.3% amino acid divergence (110 amino acid exchanges
plus 4 deleted residues, ZIKV/Uganda versus ZIKV/Brazil) (Fig. 1B and C) (Table 1), while
amino acid sequences of ZIKV/Cambodia and ZIKV/Brazil demonstrated high identity
(99.5%) and differed in only 18 out of 3,423 residues (Table 2). Eight of these changes
were shared between ZIKV/Cambodia and ZIKV/Uganda (Tables 1 and 2, bold residues).
Alignment of single protein sequences of ZIKV/Cambodia and ZIKV/Uganda with
ZIKV/Brazil revealed that the highest divergence was contained within the prM protein
(Fig. 1D). Overall, nonstructural proteins were better conserved across the ZIKV strains
than the structural proteins, which might primarily impact differences regarding entry,
maturation, and release of virus particles. According to a recently published phyloge-
netic study, we assigned ZIKV/Cambodia to node C based on the emergence of the
T777M substitution in E glycoprotein and ZIKV/Brazil to node G (appearance of 2634V
in NS5 RNA polymerase) (27). Furthermore, mutation 1143V in NS1 identified ZIKV/Brazil
as a member of clade Z within node G, a group which is associated with a high rate
(33%) of congenital ZIKV syndrome (CZVS) (Fig. 1A) (23). ZIKV/Brazil mutation A982V in
NS1 is reported to be associated with enhanced infectivity in Aedes sp. mosquitoes,
possibly contributing to the recent spread of ZIKV (Fig. 1A) (28). In addition, ZIKV/Brazil

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 3

Esser-Nobis et al. Journal of Virology

TABLE 1 Amino acid residues differing between ZIKV/Uganda and ZIKV/Brazila

ZIKV/Uganda compared to
ZIKV/Brazil
According to ZIKV/Brazil single
No. Full ORF Protein proteins
1 S25N Capsid S25N
2 F27L Capsid F27L
3 K101R Capsid K101R
4 V110I Capsid V110I
5 V113I Capsid V113I
6 V125I prM V3I
7 N139S prM N17S
8 E143K prM E23K
9 P148A prM P26A
10 M153V prM M31V

11 Y157H prM Y35H

12 I158V prM I36V
13 A196T prM A74T
14 P231S M P16S
15 R246K M R31K
16 A260V M A45V
17 A262V M A47V
18 A410T E A120T
19 delta443-446 E delta153-156
20 H448Y E H158Y

21 I459V E I169V
22 R573K E R283K
23 S575F E S285F
24 I607V E I317V
25 V631I E V341I
26 A633V E A6343V
27 E683D E E393D
28 A727V E A437V
29 L728F E L438F
30 M763V E M473V

31 M777T E M487T
32 L785M E L495M
33 V815I NS1 V21I
34 D846E NS1 D52E
35 R863K NS1 R69K
36 K940E NS1 K146E
37 K985R NS1 K191R
38 V988A NS1 V194A
39 I1030V NS1 I236V
40 M1058V NS1 M264V

41 H1080Y NS1 H286Y

42 V1143M NS1 V349M
43 I1180M NS2A I34M
44 A1189V NS2A A43V
45 A1204V NS2A A58V
46 I1226V NS2A I80V
47 V1289A NS2A V143A
48 V1290M NS2A V144M
49 T1297A NS2A T151A
50 A1299P NS2A A153P

51 F1326I NS2A F180I

52 L1354V NS2A L208V
53 D1461E NS2B D89E
54 T1477A NS2B T113A
55 S1558A NS3 S56A
56 H1594L NS3 H92L
57 R1671K NS3 R169K
58 T1717K NS3 T215K
59 H1902N NS3 H400N
60 V1909I NS3 V407I
(Continued on next page)

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 4

Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

TABLE 1 (Continued)
ZIKV/Uganda compared to
ZIKV/Brazil
According to ZIKV/Brazil single
No. Full ORF Protein proteins
61 L1974M NS3 L472M
62 D1985G NS3 D483G
63 R2085K NS3 R583K
64 H2086Y NS3 H584Y
65 R2089K NS3 R587K
66 F2123L NS4A F4L
67 S2280N NS4B S11N
68 L2282I NS4B L13I
69 S2283A NS4B S14A
70 I2295M NS4B I26M

71 F2318L NS4B F49L

72 F2360L NS4B F91L
73 I2367M NS4B I98M
74 V2449I NS4B V180I
75 I2453V NS4B I184V
76 S2455L NS4B S186L
77 I2598V NS5 I78V
78 K2621R NS5 K101R
79 V2634M NS5 V114M
80 A2679T NS5 A159T

81 L2715M NS5 L191M

82 Y2722H NS5 Y202H
83 T2749I NS5 T229I
84 V2787A NS5 V267A
85 N2800R NS5 N280R
86 S2807N NS5 S287N
87 F2815L NS5 F295L
88 I2842V NS5 I322V
89 S2896N NS5 S376N
90 M2897I NS5 M377I

91 H2909R NS5 H389R

92 K2958R NS5 K438R
93 Q2969H NS5 Q449H
94 V3039I NS5 V519I
95 S3044N NS5 S524N
96 I3046A NS5 I526A
97 R3050K NS5 R530K
98 R3065K NS5 R545K
99 K3080E NS5 K560E
100 A3084T NS5 A564T

101 I3089V NS5 I569V

102 K3107G NS5 K587G
103 R3161K NS5 R641K
104 S3162P NS5 S642P
105 N3167R NS5 N647R
106 D3223S NS5 D703S
107 H3239Y NS5 H719Y
108 S3304A NS5 S784A
109 V3333M NS5 V813M
110 N3387D NS5 N867D
aNumbers in the 1st column represent the total number of mutations between the two virus strains. Bold
mutations are shared between ZIKV/Uganda and ZIKV/Cambodia.

carries a S139N substitution in prM (Fig. 1A), a mutation which has been reported to
result in higher infectivity of human and mouse neural progenitor cells and more severe
microcephaly in the mouse fetus (24).
Dynamics of viral growth and innate immune activation. To determine how viral
sequence distinctions relate to ZIKV replication and innate immune activation of the
host cell, we examined viral replication and host cell innate immune gene induction in

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 5

Esser-Nobis et al. Journal of Virology

TABLE 2 Amino acid changes between ZIKV/Cambodia and ZIKV/Brazila

ZIKV/Cambodia compared to
ZIKV/Brazil
According to ZIKV/Brazil single
No. Full ORF Protein proteins
1 A106T Capsid A106T
2 A123V prM A1V
3 S130N prM S8N
4 N139S prM N17S
5 L151M prM L29M
6 A196T prM A74T
7 M763V E M473V
8 V982A NS1 V188A
9 K1059E NS1 K265E
10 V1143M NS1 V349M
11 L1274P NS2A L128P
12 T1477A NS2B T113A
13 H2086Y NS3 H584Y
14 R2089K NS3 R587K
15 V2634M NS5 V114M
16 H3375Y NS5 H855Y
17 V3392M NS5 V872M
18 M3403V NS5 M883V
aNumbers in the 1st column represent the total number of mutations between the two virus strains. Bold
mutations are shared between ZIKV/Cambodia and ZIKV/Uganda.

immunocompetent A549 human epithelial cells. As a first step, we infected A549 cells
with viral titers derived from plaque assays performed with Vero cells, which lack type
I IFN production and are a standard cell line to measure viral titers for Flaviviridae.
However, immunofluorescent staining for dsRNA, used as a marker for infected cells,
demonstrated significant variation in infection efficiency of A549 cells, with ZIKV/Brazil
infecting at the lowest efficiency (Fig. 2A and B). To allow more consistent infection of
A549 cells across the different viral strains, we measured the titers of viral stocks by
focus-forming unit (FFU) assays of infection in A549 cells and in Vero cells. This
comparison established a titration analysis of each virus in the two cell lines and
allowed us to define infection efficiency in each cell line across viral strains. We found
that ZIKV/Brazil indeed infected A549 cells with lower efficiency than Vero cells (Fig. 2C).
Twenty-four hours after ZIKV challenge (multiplicity of infection [MOI] ⫽ 1, based on
viral titers derived from an FFU assay performed with A549 cells), we examined
infection rates of A549 cells (Fig. 2D and E). We found that ZIKV/Uganda and ZIKV/Brazil
display significant differences in infection rates (mean infection rates as follows: ZIKV/
Uganda, 85.6%; ZIKV/Brazil, 59.0%; ZIKV/Cambodia, 71.9%) but with a minor difference
in comparison to infection of cells using an MOI based on Vero cell-derived viral titers
(mean infection rates as follows: ZIKV/Uganda, 80.0%; ZIKV/Brazil, 29.9%; ZIKV/Cambo-
dia, 49.4%) (compare Fig. 2B and E). Next, we conducted one-step growth analyses of
each viral strain in A549 cells. As a comparison, we also included analyses of West Nile
virus (WNV) TX-02 (termed TX), a North American emerging flavivirus, and Sendai virus
(SeV), a member of the Paramyxoviridae family (29). While production of viral RNA
(intracellular) and infectious virus (extracellular) by ZIKV/Cambodia peaked by 24 h,
virus production by ZIKV/Uganda peaked at 48 h and ZIKV/Brazil increased virus
production up to the 72-h time point (Fig. 2F and G). One striking difference between
the strains was the significant drop in viral RNA and infectious virus particle production
for ZIKV/Cambodia after 24 h of infection (Fig. 2F and G). This observation was con-
firmed by examining ZIKV NS5 protein abundance over the infection time course (Fig.
2H). Thus, the ZIKV strains phenotypically differ in their viral replication properties in
our epithelial cell infection model, with ZIKV/Uganda and ZIKV/Brazil exhibiting a
higher replication fitness than that of ZIKV/Cambodia.
As a readout for innate immune activation in A549 cells, immunoblot analyses were
conducted to evaluate IRF3 activation as indicated by serine 386 and serine 396
phosphorylation (IRF3 S386, IRF3 S396). ZIKV/Uganda and ZIKV/Cambodia induced IRF3

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 6

Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

A A549, MOI=5, 24h, plaque assay titers from Vero B *

100 **
Mock Uganda Brazil Cambodia

% infection efficiency
dsRNA
DAPI 75
ns
dsRNA

50

25

0
Uganda Brazil Cambodia
C Uganda D
9 Brazil A549, MOI=1, 24h, FFU assay titers from A549
FFU/ml (log10)

Cambodia Mock Uganda Brazil Cambodia WNV

8 WNV
7
Merge

5
ro

Ve 9
ro
49
ro
49
ro
49
4
Ve

Ve

Ve
A5

A5

A5

A5

E
% infected cells (NS4B positiv)

ns
120
NS4B

**
100 ns

80
60
40
20
dsRNA

0
a

il

V
az
nd

di

N
bo

W
Br
ga

am
U

F G
Viral RNA mean fold change

Uganda Cambodia Uganda Cambodia

4 Brazil WNV 8 Brazil WNV
FFU/ml (log10)

SeV 7
3
h p.i. 24 48 72 6 h p.i. 24 48 72
2 ns Uganda vs.
Uganda vs. 5
Cambodia p=0.95 *** *** Cambodia *** **** **
1 Brazil vs. ns ns Brazil vs. ns
* 4 Cambodia p=0.76
**** ****
Cambodia p=0.08 p=0.07
0 Uganda vs. ns ns ns 3 Uganda vs. ns ns
Brazil p=0.13 p=0.22 p=0.15 Brazil *** p=0.20 p=0.10
-1 2
6 24 48 72 h p.i. 6 24 48 72 h p.i.

H Mock Uganda Brazil Cambodia I Mock WNV SeV

6 24 48 72 6 24 48 72 6 24 48 72 6 24 48 72 6 24 48 72 6 24 48 72 6 24 48 72
IRF3 S386 IRF3 S386
IRF3 IRF3
IFIT1 IFIT1
MxA MxA
ZIKV NS5 WNV NS3
SeV
Actin
Actin
J Mock Cambodia
IFNb mRNA rel to Rpl13a

IFIT1 mRNA rel to Rpl13a

1 Uganda WNV Mock Cambodia

1
Brazil SeV Uganda WNV
0 0 Brazil SeV
-1 h p.i. 24 48 72 h p.i. 24 48 72
-1
-2 Uganda vs. ns ns Uganda vs. ns ns
Cambodia p>0.99 *** p=0.52 Cambodia *** p=0.10 p=0.99
-3 Brazil vs. ns ns -2 Brazil vs. ns ns
Cambodia **** p=0.97 p=0.99 Cambodia ** p=0.83 p=0.83
-4 Uganda vs. ns -3 Uganda vs. ns ns ns
Brazil **** *** p=0.36 Brazil p=0.92 p=0.42 p=0.79
-5 -4
6 24 48 72 h p.i. 6 24 48 72 h p.i.

FIG 2 Growth kinetics and innate immune activation of African and Asian lineage ZIKV strains in A549 cells. (A and B) Infection efficiency of ZIKV
strains in A549 cells. MOIs were calculated with viral titers derived from plaque assays performed with Vero cells. After infection of A549 cells with
(Continued on next page)

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 7

Esser-Nobis et al. Journal of Virology

phosphorylation/activation by 24 h, while IRF3 activation appeared delayed and re-

mained weak over the whole time course in cells infected with ZIKV/Brazil (Fig. 2H). This
observation was surprising to us considering the consistently high viral RNA, virus
particle, and viral protein levels produced in cells infected with ZIKV/Brazil. In contrast,
infection with ZIKV/Uganda demonstrated viral RNA, virus particle, and viral protein
levels comparable to those of ZIKV/Brazil but induced strong IRF3 activation at 24, 48,
and 72 h of infection (Fig. 2F to H). This delay and overall weak induction of IRF3
phosphorylation by ZIKV/Brazil, despite ongoing viral replication and presence of viral
PAMPs, could point to an evasion of IRF3 activation by this ZIKV strain. With ZIKV/
Cambodia, a strong decrease of the IRF3 S386 signal coincided with a drop in viral RNA,
virus particle, and NS5 protein levels, suggesting an inhibition of ZIKV/Cambodia
replication by the induced immune response and a rapid resolution of IRF3 signaling
(Fig. 2F to H). Similarly, WNV infection induced strong IRF3 phosphorylation at 24 h that
resolved over 48 and 72 h with a drop in virus replication (Fig. 2F, G, and I). In
comparison, SeV, a model virus for innate immune activation, induced early and brief
IRF3 activation in A549 cells, which mostly resolved at 48 h after infection (Fig. 2I). In
line with this observation, the strong IRF3 activation induced by ZIKV/Uganda, ZIKV/
Cambodia, WNV, and SeV but not ZIKV/Brazil infection was followed by a reduction in
total IRF3 over time (Fig. 2H and I).
To determine how each ZIKV strain engages the host cell to trigger innate immune
activation and antiviral defenses, we assessed the expression of IFIT1 and IFN-␤ mRNA
as well as IFIT1 and MxA protein (Fig. 2H to J). Expression of both IFN-␤ and IFIT1 is
induced in large part by activated IRF3, while IFIT1 and MxA are induced by IFN-␤ or
IFN-␣ as interferon-stimulated genes (ISGs) via activation of the transcription factor
interferon-stimulated gene factor 3 (ISGF3) (30). Protein expression of IFIT1 (IRF3 and
ISGF3 induced) and MxA (ISGF3 induced) and transcript level of IFN-␤ (IRF3 induced)
and IFIT1 were strongly increased 24 h after ZIKV/Cambodia infection, concomitant with
reduced viral protein abundance (Fig. 2H and J). In line with the weak and delayed IRF3
activation after ZIKV/Brazil infection, induction of the IFN-␤ transcript level remained
weak over the whole time course, and despite a stronger induction of the IFIT1
transcript level at 24 h, the ISG protein level increased only at 48 h of ZIKV/Brazil

FIG 2 Legend (Continued)

an MOI of 5 for 24 h, samples were analyzed by immunofluorescent staining for dsRNA. Per condition, three randomly selected fields of view
representing at least 300 cells were analyzed. Images were acquired on a Nikon Eclipse Ti confocal microscope and manually analyzed in ImageJ using
the multipoint tool. The number of dsRNA-positive cells was normalized to the total number of cells as determined by DAPI staining of nuclei and
is presented as the percentage of infection efficiency. Depicted are means and standard deviations (SD) of the results of two independent
experiments (n ⫽ 2). Statistical analysis was performed with a one-way analysis of variance (ANOVA), followed by Tukey’s range test. ns, not significant;
*, P ⬍ 0.05; **, P ⬍ 0.01. (C) Focus-forming unit (FFU) assay performed with Vero and A549 cells to obtain viral titers for ZIKV and WNV stocks for both
cell lines. Data are derived from two FFU assays performed independently and are presented as the means with SD on a log scale. (D and E) Infection
efficiency of ZIKV strains and WNV TX in A549 cells after calculating the MOI with viral titers derived from an FFU assay performed with A549 cells
(shown in panel C). At 24 h after virus challenge, infection rates were analyzed by immunofluorescent staining for viral protein NS4B and dsRNA. Per
condition, at least five randomly selected fields of view representing at least 230 cells in total were analyzed. Images were acquired on a Nikon Eclipse
Ti confocal microscope and manually analyzed in ImageJ using the multipoint tool. The number of NS4B-positive cells was normalized to the total
number of cells as determined by DAPI staining of nuclei and is presented as the percentage of infection efficiency in panel E. Data are derived from
two independent experiments and were tested for statistical significance by one-way ANOVA, followed by Tukey’s range test. ns, not significant; **,
P ⬍ 0.01. (F to J) A549 cells were infected with SeV (40 hemagglutination units [HAU]/ml) or ZIKV or WNV (both at an MOI of 1) based on viral titers
derived from an FFU assay of A549 cells. Cell lysates and culture supernatants were collected after 6, 24, 48, and 72 h to determine intracellular viral
RNA, viral particles in the supernatant, and viral protein and for analysis of the innate immune response. Three independent experiments were
performed (n ⫽ 3). (F) Analysis of ZIKV, WNV, and SeV RNA by SYBR green qPCR using virus-specific primer pairs and normalized to RPL13a
housekeeping gene expression. Shown are the mean fold changes over the value at 6 h and SD calculated from three independent experiments
performed in triplicate and presented on a log scale (log10). A two-way ANOVA followed by Tukey’s range test was used to test for statistical
significance. ns, not significant; *, P ⬍ 0.05; **, P ⬍ 0.01; ***, P ⬍ 0.001. p.i., postinfection. (G) Viral titers in supernatants were measured by an FFU assay
performed on Vero cells. Presented are means and SD calculated from three independent experiments on a log scale. A two-way ANOVA followed
by Tukey’s range test was used to test for significance. ns, not significant; **, P ⬍ 0.01; ***, P ⬍ 0.001; ****, P ⬍ 0.0001. (H and I) Western blot analysis
of cell lysates collected at the indicated time points after infection. Viral protein levels were measured using antibodies specific for ZIKV NS5, WNV
NS3, or parainfluenza virus (SeV). The innate immune response was analyzed with antibodies targeting IRF3 phosphorylated at serine 386 (IRF3 S386),
total IRF3 (IRF3), and the ISGs IFIT1 and MxA. The actin level served as a loading control. Depicted is one representative Western blot of three
independent experiments. (J) IFN-␤ and IFIT1 mRNA expression analyzed by SYBR green qPCR and normalized to RPL13a housekeeping gene
expression using the total RNA harvested from infection experiments described above. Presented are means and SDs of the results of three
independent experiments performed in triplicate and depicted on a log scale. A two-way ANOVA followed by Tukey’s range test was used to test
for statistical significance. ns, not significant; **, P ⬍ 0.01; ***, P ⬍ 0.001; ****, P ⬍ 0.0001.

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 8

Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

infection and did not result in reduced viral replication (Fig. 2H and J). ZIKV/Uganda
infection induced rapid IFN-␤ and IFIT1 mRNA expression; however, this did not
translate into strong IFIT1 or MxA protein expression, which is likely due to the overall
higher infection efficiency and inhibition of Jak-STAT signaling in infected cells (Fig. 2D,
E, H, and J). In comparison, analysis of WNV infection demonstrated viral replication and
innate immune activation kinetics similar to that of ZIKV/Uganda, resulting in strong
induction of ISG expression within 24 h after virus challenge. As a control, SeV infection
induced a much faster innate immune response, with the highest IFN-␤ and IFIT1 mRNA
expression at 6 h postinfection, the earliest time point measured, showing that our
A549 cell model exhibits robust innate immune signaling programs. In summary, our
analyses of virus replication and activation of innate immune signaling reveal striking
differences between ZIKV strains, with a much weaker and delayed induction of innate
immune activation by ZIKV/Brazil.
Differential IRF3 activation kinetics and IFN sensitivity of ZIKV strains. To
determine if the observed delayed and overall weak IRF3 activation induced by
ZIKV/Brazil was derived from its slightly lower infection efficiency (ZIKV/Uganda, 85.6%;
ZIKV/Brazil, 59.0%; ZIKV/Cambodia, 71.9%) (Fig. 2D and E) or an inherent feature of the
infection model, we used immunofluorescence analysis to simultaneously detect IRF3
nuclear translocation and dsRNA products of viral replication in A549 cells (Fig. 3A).
Nuclear translocation of IRF3 was observed in more than 60% of cells containing dsRNA,
a marker of viral replication, after 24 h of infection with ZIKV/Uganda or ZIKV/Cambo-
dia, and in more than 95% of cells for SeV infection (all cells were considered SeV
infected as demonstrated by anti-parainfluenza virus staining) (Fig. 3A and B). However,
the majority of cells in cultures infected with ZIKV/Brazil did not contain activated/
nuclear IRF3 at 24 h despite the presence of the viral dsRNA PAMP (Fig. 3A, top row; Fig.
3B). By 48 h of infection, 51% of ZIKV/Brazil dsRNA-positive cells had detectable nuclear
IRF3 in comparison to 83% for ZIKV/Uganda, 80% for ZIKV/Cambodia, and 81% for WNV
(Fig. 3A, row 2 and boxed areas; Fig. 3B). Thus, in comparison to two other ZIKV strains,
ZIKV/Brazil displays significantly reduced IRF3 activation, despite the presence of dsRNA
PAMP within infected cells.
To determine if ZIKV/Brazil imparts a blockade to antagonize IRF3 activation during
infection, we assessed its ability to block SeV-induced IRF3 activation in a superinfec-
tion model. In this approach, the cells are first infected with ZIKV/Brazil, followed by
superinfection with SeV 7 h after ZIKV/Brazil challenge. Immunofluorescent analysis
clearly showed that ZIKV/Brazil virus replication did not block nuclear translocation of
IRF3 induced by SeV (Fig. 3C and D). As observed before, ZIKV/Brazil infection alone
triggered IRF3 activation in only a small number of infected, dsRNA-positive cells (9%),
and IFIT1 protein expression occurred primarily in uninfected bystander cells, likely
through paracrine signaling by IFN produced from infected cells (Fig. 3C and D).
However, infection with SeV alone and superinfection with SeV resulted in IRF3 nuclear
translocation in a majority of cells (91% and 87%, respectively) (Fig. 3C and D).
Therefore, it was unlikely that the weak and delayed induction of IRF3 activation upon
ZIKV/Brazil infection was caused by an early active blockade of IRF3 activation by this
ZIKV strain.
The observed levels of viral RNA, protein, and infectious particles generated across
ZIKV strains in our infection experiments of A549 cells (Fig. 2F to H) suggest that
ZIKV/Cambodia replication is suppressed by innate immune actions of the host cell. We
therefore conducted analyses of IFN sensitivity across the different ZIKV strains. As a cell
model for analysis of viral sensitivity to IFN, we chose Vero cells, because they are
deficient in IFN production but retain an intact response to IFN (31). These properties
of Vero cells prevent potential experimental bias that might otherwise occur when cells
produce IFN in response to virus infection. Therefore, Vero cells were pretreated with
IFN-␤ for 4 h (for assessment of viral protein) (Fig. 3E) or 1 h (for assessment of viral RNA
levels) (Fig. 3F). Analysis of viral protein and RNA levels revealed that ZIKV/Cambodia is
more sensitive to inhibition of viral replication by IFN, with reduced viral protein and

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 9

Esser-Nobis et al. Journal of Virology

A A549, MOI 5
Mock Uganda Brazil Cambodia WNV SeV

66
24h

IRF3 dsRNA
3 5 α-parainfluenza
4
48h

1 2

1 2 3 4 5 6
Insets

48h 48h 48h 48h 48h 24h

B ns, p>0.99 C A549, MOI 1, 24h
Insets Insets
ns, p>0.99
ns, p=0.34 1 3

Brazil + SeV
120 ***
1 3
Mock
% nuclear IRF3+ cells/

****
100 ***
dsRNA+ cells

80 ****

60 IRF3 IFIT1 dsRNA

40 2 4
20 2 4
Brazil

SeV

0
24 48 24 48 24 48 24 48 24 h p.i.
a

il

ll V
)
az
nd

di

lls
N

(a Se
bo

W
Br

ce
ga

am
U

D E Mock Uganda Brazil Cambodia

****
120 ns, p=0.55 IFN-b
24 +
72 +

24 +
48 +
72 +

24 +
48 +
72 +

24 +
48 +
72 +
% nuclear IRF3+ cells/

****
24
72

24
48
72

24
48
72

24
48
72

100
dsRNA+ cells

80 ZIKV NS5
60
MxA
40
20 Actin
0
-20
Brazil Brazil SeV
SeV (all cells)
Mock Brazil
F ns, p=0.20
G Uganda Cambodia
200 0
rel. to Rpl13a (log10)

ns, p=0.52 Untreated IFN-b pre-treated

IFITM1 mRNA
% untreated

150 Uganda
ZIKV RNA

ns, p=0.78 -1
Brazil
100
Cambodia
-2
50

0 -3
3
7
24
48
3
7
24
48
3
7
24
48
3
7
24
48
3
7
24
48
3
7
24
48
3
7
24
48
3
7
24
48

3 7 24 48 3 7 24 48 3 7 24 48
h p.i. h p.i.

FIG 3 ZIKV-induced IRF3 activation and type I IFN sensitivity. (A) Immunofluorescence analysis of IRF3 activation in A549 cells after
infection with ZIKV (MOI ⫽ 5), WNV TX (MOI ⫽ 5), or SeV (20 HAU/ml). At 24 or 48 h postinfection (p.i.), cells were fixed and analyzed with
antibodies targeting IRF3 and dsRNA or parainfluenza virus to control for SeV infection. The bottom row shows enlarged images of the
boxed areas (insets: 48 h for ZIKV and WNV, 24 h for SeV). (B) Quantification of immunofluorescence shown in panel A. dsRNA/nuclear IRF3
double-positive cells were counted for 150 to 300 dsRNA-positive cells per condition and expressed as a percentage of double-positive
cells. The graph depicts the means and SD of the results of three independent experiments (n ⫽ 3), with one data point representing one
analyzed field of view. For SeV, cells with nuclear IRF3 were counted and compared to the total cell number, since at 20 HAU/ml, the
infection efficiency was ⬃100% as determined by anti-parainfluenza virus staining. Statistical analysis was performed with one-way
ANOVA, followed by Tukey’s range test. ns, not significant; ***, P ⬍ 0.001; ****, P ⬍ 0.0001. (C) A549 cells were infected with ZIKV/Brazil
(MOI ⫽ 1), and at 7 h p.i., cells were superinfected with SeV (20 HAU/ml) for 17 h. After 24 h of infection with ZIKV/Brazil, cells were fixed
(Continued on next page)
July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 10
Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

RNA levels in infected cells pretreated with IFN (Fig. 3E and F). In contrast, ZIKV/Uganda
and ZIKV/Brazil protein and viral RNA levels remained relatively stable over 72 h of
treatment during Vero cell infection and were comparable to levels in untreated cells
(Fig. 3E and F). ISG induction levels by IFN-␤ pretreatment were comparable across
infection groups (Fig. 3G). All together, these results point to a higher sensitivity of
ZIKV/Cambodia to the antiviral actions of IFN-␤.
RIG-I plays a major role for induction of antiviral innate immunity during ZIKV
infection. To evaluate the contribution of RLRs in detecting ZIKV infection and trig-
gering innate immune activation, stable knockout lines of A549 cells independently
lacking RIG-I, MDA5, or LGP2 were produced and analyzed. For controls, we generated
A549 cell lines lacking MAVS (positive control; MAVS knockdown [KD]) or expressing
nontargeting guide RNA (negative control; gNT). Knockout (KO) or KD efficiencies of
RLR and MAVS proteins were analyzed by Western blotting after stimulating the cells
with IFN-␤ and tumor necrosis factor alpha (TNF-␣) to induce RLR expression (Fig. 4A).
RIG-I, MDA5, and LGP2 proteins could not be detected in the respective knockout cell
lines even after stimulation. However, a longer exposure revealed residual amounts of
MAVS protein in control cells so that only a reduction of innate immune signaling could
be expected for this MAVS KD cell line. IFIT1 was induced in response to IFN-␤/TNF-␣
treatment, demonstrating that each cell line responds to stimulation with these cyto-
kines (Fig. 4A). Analysis of innate immune activation after infection with ZIKV/Cambodia
or WNV revealed strong IRF3 activation and ISG induction in the absence of MDA5 or
LGP2, with each response being comparable to that of control cells (gNT) (Fig. 4B, C, E,
and F). In contrast, in RIG-I KO cells, IRF3 activation, as well as IFIT1 and MxA protein
expression, was strongly reduced, similar to that in MAVS KD cells (Fig. 4B). By 48 h of
infection, the ZIKV/Cambodia NS5 protein level was found to be reduced in all cell lines
except RIG-I KO and MAVS KD cells (Fig. 4B). We also measured IFIT1 and IFN-␤ mRNA
expression over the infection time course in the knockout cells and observed a trend
toward reduced IFIT1 mRNA and significantly reduced IFN-␤ mRNA expression in RIG-I
KO cells upon 24 h of ZIKV infection, which indicated a dominant role of RIG-I for innate
immune signaling during ZIKV infection in A549 epithelial cells at the investigated time
points (Fig. 4C). Interestingly, 24 and 48 h after infection with ZIKV, a slight induction
of ISG proteins and IFIT1 and IFN-␤ mRNA could be detected in RIG-I KO cells (Fig. 4B
and C), which might be due to induction of innate immune signaling by MDA5 or TLR3
in these cells. These findings are in line with previous reports on MDA5-dependent late
induction of innate immune signaling in response to infection with members of the
Flaviviridae family (14, 18, 32). In line with this strong reduction in antiviral immune
responses in the absence of RIG-I, 48 h after infection, ZIKV RNA level and virus particle
production were significantly enhanced in RIG-I KO cells (Fig. 4D). Similarly, upon
challenge with WNV, IRF3 activation and ISG protein expression were strongly reduced
in cells lacking RIG-I (Fig. 4E). In addition, RIG-I KO cells demonstrated a significant
reduction in IFIT1 mRNA expression and trended toward reduced IFN-␤ transcript levels
24 and 48 h after infection (Fig. 4F). As observed for ZIKV/Cambodia challenge, IFIT1 and
IFN-␤ mRNA were induced at 24 and 48 h after WNV infection in RIG-I KO cells, though

FIG 3 Legend (Continued)

for immunofluorescent staining with antibodies targeting dsRNA to detect ZIKV-infected cells, IRF3, or IFIT1. The right columns show
enlarged images of the boxed areas (insets). (D) Quantification of immunofluorescence shown in panel C. dsRNA/nuclear IRF3
double-positive cells were counted for 200 to 270 cells per condition and expressed as a percentage of double-positive cells. The graph
depicts the means and SD of the results of two independent experiments (n ⫽ 2), with one data point representing one analyzed field
of view. A one-way ANOVA analysis followed by Tukey’s range test was used to test for statistical significance. ns, not significant; ****,
P ⬍ 0.0001. (E) Type I IFN sensitivity of ZIKV strains in Vero cells. Vero cells were treated with IFN-␤ (500 IU/ml) for 4 h, followed by infection
with the indicated ZIKV strains (MOI ⫽ 5). Cells were harvested at the indicated time points, and lysates were analyzed by Western
blotting. One representative Western blot of three independent experiments is shown. (F and G) ZIKV RNA and IFITM1 mRNA expression
measured by qPCR analysis of experiments performed analogous to those described for panel E, with 1 h of IFN-␤ pretreatment before
ZIKV infection. Values for ZIKV RNA were normalized to those of the RLP13a housekeeping gene and the respective untreated control.
IFITM1 transcript levels were normalized to those of the RLP13a housekeeping gene and are presented on a log scale. Depicted are the
means and SD of the results from three independent experiments (n ⫽ 3). Statistical analysis was performed with a two-way ANOVA
followed by Tukey’s range test. ns, not significant.

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 11

Esser-Nobis et al. Journal of Virology

A E WNV Tx
- + - + - + - + - + IFN-b/TNF-a gNT RIG-I KO MDA5 KO LGP2 KO MAVS KD

MAVS KD
MAVS KD
MDA5 KO
MDA5 KO
LGP2 KO
LGP2 KO
RIG-I KO
RIG-I KO

Mock

Mock

Mock

Mock

Mock
h.p.i.

10
24
48

10
24
48

10
24
48

10
24
48

10
24
48
gNT
gNT

IRF3 Ser396
RIG-I
IRF3
MDA5
IFIT1
LGP2 MxA
MAVS
WNV NS3
MAVS* Actin
IFIT1
IRF3
F

IFN-b mRNA rel. to GAPDH (log10) IFIT1 mRNA rel. to GAPDH (log10)
Actin gNT WNV Tx
4 gRIG-I
B ZIKV/Cambodia 3
gMDA5
gNT RIG-I KO MDA5 KO LGP2 KO MAVS KD
gLGP2
2 gMAVS gNT vs ns
*
ns
gRIG-I p>0.99 p=0.35
Mock

Mock

Mock

Mock

Mock

h.p.i. 1 gNT vs ns ns ns
10
24
48

10
24
48

10
24
48

10
24
48

10
24
48

gMDA5 p>0.99 p>0.99 p>0.99

IRF3 Ser396 0 gNT vs ns ns ns
gMAVS p>0.99 p=0.19 p>0.99
IRF3 -1
0 10 24 48 h p.i.
IFIT1
IFIT1*
MxA
ZIKV NS5
gNT WNV Tx
Actin 5 gRIG-I
4 gMDA5
C 3 gLGP2
2 gMAVS ns ns
IFIT1 mRNA rel. to GAPDH (log10)

IFN-b mRNA rel. to GAPDH (log10)

gNT vs ns
1 gRIG-I p>0.99 p=0.11 p>0.99
gNT ZIKV/Cambodia gNT ZIKV/Cambodia 0 gNT vs ns ns ns
gMDA5 p>0.99 p>0.99 p>0.99
4 gRIG-I 3 gRIG-I -1 gNT vs ns ns ns
gMDA5 gMDA5 -2 gMAVS p>0.99 p=0.63 p>0.99
3 2
gLGP2 gLGP2 -3
1 0 10 24 48 h p.i.
2 gMAVS gMAVS
0
1
-1
0 -2
G
WNV RNA rel. to GAPDH (log10)

-1 -3
0 10 24 48 h p.i. 0 10 24 48 h p.i. gNT WNV Tx
8
gNT vs ns ns ns gNT vs ns
**
ns gRIG-I
gRIG-I p>0.99 p=0.07 p>0.99 gRIG-I p>0.99 p>0.99
7 gMDA5
gNT vs ns ns ns gNT vs ns ns ns
gMDA5 p>0.99 p>0.99 p>0.99 gMDA5 p>0.99 p>0.99 p>0.99 gLGP2 h p.i. 24 48
6 gNT vs ns ns
gNT vs ns ns ns gNT vs ns ns ns gMAVS
gMAVS p>0.99 p=0.39 p>0.99 gRIG-I p>0.99 p=0.07
gMAVS p>0.99 p>0.99 p>0.99 5 gNT vs ns ns
gMDA5 p>0.99 p>0.99
D 4 gNT vs ns ns
ZIKV RNA rel. to GAPDH (log10)

gMAVS p>0.99 p=0.15

gNT ZIKV/Cambodia ZIKV/Cambodia 3
10 24 48 h p.i.
ZIKV PFU/ml (log10)

6 gRIG-I 7
gMDA5
5
gLGP2
6 gNT
4 gMAVS
gRIG-I gNT WNV Tx
10
WNV PFU/ml (log10)

3 gMDA5 gRIG-I
5
2 gLGP2 gMDA5
9
gMAVS gLGP2 h p.i. 24 48
1 4 gMAVS
gNT vs ns ns
10 24 48 h p.i. 10 24 48 h p.i. 8 gRIG-I p>0.99 p=0.75
ns gNT vs ns ns
gNT vs gNT vs ns gMDA5 p>0.99 p>0.99
gRIG-I p>0.99 ** gRIG-I p>0.99 ** 7 gNT vs ns ns
gNT vs ns ns gNT vs ns ns gMAVS p>0.99 p=0.97
gMDA5 p>0.99 p>0.99 gMDA5 p=0.82 p>0.99
gNT vs ns ns gNT vs ns ns 6
gMAVS p>0.99 p=0.10 gMAVS p=0.60 p=0.08 10 24 48 h p.i.

FIG 4 RLR dependence of innate immune signaling during ZIKV and WNV infection of A549 cells. (A) A549 cells with single RLR knockout (KO) or MAVS
knockdown (KD) were generated by CRISPR Cas9 and analyzed for RLR, MAVS, and ISG protein level upon stimulation with IFN-␤ (100 IU/ml) and
TNF-␣ (50 ng/ml) for 24 h. An asterisk indicates prolonged exposure. (B) A549 RLR KO and MAVS KD cells were infected with ZIKV/Cambodia (MOI ⫽ 5).
At the indicated time points, cell lysates were generated and analyzed by Western blotting for IRF3 activation (IRF3 S396), ISG induction, and ZIKV
(Continued on next page)
July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 12
Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

this did not result in the detectable production of IFIT1 or MxA protein (Fig. 4E and F).
As with ZIKV/Cambodia, the weaker immune response in RIG-I KO cells translated into
a trend toward higher WNV RNA and virus particle level (Fig. 4G). In nontargeting
control cells, as well as MDA5 and LGP2 KO cells, viral RNA and infectious virus particles
plateaued or dropped after 24 h of infection (Fig. 4D and G). In contrast, RIG-I KO and
MAVS KD cells supported ongoing viral replication even beyond 24 h of infection for
both flaviviruses, underlining the importance of RIG-I and IRF3 activation for restriction
of ZIKV and WNV replication (Fig. 4D and G).

DISCUSSION
We compared viral sequences, viral replication, and antiviral innate immunity for
three ZIKV strains derived from African and Asian lineages. We provide evidence for a
much weaker and delayed activation of innate immune signaling by ZIKV/Brazil, a strain
with a high association with CZVS. In comparison to ZIKV/Uganda and ZIKV/Brazil, viral
replication of ZIKV/Cambodia, an Asian strain with less severe pathological outcomes
(33), demonstrates a higher sensitivity to the antiviral action of IFN-␤. Finally, we
identify RIG-I as a major PRR at early time points after ZIKV infection.
The observed reduction and delay in IRF3 activation by the more virulent ZIKV strain
ZIKV/Brazil are reminiscent of observations made for pathogenic WNV strains, which
were reported to delay IRF3 activation by evasion of detection by the host cell early
after infection (34, 35). Similarly, evasion of detection by PRRs might also be a strategy
employed by ZIKV/Brazil to reduce and delay IRF3 activation, since our data gained
from SeV superinfection experiments argue against a direct and active block of IRF3
activation by this virus. A potential reason for the reduction and delay in IRF3 activation
during ZIKV/Brazil infection could be the smaller amounts of viral PAMPs, although
levels of released infectious viral particles or viral RNA during viral growth experiments
were not reduced for ZIKV/Brazil, arguing against this notion. Another potential mech-
anism for the delay in IRF3 activation could be protection of ZIKV/Brazil PAMPs from
detection by RIG-I or other PRRs within the viral replication compartment, as has been
shown for hepatitis C virus (HCV) (36). Apart from delayed activation of IRF3, ZIKV/Brazil
trended toward enhanced resistance to type I IFN antiviral actions in comparison to
ZIKV/Cambodia, indicated by more consistent viral RNA and NS5 protein levels upon
IFN treatment, suggesting that evasion of IFN actions might possibly contribute to the
higher virulence of this virus strain. The difference in IFN sensitivity between ZIKV/Brazil
and ZIKV/Cambodia is unlikely to be due to differences in viral replication fitness,
something that has previously been described for IFN-resistant and IFN-sensitive WNV
strains (29), since these virus strains demonstrate comparable replication kinetics up to
24 h postinfection. Also, a more efficient block of Jak-STAT signaling by ZIKV/Brazil is
unlikely as an underlying mechanism, since equal amounts of the ISGs IFIT1 and MxA
were induced by IFN-␤ treatment under the different infection conditions. An interest-

FIG 4 Legend (Continued)

NS5 protein level. Depicted is one representative blot of three independent experiments (n ⫽ 3). An asterisk indicates prolonged exposure. (C) IFIT1
and IFN-␤ mRNA expression measured by qPCR analysis of experiments described for panel B. The graph depicts the means and SD of the results
of three independent experiments (n ⫽ 3) performed in triplicate and presented on a log scale (log10). Data were normalized to those of the GAPDH
housekeeping gene. (D) Viral growth kinetics of infection experiments described for panel B determined by qPCR (left) and plaque assay (Vero cells)
(right). (Left) A graph presents the means and SD of the results of three independent experiments (n ⫽ 3) measured in triplicate and depicted on a
log scale (log10). (Right) Supernatants were collected at the indicated time points, and PFU/ml were determined by plaque assay on Vero cells. The
graph presents the means and SD of the results of three independent experiments (n ⫽ 3) on a log scale (log10). (E) Analogous to infection
experiments described for panel B, A549 RLR KO or MAVS KD cells were infected with WNV TX (MOI ⫽ 5), and cell lysates were harvested at the
indicated time points and analyzed by Western blotting for innate immune activation (IRF3 Ser396, IFIT1, MxA) and WNV NS3 protein level. Depicted
is one representative blot of three independent experiments (n ⫽ 3). (F) qPCR analysis of IFIT1 and IFN-␤ mRNA expression upon infection of A549
KO or KD cells with WNV as described for panel E. The graph presents the mean and SD of three independent experiments (n ⫽ 3) performed in
triplicate and presented on a log scale (log10). (G) WNV growth kinetics of A549 KO or KD cell infection experiments described for panel E. (Top) WNV
RNA measured by qPCR using WNV-specific primer pairs. Data were normalized to GAPDH. The means and SD of the results of three independent
experiments (n ⫽ 3) performed in triplicate are presented on a log scale (log10). (Bottom) Analysis of viral supernatants by plaque assay. Shown are
the means and SD of the results of three independent experiments (n ⫽ 3) depicted on a log scale (log10). Statistical analysis of all qPCR and plaque
assay data was performed with two-way ANOVA, followed by Bonferroni’s multiple-comparison test. ns, not significant; *, P ⬍ 0.05; **, P ⬍ 0.01; ***,
P ⬍ 0.001; ****, P ⬍ 0.0001.

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 13

Esser-Nobis et al. Journal of Virology

ing possibility to define these differences might lie within the 18 amino acids that differ
between ZIKV/Cambodia and ZIKV/Brazil and that could impact host innate immune
effector functions (37), including rendering a delay in IRF3 activation. For ZIKV/Brazil,
these features could contribute to the high association of ZIKV clade Z with CZVS. Two
groups have reported binding of ZIKV RNA by RIG-I (18, 38). While Chazal et al. focused
on RIG-I–RNA binding after ZIKV infection of HEK293 cells for 24 h, Hertzog et al. studied
the contribution of RIG-I and MDA5 in HEK cells transfected with total RNA extracted
from ZIKV-infected A549 cells, finding evidence for a role of RIG-I and MDA5 in directing
IFN induction in response to ZIKV RNA, similar to our previous studies of WNV (14). Our
observations from ZIKV infection in the different RLR knockout A549 cells support the
findings by both groups. Our work does, however, reveal a dominant role of RIG-I in the
detection of ZIKV PAMPs at early time points during infection of otherwise immuno-
competent A549 cells. At later time points during infection, induction of innate immune
signaling was detected even in the absence of RIG-I, suggesting a contribution of MDA5
to the antiviral innate immune response. A sequential contribution of RIG-I and MDA5
is in line with previous observations made for WNV and HCV (14, 32). We propose that
RIG-I serves to recognize PAMPs that are presented early in the ZIKV infection cycle
while MDA5-stimulatory viral PAMPs might accumulate at later time points during the
viral replication cycle or become more accessible for detection by MDA5, possibly by
morphological changes of viral replication compartments. In addition, low basal MDA5
protein levels might require an IFN-driven induction of MDA5 expression prior to a
significant contribution of this PRR to innate immune signaling. We also note that we
cannot exclude cell line- or cell type-specific differences in the contribution of each RLR
to virus recognition and induction of an antiviral response which can occur differen-
tially among tissues (9).
All together, our findings reveal striking differences in host cell innate immune
responses and point to a difference in IFN sensitivity of distinct ZIKV strains. In
summary, in contrast with other ZIKV strains, the emerging strain ZIKV/Brazil presented
with characteristics of a stealth virus that does not robustly trigger innate immune
activation, despite the accumulation of viral RNA/PAMPs in the infected cell. Moreover,
ZIKV/Cambodia exhibits increased sensitivity to IFN compared to other ZIKV strains.
These viral properties should be considered when choosing ZIKV strains for future
studies of innate immune activation and response. Uncovering virus strain-specific
features of innate immune regulation is critical for understanding ZIKV infection
outcome and is paramount for developing therapeutic strategies that harness innate
immunity for the control of ZIKV infection.

MATERIALS AND METHODS

Cell culture and virus stocks. A549 lung epithelial cells and Vero cells were maintained in
Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% fetal calf serum, 2 mM L-glutamine,
1 mM sodium pyruvate, penicillin-streptomycin solution, 1⫻ nonessential amino acids (all from Fisher
Scientific, NH, USA), and 10 mM HEPES (Corning, NY, USA) (complete DMEM). The following flaviviruses
were used during this study: West Nile Virus, 2002, Texas, Hall County (termed WNV TX); Zika virus African
strain, 1947, Uganda, MR766 (termed ZIKV/Uganda); Zika virus Asian strain, 2010, Cambodia, FSS13025
(termed ZIKV/Cambodia); Zika virus Asian strain, 2015, Brazil, Fortaleza, Fortaleza 2015 (termed ZIKV/
Brazil). WNV TX (GenBank no. DQ176637) was isolated and working stocks were prepared as previously
described (29). ZIKV/Cambodia (GenBank no. KU955593) was provided by the World Reference Center of
Emerging Viruses and Arboviruses (WRCEVA, Galveston, TX, USA). ZIKV/Brazil (GenBank no. KX811222)
was provided by M. Diamond (Washington University School of Medicine in St. Louis). ZIKV MR766
(Uganda) (GenBank no. NC_012532) was purchased from the ATCC (ATCC VR-84). All ZIKV working stocks
were generated from plaque-purified isolates amplified in Vero cells, and viral titers are derived either
from plaque assays performed with Vero cells or from FFU assays performed with A549 cells as stated in
the text and figure legends. Sendai virus Cantell strain (SeV) was purchased from Charles River (Seattle,
WA, USA). All viral stocks and cell lines tested negative for mycoplasma.
Deep sequencing of viral stocks and sequence alignments. RNA for whole-transcriptome se-
quencing (RNA-Seq) was isolated from virus stocks derived from plaque-purified isolates, passaged one
time in Vero cells with the QIAamp viral RNA minikit (Qiagen, Germantown, MD, USA) according to the
instructions of the manufacturer. The RNA was digested with DNase I, followed by purification with the
Qiagen RNeasy minikit (Qiagen, USA), and stored at ⫺80°C. RNA concentrations were measured on a
Qubit fluorometer (Invitrogen, Carlsbad, CA, USA), and RNA quality was analyzed on the Agilent 2100
bioanalyzer (Agilent, Santa Clara, CA, USA). rRNA was depleted from each RNA sample by using the

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 14

Zika Virus Strain-Specific Properties in Innate Immunity Journal of Virology

Ribo-Zero rRNA removal kit (Epicentre). Libraries were prepared from 150 ng of rRNA-depleted RNA by
following the KAPA stranded RNA-Seq with RiboErase workflow for Total RNA-Seq libraries (KAPA
Biosystems). Library quality was evaluated using the Qubit 3.0 fluorometer and the Agilent 2100
bioanalyzer instrument. Constructed libraries were sequenced on a NextSeq 500 Illumina platform,
producing 2 ⫻ 75nt stranded paired-end reads. Raw RNA-Seq data were demultiplexed and checked for
quality (FastQC version 0.11.3), and adapters were removed. After quality control, the sequencing files
(Fastqs) were loaded onto the de novo assembler Trinity (version 2.4.0) and assembled using methods
previously outlined (39, 40). Each sample had roughly 30 million raw reads. The Trinity assembler has
several components (Jellyfish, Inchworm, Chysalis, Butterfly) that assemble sequences into contigs with
k-mer clusters and build de Bruijn graphs. Trinity generated viral contigs from the strain-specific samples,
and these sequences were deposited into GenBank under the following accession numbers: ZIKV/Brazil,
KX811222.1; ZIKV/Uganda, MK105975; ZIKV/Cambodia, MH368551. Viral sequences were aligned using
the Jotun Hein method of MegAlign software, version 10.0.1 (DNASTAR, Madison, WI, USA), to identify
nucleotide and amino acid differences.
Plaque assay. A total of 3.7 ⫻ 105 Vero cells were seeded in 6-well dishes, and virus-containing
supernatants were serially diluted in complete DMEM. Vero cell monolayers were incubated in duplicate
with dilutions shaking at 37°C for 2 h. Monolayers were overlaid with 1% agarose, and 3 to 4 days later,
plaques were visualized with a 1% agarose overlay containing 3% neutral red (Sigma, St. Louis, MO, USA).
FFU assay. A total of 1 ⫻ 104 Vero cells or 2 ⫻ 104 A549 cells were seeded in a 96-well plate in a final
volume of 100 ␮l complete DMEM containing 10% fetal bovine serum (FBS). The next day, the medium
was removed from the cells and replaced with 100 ␮l of serial dilutions of virus containing supernatant
made in complete DMEM containing 2% FBS. After incubation of the cells for 2 h at 37°C and 5% CO2,
the cells were covered with ⬃120 ␮l minimum essential medium (MEM) supplemented with 2% FBS, 1%
methylcellulose, a penicillin-streptomycin solution (all from Fisher Scientific, NH, USA), and 10 mM HEPES
(Corning, NY, USA). At 20 h later, the overlay and medium were removed, and the cells were fixed for
20 min at room temperature (RT) by the addition of 200 ␮l 4% paraformaldehyde (PFA) per well. After
washing the cells three times with phosphate-buffered saline (PBS), cells were permeabilized with
Perm/Wash (BD biosciences) for 5 to 10 min at RT. After the removal of Perm/Wash, 50 ␮l of a fluorescein
isothiocyanate (FITC)-conjugated anti-ZIKV-E 4G2 antibody (1:250) or an FITC-conjugated anti-ZIKV-E
ZV13 antibody (cross-reactive against WNV) (1:1,000) diluted in Perm/Wash was added. After gently
rocking the plates for 2 h at RT in the dark and three washes with PBS, foci of infected cells were detected
in an IncuCyte Zoom analysis system and analyzed with the IncuCyte Zoom 2018A software (Sartorius,
Essen BioScience, MI, USA). Anti-ZIKV-E 4G2 (derived from an anti-pan-flavivirus hybridoma cell line, ATCC
HB-112) and anti-ZIKV-E ZV13 (41) (gift of Michael S. Diamond, Washington University School of Medicine
in St. Louis) antibodies were conjugated to FITC using the Fluorescein-EX labeling kit (Thermo Fisher)
according to the instructions of the manufacturer.
SYBR green quantitative PCR. Total RNA was isolated from cell lysates with the RNeasy kit (Qiagen,
Germantown, MD, USA) by following the instructions of the manufacturer. All samples were DNase I
digested. Five hundred nanograms of total RNA was subjected to cDNA synthesis with the iScript cDNA
synthesis kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. cDNA was diluted
1:8 in H2O, and SYBR green quantitative PCR (qPCR) was performed on an Applied Biosystems ViiA 7
real-time PCR machine using the SYBR select master mix (Thermo Fisher, Waltham, MA, USA) and
gene-specific primers. Primers for specific detection of cellular target genes and viral genomes can be
found in Table 3. qPCR analyses were run in triplicate, and data were analyzed using the 2–ΔΔCT method
and compared to GAPDH or Rpl13a housekeeping genes.
SDS-PAGE and Western blot analysis. Cells were lysed in a modified radioimmunoprecipitation
(RIPA) buffer (150 mM NaCl, 50 mM Tris-HCl [pH 7.6], 1% Triton X-100, 0.5% sodium deoxycholate) with
freshly added protease inhibitor cocktail (Sigma, St. Louis, MO, USA), phosphatase inhibitor cocktail
(Millipore, Burlington, MA, USA), and okadaic acid (Thermo Fisher, Waltham, MA, USA). Protein concen-
trations were measured using the Pierce BCA protein assay kit (Thermo Fisher), and 12 ␮g protein was
subjected to SDS-PAGE and blotted onto polyvinylidene difluoride (PVDF) membranes (Thermo Fisher).
After a blocking step with a 4% bovine serum albumin (BSA) solution, the membranes were incubated
with the following primary antibodies at 4°C overnight: rabbit anti-IRF3 S386 (1:500) (ab76493; Abcam,
MA, USA), rabbit anti-IRF3 S396 (1:1,000) (no. 29047; Cell Signaling Technology [CST], Danvers, MA, USA),
rabbit anti-IRF3 (1:1,000) (no. 4302; CST), rabbit anti-IFIT1 no. 971 (1:1,000) and rabbit anti-MxA no. 340B
(1:500) (both made at UT Southwestern Antibody Core facility by repeated injections of synthetic
peptides into rabbits), mouse anti-pan-actin C4 (1:3,000) (MAB1501; Millipore), rabbit anti-ZIKV-NS5
(1:2,500) (GTX133312; GeneTex, Irvine, CA, USA), goat anti-WNV-NS3 (1:1,000) (BAF2901; R&D Systems,
Minneapolis, MN, USA), goat anti-parainfluenza virus 1 (B65121G-1; Amsbio, Cambridge, MA, USA),
mouse anti-RIG-I AlmeI (1:1,000) (AG-20B-0009-C100; AdipoGen, San Diego, CA, USA), rabbit anti-MDA5
(1:500) (29020; IBL, Minneapolis, MN, USA), rabbit anti-LGP2 (1:500) (no. 29030; IBL), and rabbit anti-Cardif
AT107 (1:1,000) (ALX-210-929-C100; Enzo Life Sciences, Farmingdale, NY, USA). Bound primary antibodies
were detected with 1:1,000 diluted horseradish peroxidase-coupled secondary antibodies: donkey
anti-mouse antibody (715-035-150), donkey anti-rabbit antibody (711-035-152), donkey anti-goat anti-
body (705-035-003) (all from Jackson Immunoresearch, West Grove, PA, USA), and an ECL prime reagent
(GE Healthcare, Pittsburgh, PA, USA) on a ChemiDoc Imager (Bio-Rad). If necessary, membranes were
stripped for reprobing with a harsh stripping buffer containing 2% SDS and 0.8% ␤-mercaptoethanol.
Immunofluorescence. A total of 1 ⫻ 105 A549 cells were seeded onto glass coverslips in a 24-well
plate. The next day, cells were infected with ZIKV, WNV, or SeV and fixed with 4% PFA for 15 min at 24
or 48 h postinfection. Cells were permeabilized with 0.5% Triton X-100 for 15 min at RT. After blocking

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 15

Esser-Nobis et al. Journal of Virology

TABLE 3 Primer sequences and gRNA sequencesa

Primer or gRNA Sequence 5= to 3=
Primers
F_GAPDH ACAACTTTGGTATCGTGGAAGG
R_GAPDH GCCATCACGCCACAGTTTC
F_Rpl13a GCCCTACGACAAGAAAAAGCG
R_Rpl13a TACTTCCAGCCAACCTCGTGA
F_IFIT1 AGAAGCAGGCAATCACAGAAAA
R_IFIT1 CTGAAACCGACCATAGTGGAAAT
F_IFN-b AGTGTCAGAAGCTCCTGTGGC
R_IFN-b TGAGGCAGTATTCAAGCCTCC
F_IFITM1 TACTCCGTGAAGTCTAGGGACAG
R_IFITM1 AACAGGATGAATCCAATGGTCA
F_WNV TCAGCGATCTCTCCACCAAAG
R_WNV GGGTCAGCACGTTTGTCATTG
F_ZIKV CCGCTGCCCAACACAAG
R_ZIKV CCACTAACGTTCTTTTGCAGACAT
F_SeV GACGCGAGTTATGTGTTTGC
R_SeV TTCCACGCTCTCTTGGATCT

gRNAs
gNT GACGGAGGCTAAGCGTCGCAA
gLGP2 GATGGCACTGACCAGCCCCG
gRIG-I GGGTCTTCCGGATATAATCC
gMDA5 GTGGTTGGACTCGGGAATTCG
gMAVS GTCCTGCTCCTGATGCCCGC
aAll sequences are of human origin.

the cells with 3% BSA in PBS, immunofluorescent staining was performed for 1 h at RT with primary
antibodies directed against dsRNA (J2, mouse, 1:800; no. 10010500; Scicons, Budapest, Hungary),
parainfluenza virus (1:200, goat, no. B65121G; Amsbio, MA, USA), rabbit anti-ZIKV-NS4B cross-reacting
with WNV (1:500, no. 133311; GeneTex, CA, USA), IFIT1 (no. 971, 1:100, rabbit), or IRF3 (AR1, 1:100,
mouse), which has been described elsewhere (42). Nuclei were counterstained with 4’,6-diamidine-2’-
phenylindole dihydrochloride (DAPI; Thermo Fisher). Isotype-specific and fluorophore-coupled secondary
antibodies (1:1,000; Thermo Fisher) were applied for 1 h at RT. After washing, samples were mounted
onto glass slides using ProLong gold (Thermo Fisher). Images were acquired with a Nikon Eclipse Ti
confocal microscope equipped with a 60⫻ oil immersion objective using the Nikon confocal software.
Images were merged and processed using the Nikon confocal analysis software (NIS Elements AR 5.11.00;
Nikon, Melville, NY, USA). Further analyses of the images were performed in ImageJ (version 1.52; NIH,
USA) (43).
Generation of gene knockouts by CRISPR Cas9. For CRISPR Cas9-mediated gene knockout, guide
RNA (gRNA) sequences were designed with the CRISPR tool of benchling (Biology Software, 2017;
https://benchling.com). Upon annealing of the gRNA, target oligonucleotides were cloned into a
puromycin-selectable Cas9-t2a-pRRL lentiviral vector (44) by digesting the plasmid with SbfI and AfeI and
using the In-Fusion cloning kit (TaKaRa, Mountain View, CA, USA). Production of lentiviral particles and
generation of stable cell lines were performed as described previously (45). Sequences for gRNA-directed
gene knockout are summarized in Table 3. Upon transduction, cells were kept under continuous
selection with 1.5 ␮g/ml puromycin and knockouts were confirmed by Western blotting.
Statistical analysis. Statistical analysis of all data was performed using GraphPad Prism 7.03
(GraphPad, La Jolla, CA, USA) and is described in the figure legends.
Data availability. Deep sequencing data were deposited in the Sequencing Read Archive (SRA)
under the following accession numbers: BioProject no. PRJNA498737; GenBank no. KU955593,
ZIKV/Cambodia, as derived from the World Reference Center of Emerging Viruses and Arboviruses;
GenBank no. NC_012532, ZIKV/Uganda, as purchased from the ATCC; GenBank no. MH368551, ZIKV/
Cambodia, plaque-picked isolate (sequence identified in the present study); GenBank no. MK105975,
ZIKV/Uganda, plaque-picked isolate (sequence identified in the present study); GenBank no. KX811222.1,
ZIKV/Brazil, plaque-picked isolate (sequence identified in the present study); and GenBank no. DQ176637,
WNV TX (29).

ACKNOWLEDGMENTS
This work was supported by NIH grants AI143265, AI145296, AI104002, AI083019,
and AI100625.
We thank the Seattle Genomics sequencing group for RNA sequencing of ZIKV
stocks.
K.E.-N. designed and performed experiments, interpreted data, and wrote the
manuscript, L.D.A. designed and cloned all CRISPR Cas9 gRNA constructs and generated

July 2019 Volume 93 Issue 13 e00640-19 jvi.asm.org 16

Zika Virus Strain-Specific Properties in Innate Immunity
A549 MAVS KO cells, J.A.R. helped with IFN sensitivity experiments, M.R.F. helped with
total RNA isolation and Western blotting, R.G. processed the deep sequencing data and
assembled the contigs, and M.G. designed the concept of this study, interpreted the
results, and wrote the manuscript. All authors contributed to writing the manuscript.
We declare no conflicts of interest.
REFERENCES
1. Dick GW, Kitchen SF, Haddow AJ. 1952. Zika virus. I. Isolations and
serological specificity. Trans R Soc Trop Med Hyg 46:509 –520. https://
doi.org/10.1016/0035-9203(52)90042-4.
2. PAHO/WHO. 25 August 2017. Zika– epidemiological update. PAHO/
WHO, Washington, DC. https://www.paho.org/hq/index.php?option⫽
com_docman&task⫽doc_download&gid⫽41708&lang⫽fr. Accessed 4
June 2018.
3. Weaver SC, Costa F, Garcia-Blanco MA, Ko AI, Ribeiro GS, Saade G, Shi PY,
Vasilakis N. 2016. Zika virus: history, emergence, biology, and prospects
for control. Antiviral Res 130:69 – 80. https://doi.org/10.1016/j.antiviral
.2016.03.010.
4. Martines RB, Bhatnagar J, Keating MK, Silva-Flannery L, Muehlenbachs A,
Gary J, Goldsmith C, Hale G, Ritter J, Rollin D, Shieh WJ, Luz KG, Ramos
AM, Davi HP, Kleber de Oliveria W, Lanciotti R, Lambert A, Zaki S. 2016.
Notes from the field: evidence of Zika virus infection in brain and
placental tissues from two congenitally infected newborns and two fetal
losses–Brazil, 2015. MMWR Morb Mortal Wkly Rep 65:159 –160. https://
doi.org/10.15585/mmwr.mm6506e1.
5. Mead PS, Hills SL, Brooks JT. 2018. Zika virus as a sexually transmitted
pathogen. Curr Opin Infect Dis 31:39 – 44. https://doi.org/10.1097/QCO
.0000000000000414.
6. Azevedo RSS, de Sousa JR, Araujo MTF, Martins Filho AJ, de Alcantara BN,
Araujo FMC, Queiroz MGL, Cruz ACR, Vasconcelos BHB, Chiang JO,
Martins LC, Casseb LMN, da Silva EV, Carvalho VL, Vasconcelos BCB,
Rodrigues SG, Oliveira CS, Quaresma JAS, Vasconcelos PFC. 2018. In situ
immune response and mechanisms of cell damage in central nervous
system of fatal cases microcephaly by Zika virus. Sci Rep 8:1. https://doi
.org/10.1038/s41598-017-17765-5.
7. de Oliveira WK, de Franca GVA, Carmo EH, Duncan BB, de Souza Kuchen-
becker R, Schmidt MI. 2017. Infection-related microcephaly after the
2015 and 2016 Zika virus outbreaks in Brazil: a surveillance-based anal-
ysis. Lancet 390:861– 870. https://doi.org/10.1016/S0140-6736(17)
31368-5.
8. Cortese M, Goellner S, Acosta EG, Neufeldt CJ, Oleksiuk O, Lampe M,
Haselmann U, Funaya C, Schieber N, Ronchi P, Schorb M, Pruunsild P,
Schwab Y, Chatel-Chaix L, Ruggieri A, Bartenschlager R. 2017. Ultrastruc-
tural characterization of Zika virus replication factories. Cell Rep 18:
2113–2123. https://doi.org/10.1016/j.celrep.2017.02.014.
9. Suthar MS, Diamond MS, Gale M, Jr. 2013. West Nile virus infection and
immunity. Nat Rev Microbiol 11:115–128. https://doi.org/10.1038/
nrmicro2950.
10. Daffis S, Samuel MA, Suthar MS, Gale M, Jr, Diamond MS. 2008. Toll-like
receptor 3 has a protective role against West Nile virus infection. J Virol
82:10349 –10358. https://doi.org/10.1128/JVI.00935-08.
11. Nazmi A, Dutta K, Hazra B, Basu A. 2014. Role of pattern recognition
receptors in flavivirus infections. Virus Res 185:32– 40. https://doi.org/10
.1016/j.virusres.2014.03.013.
12. Nazmi A, Mukherjee S, Kundu K, Dutta K, Mahadevan A, Shankar SK, Basu
A. 2014. TLR7 is a key regulator of innate immunity against Japanese
encephalitis virus infection. Neurobiol Dis 69:235–247. https://doi.org/
10.1016/j.nbd.2014.05.036.
13. Szretter KJ, Daffis S, Patel J, Suthar MS, Klein RS, Gale M, Jr, Diamond MS.
2010. The innate immune adaptor molecule MyD88 restricts West Nile
virus replication and spread in neurons of the central nervous system. J
Virol 84:12125–12138. https://doi.org/10.1128/JVI.01026-10.
14. Errett JS, Suthar MS, McMillan A, Diamond MS, Gale M, Jr. 2013. The
essential, nonredundant roles of RIG-I and MDA5 in detecting and
controlling West Nile virus infection. J Virol 87:11416 –11425. https://doi
.org/10.1128/JVI.01488-13.
15. Sprokholt JK, Kaptein TM, van Hamme JL, Overmars RJ, Gringhuis SI,
Geijtenbeek TBH. 2017. RIG-I-like receptor activation by dengue virus
drives follicular T helper cell formation and antibody production. PLoS
Pathog 13:e1006738. https://doi.org/10.1371/journal.ppat.1006738.
July 2019 Volume 93 Issue 13 e00640-19
Journal of Virology
16. Chang TH, Liao CL, Lin YL. 2006. Flavivirus induces interferon-beta gene
expression through a pathway involving RIG-I-dependent IRF-3 and
PI3K-dependent NF-kappaB activation. Microbes Infect 8:157–171.
https://doi.org/10.1016/j.micinf.2005.06.014.
17. Sprokholt JK, Kaptein TM, van Hamme JL, Overmars RJ, Gringhuis SI,
Geijtenbeek TBH. 2017. RIG-I-like receptor triggering by dengue virus
drives dendritic cell immune activation and TH1 differentiation. J Immu-
nol 198:4764 – 4771. https://doi.org/10.4049/jimmunol.1602121.
18. Hertzog J, Dias Junior AG, Rigby RE, Donald CL, Mayer A, Sezgin E, Song
C, Jin B, Hublitz P, Eggeling C, Kohl A, Rehwinkel J. 2018. Infection with
a Brazilian isolate of Zika virus generates RIG-I stimulatory RNA and the
viral NS5 protein blocks type I IFN induction and signaling. Eur J Immu-
nol 48:1120 –1136. https://doi.org/10.1002/eji.201847483.
19. Best SM. 2017. The many faces of the flavivirus NS5 protein in antago-
nism of type I interferon signaling. J Virol 91:e01970-16. https://doi.org/
10.1128/JVI.01970-16.
20. Grant A, Ponia SS, Tripathi S, Balasubramaniam V, Miorin L, Sourisseau M,
Schwarz MC, Sánchez-Seco MP, Evans MJ, Best SM, García-Sastre A. 2016.
Zika virus targets human STAT2 to inhibit type I interferon signaling. Cell
Host Microbe 19:882– 890. https://doi.org/10.1016/j.chom.2016.05.009.
21. Kumar A, Hou S, Airo AM, Limonta D, Mancinelli V, Branton W, Power C,
Hobman TC. 2016. Zika virus inhibits type-I interferon production and
downstream signaling. EMBO Rep 17:1766 –1775. https://doi.org/10
.15252/embr.201642627.
22. Netto EM, Moreira-Soto A, Pedroso C, Hoser C, Funk S, Kucharski AJ,
Rockstroh A, Kummerer BM, Sampaio GS, Luz E, Vaz SN, Dias JP, Bastos FA,
Cabral R, Kistemann T, Ulbert S, de Lamballerie X, Jaenisch T, Brady OJ,
Drosten C, Sarno M, Brites C, Drexler JF. 2017. High Zika virus seropreva-
lence in Salvador, Northeastern Brazil limits the potential for further out-
breaks. mBio 8:e01390-17. https://doi.org/10.1128/mBio.01390-17.
23. Tsetsarkin KA, Kenney H, Chen R, Liu G, Manukyan H, Whitehead SS,
Laassri M, Chumakov K, Pletnev AG. 2016. A full-length infectious cDNA
clone of Zika virus from the 2015 epidemic in Brazil as a genetic platform
for studies of virus-host interactions and vaccine development. mBio
7:e01114-16. https://doi.org/10.1128/mBio.01114-16.
24. Yuan L, Huang XY, Liu ZY, Zhang F, Zhu XL, Yu JY, Ji X, Xu YP, Li G, Li C,
Wang HJ, Deng YQ, Wu M, Cheng ML, Ye Q, Xie DY, Li XF, Wang X, Shi
W, Hu B, Shi PY, Xu Z, Qin CF. 2017. A single mutation in the prM protein
of Zika virus contributes to fetal microcephaly. Science 358:933–936.
https://doi.org/10.1126/science.aam7120.
25. Aliota MT, Dudley DM, Newman CM, Mohr EL, Gellerup DD, Breitbach
ME, Buechler CR, Rasheed MN, Mohns MS, Weiler AM, Barry GL, Weisgrau
KL, Eudailey JA, Rakasz EG, Vosler LJ, Post J, Capuano S, Golos TG, Permar
SR, Osorio JE, Friedrich TC, O’Connor SL, O’Connor DH. 2016. Heterolo-
gous protection against Asian Zika virus challenge in rhesus macaques.
PLoS Negl Trop Dis 10:e0005168. https://doi.org/10.1371/journal.pntd
.0005168.
26. Fontes-Garfias CR, Shan C, Luo H, Muruato AE, Medeiros DBA, Mays E, Xie
X, Zou J, Roundy CM, Wakamiya M, Rossi SL, Wang T, Weaver SC, Shi PY.
2017. Functional analysis of glycosylation of Zika virus envelope protein.
Cell Rep 21:1180 –1190. https://doi.org/10.1016/j.celrep.2017.10.016.
27. Pettersson JH, Eldholm V, Seligman SJ, Lundkvist A, Falconar AK, Gaunt
MW, Musso D, Nougairede A, Charrel R, Gould EA, de Lamballerie X.
2016. How did Zika virus emerge in the Pacific Islands and Latin Amer-
ica? mBio 7:e01239-16. https://doi.org/10.1128/mBio.01239-16.
28. Liu Y, Liu J, Du S, Shan C, Nie K, Zhang R, Li X-F, Zhang R, Wang T, Qin
C-F, Wang P, Shi P-Y, Cheng G. 2017. Evolutionary enhancement of Zika
virus infectivity in Aedes aegypti mosquitoes. Nature 545:482– 486.
https://doi.org/10.1038/nature22365.
29. Keller BC, Fredericksen BL, Samuel MA, Mock RE, Mason PW, Diamond
MS, Gale M, Jr. 2006. Resistance to alpha/beta interferon is a determinant
of West Nile virus replication fitness and virulence. J Virol 80:9424 –9434.
https://doi.org/10.1128/JVI.00768-06.
jvi.asm.org 17
Esser-Nobis et al.
30. Grandvaux N, Servant MJ, tenOever B, Sen GC, Balachandran S, Barber
GN, Lin R, Hiscott J. 2002. Transcriptional profiling of interferon regula-
tory factor 3 target genes: direct involvement in the regulation of
interferon-stimulated genes. J Virol 76:5532–5539. https://doi.org/10
.1128/JVI.76.11.5532-5539.2002.
31. Emeny JM, Morgan MJ. 1979. Regulation of the interferon system:
evidence that Vero cells have a genetic defect in interferon production.
J Gen Virol 43:247–252. https://doi.org/10.1099/0022-1317-43-1-247.
32. Hiet MS, Bauhofer O, Zayas M, Roth H, Tanaka Y, Schirmacher P, Willem-
sen J, Grunvogel O, Bender S, Binder M, Lohmann V, Lotteau V, Ruggieri
A, Bartenschlager R. 2015. Control of temporal activation of hepatitis C
virus-induced interferon response by domain 2 of nonstructural protein
5A. J Hepatol 63:829 – 837. https://doi.org/10.1016/j.jhep.2015.04.015.
33. Zhang F, Wang HJ, Wang Q, Liu ZY, Yuan L, Huang XY, Li G, Ye Q, Yang
H, Shi L, Deng YQ, Qin CF, Xu Z. 2017. American strain of Zika virus
causes more severe microcephaly than an old Asian strain in neonatal
mice. EBioMedicine 25:95–105. https://doi.org/10.1016/j.ebiom.2017.10
.019.
34. Courtney SC, Scherbik SV, Stockman BM, Brinton MA. 2012. West Nile
virus infections suppress early viral RNA synthesis and avoid inducing
the cell stress granule response. J Virol 86:3647–3657. https://doi.org/
10.1128/JVI.06549-11.
35. Fredericksen BL, Gale M, Jr. 2006. West Nile virus evades activation of
interferon regulatory factor 3 through RIG-I-dependent and
-independent pathways without antagonizing host defense signaling. J
Virol 80:2913–2923. https://doi.org/10.1128/JVI.80.6.2913-2923.2006.
36. Neufeldt CJ, Joyce MA, Van Buuren N, Levin A, Kirkegaard K, Gale M, Jr,
Tyrrell DL, Wozniak RW. 2016. The hepatitis C virus-induced membra-
nous web and associated nuclear transport machinery limit access of
pattern recognition receptors to viral replication sites. PLoS Pathog
12:e1005428. https://doi.org/10.1371/journal.ppat.1005428.
37. Pierson TC, Diamond MS. 2018. The emergence of Zika virus and its new
clinical syndromes. Nature 560:573–581. https://doi.org/10.1038/s41586
-018-0446-y.
38. Chazal M, Beauclair G, Gracias S, Najburg V, Simon-Loriere E, Tangy F,
Komarova AV, Jouvenet N. 2018. RIG-I recognizes the 5’ region of
July 2019 Volume 93 Issue 13 e00640-19
Journal of Virology
dengue and Zika virus genomes. Cell Rep 24:320 –328. https://doi.org/
10.1016/j.celrep.2018.06.047.
39. Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I,
Adiconis X, Fan L, Raychowdhury R, Zeng Q, Chen Z, Mauceli E, Hacohen
N, Gnirke A, Rhind N, di Palma F, Birren BW, Nusbaum C, Lindblad-Toh K,
Friedman N, Regev A. 2011. Full-length transcriptome assembly from
RNA-Seq data without a reference genome. Nat Biotechnol 29:644 – 652.
https://doi.org/10.1038/nbt.1883.
40. Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J,
Couger MB, Eccles D, Li B, Lieber M, MacManes MD, Ott M, Orvis J,
Pochet N, Strozzi F, Weeks N, Westerman R, William T, Dewey CN,
Henschel R, LeDuc RD, Friedman N, Regev A. 2013. De novo transcript
sequence reconstruction from RNA-seq using the Trinity platform for
reference generation and analysis. Nat Protoc 8:1494 –1512. https://doi
.org/10.1038/nprot.2013.084.
41. Zhao H, Fernandez E, Dowd KA, Speer SD, Platt DJ, Gorman MJ, Govero
J, Nelson CA, Pierson TC, Diamond MS, Fremont DH. 2016. Structural
basis of Zika virus-specific antibody protection. Cell 166:1016 –1027.
https://doi.org/10.1016/j.cell.2016.07.020.
42. Rustagi A, Doehle BP, McElrath MJ, Gale M, Jr. 2013. Two new mono-
clonal antibodies for biochemical and flow cytometric analyses of hu-
man interferon regulatory factor-3 activation, turnover, and depletion.
Methods 59:225–232. https://doi.org/10.1016/j.ymeth.2012.05.011.
43. Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T,
Preibisch S, Rueden C, Saalfeld S, Schmid B, Tinevez JY, White DJ,
Hartenstein V, Eliceiri K, Tomancak P, Cardona A. 2012. Fiji: an open-
source platform for biological-image analysis. Nat Methods 9:676 – 682.
https://doi.org/10.1038/nmeth.2019.
44. Gray EE, Winship D, Snyder JM, Child SJ, Geballe AP, Stetson DB. 2016. The
AIM2-like receptors are dispensable for the interferon response to intracel-
lular DNA. Immunity 45:255–266. https://doi.org/10.1016/j.immuni.2016.06
.015.
45. Grunvogel O, Esser-Nobis K, Reustle A, Schult P, Muller B, Metz P, Trippler
M, Windisch MP, Frese M, Binder M, Fackler O, Bartenschlager R, Ruggieri
A, Lohmann V. 2015. DDX60L is an interferon-stimulated gene product
restricting hepatitis C virus replication in cell culture. J Virol 89:
10548 –10568. https://doi.org/10.1128/JVI.01297-15.
jvi.asm.org 18