Articles

Pre-dementia clinical stages in presenilin 1 E280A familial

early-onset Alzheimer’s disease: a retrospective cohort study
Natalia Acosta-Baena, Diego Sepulveda-Falla, Carlos Mario Lopera-Gómez, Mario César Jaramillo-Elorza, Sonia Moreno,
Daniel Camilo Aguirre-Acevedo, Amanda Saldarriaga, Francisco Lopera

Summary
Background Mild cognitive impairment (MCI) and pre-MCI have been proposed as stages preceding Alzheimer’s Lancet Neurol 2011; 10: 213–20
disease (AD) dementia. We assessed descendants of individuals with a mutation in presenilin 1 (PSEN1) that causes Published Online
familial AD, with the aim of identifying distinct stages of clinical progression to AD dementia. February 4, 2011
DOI:10.1016/S1474-
4422(10)70323-9
Methods We retrospectively studied a cohort of descendants of carriers of the PSEN1 E280A mutation. Pre-dementia
See Comment page 200
cognitive impairment was defined by a score 2 SD away from normal values in objective cognitive tests, and was
Neuroscience Group of
subdivided as follows: asymptomatic pre-MCI was defined by an absence of memory complaints and no effect on Antioquia (N Acosta-Baena MD,
activities of daily living; symptomatic pre-MCI was defined by a score on the subjective memory complaints checklist D Sepulveda-Falla MD,
higher than the mean and no effect on activities of daily living; and MCI was defined by a score on the subjective S Moreno MSc,
D C Aguirre-Acevedo MSc,
memory complaints checklist higher than the mean, with no effect on basic activities of daily living and little or no
A Saldarriaga BSc,
effect on complex daily activities. Dementia was defined according to the diagnostic and statistical manual of mental Prof F Lopera MD) and Clinical
disorders, fourth edition. Reference mean scores were those of participants who did not carry the PSEN1 E280A Epidemiology Academic Group
mutation. We used the Turnbull survival analysis method to identify ages at onset of each stage of the disease. We (GRAEPIC) (N Acosta-Baena,
D C Aguirre-Acevedo), Faculty of
measured the time from birth until onset of the three pre-dementia stages, dementia, and death, and assessed decline
Medicine, University of
in cognitive domains for each stage. Antioquia, Medellín, Colombia;
Department of Psychiatry and
Findings Follow-up was from Jan 1, 1995, to Jan 27, 2010. 1784 patients were initially identified, 449 of whom were Psychotherapy
(N Acosta-Baena) and Institute
PSEN1 E280A carriers who had complete clinical follow-up. Median age at onset was 35 years (95% CI 30–36) for
of Neuropathology
asymptomatic pre-MCI, 38 years (37–40) for symptomatic pre-MCI, 44 years (43–45) for MCI, and 49 years (49–50) (D Sepulveda-Falla), University
for dementia. The median age at death was 59 years (95% CI 58–61). The median time of progression from Medical Center
asymptomatic to symptomatic pre-MCI was 4 years (95% CI 2–8), from symptomatic pre-MCI to MCI was 6 years (4–7), Hamburg-Eppendorf,
Hamburg, Germany; and
from MCI to dementia was 5 years (4–6), and from dementia to death was 10 years (9–12). The cognitive profile was School of Statistics, Faculty of
predominantly amnestic and was associated with multiple domains. Affected domains showed variability in initial Sciences, National University
stages, with some transient recovery in symptomatic pre-MCI followed by continuous decline. of Colombia, Medellín,
Colombia
(C M Lopera-Gómez MSc,
Interpretation Clinical deterioration can be detected as measurable cognitive impairment around two decades before M C Jaramillo-Elorza MSc)
dementia onset in PSEN1 E280A carriers. Onset and progression of pre-dementia stages should be considered in the
Correspondence to:
investigation and use of therapeutic interventions for familial AD. Prof Francisco Lopera,
Neuroscience Group of
Funding Departamento Administrativo de Ciencia, Tecnología e Innovación, COLCIENCIAS, Republic of Colombia. Antioquia, Calle 62 #52–59,
Lab 412, Torre 1, Sede de
Investigación Universitaria,
Introduction subjective memory complaints that might not be detected University of Antioquia,
Alzheimer’s disease (AD) is the most prevalent in neuropsychological assessments.5 The addition of Medellín AA 1226, Colombia
neurodegenerative disorder and is the main cause of these two clinical stages to the course of AD suggests flopera@une.net.co

dementia worldwide.1 The risk of developing AD
increases with age, with incidence doubling every 5 years
after age 65 years, and more than a third of all individuals
over age 85 years worldwide have AD.1 Generally, age at
onset of AD is defined by the age at onset of dementia,
when patients present with memory impairment, other
cognitive impairment, and loss of autonomy. During the
past 20 years, mild cognitive impairment (MCI) has been
proposed to precede dementia.2 MCI has been defined as
cognitive deficits that are detectable in neuro-
psychological assessments but do not affect functionality
in daily life.3 In AD, this prodromal stage is usually
associated with memory impairment.4 However,
cognitive impairment might also occur before MCI in
AD. This stage, termed pre-MCI, has been defined as
that there is a continuous cognitive decline from normal
cognition to dementia. However, diagnostic criteria for
the identification of pre-MCI and MCI are still not
universally accepted and, in sporadic AD, whether
cognitive impairment is a predictor of development of
dementia is unclear.6
Most people with AD have sporadic disease, but familial
AD is generally more severe and of earlier onset.7,8 Less
than 1% of patients with AD have mutations in the amyloid
precursor protein, presenilin 1 (PSEN1), or presenilin 2
(PSEN2) genes.9 Mutations in PSEN1 account for most For more on mutations in
cases of familial AD, and more than 180 mutations have familial AD see http://www.
molgen.ua.ac.be/ADMutations
been identified.10 PSEN1 is part of the γ-secretase protein
complex; PSEN1 mutations seem to increase concen-
trations of amyloid β1–42, which alters calcium homoeostasis

www.thelancet.com/neurology Vol 10 March 2011 213

 Articles
in the endoplasmic reticulum and facilitates aggregation
of amyloid β into plaques.1 The few longitudinal studies of
clinical progression from an asymptomatic state in familial
AD have identified a continuous progression of cognitive
impairment towards dementia,11 which might include
MCI12 and take several years.13 Prodromal memory
impairment has been detected in some individuals.13–15
Over 25 years ago, we began to follow up a kindred of
around 5000 individuals who were potentially carrying a
single mutation, E280A (Glu280Ala), in PSEN1.16,17
PSEN1 E280A carriers present with dementia before age
65 years, although age at disease onset varies, possibly
because of environmental18 and genetic17,19 factors. The
clinical course includes atypical symptoms such as aphasia,
myoclonia, seizures, and behavioural changes.7,16 The
cognitive profile of PSEN1 E280A AD does not differ
substantially from that of sporadic AD, although patients
do have slightly greater impairment in language
functions.20
Inherited AD is an ideal model in which to study
disease progression because penetrance is complete. The
identification of early clinical features will help in
definition of the onset of familial AD. Here, we
retrospectively assessed a cohort of descendants of
PSEN1 E280A mutation carriers with the aim of
identifying distinct stages of clinical progression to AD
dementia and estimating the onset age and duration of
each stage until death.
Methods
Participants
See Online for webappendix Descendants of patients with confirmed PSEN1 E280A
mutations were enrolled into the E280A Antioquia
cohort study, which was done at the University of
Antioquia, Colombia. Participants were included if they
were aged over 17 years. There were no other exclusion
criteria for medical and neuropsychological monitoring.
All participants (both carriers and non-carriers of
PSEN1 E280A) or their guardians provided written
informed consent for participation in the study; if the
physician thought that a participant had dementia, their
guardian provided written informed consent. All
assessed participants with no evident dementia and
examiners were masked to genetic status throughout
monitoring. The study was approved by the medical
ethics board of the University of Antioquia.
Procedures
Participants were followed up every 2 years. Initially, we
started to monitor participants from around the third
decade of life to detect early dementia. Follow-up
examinations included medical and neuropsychological
assessments, which focused on registration of memory
complaints and their effect on the everyday life, family
life, social life, and working life of participants. Clinical
history was taken and medical and neurological
examinations were done by a neurologist or a physician
214
trained in dementia assessment. Neuropsychological
tests were done by neuropsychologists and psychologists
trained in neuropsychology. Medical history and
neuropsychological assessments were systematised with
the systematised information system for the neuroscience
group of Antioquia (SISNE).
The dementia protocol included the CERAD
(consortium to establish a registry for Alzheimer’s
disease) neuropsychological test battery with additional
neuropsychological tests, as previously described.21 Tests
were applied according to the assigned cognitive domain
as follows. To assess attention in participants, we did the
visual A cancellation test (omissions and time) and trail
making test part A (corrects and time). For memory
assessments, we used the memory of three phrases test,
Rey-Osterrieth complex figure test (recall), list of words
tests (total corrects, total intrusions, recall, intrusions
recall, recognition “yes”, and recognition “no”), and recall
of line drawings test. We assessed language ability with
the verbal fluency and naming test. To assess
constructional praxis, we used the constructional praxis
test and the Rey-Osterrieth complex figure test (copy).
For abstract reasoning we used the Raven test (part A).
We assessed participants’ calculation abilities with the
arithmetic subtest of the Wechsler adult intelligence
scale revised. For assessment of executive function, we
used the Wisconsin card sorting test (corrects, errors,
perseverative errors, categories, and conceptual) and
phonological verbal fluency-F test. We also completed
a subjective memory complaints checklist according
to answers supplied by relatives and patients;
(webappendix p 1) and used the geriatric depression scale
(short version), mini-mental state examination, and
dementia functional scales (global deterioration scale,
functional assessment staging, Barthel index, Katz scale,
and Lawton instrumental activities of daily living scale).
This expanded CERAD neuropsychological protocol
was validated for the Colombian population in
participants over 50 years of age22 but we needed to
establish normal parameters for participants under
50 years of age because of the early age at onset of familial
AD. We analysed data from PSEN1 E280A non-carriers
from the same kindred to obtain normal parameters for
cognitive tests. Mean scores were calculated for each test
from the first neuropsychological assessment done while
the participant was under 50 years of age. These data
were then grouped according to age and education
(webappendix p 3).
Patients with MCI or dementia also had MRI and blood
chemistry analyses; concentrations of vitamin B12, folic
acid, creatinine, and glucose were measured, and thyroid
tests, lipid profiles, and HIV and syphilis serological tests
were done to rule out other causes of cognitive
impairment that was reported in neurological and
neuropsychological assessments.
For genetic analyses, genomic DNA was extracted from
blood by standard protocols, and PSEN1 E280A
www.thelancet.com/neurology Vol 10 March 2011
 Articles

Dementia MCI Symptomatic Asymptomatic Healthy

pre-MCI pre-MCI
Clinically significant cognitive decline* Yes Yes Yes Yes No
Memory complaints† Yes Yes Yes No No
Memory complaints with effect‡ Yes Yes No No No
Impairment in complex instrumental functions§ Yes No or minimal¶ No No No
Impairment in basic activities of daily living|| Yes No No No No
DSM-IV dementia criteria Yes No No No No

MCI=mild cognitive impairment. DSM-IV=diagnostic and statistical manual of mental disorders, fourth edition. *Neuropsychological test scores 2 SD or more away from the
mean normal value score for non-carriers in at least one test on any cognitive domain, adjusted for age and education. †Benign forgetfulness but with normal score in the
subjective memory complaints checklist (any score less than the mean score of non-carriers and adjusted for age and education) and supported by reports from patients or
families. ‡High score in the subjective memory complaints checklist (any score more than the mean score of non-carriers and adjusted for age and education) and supported
by medical reports from patients or families. §Measured with the Lawton instrumental activities of daily living and functional assessment staging scales. ¶Minimum need of
assistance on the Lawton instrumental activities of daily living scale and a score of 3 on the functional assessment staging scale. ||According to scores on the functional
assessment staging, global deterioration, and Katz scales, and the Barthel index.

Table 1: Criteria for classification of PSEN1 E280A carriers

characterisation was done as previously described.19
Genomic DNA was amplified with the primers PS1-S 5´
AACAGCTCAGGAGAGGAATG 3´ and PS1-AS 5´
GATGAGACAAGTNCCNTGAA 3´. We used the
restriction enzyme BsmI for restriction fragment length
polymorphism analysis.
All PSEN1 E280A carriers were classified retrospectively
at the end of the study into the stages of pre-MCI, MCI,
dementia, or death (table 1), according to results from all
medical assessments, neuropsychological tests, and
subjective memory complaints checklists obtained
throughout the study. These stages and their criteria were
defined before analysis. Pre-MCI was further divided into
asymptomatic and symptomatic after we identified
individuals who did not have memory complaints but
who did have objective cognitive decline, but before
formal analyses (table 1). Death attributed to AD was
defined as death from complications associated with
advanced dementia, according to basic activities of daily
living scales.
Clinically significant cognitive decline was defined as
neuropsychological test scores 2 SD away from the mean
score of non-carriers in at least one test on any cognitive
domain, adjusted for age and education. Memory
complaints were subdivided into those with or without
effect: memory complaints with effect, which distinguish
MCI from symptomatic pre-MCI, were defined as a score
checklist results and medical report from the patient
differed from those of family members, results from family
members were classed as more reliable.
Statistical analysis
We did survival analyses to estimate age of onset and
progression rate of each stage. All individuals were
analysed from date of birth until date of onset of each of
the five stages (asymptomatic pre-MCI, symptomatic pre-
MCI, MCI, dementia, and death). The end of follow-up
for every outcome was at diagnosis of the outcome or at
the last assessment date. Each stage was determined
separately.
We used the survival analysis method proposed by
Turnbull,24 with arbitrary censoring of data. We used age
as the time scale. Age of onset was classified according to
exact time to reach a stage, or as left, interval, or right
1784 participants enrolled
603 not genotyped*
1181 genotyped
722 non-carriers†

in the subjective memory complaints checklist that was

higher than the mean score of non-carriers after adjustment 459 carriers
for age and education, and supported by medical report,
little or no impairment in complex instrumental
10 had no neuropsychological
functions,23 and preserved basic activities of daily living. assessment
Memory complaints without effect were defined as a
normal score compared with the mean of non-carriers
449 included in analyses
after adjustment for age and education on the subjective
memory complaints checklist and completely preserved
Figure 1: Participant selection
basic and complex23 activities of daily living. The subjective *For more details on participants who were not genotyped see webappendix
memory complaints checklist was always supported by p 9. †499 non-carriers were selected from this group for definition of normal
medical report from patients and their relatives. When cognitive parameters.

www.thelancet.com/neurology Vol 10 March 2011 215

 Articles

95% bootstrap percentile CIs.26 Progression rates were

PSEN1 E280A carriers (n=449)
calculated as the difference between median survival
Women 252 (56%) times in two consecutive stages. The 95% CI was
Years of education calculated by the same method. Although participants
0 20 (4%) were assessed multiple times during follow-up, these
1–5 217 (48%) measurements were relevant for staging definition only
6–11 155 (35%) when they deviated from normality by 2 SD. Repeated
>11 57 (13%) values were not taken into account for any analyses.
Residence Data from participants whose age at onset was exactly
Urban 280 (62%) recorded were used to subclassify PSEN1 E280A carriers
Rural 169 (38%) according to the affected cognitive domains (webappendix
Marital status pp 6–8). Z scores were calculated from neuropsychological
Married or cohabiting 264 (59%) tests and averaged for each cognitive domain for healthy
Single 138 (31%) carriers and people in the asymptomatic pre-MCI,
Divorced or widowed 47 (10%) symptomatic pre-MCI, MCI, and dementia stages. We
Neuropsychological assessments applied the Mann-Whitney U non-parametric test to
Total 1443 mean values of Z scores for each cognitive domain
Mean 3·21 (1–12) between stages. Statistical significance was set at p≤0·05.
Age at first assessment (years) 36·93 (17–70)
Role of the funding source
Data are number (%) or mean (range).
The sponsor of the study had no role in the study design,
Table 2: Demographics and characteristics of PSEN1 E280A carriers data collection, data analysis, data interpretation, or
writing of the report. NA and FL had full access to all the
data in the study and FL had the final responsibility for
Asymptomatic Symptomatic MCI Dementia Death the decision to submit for publication.
pre-MCI pre-MCI
Exact age at onset known* 17 (4%) 102 (23%) 117 (26%) 173 (39%) 83 (18%) Results
Left censored† 267 (59%) 169 (38%) 96 (21%) 0 (0%) 0 (0%) Participants were recruited between Jan 1, 1995, and
Interval censored‡ 3 (1%) 5 (1%) 3 (1%) 0 (0%) 0 (0%) Jan 27, 2010. Of about 5000 people identified and invited
Right censored§ 162 (36%) 173 (39%) 233 (52%) 276 (61%) 366 (82%)
to enrol, 1784 individuals were enrolled (figure 1), 603 of
Total¶ 287 (64%) 276 (61%) 216 (48%) 173 (39%) 83 (18%)
whom were not genotyped for PSEN1 E280A because
they refused to give a blood sample, were dead, could not
Data are number (% of all PSEN1 E280 carriers). MCI=mild cognitive impairment. *Age of onset was judged to be exact be contacted, or refused to sign informed consent
according to medical recollection and neuropsychological assessments. 43 participants were in more than one stage.
†Onset before the first neuropsychological assessment. 83 participants were in more than one stage. ‡Onset between
(webappendix p 9). Of 1181 genotyped participants,
two consecutive assessments. §Participants who did not show expected outcome to each stage until the last assessment. 459 were carriers and 722 were non-carriers. We used
162 carriers right censored for asymptomatic pre-MCI were classed as healthy carriers. ¶Total affected carriers at each data from 499 of the non-carriers (223 excluded: 112 were
stage (excluding right censored). older than 50 years of age, 101 did not have
Table 3: Classification of PSEN1 E280A carriers according to failure type and censoring for each stage neuropsychological assessments, eight had mental
retardation, and two had sequelae after cranioencephalic
trauma) to define normal parameters of neuro-
censored time. Exact time to reach a stage was fixed when psychological tests (webappendix pp 2–5). Of the
age of onset was known according to reports from 459 PSEN1 E280A carriers, ten (four women and six men,
patients or relatives, and neuropsychological assessment. mean age 39·7 years [SD 6·1]) were excluded because
When a specific stage was not recorded at any they had not had neuropsychological assessments.
assessments, despite more severe impairment being Table 2 shows demographics and baseline characteristics
recorded subsequently, age of onset for the missing stage of the 449 carriers. During the 15 years of follow-up,
was defined as within time interval between two 2684 medical and neuropsychological assessments were
consecutive assessments (interval censoring). Left done in the studied population (1443 in carriers and
censoring was applied when onset occurred before the 1241 in non-carriers). The mean time between
first neuropsychological assessment. Right censoring assessments in carriers was 2·09 years (range 1–11);
was done for participants who did not show an expected 140 (31%) of 449 carriers were assessed only once.
outcome at the last assessment. We grouped the 449 carriers according to their clinical
We used Giolo’s algorithm25 for data input in software R stages. Of participants who were classed as having pre-
(version 2.10.1). We took 10 000 bootstrap samples with MCI with an exact age at onset, 17 had impairment in
replacement of size 500 from data. We created a survival cognitive tasks without memory complaints and were
curve for all stages for each of these 10 000 samples and defined as asymptomatic pre-MCI for analysis (table 3).
calculated median values, which we used to define 162 carriers were right censored for asymptomatic pre-MCI;

216 www.thelancet.com/neurology Vol 10 March 2011

 Articles

these participants were classed as healthy carriers. Seven

participants died of causes other than AD: one died in a car 100

accident before reaching any disease stage, three died

before the MCI stage (one patient had symptomatic pre-
MCI; no data were available for the other two patients) of 80

Free-stage PSEN1 E280A carriers (%)

causes not registered in their records, one participant with
MCI died of myocardial infarction, and two participants in
initial stages of dementia died of causes not related to 60
dementia complications (myocardial infarction and
cancer). These participants were analysed as right censored,
and outcome values were set as they were at the last 40
assessment. 34 participants received treatment during
their clinical progression, 31 during dementia and three
during MCI. Administered drugs were cholinesterase 20 Asymptomatic pre-MCI
inhibitors or memantine, which did not modify the disease Symptomatic pre-MCI
MCI
progression (data not shown). None of the participants Dementia
identified as non-carriers developed dementia during the Death
0
study. We did not assess whether any non-carriers 0 20 40 60 80
developed MCI or pre-MCI. However, two non-carriers Age of onset (years)
were detected by the MCI criteria. One was identified after
being diagnosed with cranioencephalic trauma and one Figure 2: Survival analysis of disease progression in PSEN1 E280A carriers
after bipolar affective disorder. After genotyping, these MCI=mild cognitive impairment.

participants were excluded from all analyses.

We differentiated five clinical stages with a non- Asymptomatic Symptomatic MCI Dementia
pre-MCI pre-MCI
overlapping progression in the PSEN1 E280A carriers
(figure 2). The median time to progression from
4 years 6 years 5 years 10 years
asymptomatic to symptomatic pre-MCI was 4 years Progression
(95% CI 2–8) (4–7) (4–6) (9–12)
(95% CI 2–8), from symptomatic pre-MCI to MCI was
6 years (4–7), from MCI to dementia was 5 years (4–6), and Years of follow-up
5 10 15 20
from dementia to death was 10 years (9–12). Median age of
Median age* 35 38 44 49 59
onset was 35 years (95% CI 30–36) for asymptomatic pre- (95% CI) (30–36) (37–40) (43–45) (49–50) (58–61)
MCI, 38 years (37–40) for symptomatic pre-MCI, 44 years
(43–45) for MCI, and 49 years (49–50) for dementia.
Carriers died at a median age of 59 years (58–61; figure 3). Figure 3: Progression of disease in PSEN1 E280A carriers
MCI=mild cognitive impairment. 95% CI=bootstrap 95% CI. *Age by which half the participants had reached
About 50% of carriers had asymptomatic pre-MCI by age each stage.
35 years, and there was an interval of about 25 years
between onset of asymptomatic pre-MCI and death.
Neuropsychological assessments of different cognitive Amnestic* Amnestic* Single non- Non-memory†
multiple domains memory† domain multiple domains
domains in participants for whom exact age at onset was
known for each stage (table 4) were classified into four Asymptomatic pre-MCI (n=17) 5 (29%) 8 (47%) 4 (24%) 0 (0%)
different subtypes, according to whether the amnestic Symptomatic pre-MCI (n=102) 59 (58%) 30 (29%) 13 (13%) 0 (0%)
domain, multiple amnestic domains, a single non- MCI (n=117) 45 (38%) 68 (58%) 4 (3%) 0 (0%)
memory domain, or multiple non-memory domains Dementia (n=173) 0 (0%) 173 (100%) 0 (0%) 0 (0%)
were most severely affected (webappendix pp 6–8 and 10). Data are number (%). Totals do not always add to 100% because of rounding. MCI=mild cognitive impairment.
Several cognitive domains were affected in participants *Memory. †Attention, language, constructional praxis, abstract reasoning, calculation, and executive function.
with asymptomatic pre-MCI, including memory (table 4).
Table 4: Cognitive impairment subtypes in participants for whom an exact age at onset was available
Participants with symptomatic pre-MCI and those with
MCI presented mainly with memory impairment, with
or without involvement of other cognitive domains. classed as healthy and were compared with the other
No participants were identified with non-memory groups. There was a statistically significant decline in
impairment in multiple domains at any stage. memory (p=0·001), language (p=0·002), praxis (p=0·015),
21 participants with pre-MCI or MCI had a single non- and abstract reasoning (p=0·009) in participants with
memory domain affected. The main affected domains in asymptomatic pre-MCI compared with healthy carriers
these patients were attention, executive function, (webappendix p 10), which seemed to recover in
constructional praxis, and calculation. symptomatic pre-MCI (figure 4). From this stage onwards,
162 PSEN1 E280A carriers who did not have any cognitive the Z score in these cognitive domains decreased
deficit or subjective complaint in the first assessment were progressively in a statistically significant manner (figure 4

www.thelancet.com/neurology Vol 10 March 2011 217

 Articles
1·00
0·50
Z score
0
Abstract reasoning
Praxis
–0·50
Calculation
Language
Memory
Executive function
–1·00
Attention
Healthy Asymptomatic Symptomatic MCI
carriers pre-MCI pre-MCI (n=117)
(n=162) (n=17) (n=102)
Figure 4: Variability of cognitive domains during clinical progression in
PSEN1 E280A carriers
MCI=mild cognitive impairment.
and webappendix p 10). Executive function was inversely
up and down with respect to other cognitive domains
during clinical progression; however, this variability was
not significant. Attention decreased continuously, but this
was statistically significant only from symptomatic pre-
MCI onwards.
Discussion
In this cohort study, neuropsychological assessment and
classification of memory complaints has allowed us to
describe distinct stages of cognitive decline, including
two pre-MCI stages, in PSEN1 E280A carriers (panel).
MCI has been proposed as the first stage in AD27,28 but
this theory has been challenged by several researchers
because some patients recover from MCI and do not
develop dementia, and MCI is still classed as a separate
clinical entity.6 During the 1990s, MCI referred to people
who were at stage 3 on the global deterioration scale
(GDS) or 0·5 on the clinical dementia rating (CDR)
scale.2,29 In 1999, Petersen and colleagues28 suggested a
clinical continuum from normal ageing, through MCI, to
AD. They highlighted that GDS and CDR are severity
rating scales and not diagnostic instruments. A GDS
score of 3 or a CDR score of 0·5 might correspond to
MCI or very mild dementia.30 When we started follow-up
of the PSEN1 E280A population 15 years ago, MCI was
not a widespread idea. However, we noticed a cognitive
decline that preceded the onset of AD, mainly in memory
function, which was supported by results from periodic
neuropsychological assessments and the subjective
memory complaints checklist, which were the methods
available for assessing cognitive decline. Pre-MCI was
separated into asymptomatic and symptomatic after
preliminary analyses, when, retrospectively, cognitive
impairment was evident in asymptomatic patients. We
218
defined the criterion for cognitive dysfunction as a 2 SD
variation in test scores for all identified stages, whereas
Petersen and colleagues28 defined cognitive dysfunction
criteria for MCI as 1·5 SD away from normal values. We
believe that the greater precision in the classification of
patients with pre-dementia in our study reduced false
positives at each stage. As in the definition by Petersen
and colleagues,28 in our definition of MCI we excluded
participants with dementia and included only those who
showed preserved basic activities of daily living and no
or minimum impairment in complex instrumental
functions, as recommended by the International Working
Group on MCI.3 We gave more weight to the effect of
memory complaints than to neuropsychological test
results for the definition of MCI because memory
Dementia
(n=173)
impairment might be more clinically relevant. A previous
study in this population,21 which used the same memory
checklist and neuropsychological battery that we used
here, reported that subjective memory complaints were
the earliest sign of AD onset. Also, because of the
observed amnestic profile in PSEN1 E280A carriers,
almost all patients who were classed as having MCI also
reported objective memory impairment on the memory
complaints checklist.
Pre-MCI has been defined as subjective memory
complaints associated with other symptoms but with
normal neuropsychological assessments.5,29 An alternative
definition of pre-MCI was based on objective assessment
of verbal memory impairment with PET-detected
hypometabolism in the absence of symptoms.31 In
PSEN1 E280A carriers, we identified two stages in pre-
MCI, both with measurable cognitive dysfunction and
differentiated by the presence of memory complaints in
symptomatic pre-MCI. The distribution of age at first
assessment (mean age of carriers 36·93 years and that of
non-carriers 31·45 years) might have had an effect on the
classification of asymptomatic pre-MCI.
This study was a retrospective analysis, which might
be a methodological limitation. Also, the dementia
protocol used in this population was originally designed
to detect dementia; therefore, tests might not be sensitive
enough for detection of pre-MCI and some participants
might have been misdiagnosed. Knowledge of family
history might have affected the reporting of memory
complaints by participants and their families. A possible
selection bias was introduced because 603 non-genotyped
individuals were not included in the final analysis. Those
from this group who presented with dementia had
similar ages at onset of dementia and death to the
genotyped studied sample (webappendix p 9) and thus
this population is probably comparable to genotyped
participants.
Carriers overall had low education (1–5 years in 48%;
table 2), which might have influenced the reported age at
detection and progression rates between stages. The age
of onset ranges were wide for all stages, which might be
because of individual genetic or epigenetic factors, or
www.thelancet.com/neurology Vol 10 March 2011

other familial factors. Further studies are needed to
detect modifying factors for disease onset and
progression. We did not identify any regression in
cognitive impairment at any stage, which allows a clear
distinction between this cohort and other populations, in
which some people with MCI will remain stable or even
improve over time.32,33 The interval between asymptomatic
pre-MCI and dementia in our cohort was about 15 years,
which is substantially shorter than the estimate made by
Reisberg and colleagues5 for sporadic AD (22 years). The
progression rate from MCI to dementia and dementia
duration are similar to those in sporadic AD according to
previous estimates.5 However, the duration of AD
between familial and sporadic populations is difficult to
compare because sporadic cases are usually assessed
only after diagnosis and 25% of patients with MCI do not
develop dementia.34,35 Each of the three stages before
dementia in this study took about 5 years; hence, we
propose a 5-year follow-up for any clinical trial undertaken
in this population.
Cognitive impairment in non-memory multiple
domains was not recorded at any stage, which confirms
that there is a predominant amnestic profile during the
progression of PSEN1 E280A AD, as previously reported
for sporadic AD.36 Recently, we studied a subgroup of
healthy PSEN1 E280A carriers who did significantly
worse than non-carriers in short-term memory-binding
tests, but this difference was not identified with our
standard dementia protocol.37 Consequently, memory
impairment might start even before our present
estimate and might be detected if more sensitive
memory-specific tests are applied. Pre-MCI could be
defined as an oscillating phase in cognitive impairment.
The slight recovery in symptomatic pre-MCI in memory,
language, praxis, abstract reasoning, and calculation
domains could be attributed to cognitive reserve, which
might be depleted or not available in MCI,38 because
continuous deterioration was evident from symptomatic
pre-MCI onwards. Further studies are required to
clarify these observations. A dysexecutive profile for
PSEN1 E280A AD has been suggested.37 Here, we noted
that executive function showed slight deterioration in
symptomatic pre-MCI; however, this variation is
opposite to the slight recovery in the other cognitive
domains, suggesting that there is dissociation between
them. Previously, Dickerson and Wolk39 reported two
different phenotypes—one amnestic and one
dysexecutive—in mild AD. Hence, executive function
might be dissociated from memory impairment in AD.
Contrasting results between executive function and
other cognitive domains in symptomatic pre-MCI could
be explained by frontal recruitment, increasing other
functions while diminishing executive function at this
stage.40 Impairment of attention has previously been
identified in MCI and worsening in dementia, and was
proposed as an early marker for cognitive impairment
and AD.41 In the present study, attention was the only
www.thelancet.com/neurology Vol 10 March 2011
Articles
Panel: Research in context
Systematic review
We searched PubMed, Embase, CINAHL (Cumulative Index to Nursing and Allied Health
Literature), and LILACS (Latin American and Caribbean Health Sciences) without language
or date restrictions up to December, 2010 (webappendix pp 11–14). We used the
following search terms: “prospective cohort studies”, “retrospective cohort studies”,
“cohort studies”, “cohort”, “Familial Alzheimer disease”, “early onset familial Alzheimer”,
“amyloid precursor protein”, “presenilin”, “presenilin mutations”, “presenilin 2”,
“presenilin 1”, “Alzheimer’s disease progression”, and “disease progression”. Of
131 identified records, five longitudinal studies11–15 fulfilled criteria (webappendix p 13)
and were included in the analysis. Only three of these studies included more than one
patient and follow-up was 5 years or shorter.11,13,14 Two studies followed up one patient
each, one for 10 years.12,15 We assessed the quality of evidence according to group
characteristics, confounding factors, masking of the study, and follow-up duration.
Interpretation
Taken together, these findings show weak evidence for a gradual cognitive decline in
familial AD, characterised by prodromal memory impairment in heterogeneous or small
family groups. There was a high risk of bias in all studies reviewed. Diagnostic criteria and
clearly defined clinical stages before dementia were not applied. The present study
provides strong evidence for cognitive decline preceding dementia in familial AD, and
defines two stages of objective cognitive decline differentiated by absence and eventually
presence of memory complaints, followed by mild cognitive impairment and eventually
dementia. We propose that follow-up of patients with early-onset familial AD should start
in the third decade of life to enable early use of potential treatments or patients’
participation in clinical studies.
cognitive domain that decreased continuously from
asymptomatic pre-MCI onwards.
Advantages of this study are the population size and
estimation of survival data at intervals, which permitted
the identification of age at onset for all stages. In familial
AD, subclinical cognitive deficit is a marker of disease
onset. This assertion needs to be proved in other
populations of patients with hereditary AD. The
application of these criteria for staging of familial AD
should be retrospective and after a minimum follow-up of
two consecutive neurological and neuropsychological
assessments. Assessments should be done a minimum
of every 2 years in accordance with the lower limit of time
to progression from asymptomatic to symptomatic pre-
MCI stages. This staging might not be applicable to
sporadic AD populations because of the uncertainty of
progression from cognitive impairment.6 However, the
identification of similar initial stages for all patients with
AD might be of help for the timely use of preventive
therapies and in clinical trials. A clinical continuum in
AD has been recently proposed, starting from healthy
individuals to patients with dementia; here we present
the first evidence for a gradual cognitive decline in familial
AD (panel). We propose that in familial AD, occurrence of
measurable cognitive impairment should be recognised
as disease onset, and clinicians should act accordingly
when using or investigating potential preventive or
therapeutic interventions.
219
 Articles
Contributors
NA-B, CML-G, MCJ-E, DCA-A, and FL designed the study. NA-B, DS-F,
SM, AS, and FL did the data collection. NA-B, DS-F, CML-G, and MCJ-E
did the statistical analyses. NA-B, DS-F, and FL prepared the manuscript
and all authors reviewed the manuscript.
Conflicts of interest
We declare that we have no conflicts of interest.
Acknowledgments
This study was sponsored by the Departamento Administrativo de
Ciencia, Tecnología e Innovación, COLCIENCIAS, Republic of Colombia
(grant numbers 1115-408-20543 and 1115-408-20512). The funding source
is of governmental nature and was not involved in any stage of this
study, as defined by Colombian law. We thank Fabian Jaimes for
methodological advice, Markus Glatzel for critical review, and the
Colombian families with the PSEN1 E280A mutation.
References
1 Querfurth HW, LaFerla FM. Alzheimer’s disease. N Engl J Med
2010; 362: 329–44.
2 Flicker C, Ferris SH, Reisberg B. Mild cognitive impairment in the
elderly: predictors of dementia. Neurology 1991; 41: 1006–09.
3 Winblad B, Palmer K, Kivipelto M, et al. Mild cognitive
impairment—beyond controversies, towards a consensus: report of
the International Working Group on Mild Cognitive Impairment.
J Intern Med 2004; 256: 240–46.
4 Dubois B, Feldman HH, Jacova C, et al. Research criteria for the
diagnosis of Alzheimer’s disease: revising the NINCDS-ADRDA
criteria. Lancet Neurol 2007; 6: 734–46.
5 Reisberg B, Prichep L, Mosconi L, et al. The pre-mild cognitive
impairment, subjective cognitive impairment stage of Alzheimer’s
disease. Alzheimers Dement 2008; 4 (suppl 1): S98–108.
6 Allegri RF, Glaser FB, Taragano FE, Buschke H. Mild cognitive
impairment: believe it or not? Int Rev Psychiatry 2008; 20: 357–63.
7 Larner AJ, Doran M. Clinical phenotypic heterogeneity of
Alzheimer’s disease associated with mutations of the presenilin-1
gene. J Neurol 2006; 25: 139–58.
8 Rosselli MC, Ardila AC, Moreno SC, et al. Cognitive decline in
patients with familial Alzheimer’s disease associated with E280a
presenilin-1 mutation: a longitudinal study. J Clin Exp Neuropsychol
2000; 22: 483–95.
9 Ertekin-Taner N. Genetics of Alzheimer disease in the pre- and
post-GWAS era. Alzheimers Res Ther 2010; 2: 3.
10 Cruts M, Van Broeckhoven C. Presenilin mutations in Alzheimer’s
disease. Hum Mutat 1998; 11: 183–90.
11 Wahlund LO, Basun H, Almkvist O, et al. A follow-up study of the
family with the Swedish APP 670/671 Alzheimer’s disease
mutation. Dement Geriatr Cogn Disord 1999; 10: 526–33.
12 Nikisch G, Hertel A, Kiessling B, et al. Three-year follow-up of a
patient with early-onset Alzheimer’s disease with presenilin-2 N141I
mutation—case report and review of the literature. Eur J Med Res
2008; 13: 579–84.
13 Fox NC, Warrington EK, Seiffer AL, Agnew SK, Rossor MN.
Presymptomatic cognitive deficits in individuals at risk of familial
Alzheimer’s disease: a longitudinal prospective study. Brain 1998;
121: 1631–39.
14 Godbolt AK, Cipolotti L, Watt H, Fox NC, Janssen JC, Rossor MN.
The natural history of Alzheimer disease: a longitudinal
presymptomatic and symptomatic study of a familial cohort.
Arch Neurol 2004; 61: 1743–48.
15 Godbolt AK, Cipolotti L, Anderson VM, et al. A decade of
pre-diagnostic assessment in a case of familial Alzheimer’s disease:
tracking progression from asymptomatic to MCI and dementia.
Neurocase 2005; 11: 56–64.
16 Lopera F, Ardilla A, Martinez A, et al. Clinical features of
early-onset Alzheimer’s disease in a large kindred with an E280A
presenilin-1 mutation. JAMA 1997; 277: 793–99.
17 Pastor P, Roe CM, Villegas A, et al. Apolipoprotein epsilon4
modifies Alzheimer’s disease onset in an E280A PS1 kindred.
Ann Neurol 2003; 54: 163–69.
220
18 Mejia S, Giraldo M, Pineda D, Ardila A, Lopera F. Nongenetic
factors as modifiers of the age of onset of familial Alzheimer’s
disease. Int Psychogeriatr 2003; 15: 337–49.
19 Lendon CL, Martinez A, Behrens IM, et al. E280A PS-1 mutation
causes Alzheimer’s disease but age of onset is not modified by
ApoE alleles. Hum Mutat 1997; 10: 186–95.
20 Arango-Lasprilla JC, Cuetos F, Valencia C, Uribe C, Lopera F.
Cognitive changes in the preclinical phase of familial Alzheimer’s
disease. J Clin Exp Neuropsychol 2007; 29: 892–900.
21 Ardila A, Lopera F, Rosselli M, et al. Neuropsychological profile of
a large kindred with familial Alzheimer’s disease caused by the
E280A single presenilin-1 mutation. Arch Clin Neuropsychol 2000;
15: 515–28.
22 Aguirre-Acevedo DC, Gomez RD, Moreno S, et al. Validity and
reliability of the CERAD-Col neuropsychological battery. Rev Neurol
2007; 45: 655–60.
23 Lawton MP, Brody EM. Assessment of older people: self-maintaining
and instrumental activities of daily living. Gerontologist 1969; 9: 17–86.
24 Turnbull BW. The empirical distribution function with arbitrarily
grouped, censored and truncated data. J R Stat Soc Ser B 1976;
38: 290–95.
25 Giolo SR. Turnbull’s Nonparametric estimator for interval-censored
data. http://www.est.ufpr.br/rt/suely04a.pdf (accessed Jan 22, 2011).
26 Meeker WQ, Escobar LA. Statistical methods for reliability data,
1st edn. New York: Wiley Interscience, 1998.
27 Morris JC, Storandt M, Miller JP, et al. Mild cognitive impairment
represents early-stage Alzheimer’s disease. Arch Neurol 2001;
58: 397–405.
28 Petersen RC, Smith GE, Waring SC, Ivnik RJ, Tangalos EG,
Kokmen E. Mild cognitive impairment: clinical characterisation and
outcome. Arch Neurol 1999; 56: 303–08.
29 Reisberg B, Gauthier S. Current evidence for subjective cognitive
impairment (SCI) as the pre-mild cognitive impairment (MCI)
stage of subsequently manifest Alzheimer’s disease.
Int Psychogeriatr 2008; 20: 1–16.
30 Petersen RC. Mild cognitive impairment or questionable dementia.
Arch Neurol 2000; 57: 643–44.
31 Caselli RJ, Chen K, Lee W, Alexander GE, Reiman EM. Correlating
cerebral hypometabolism with future memory decline in
subsequent converters to amnestic pre-mild cognitive impairment.
Arch Neurol 2008; 65: 1231–36.
32 Ritchie K, Artero S, Touchon J. Classification criteria for mild
cognitive impairment: a population-based validation study.
Neurology 2001; 56: 37–42.
33 Gauthier S, Reisberg B, Zaudig M, et al. Mild cognitive impairment.
Lancet 2006; 367: 1262–70.
34 Mariani E, Monastero R, Mecocci P. Mild cognitive impairment:
a systematic review. J Alzheimers Dis 2007; 12: 23–35.
35 Helzner EP, Scarmeas N, Cosentino S, Tang MX, Schupf N, Stern Y.
Survival in Alzheimer’s disease: a multi-ethnic, population-based
study of incident cases. Neurology 2008; 71: 1489–95.
36 Gallagher M, Bakker A, Yassa MA, Stark CE. Bridging neurocognitive
aging and disease modification: targeting functional mechanisms of
memory impairment. Curr Alzheimer Res 2010; 7: 197–99.
37 Parra MA, Abrahams S, Logie RH, Mendez LG, Lopera F, Della SS.
Visual short-term memory-binding deficits in familial Alzheimer’s
disease. Brain 2010; 133: 2702–13.
38 Stern Y. Cognitive reserve. Neuropsychologia 2009; 47: 2015–28.
39 Dickerson BC, Wolk DA. Dysexecutive versus amnestic phenotypes
of very mild Alzheimer’s disease are associated with distinct
clinical, genetic and cortical thinning characteristics.
J Neurol Neurosurg Psychiatry 2011; 82: 45–51.
40 Buckner RL. Memory and executive function in aging and
Alzheimer’s disease: multiple factors that cause decline and reserve
factors that compensate. Neuron 2004; 44: 195–208.
41 Levinoff EJ, Saumier D, Chertkow H. Focused attention deficits in
patients with Alzheimer’s disease and mild cognitive impairment.
Brain Cogn 2005; 57: 127–30.
www.thelancet.com/neurology Vol 10 March 2011