Int. J.

Cancer: 108, 540 –548 (2004) Publication of the International Union Against Cancer

© 2003 Wiley-Liss, Inc.

HER-2 RECEPTOR EXPRESSION, LOCALIZATION, AND ACTIVATION IN

COLORECTAL CANCER CELL LINES AND HUMAN TUMORS
Elizabeth HALF1, Russell BROADDUS2, Kathleen D. DANENBERG4, Peter V. DANENBERG5, Gregory D. AYERS3 and
Frank A. SINICROPE1,6*
1
Department of Gastrointestinal Medicine and Nutrition University of Texas M.D. Anderson Cancer Center, Houston, TX, USA
2
Department of Pathology, University of Texas M.D. Anderson Cancer Center, Houston, TX, USA
3
Department of Statistics, University of Texas M.D. Anderson Cancer Center, Houston, TX, USA
4
Response Genetics, Los Angeles, CA, USA
5
Department of Biochemistry and Molecular Biology, University of Southern California, Los Angeles, CA, USA
6
Divisions of Gastroenterology and Hepatology and Oncology, Mayo Clinic, Rochester, MN, USA

The HER-2/neu oncogene encodes a 185 kD protein that is
phosphorylated upon ligand binding to other HER/erbB
members and regulates cell growth and differentiation.
Given that HER-2 receptor blockade can inhibit the growth
of colon cancer cell lines and tumor xenografts, we investi-
gated the frequency, localization and phosphorylation status
of HER-2 in colon cancer cell lines and in human tumors.
Protein expression was analyzed in relation to mRNA levels,
HER-2 amplification, and clinicopathological variables. Colon
cancer cell lines constitutively expressed HER-2 proteins and
none showed HER-2 amplification by fluorescence in situ hy-
bridization. Cell fractionation and immunoblotting showed
HER-2 in both the membrane and cytosolic compartments.
Primary colorectal carcinomas (n ⴝ 96) and their metastases
(n ⴝ 25) were examined by immunohistochemistry. Strong
membrane HER-2 staining was detected in 5 (5%) of prima-
ries and in 3 (12%) metastases (p ⴝ 0.36). Membrane but not
cytoplasmic localization was strongly associated with HER-2
gene amplification (p ⴝ 0.007). Cytoplasmic HER-2 staining
was found in 61 (63.5%) of primary tumors and localization
was confirmed by immunoelectron microscopy that also
showed plasma membrane HER-2. Using real-time quantita-
tive RT-PCR, HER-2 mRNA was increased in tumors with
membrane compared to cytoplasmic staining (r ⴝ 0.66, p ⴝ
0.001). Cytoplasmic HER-2 was associated with tumor differ-
entiation (p ⴝ 0.018), but not other clinicopathological vari-
ables. By immunoblotting, heterogeneity was seen in HER-2
levels with downregulation in 4 of 7 tumors relative to nor-
mal epithelia that uniformly expressed HER-2. Phosphory-
lated HER-2 was detected in approximately 50% of tumors
and in normal mucosa. In conclusion, HER-2 is expressed
constitutively in colon cancer cell lines and demonstrates
relatively distinct localization patterns in human tumors.
Strong membrane immunoreactivity is associated with high
levels of HER-2 mRNA and gene amplification whereas cyto-
plasmic HER-2 is detected frequently and seems to be a
marker of tumor differentiation.
© 2003 Wiley-Liss, Inc.
Key words: HER2/neu (c-erbB-2); phosphorylation; colorectal
cancer
The HER-2/neu oncogene is a member of the tyrosine kinase
family that includes epidermal growth factor receptor (EGFR) or
HER-1, HER-2, HER-3, and HER-4. HER-2 is located on chro-
mosome 17q21 and encodes a 185 kD transmembrane protein that
lacks a natural ligand. HER-2 can be activated through het-
erodimerization with HER-1, HER-3 or HER-4 when these recep-
tors are activated by their specific ligands, i.e., heregulin or neu-
regulin.1 Heregulin has been reported to be constitutively
expressed in colon cancer cells.2 Heregulin binds to HER-3 and
HER-4 inducing heterodimeric complexes with HER-2, thus lead-
ing to its activation.3,4 HER-2 activation initiates signal cascades
including the MAPK and PI3K/AKT pathways that are essential
for cell proliferation and differentiation.5 HER-2 is activated by
tyrosine phosphorylation at serine residues and is the preferred
heterodimerization partner of the other HER/erbB receptors.6,7 The
Tyr1248 autophosphorylation site seems to be the most tightly
linked to oncogenic transformation8 –10 and may be responsible for
coupling to the ras/MAP kinase signaling pathway.11
Conflicting data exist as to the frequency, localization and
clinical significance of HER-2 expression in human colorectal
cancers.12–14 Furthermore, the HER-2 tyrosine phosphorylation
status in this malignancy remains unknown. Given the availability
of HER-2 neutralizing antibodies and small molecule tyrosine
kinase inhibitors, this is an issue of considerable therapeutic im-
portance. Overexpression of HER-2 in tumor cell membranes is
detected in 30% of human breast cancers.15 The majority of cases
with strong membrane staining show HER-2 gene amplification
and these features are associated with chemotherapy resistance and
reduced patient survival rates.16 Treatment of these patients with
the anti-HER-2 monoclonal antibody, Herceptin威, has been shown
to reduce tumor volume, to augment the effects of chemotherapy,
and to increase survival in primary and metastatic breast cancer
patients.17,18 Favorable clinical results with anti-HER-2 antibodies
in breast cancer have led to analysis of HER-2 expression in other
solid tumors. Relative to breast cancers, HER-2 is expressed at a
lower frequency in gastric (5–35%),19,20 small cell and non-small
cell lung cancers21,22 and prostate23,24 and ovarian cancers.25,26
Although emphasis has been on cell membrane expression, cyto-
plasmic HER-2 localization has also been described in colorec-
tal,12–14 breast,27–29 prostate23,24 and lung carcinomas.30,31 Contro-
versy exists, however, as to whether cytoplasmic staining
represents an immunohistochemical artifact.
HER-2 neutralizing antibodies (Herceptin威 or 2C4) have been
shown to inhibit colony formation of the HCA-7 colon cancer cell
line and HCA-7 tumor xenografts.32 Furthermore, we found that
Herceptin威 can inhibit HER-2 expression and tyrosine phosphor-
ylation in heregulin-stimulated HCA-7 cells and reduce cell via-
bility.33 These experimental data suggest that HER-2 may be a
therapeutic target in colorectal cancers. Based upon these data, we
determined the frequency of HER-2 expression, its cellular local-
ization, and its activation status in human colon cancer cell lines
and human tumors. Furthermore, we investigated the relationship
Grant sponsor: NIH; Grant number: R01 DK56378-04.
*Correspondence to: Mayo Clinic, 200 First St. SW, Rochester, MN
55905. Fax: ⫹507-284-5486. E-mail: sinicrope.frank@mayo.edu;
Received 7 January 2003; Revised 24 July 2003, 4 September 2003;
Accepted 12 September 2003
DOI 10.1002/ijc.11599
 HER-2 (c-erbB-2) EXPRESSION IN COLORECTAL CANCER
of HER-2 localization with mRNA levels, HER-2 gene amplifica-
tion and clinicopathologic variables in colorectal cancers.
MATERIAL AND METHODS
Tumor cell lines
The colorectal cancer cell lines HCT116, HT-29, RKO and
SW480 were obtained from the American Type Culture Collection
(ATCC, Rockville, MD). The HCA-7 cell line was obtained from
Dr. S. Kirkland (Imperial Cancer Research Fund, London, UK).
HCA-7 cells were derived from a well-differentiated mucoid ad-
enocarcinoma of the colon34 and are known to constitutively
express COX-2.35 Cell lines were grown in Dulbecco’s modified
Eagle/F-12 medium (Life Technologies, Inc., Frederick, MD) sup-
plemented with glutamine and heat-inactivated 10% FCS and 10
U/mL penicillin and streptomycin. Cultured cells were maintained
in a humidified environment at 37°C with 5% CO2. The breast
carcinoma cell lines SKRB-3 and MDA-MB-231 (gift of Dr. M.-C.
Hung, M.D. Anderson Cancer Center) that display high and low
levels of HER-2 expression, respectively, were used as controls.
For immunohistochemistry, tumor cell lines were fixed in formalin
and embedded in paraffin, as described.36
Archival patients specimens
A nonconsecutive and unselected series of primary colorectal
adenocarcinomas (n ⫽ 96) and colorectal cancer metastases [he-
patic (n ⫽ 23), ovarian (n ⫽ 1), peritoneal (n ⫽ 1)] were ana-
lyzed). In 19 patients, both primary tumors and synchronous
metastases were available. Tumors had been staged according to
the Duke’s classification37 and were as follows: A (n ⫽ 16), B
(n ⫽ 25), C (n ⫽ 20), D (n ⫽ 33), and unknown stage (n ⫽ 2).
Primary tumor site included proximal (n ⫽ 36) and distal (n ⫽ 30)
colon (reference point being the splenic flexure), rectum (n ⫽ 21)
and unspecified (n ⫽ 9). In 19 patients, both the primary tumor and
its corresponding metastasis were analyzed. Normal colorectal
mucosa adjacent to tumor was analyzed whenever present. For-
malin-fixed, paraffin-embedded tissue sections (4 – 6 ␮M) were
obtained from the Surgical Pathology Laboratory at University of
Texas M.D. Anderson Cancer Center for subsequent analysis.
Histologic grade included well (n ⫽ 10), moderate (n ⫽ 70), and
poorly differentiated (n ⫽ 8) adenocarcinomas. None of the pa-
tients had received preoperative radiation or chemotherapy. An
infiltrating ductal adenocarcinoma of the breast known to display
membranous HER-2 expression and gene amplification was used
as a positive control for immunohistochemistry. In addition, archi-
val sections of normal colonic mucosa (n ⫽ 7) obtained from
non-cancer patients were obtained for comparison with normal
mucosa adjacent to tumor.
Frozen tissues
Fresh tissue from 7 invasive colorectal adenocarcinomas and
paired adjacent normal tissue were obtained from an Institutional
Tissue Bank.
Immunohistochemistry
Slides were deparaffinized and endogenous peroxidase activity
was blocked by incubation in 3% H2O2 in methanol for 30 min at
room temperature. Antigen retrieval was carried out by microwave
treatment of slides in citrate buffer (pH 6.0) for 4 min on high
setting and an additional 6 min at low power. Nonspecific binding
was blocked with avidin, then biotin (Vector Laboratories, Bur-
lingame, CA) for 15 min each. Slides were incubated with an
anti-HER-2 monoclonal antibody (mAb) directed against the cy-
toplasmic domain of the HER-2 receptor (clone e2-4001⫹B5,
Neomarkers, LabVision Corp., Fremont, CA) at a concentration of
1:200 for 2 hr. A second anti-HER-2 mAb (Ab-3, Oncogene
Science, Manhasset, NY) was also used to stain the control tissues
and cell lines to verify HER-2 expression and localization. Immu-
noreactivity was detected using an immunoperoxidase method
(Vectastain Elite ABC; Vector Laboratories, Burlingame, CA).
541
The chromogen 3,3⬘ diaminobenzidine (Research Genetics, Hunts-
ville, AL) was subsequently added and the color reaction was
observed at light microscopy. The reaction was stopped by im-
mersing slides in deionized water, and slides were then counter-
stained with hematoxylin and then mounted. As controls, a human
breast cancer displaying HER-2 membrane staining and SKBR-3
and MDA-MB-231 cell lines were included with all slide runs. As
an additional negative control, the primary antibody was omitted
but included all other steps of the procedure. Cases with at least
10% immunoreactive tumor cells for HER-2 and moderate (2⫹) or
strong (3⫹) staining intensity (0 –3⫹) were regarded as positive.
Cases with absent or weak (0 –1⫹) HER-2 staining were regarded
as negative. HER-2 localization was categorized as membranous
or cytoplasmic based upon the predominant staining pattern.
Immunoblot assay
Cultured cell lines were processed according to standard proce-
dures and cell lysates were prepared. Frozen tissue samples were
homogenized in Tris-HCl buffer (pH 7.4) containing 0.5% Nonidet
P-40 and protease inhibitors (Boehringer Mannheim, Indianapolis,
IN). Protein extraction was carried out from tissue and cell lysates
and protein concentration (Bradford protein assay kit) was deter-
mined in the soluble supernatants in each sample. Samples con-
taining 40 ␮g of protein were added to SDS-PAGE loading buffer
and then loaded onto a 10% sodium dodecyl sulfate-polyacrylam-
ide gel. Proteins were then transferred onto an Immobilon mem-
brane (Millipore, Bedford, MA). Membranes were blocked using
5% nonfat dry milk. Blots were incubated overnight at 4°C with an
anti-HER-2 mAb (clone e2-4001⫹B5, Neomarkers, Lab Vision
Corp.) at a dilution of 1:400, a pan phosphotyrosine antibody
(clone G410, Upstate Biotechnology, Lake Placid, NY) at a dilu-
tion of 1:1,000, an anti-phospho-erbB-2/Her-2 antibody recogniz-
ing residue Y1248 (Upstate Biotechnology) at a dilution of
1:2,000. Blots were washed with PBS containing 0.1% Tween 20
for 15 min and incubated with a secondary antibody conjugated
with peroxidase (Bio-Rad, Hercules, CA). The level of protein
expression was measured using the enhanced chemiluminescence
detection system (Amersham, Arlington Heights, IL) according to
manufacturer’s instructions. ␤-Actin levels were determined as
controls for protein loading.
Cell fractionation
HCA-7, HT-29 and SKBR-3 cells were grown to confluency in
10-cm tissue culture dishes, washed with PBS and harvested by
scraping. Cells were centrifuged at 2,000g for 5 min, and the pellet
was resuspended in a buffer containing 20 mM Tris pH-7.4, 2.5
mM EDTA and protease inhibitors (aprotinin, leupeptin PMSF and
NaVO3 all at 10 ␮g/ml). Cell fractionation procedures were car-
ried out at 4°C unless otherwise noted. The suspension was ho-
mogenized by 50 strokes in a tightly fitting Dounce homogenizer,
and incubated for 15 min on ice. Sucrose 0.25 M was then added
and centrifuge was carried out at 2,000g for 10 min. The super-
natant was collected and centrifuged in a 70Ti fixed angle rotor
(Beckman Instruments, Fullerton, CA) at 100,000g for 60 min to
separate soluble and membrane fractions. The membrane fraction
(pellet) was washed with a hypotonic buffer, resuspended in 1 ml
of lysis buffer for 30 min on ice and centrifuged at 13,000g for 20
min. Protein concentration in both membrane and cytosolic frac-
tions were determined using the Bradford protein assay (Bio-Rad)
and each fraction was subjected to immunoblotting. The fractions
were subjected to immunoblot analysis as described below using
antibodies directed against compartment specific proteins.
Reverse transcription-PCR quantification of mRNA expression
RNA isolation from paraffin-embedded specimens was carried out
according to a proprietary procedure (US patent number 6,248,535).
After RNA isolation, cDNA was prepared from each sample as
described previously.38 Relative cDNA quantitation for Her-2/neu
and an internal reference gene (␤-actin) were done using a fluores-
542 HALF ET AL.

cence-based, real-time detection method (ABI PRISM 7700 Sequence TABLE I – RELATIONSHIP BETWEEN CYTOPLASMIC HER-2 EXPRESSION
AND CLINICOPATHOLOGIC VARIABLES
Detection System; TaqMan; Applied Biosystems, Foster City, CA),
as described previously.38,39 The primers and probe sequences used Primary colorectal cancers Cytoplasmic cerbB-2 (p value)
are given below. In each case, the first primer is the forward PCR Age (years)
primer, the second is the reverse PCR primer, and the third is the Mean 61
TaqMan probe: Her-2 Neu, CTGAACTGGTGTATGCAGATTGC, Range 30–90
TTCCGAGCGGCCAA GTC, and 6FAM (carboxyfluorescein) Dukes’ stage1 (n) 0.89
5⬘-TGTGTACGAGCCGCACATCCTCCA-3⬘TAMRA (N,N,N⬘,N⬘- A 16
tetramethyl-6-carboxyrhodamine); ␤-actin, TGAGCGCGGCTA- B 25
CAGCTT, TCCTTAATGTCACGCACGATTT and 6FAM5⬘- C 20
D 33
ACCACCACGGCCGAGCGG-3⬘TAMRA. The PCR reaction Tumor location2 (n) 0.57
mixture consisted of 600 nM of each primer, 200 nM probe, 2.5 U Proximal 36
of AmpliTaq Gold polymerase, 200 ␮M each dATP, dCTP, dGTP, Distal 30
400 ␮M dUTP, 5.5 mM MgCl2, and 1⫻ TaqMan Buffer A Rectal 21
containing a reference dye, to a final volume of 25 ␮l (all reagents Histologic grade3 (n) 0.01
were from Applied Biosystems, Foster City, CA). Cycling condi- Well 11
tions were 50°C for 10 sec, 95°C for 10 min, followed by 46 cycles Moderate 70
at 95°C for 15 sec and 60°C for 1 min. Colon, liver and lung RNAs Poor 8
Nodal status4 (n) 0.84
(Stratagene, La Jolla, CA) were used as control calibrators on each Negative 48
plate. All gene expression analyses were carried out in a blinded ⬍4 26
fashion with the laboratory investigators unaware of the clinical ⬎4 15
data. 1
Missing data: 1n⫽2; 2n⫽9; 3n⫽7; 4n⫽7.
Fluorescence in situ hybridization
Fluorescence in situ hybridization (FISH) was carried out using Statistics
the PathVysion HER-2 DNA Probe Kit (Vysis, Downers Grove, The association between HER-2 membrane and cytoplasmic
IL) according to the manufacturer’s instructions. Slides were eval- localization, determined by IHC, and gene amplification was an-
uated for HER-2 gene copy number using an epifluorescence alyzed using Fisher’s exact test. HER-2 mRNA levels were com-
microscope (Zeiss, Thornwood, NY). The PathVysion kit uses 2 pared between tumors found to display cell membrane vs. cyto-
directly labeled fluorescent DNA probes; LSI HER-2, which is plasmic staining using Fisher’s exact test. The localization of
specific for the HER-2 gene locus, and CEP17 that is specific for HER-2 protein expression in human colorectal cancers was corre-
the alpha satellite DNA sequence at the centromeric region of lated with clinicopathological variables as shown in Table I. The
chromosome 17. The expected ratio of LSI HER-2 to CEP 17 is nonparametric Spearman’s correlation coefficient was used to test
2.0 for normal or unamplified breast tissue specimens. A ratio of for associations between HER-2 staining intensity and patient and
⬎2.0 was considered amplified. Signals were counted for 60 tumor tumor characteristics. The frequency of HER-2 membrane staining
nuclei within an area of invasive carcinoma. Signal enumeration in primaries vs. metastases was compared using Fisher’s exact test.
was carried out following the criteria established by Hopman et Statistical significance was defined as a p-value ⬍ 0.05.
al.40 Overlapping nuclei were not counted, and split signals were
counted as one chromosome component. Stromal and inflamma- RESULTS
tory cells were excluded from analysis on the basis of the mor- Colorectal cancer cell lines
phological features of their nuclei. HER-2 expression was analyzed by immunoblotting (IB) in 5
human colorectal cancer cell lines (HCA-7, HCT-116, HT-29,
Immunoelectron microscopy RKO, SW480) (Fig. 1a). A high level of HER-2 expression was
Tissues were fixed in 2% paraformaldehyde and 0.2% glutaral- found in HCA-7 cells, whereas a low level of HER-2 was found in
dehyde in phosphate buffer (pH 7.4) overnight at 4 – 6°C. After the other cell lines. Results for HER-2 protein expression were
dehydration in a series of ethyl alcohols while progressively low- confirmed using a second anti-HER-2 mAb in separate experi-
ering the temperature to ⫺20°C, the specimens were infiltrated and ments (data not shown). HER-2 was found to be phosphorylated in
embedded in LR White resin. Thin sections were mounted on HCA-7 and HT-29 cell lines (anti-phospho-erbB-2/Her-2 antibody
nickel grids and pretreated in citrate buffer (pH 6) at 100°C for 10 against Y1248; data not shown). None of the colon cancer cell
min and cooled for 15 min. Non-specific binding sites were lines showed HER-2 amplification in contrast to SKBR3 breast
blocked in 0.1 M glycine for 15 min and in PBS with 0.05% cancer cells (control) using FISH analysis. IHC was then used to
Tween 20 (PBST) and 2% normal goat serum for 15 min. Grids determine the cellular localization of HER-2 proteins. HER-2
were incubated with the same anti-HER-2 monoclonal antibody staining was detected predominantly in the tumor cell cytoplasm
used for IHC and immunoblotting and results were confirmed although some membrane staining was also seen in the cell lines
using another anti-HER-2 antibody (NCL-CB11; Vector Labora- examined, as shown for HCA-7 cells (Fig. 2h). Human breast
tories) for 3 hr at room temperature, rinsed in PBST, and incubated cancer cell lines with high (SKBR-3) and low (MDA-MB-231)
for 60 min in secondary goat anti-mouse conjugated to 5 nm HER-2 expression were used as controls (Figs. 1a, 2i).
colloidal gold. After rinsing grids in PBST, grids were rinsed in To further analyze the cellular localization of HER-2, we carried
filtered water and silver enhanced for 20 min. Sections were out a cellular fractionation experiment using HCA-7 and HT-29
stained in uranyl acetate and lead citrate and examined by trans- cells (Fig. 1b). HER-2 proteins were detected in both the mem-
mission electron microscopy. HER-2 localization was detected by brane and cytosolic fractions in both cell lines, as also shown for
the presence of colloidal gold particles. SKBR-3 breast cancer cells as reported previously.41 Furthermore,
HER-2 was phosphorylated in the membrane fraction in these cell
Association with clinicopathological variables lines (data not shown).
HER-2 protein expression was analyzed in relation to the fol- Human colorectal cancers
lowing variables: tumor stage, histological grade, lymph node HER-2 protein expression. HER-2 protein expression and local-
status and tumor site (proximal, distal or rectal) (Table I). ization were analyzed in 96 primary, human colorectal adenocar-
 HER-2 (c-erbB-2) EXPRESSION IN COLORECTAL CANCER
FIGURE 1 – (a) Immunoblot analysis of HER-2 protein expression in
human colorectal carcinoma cell lines. All cell lines examined were
found to expressed HER-2 proteins. SKBR-3 and MDA-MB-231
breast cancer cell lines were used as positive and negative controls,
respectively. (b) Fractionation of HCA-7 and HT-29 cell lines dem-
onstrates HER-2 expression in both membrane/cytoskeleton (M) and
the cytosolic (C) compartments of both cell lines. A similar distribu-
tion is shown for SKBR-3 breast cancer cells, as described previously.41
cinomas and in 25 metastases by IHC. Patient characteristics are
shown in Table I. In 19 patients, both primary tumors and syn-
chronous metastases were available for analysis. Predominant
HER-2 membranous staining was detected in only 5 of 96 (5.2%)
primaries and in 3 of 25 (12%) hepatic metastases (p ⫽ 0.36). In
cases with membranous HER-2 staining, expression was detected
in a majority of malignant cells and was strong (3⫹) in all cases
(Fig. 2a). Some cases with predominant cell membrane staining
also showed cytoplasmic HER-2 (Fig. 2b,c). A predominant cyto-
plasmic HER-2 staining pattern was detected in 61 of 96 (63.5%)
primary tumors (Fig. 2d, Table II) Staining was generally diffuse
and intensity was medium (2⫹; n ⫽ 52) or strong (3⫹; n ⫽ 9). In
some of these cases, a focus of ⬍10% of tumor cells expressed
HER-2 in the cell membrane. To further support the presence of
cytoplasmic staining, a subset of tumors were stained with a
second anti-HER-2 mAb and identical results were found (see
Material and Methods; data not shown). In metastases, diffuse
cytoplasmic staining was detected in 17 of 25 (68%) cases and 5
cases were immunonegative (Table II). To confirm cytoplasmic
HER-2 localization, immunoelectron microscopy was carried out
as outlined below.
Electron microscopy
A colorectal carcinoma demonstrating cytoplasmic immunore-
activity for HER-2 was examined by immunoelectron microscopy
to determine the subcellular localization of HER-2 (Fig. 3). HER-2
expression, indicated by colloidal gold particles, was seen within
the tumor cell cytoplasm with the following subcellular localiza-
tion. HER-2 was detected within rough endoplasmic reticulum
(RER), especially within the lumen of vesicular RER. As shown,
the cisternae are dilated and form large sacs within which HER-2
is detected and is consistent with the localization of newly syn-
thesized protein (Fig. 3). Ribosomes can be seen to sit on the outer
543
surfaces of the sacs or cisternae. HER-2 was also detected in
cytosolic vacuoles within cells. Additionally, HER-2 was found on
the plasma membrane and at desmosomes representing membranes
at the intercellular junction. Gold particles were also seen labeling
the mitochondrial cristae. The same anti-HER-2 antibody chosen
for IHC and immunoblotting was utilized and consistent results
were found with another anti-HER-2 antibody (NCL-CB 11). No
signal was detected in sections where the primary antibody had
been omitted.
Immunoblotting
We determined the relative level of HER-2 expression in tumors
compared to normal colorectal epithelia. Immunoblotting was car-
ried out on 7 pairs of frozen colorectal cancer specimens that were
tumor enriched and adjacent normal-appearing mucosa. A single
band of 185 kDa was detected in all 7 tumors and in normal
adjacent tissue examined (Fig. 4). The level of HER-2 in tumors
was increased relative to adjacent normal tissue in 3 of 7 (43%)
cases and interestingly, was decreased in 4 of 7 (57%) cases
indicating heterogeneity of expression. Normal colorectal epithelia
expressed HER-2 in all cases examined. To determine whether
HER-2 is tyrosine phosphorylated, a pan-phosphotyrosine anti-
body and an antibody specifically recognizing residue Y1248 were
utilized. Phosphorylated HER-2 was detected in 4 of 7 tumors and
in 6 of 7 adjacent normal tissue specimens (Fig. 4). Similar results
were found for both p-HER-2 antibodies (data not shown).
HER-2 mRNA expression
We compared the level of HER-2 mRNA in tumors with cell
membrane vs. cytoplasmic staining (Table II). Quantitative real-
time RT-PCR (TaqMan) was carried out for analysis of HER-2
mRNA in archival primary colorectal cancers that had also been
analyzed for HER-2 by IHC. All available cases with membrane
staining were analyzed and a random sample of cases with cyto-
plasmic staining were examined. HER-2 mRNA was detected in
all tumors analyzed (n ⫽ 25) that included both membrane (n ⫽ 4)
and cytoplasmic (n ⫽ 21) cases [Table II]. A 12.7-fold increase in
HER-2 mRNA levels was found in tumors with membrane staining
relative to those with cytoplasmic immunoreactivity (r ⫽ 0.66,
p ⫽ 0.001). When comparing HER-2 mRNA levels in primaries
vs. metastases, increased mRNA levels were found in metastases
but did not reach statistical significance (Table II). We also com-
pared HER-2 mRNA levels in primary tumors with their corre-
sponding metastases (n ⫽ 7) from the same patients, and similar
HER-2 expression levels (p ⫽ NS; data not shown) were found.
HER-2 gene amplification
None of the 5 colorectal cancer cell lines examined showed
HER-2 gene amplification. We also analyzed HER-2 amplification
in 22 primary colorectal cancers using FISH. These cases had been
previously analyzed for HER-2 by IHC [membrane (n ⫽ 6),
cytoplasmic (n ⫽ 12), and negative (n ⫽ 4)]. Membrane by not
cytoplasmic HER-2 staining was strongly associated with gene
amplification (p ⫽ 0.007). Whereas all but one of the membrane-
stained colorectal cancers showed HER-2 gene amplification, none
of the cytoplasmic or negatively-stained cases were amplified
(Table II).
Normal colorectal mucosa
Cytoplasmic HER-2 staining was uniformly detected in normal
colorectal epithelia adjacent to cancers when present on the same
tissue sections (Fig. 2e). HER-2 staining intensity was increased in
crypt epithelial cells in the superficial compartment, including cells
at or near the luminal surface. This region corresponds to the
location of nonproliferating and differentiated colonocytes. Given
these findings in normal tissue adjacent to tumor, we sought to
compare them with normal mucosa from non-cancer patients.
Seven cases of normal colonic mucosa from non cancer patients
were obtained. HER-2 expression was detected in all specimens
544 HALF ET AL.

FIGURE 2 – Immunoperoxidase staining for HER-2 demonstrates localization to the cell membrane (a), cell membrane and cytoplasm (b,c),
or cytoplasm (d) of human colorectal carcinomas. (e) Normal colorectal mucosa with cytoplasmic HER-2 staining in colonic crypts. (f) HER-2
negative human colorectal cancer. (g) Human breast carcinoma with strong (3⫹) HER-2 membrane staining (positive control). (h) HCA-7 colon
cancer cell line with predominant cytoplasmic HER-2 staining. (i) SKBR-3 breast cancer cell line displays membrane HER-2 staining, and
MDA-MB-231 (insert), was negative for HER-2 (cell line controls).

TABLE II – HER-2 CELLULAR LOCALIZATION

Membrane1 Cytoplasmic Negative n

Immunoreactivity
Primary 5 (5.2%) 61 (63.5%) 30 (31%) 96
Metastases 3 (12%) 17 (68%) 5 (20%) 25
Gene amplification2,3
Primary 4/5 (80%) 0/12 0/4 21
Metastases 3/3 (100%) 0/1 ND 4
mRNA *levels3,4
Primary 0.456 (n ⫽ 3) 0.037 (n ⫽ 14) ND 17
Metastases 1.1 (n ⫽ 1) 0.06 (n ⫽ 7) ND 8
1
3 ⫹ staining intensity.–2Determined by FISH.–3Randomly selected subset of available cases showing
staining pattern outlined above.–4Mean relative values determined by RT-PCR. ND, not done.

and the pattern of expression was similar to that found for normal
tissue adjacent to cancer (data not shown).
Association with clinicopathological variables
Membrane HER-2 staining and gene amplification were de-
tected only in Dukes’ C or D (TNM Stage III or IV) primary
tumors or in hepatic metastases. Again, intense membrane HER-2
staining was increased 3 of 25 (12%) metastases relative to 5 of 96
(5.2%) primary tumors (p ⫽ 0.36). All membrane-staining cases
showed moderate tumor cell differentiation. We also determined
the association between cytoplasmic HER-2 expression in primary
tumors and clinicopathological variables (Table I). HER-2 over-
expression was positively correlated with tumor differentiation
status (p ⫽ 0.018). In this regard, tumors with well or moderate
differentiation more frequently expressed cytoplasmic HER-2 than
did poorly differentiated tumors. No relationship was found be-
tween cytoplasmic HER-2 and tumor stage, lymph node involve-
ment, or tumor site (Table I).
DISCUSSION
We found that colorectal cancer cell lines and human tumors
constitutively express the HER-2 receptor. In primary colorectal
cancers, strong membranous HER-2 staining was detected in only
 HER-2 (c-erbB-2) EXPRESSION IN COLORECTAL CANCER
FIGURE 3 – (a–f) Immunoelectron microscopy of a colorectal ade-
nocarcinoma. The subcellular localization of HER-2 proteins is dem-
onstrated by colloidal gold labeling (black dots; arrows). Within tumor
cells, HER-2 was detected in plasma membranes (a), rough endoplas-
mic reticulum (b), mitochondrial cristae (c), intercellular plasma mem-
branes (d,e), and within the lumen of vesicular and dilated rough endo-
plasmic reticulum (f). Results are shown for two anti-HER-2 monoclonal
antibodies (see Material and Methods) that demonstrated similar localiza-
tion results. Transmission electron microscopy; bar ⫽ 100 nm.
5% of tumors that also showed HER-2 gene amplification. Mem-
brane but not cytoplasmic HER-2 localization was strongly asso-
ciated with gene amplification (p ⫽ 0.007). The low frequency of
HER-2 membrane staining and its association with gene amplifi-
cation are consistent with are recent report by Nathanson et al.42
HER-2 mRNA levels in these tumors were increased 12.7-fold
relative to tumors with cytoplasmic HER-2 staining (r ⫽ 0.66, p ⫽
0.001). HER-2 cell membrane staining was more frequent (12%)
in hepatic metastases compared to primary tumors (5%), but this
result was not statistically significant (p ⫽ 0.36). These data define
a subset of colorectal cancers where HER-2 overexpression may
be a therapeutic target as shown in human breast cancers. Although
only 5% of human colon cancers displayed strong membrane
staining and HER-2 amplification, this corresponds to 7,375 pa-
tients from an estimated 147,500 colorectal cancers that will be
diagnosed in the U.S. in 2003.43 Interestingly, we found that
two-thirds of colorectal tumors analyzed showed unequivocal cy-
toplasmic HER-2 staining. A similar frequency of HER-2 staining
was found in primary tumors and metastases. Although, the extent
and intensity of HER-2 staining in some cytoplasmic cases was
similar to that found in membranous cases, significantly lower
levels of HER-2 mRNA were found in the former and none of
545
these cases demonstrated HER-2 amplification. HER-2 overexpres-
sion, however, can occur by mechanisms other than gene amplifica-
tion including transcriptional activation by other genes or posttrans-
lational events.44,45 To confirm the presence of cytoplasmic HER-2
and to explore the possibility that some degree of membrane local-
ization exists in these cases, we carried out immunoelectron micros-
copy. Using 2 anti-HER-2 antibodies, we detected HER-2 within the
lumen of vesicular RER consistent with the localization of newly
synthesized protein and in cytoplasmic vacuoles that can condense
proteins and move them to the membrane. HER-2 was also detected
on the plasma membrane and at desmosomes representing mem-
branes at the intercellular junction. Gold particles were also seen
labeling the mitochondrial cristae, as has been reported previously for
HER-2 in colon cancers.46,47 Consistent with our findings, HER-2 was
analyzed by EM in laryngeal squamous cell carcinomas and was
detected in the endoplasmic reticulum, nuclear envelope, and through-
out the cytoplasm on the ribosomes.48 These data confirm the pres-
ence of cytoplasmic HER-2 and demonstrate that some degree of
plasma membrane HER-2 expression is present in cases with predom-
inantly cytoplasmic staining.
We also studied the localization of HER-2 in colorectal
cancer cell lines. Fractionation of HCA-7 and HT-29 cells
exhibited HER-2 in both the membrane and cytosolic fractions,
as was shown for SKBR-3 cells in this and other reports.41 This
finding is consistent with HER-2 cellular localization as shown
by electron microscopy. In these nonamplified cell lines, anti-
HER-2 antibodies have been shown to inhibit cell prolifera-
tion,32,49,50 and to retard the growth of HCA-7 colon tumor
xenografts.32 HER-2 has been detected in cytoplasmic vesicles
in mouse fibroblasts, mammary epithelial cells and SKBR3
cells using fluorescence microscopy.51 Detection of cytoplasmic
HER-2 is consistent with evidence that the ErbB receptor fam-
ily members undergo constant cycling between the plasma
membrane and endosomal compartment and are involved in
membrane trafficking.41,52 In this regard, treatment of SKBR-3
breast cancer cells with the benzoquinone geldanamycin was
shown to prevent translocation of newly synthesized HER-2 to
the plasma membrane and trapped it in cytoplasmic or-
ganelles.41 Importantly, other HER family members have also
been detected in the cytoplasm of human colorectal and other
cancers. In this regard, McKay et al.53 detected cytoplasmic
HER-1 staining in 108 of 181 (60%) human colorectal cancers.
Another report found HER-1 to be expressed frequently in the
cytoplasm of human squamous cell carcinoma of the lung.31 A
predominantly cytoplasmic staining pattern for HER-3 and
HER-4 proteins have been detected in human breast cancers
where approximately 50% of cases overexpressed these recep-
tors.54 These data indicate that in addition to HER-2, other HER
family members also demonstrate cytoplasmic localization.
HER-2 was analyzed by immunoblotting in 7 tumor and normal
pairs. The level of HER-2 expression was heterogeneous in that it was
overexpressed in 3 tumors yet downregulated in 4 of 7 cases relative
to adjacent normal mucosa that uniformly expressed HER-2 proteins.
We also analyzed the tyrosine phosphorylation status of HER-2 using
an antibody against the most commonly phosphorylated residue,
Y1248, and a pan-phosphotyrosine antibody. Constitutive activation
of HER-2 was found in 4 of 7 tumors whereas the level of phosphor-
ylation exceeded that in normal tissue in only one tumor, activation is
the critical factor for cell signaling and the significance of the relative
level of phosphorylated HER-2 is unknown. In human breast cancers,
HER-2 phosphorylation (recognizing the Y1248 epitope) ranged from
12–35% of HER-2-positive tumors55,56 and was shown to correlate
with a higher percentage of positive tumor cells and with an adverse
outcome in node-positive patients.56
We found that cytoplasmic HER-2 staining correlated with
tumor differentiation, but not with other clinicopathological vari-
ables including tumor stage or nodal status. Specifically, colorectal
cancers with well or moderate differentiation more frequently
546 HALF ET AL.

FIGURE 4 – Immunoblot analysis of HER-2 and phosphorylated HER-2 (p-HER-2; Y1248, Upstate Biotechnology) expression in paired tumor
(T) and normal (N) adjacent mucosa from the same patients. All 7 tumors expressed HER-2 proteins. Overexpression of HER-2 was found in
3 of 7 tumors relative to normal mucosa whereas HER-2 was decreased relative to normal tissue in the other cases. p-HER-2, consistent with
HER-2 activation, was detected in 4 of 7 tumors as well as in normal mucosa. The EGF-stimulated epidermoid carcinoma A431 cell line (cell
lysate, Upstate Biotechnology) was used as a control for both HER-2 and p-HER-2. Similar results were found for p-HER-2 using a
pan-phosphotyrosine antibody (data not shown). ␤-actin served as a control for protein loading.

expressed cytoplasmic HER-2 proteins than did poorly differenti-
ated tumors (p ⫽ 0.018). Furthermore, we found that 31% of
colorectal cancers lacked HER-2 staining and that 4 of 7 tumors
showed downregulation of HER-2 relative to normal mucosa by
immunoblotting. These data suggest that cytoplasmic HER-2 func-
tions in the regulation of tumor cell differentiation and that loss of
this marker may accompany malignant progression. An association
between HER-2 and better differentiation has also been reported in
gastric57 and renal cell carcinomas58 and also for HER-1 in human
colorectal cancers.14 Membrane HER-2 overexpression and ampli-
fication in human breast cancers, however, is associated with lower
differentiation or high histologic grade.59 – 61
In normal colorectal mucosa, HER-2 was uniformly expressed
in crypt epithelial cells with staining intensity increased toward the
luminal surface. Localization of HER-2 corresponds to that of the
cdk inhibitor p21WAF1/Cip1 that is confined to differentiated epi-
thelial cells in normal colorectal epithelia as reported by our
laboratory62 and others.63 Interestingly, forced expression of
HER-2 has been shown to induce p21WAF1/Cip1 expression, Rb
phosphorylation, and differentiation in hormone-dependent
MCF-7 human breast cancer cells.64 Furthermore, a HER-2 recep-
tor ligand (gp30) inhibited the growth of breast cancer cells with
an apparent induction of differentiation.65 Taken together, our data
suggest that cytoplasmic HER-2 expression is a marker of tumor
cell differentiation whereas membrane overexpression and gene
amplification are likely to be associated with an oncogenic role in
human colorectal cancers. In this regard, membrane HER-2 over-
expression/amplification may correlate with tumor aggressiveness
although its low frequency in colorectal cancer limits such an
analysis. Evaluation of a much larger patient cohort would be
needed to further address this issue or alternatively, analysis of
anti-HER-2 antibodies in this patient subset may provide insights
into its role. Variable rates of HER-2 immunoreactivity in human
colon cancers have been reported in the literature.12–14,42,66,67 Fac-
tors contributing to variability in HER-2 expression frequency in
this malignancy include the lack of an adequate description of
protein localization. In this regard, the anti-HER-2 antibody used
for IHC in our study recognized 2 distinct staining patterns, i.e.,
membrane and cytoplasmic immunoreactivity, which were ana-
lyzed separately in relation to gene amplification, mRNA levels
and clinicopathologic variables. Other factors contributing to the
variability in prevalence of HER-2 expression include the use of
different primary antibodies and variations in immunohistochem-
ical methodology including the use of antigen retrieval. These
factors, in addition to small study sample sizes, may also account
for conflicting reports suggesting that HER-2 is associated with
adverse clinical outcome in some12–14 but not others studies14,66,67
in human colorectal cancers.
In summary, we found that only HER-2 membrane localization
is associated with gene amplification and high levels of HER-2
mRNA, but occurs in only 5% of human colorectal cancers. In
contrast, cytoplasmic HER-2 localization is frequently detected
and a functional role is suggested by its association with tumor
differentiation. These data suggest that HER-2 membrane overex-
pression and gene amplification are associated with an oncogenic
role whereas cytoplasmic HER-2 is a marker of differentiation.
ACKNOWLEDGMENT
The authors wish to thank L. Wussow for her very capable
secretarial assistance. Supported by NIH grant R01 DK56378-04
and awards from the Kadoorie Human Cancer Genetics initiative
and the National Colorectal Cancer Alliance (all to F.A.S.).

REFERENCES

1. Pinkas-Kramarski R, Soussan L, Waterman H, Levkowitz G, Alroy I,
Klapper L, Lavi S, Seger R, Ratzkin BJ, Sela M, Yarden Y. Diver-
sification of Neu differentiation factor and epidermal growth factor
signaling by combinatorial receptor interactions. EMBO J 1996;15:
2452– 67.
2. Venkateswarlu S, Dawson DM, St. Clair P, Gupta A, Willson JK,
Brattain MG. Autocrine heregulin generates growth factor indepen-
dence and blocks apoptosis in colon cancer cells. Oncogene 2002;21:
78 – 86.
3. Pinkas-Kramarski R, Shelly M, Guarino BC, Wang LM, Lyass L,
Alroy I, Alimandi M, Kuo A, Moyer JD, Lavi S, Eisenstein M,
Ratzkin BJ, et al. ErbB tyrosine kinases and the two neuregulin
families constitute a ligand-receptor network. Mol Cell Biol 1998;18:
6090 –101.
4. Olayioye MA, Neve RM, Lane HA, Hynes NE. The ErbB signaling
network: receptor heterodimerization in development and cancer.
EMBO J 2000;19:3159 – 67.
5. Schlessinger J. Cell signaling by receptor tyrosine kinases. Cell 2000;
103:211–25.
6. Graus-Porta D, Beerli RR, Daly JM, Hynes NE. ErbB-2, the preferred
heterodimerization partner of all ErbB receptors, is a mediator of
lateral signaling. EMBO J 1997;16:1647–55.
7. Tzahar E, Waterman H, Chen X, Levkowitz G, Karunagaran D, Lavi
S, Ratzkin BJ, Yarden Y. A hierarchical network of interoceptor
interactions determines signal transduction by Neu differentiation
factor/neuregulin and epidermal growth factor. Mol Cell Biol 1996;
16:5276 – 87.
8. Akiyama T, Matsuda S, Namba Y, Saito T, Toyoshima K, Yamamoto
T. The transforming potential of the c-erbB-2 protein is regulated by
its autophosphorylation at the carboxyl-terminal domain. Mol Cell
Biol 1991;11:833– 42.
9. DiGiovanna MP, Lerman MA, Coffey RJ, Muller WJ, Cardiff RD,
Stern DF. Active signaling by Neu in transgenic mice. Oncogene
1998;17:1877– 84.
10. Segatto O, Lonardo F, Helin K, Wexler D, Fazioli F, Rhee SG, Di
Fiore PP. erbB-2 autophosphorylation is required for mitogenic action
and high- affinity substrate coupling. Oncogene 1992;7:1339 – 46.
11. Ben-Levy R, Paterson HF, Marshall CJ, Yarden Y. A single auto-
 HER-2 (c-erbB-2) EXPRESSION IN COLORECTAL CANCER
phosphorylation site confers oncogenicity to the Neu/ErbB- 2 receptor
and enables coupling to the MAP kinase pathway. EMBO J 1994;13:
3302–11.
12. Kapitanovic S, Radosevic S, Kapitanovic M, Andelinovic S, Ferencic
Z, Tavassoli M, Primorac D, Sonicki Z, Spaventi S, Pavelic K,
Spaventi R. The expression of p185(HER-2/neu) correlates with the
stage of disease and survival in colorectal cancer. Gastroenterology
1997;112:1103–13.
13. Osako T, Miyahara M, Uchino S, Inomata M, Kitano S, Kobayashi M.
Immunohistochemical study of c-erbB-2 protein in colorectal cancer
and the correlation with patient survival. Oncology 1998;55:548 –55.
14. McKay JA, Loane JF, Ross VG, Ameyaw M-M, Murray GI, Cassidy
J, McLeod HL. c-erbB-2 is not a major factor in the development of
colorectal cancer. Br J Cancer 2002;86:568 –73.
15. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire
WL. Human breast cancer: correlation of relapse and survival with
amplification of the HER-2/neu oncogene. Science 1987;235:177– 82.
16. Pegram MD, Pauletti G, Slamon DJ. HER-2/neu as a predictive
marker of response to breast cancer therapy. Breast Cancer Res Treat
1998;52:65–77.
17. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde
A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, Norton
L. Use of chemotherapy plus a monoclonal antibody against HER2 for
metastatic breast cancer that overexpresses HER2. N Engl J Med
2001;344:783–92.
18. Vogel CL, Cobleigh MA, Tripathy D, Gutheil JC, Harris LN, Fehren-
bacher L, Salamon DJ, Murphy M, Novotny WF, Burchmore M, Shak
S, Stewart SJ, et al. Efficacy and safety of trastuzumab as a single
agent in first-line treatment of HER2-overexpressing metastatic breast
cancer. J Clin Oncol 2000;20:719 –26.
19. Ross JS, McKenna BJ. The HER-2/neu oncogene in tumors of the
gastrointestinal tract. Cancer Invest 2001;19:554 – 68.
20. Sasano H, Date F, Imatani A, Asaki S, Nagura H. Double immuno-
staining for c-erbB-2 and p53 in human stomach cancer cells. Hum
Pathol 1993;24:584 –9.
21. Micke P, Hengstler JG, Ros R, Bittinger F, Metz T, Gebhard S, Beeh
KM, Oesch F, Buhl R. c-erbB-2 expression in small-cell lung cancer
is associated with poor prognosis. Int J Cancer 2001;92:474 –9.
22. Zinner RG, Kim J, Herbst RS. Non-small cell lung cancer clinical
trials with trastuzumab: their foundation and preliminary results. Lung
Cancer 2002;37:17–27.
23. Gu K, Mes-Masson AM, Gauthier J, Saad F. Overexpression of
her-2/neu in human prostate cancer and benign hyperplasia. Cancer
Lett 1996;99:185–9.
24. Morote J, de Torres I, Caceres C, Vallejo C, Schwartz S, Jr., Reventos
J. Prognostic value of immunohistochemical expression of the c-
erbB-2 oncoprotein in metastasic prostate cancer. Int J Cancer 1999;
84:421–5.
25. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE,
Levin WJ, Stuart SG, Udove J, Ullrich A, et al. Studies of the
HER-2/neu proto-oncogene in human breast and ovarian cancer. Sci-
ence 1989;244:707–12.
26. Yazici H, Dolapcioglu K, Buyru F, Dalay N. Utility of c-erbB-2
expression in tissue and sera of ovarian cancer patients. Cancer Invest
2000;18:110 – 4.
27. Keshgegian AA, Cnaan A. erbB-2 oncoprotein expression in breast
carcinoma. Poor prognosis associated with high degree of cytoplasmic
positivity using CB-11 antibody. Am J Clin Pathol 1997;108:456 – 63.
28. Taylor SL, Platt-Higgins A, Rudland PS, Winstanley JH, Barraclough
R. Cytoplasmic staining of c-erbB-2 is not associated with the pres-
ence of detectable c-erbB-2 mRNA in breast cancer specimens. Int J
Cancer 1998;76:459 – 63.
29. Zschiesche W, Schonborn I, Minguillon C, Spitzer E. Significance of
immunohistochemical c-erbB-2 product localization pattern for prog-
nosis of primary human breast cancer. Cancer Lett 1994;81:89 –94.
30. Harpole DH Jr, Marks JR, Richards WG, Herndon JE 2nd, Sugarbaker
DJ. Localized adenocarcinoma of the lung: oncogene expression of
erbB-2 and p53 in 150 patients. Clin Cancer Res 1995;1:659 – 64.
31. Piyathilake CJ, Frost AR, Manne U, Weiss H, Bell WC, Heimburger
DC, Grizzle WE. Differential expression of growth factors in squa-
mous cell carcinoma and precancerous lesions of the lung. Clin
Cancer Res 2002;8:734 – 44.
32. Mann M, Sheng H, Shao J, Williams CS, Pisacane PI, Sliwkowski
MX, DuBois RN. Targeting cyclooxygenase 2 and HER-2/neu path-
ways inhibits colorectal carcinoma growth. Gastroenterology 2001;
120:1713–9.
33. Half EE, Tang X, Spivak-Kroizman T, Broaddus R, Ayers GD,
Sinicrope FA. HER-2/neu expression and activation in human colo-
rectal cancers. Proc Am Assoc Cancer Res 2002;43:603.
34. Kirkland SC. Dome formation by a human colonic adenocarcinoma
cell line (HCA-7). Cancer Res 1985;45:3790 –5.
35. Sheng H, Shao J, Kirkland SC, Isakson P, Coffey RJ, Morrow J,
547
Beauchamp RD, DuBois RN. Inhibition of human colon cancer cell
growth by selective inhibition of cyclooxygenase-2. J Clin Invest
1997;99:2254 –9.
36. Morgan JM. A protocol for preparing cell suspensions with formalin
fixation and paraffin embedding which minimizes the formation of
cell aggregates. J Cell Pathol 2001;5:171– 80.
37. Beahrs OH. Staging of cancer of the colon and rectum. Cancer
1992;70:1393– 6.
38. Lord RV, Salonga D, Danenberg KD, Peters JH, DeMeester TR, Park
JM, Johansson J, Skinner KA, Chandrasoma P, DeMeester SR, Brem-
ner CG, Tsai PI, et al. Telomerase reverse transcriptase expression is
increased early in the Barrett’s metaplasia, dysplasia, adenocarcinoma
sequence. J Gastrointest Surg 2000;4:135– 42.
39. Gibson UE, Heid CA, Williams PM. A novel method for real time
quantitative RT-PCR. Genome Res 1996;6:995–1001.
40. Hopman AH, Ramaekers FC, Raap AK, Beck JL, Devilee P, van der
Ploeg M, Vooijs GP. In situ hybridization as a tool to study numerical
chromosome aberrations in solid bladder tumors. Histochemistry
1988;89:307–16.
41. Chavany C, Mimnaugh E, Miller P, Bitton R, Nguyen P, Trepel J,
Whitesell L, Schnur R, Moyer J, Neckers L. p185erbB2 binds to
GRP94 in vivo. Dissociation of the p185erbB2/GRP94 heterocomplex
by benzoquinone ansamycins precedes depletion of p185erbB2. J Biol
Chem 1996;271:4974 –7.
42. Nathanson DR, Culliford AT IV, Shia J, Chen B, D’Alessio M, Zeng
Z-S, Nash GM, Gerald W, Barany F, Paty PB. HER 2/neu expression
and gene amplification in colon cancer. Int J Cancer Res 2003;105:
796 – 802.
43. Jemal A, Murray T, Samuels A, Ghafoor A, Ward E, Thun MJ.
Cancer statistics, 2003. CA Cancer J Clin 2003;53:5–26.
44. Joh J-W, Noh D-Y, Bae CD, Choi K-J, Park J-B. Amplification and
over-expression of erbB-2 oncogene in primary human breast tumors.
Exp Mol Med 1996;28:47–53.
45. Kraus MH, Popescu NC, Amsbaugh SC, King CR. Overexpression of
the EGF receptor-related proto-oncogene erbB-2 in human mammary
tumor cell lines by different molecular mechanisms. EMBO J 1987;
6:605–10.
46. Quatacker J, De Potter C, Van Daele S, Roels H. The selective
counterstaining of the plasma membrane improves the immunoelec-
tron microscopic detection of neu protein at the cell border. Acta
Histochem Suppl 1990;40:105–7.
47. De Potter CR, Quatacker J, Maertens G, Van Daele S, Pauwels C,
Verhofstede C, Eechaute W, Roels H. The subcellular localization of
the neu protein in human normal and neoplastic cells. Int J Cancer
1989;44:969 –74.
48. Grzanka A, Skok Z, Janiak A, Grzanka D. Immunoelectron microscop-
ical identification of the c-erbB-2 oncoprotein in patients with laryngeal
squamous cell carcinoma. Acta Histochem 2000;102:403–11.
49. Wong RF, Kuang J, Xiufen L, Kuwada S. Modulation of growth
factor receptor expression and function by integrins in colon cancer
cells. Am Gastroenterol Assn 2003;124(Suppl.1):A57.
50. Half E, Sun Y, Sinicrope FA. Anti-HER-2 antibody inhibits COX-2
expression and reduces survival of human colon cancer cells. AACR
Frontiers Cancer Prevent Conf 2002;145.
51. Worthylake R, Opresko LK, Wiley HS. ErbB-2 amplification inhibits
downregulation and induces constitutive activation of both ErbB-2
and epidermal growth factor receptors. J Biol Chem 1999;274:8865–
74.
52. Wiley HS. Trafficking of the ErbB receptors and its influence on
signaling. Exp Cell Res 2003;284:78 – 88.
53. McKay JA, Murray LJ, Curran S, Ross VG, Clark C, Murray GI,
Cassidy J, McLeod HL. Evaluation of the epidermal growth factor
receptor (EGFR) in colorectal tumours and lymph node metastases.
Eur J Cancer 2002;38:2258 – 64.
54. Esteva FJ, Hortobagyi GN, Sahin AA, Smith TL, Chin DM, Liang
S-Y, Pusztai L, Buzdar A, Bacus SS. Expression of cerbB/HER
receptors, heregulin and p38 in primary breast cancer using quantita-
tive immunohistochemistry. Pathol Oncol Res 2001;7:171–7.
55. DiGiovanna MP, Carter D, Flynn SD, Stern DF. Functional assay for
HER-2/neu demonstrates active signaling in a minority of HER-2/
neu-overexpressing invasive human breast tumours. Br J Cancer
1996;74:802– 6.
56. Thor AD, Liu S, Edgerton S, Moore D 2nd, Kasowitz KM, Benz CC,
Stern DF, DiGiovanna MP. Activation (tyrosine phosphorylation) of
ErbB-2 (HER-2/neu): a study of incidence and correlation with out-
come in breast cancer. J Clin Oncol 2000;18:3230 –9.
57. Oshima CT, Lanzoni VP, Iriya K, Forones NM. C-erbB2 oncoprotein
expression in gastric carcinoma: correlation with clinical stage and
prognosis. Int J Biol Markers 2001;16:250 – 4.
58. Rotter M, Block T, Busch R, Thanner S, Hofler H. Expression of
HER-2/neu in renal-cell carcinoma. Correlation with histologic sub-
types and differentiation. Int J Cancer 1992;52:213–7.
548 HALF ET AL.
59. Moriki T, Takahashi T, Hiroi M, Yamane T, Hara H. Histological
grade in invasive ductal carcinoma of breast correlates with the
proliferative activity evaluated by BrdU: an immunohistochemical
study including correlations with p53, c-erbB2, and estrogen receptor
status. Pathol Int 1996;40:417–25.
60. Zhang K, Salto-Tellez M, Do E, Putti TC, Koay ESC. Evaluation of
HER-2/neu oncogene status in breast tumors on tissue microarrays.
Hum Pathol 2003;34:362– 8.
61. Warnberg F, Nordgren H, Bergkvist L, Holmberg L. Tumour markers
in breast carcinoma correlate with grade rather than with invasiveness.
Br J Cancer 2001;85:869 –74.
62. Sinicrope FA, Roddey G, Lemoine M, Ruan S, Stephens LC, Frazier ML,
Shen Y, Zhang W. Loss of p21WAF1/Cip1 protein expression accom-
panies progression of sporadic colorectal neoplasms but not hereditary
nonpolyposis colorectal cancers. Clin Cancer Res 1998;4:1251– 61.
63. el-Deiry WS, Tokino T, Waldman T, Oliner JD, Velculescu VE,
Burrell M, Hill DE, Healy E, Rees JL, Hamilton SR, et al. Topological
control of p21WAF1/CIP1 expression in normal and neoplastic tis-
sues. Cancer Res 1995;55:2910 –9.
64. Giani C, Casalini P, Pupa SM, De Vecchi R, Ardini E, Colnaghi MI,
Giordano A, Menard S. Increased expression of c-erbB-2 in hormone-
dependent breast cancer cells inhibits cell growth and induces differ-
entiation. Oncogene 1998;17:425–32.
65. Bacus SS, Huberman E, Chin DM, Kiguchi K, Simpson S, Lippman
M, Lupu R. A ligand for the erbB-2 oncogene product (gp30) induces
differentiation of human breast cancer cells. Cell Growth Differ
1992;3:401–11.
66. Chamberlain NL, Ward RL, Hawkins NJ. Clinicopathological signif-
icance of erbB-2 expression in colorectal carcinoma. Oncol Rep
1999;6:527–31.
67. Berney C, Fisher RJ, Yang JL, Russell PJ, Crowe PJ. Protein markers
in colorectal cancer. Ann Surg 1999;230:179 – 84.