Isolation and characterization of new

polymorphic simple sequence repeat loci

in grape ( V i t i s vinifera L.)
J.E. Bowers, G.S. Dangl, R. Vignani, and C.P. Meredith
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12

Abstract: Four new simple sequence repeat (SSR) loci (designated VVMD5, VVMD6, VVMD7, and VVMD8)
were characterized in grape and analyzed by silver staining in 77 cultivars of Vitis vinifera. Amplification
products ranged in size from 141 to 263 base pairs (bp). The number of alleles observed per locus ranged from
5 to 1 1 and the number of diploid genotypes per locus ranged from 13 to 27. At each locus at least 75% of the
cultivars were heterozygous. Alleles differing in length by only 1 bp could be distinguished by silver staining,
and size estimates were within 1 or 2 bp, depending on the locus, of those obtained by fluorescence detection at
previously reported loci. Allele frequencies were generally similar in wine grapes and table grapes, with some
exceptions. Some alleles were found only in one of the two groups of cultivars. All 77 cultivars were distinguished
by the four loci with the exception of four wine grapes considered to be somatic variants of the same cultivar,
'Pinot noir', 'Pinot gris', 'Pinot blanc', and 'Meunier'; two table grapes that are known to be synonymous,
'Keshmesh' and 'Thompson Seedless'; and three table grapes, 'Dattier', 'Rhazaki Arhanon', and 'Markandi', the
first two of which have been suggested to be synonymous. Although the high polymorphism at grape SSR loci
suggests that very few loci would theoretically be needed to separate all cultivars, the economic and legal
significance of grape variety identification requires the increased resolution that can be provided by a larger
For personal use only.

number of loci. The ease with which SSR markers and data can be shared internationally should encourage their
broad use, which will in turn increase the power of these markers for both identification and genetic analysis of
grape.
Key words: grape, Vitis, microsatellite, simple sequence repeat, DNA typing, identification.

Resume : Quatre nouveaux loci microsatellites (nommks VVMD5, VVMD6, VVMD7 et VVMD8) ont kt6
caractkrisks chez la vigne. Ces loci ont kt6 examinks par coloration a l'argent chez 77 ckpages du Vitis vinifera.
La taille des produits d'amplification variait entre 141 et 263 paires de bases (pb). Le nombre d'allkles observks
par locus variait entre 5 et 11 alors que le nombre de gknotypes diploi'des variait entre 13 et 27 par locus.
A chaque locus, au moins 75% des cultivars ktaient hktkrozygotes. Des allkles ne diffkrant que par une seule
paire de bases pouvaient Stre distinguks par coloration a l'argent et l'estimation de la taille des produits ktait
juste a une ou deux paires de bases prks, dkpendant du locus, comparativement aux estimations obtenues suite a la
dktection par fluorescence au niveau de loci rapportks prkckdemment. La frkquence des allkles ktait gkniralement
similaire chez les raisins de table et les raisins a vin, a quelques exceptions prks. Certains allkles n'itaient
prksents que chez I'un des deux groupes de cultivars. Les 77 cultivars ont pu 2tre distinguks griice aux quatre
loci, a I'exception de quatre raisins a vins considirks comme des phknovariants du mSme cultivar, 'Pinot noir',
'Pinot gris', 'Pinot blanc', 'Meunier'; de deux raisins de table qui sont connus comme ktant synonymes,
'Keshmesh' et 'Thompson Seedless'; et de trois raisins de table, 'Dattier', 'Rhazaki Arhanon' et 'Markhandi',
dont les deux premiers ont kt6 suggkrks comme ktant synonymes. Bien que le haut niveau de polymorphisme
rkvklk par ces microsatellites laisse croire qu'un petit nombre de loci serait suffisant, en thkorie, pour skparer
tous les cultivars, les enjeux kconomiques et lkgaux de l'identification des cultivars chez la vigne exige une
rksolution accrue qui pourra Stre fournie par un plus grand nombre de loci. La facilitk d'kchange des microsatellites
et des donnkes qui dkcoulent de leur emploi devrait encourager leur utilisation, ce qui permettra d'augmenter
I'importance de ces marqueurs pour les fins d'identification et d'analyse gknktique de la vigne.
Mots cle's : vigne, Vitis, microsatellite, empreintes gknktiques, identification variktale.
[Traduit par la Rkdaction]

I Corresponding Editor: J.P. Gustafson.

Received November 3, 1995. Accepted April 4, 1996.

I1 'J.E. Bowers, G.S. Dangl, R. vignani,l and C.P. Meredith. Department of Viticulture and Enology, University of
California, Davis, CA 95616, U.S.A.
Present address: Dipartimento di Biologia Ambientale, Universita degli Studi di Siena, 53100 Siena, Italy.

Genome, 39: 628-633 (1996). Printed in Canada 1 ImprimC au Canada

 Bowers et al.

Introduction Table 1. Vitis vinifera cultivars analyzed in this study

Accurate cultivar identification is particularly important in Wine grapes

grape. Not only are there at least 5000 cultivars of Vitis Aligote Grenac he Pinot blanc
vinifera (Alleweldt 1988), many of which are not easily dis- Barbera Lambrusco Pinot gris
tinguished morphologically, but many cultivars have been Black Malvoisie Malbec Pinot noir
distributed throughout the world and have acquired new Burger Malvasia bianca Refosco
names in the process. In many countries, wine is usually Cabernet franc Mataro Riesling
identified by its predominant g r a p e cultivar (e.g.,
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12

Cabernet Sauvignon Melon Saint Emilion

'Chardonnay', 'Cabernet Sauvignon') and accurate varietal Carignane Merlot Sangiovese
labeling is a legal requirement. In countries where wine is Charbono Meunier Sauvignon blanc
commonly identified by its geographic origin, as in the Chardonnay Monastrell Sauvignon vert
European Union, varietal composition is dictated by law. Chasselas dork Muscadelle Semillon
International trade regulations regarding wine labeling have Chenin blanc Muscat blanc Sylvaner
further drawn attention to identity issues, such as the use of Colombard Napa Gamay Syrah
multiple names for the same cultivar (e.g., 'Syrah' in France Dolcetto Nebbiolo Lampia Viognier
and 'Shiraz' in Australia) or a single name for several genet- Folle blanche Palomino Zinfandel
ically distinct cultivars (e.g., 'Petite Sirah' in the U.S.A.). Gamay noir Petit Verdot
DNA typing technology offers an objective method for Gewiirztraminer Petite Sirah
characterizing cultivars. The international significance of
accurate grape identification warrants the development and Table grapes
dissemination of a standard DNA typing method that can be Avgustiatico Hakiki Rhasaki Anatolico
adopted and shared by public laboratories around the world. Aricaras Keshmesh Rhazaki Arhanon
Restriction fragment length polymorphism (RFLP) analysis Black Corinth Kontehgalo Rhazaki Mavro
is robust and reliable (Bowers et al. 1993), but is slow, Chaouchi Politico Kri tico Rodi tes
For personal use only.

laborious, and often involves the use of radioactivity. More Chrisostaphylo Kurutaktas Sidezitis
importantly from the perspective of international cooper- Cornichon Markandi Sidezitis Proimo
ation, the use of the same markers by two laboratories Daphne Monukka Thompson Seedless
requires the physical exchange of DNA probes. Random Dattier Perla di Csaba Vustolethi
amplified polymorphic DNA (RAPD) analysis, on the other Dermatis Petinos Vuthomato
hand, is not only much faster and simpler but markers can Eftakilo Psevthosirico Yourutico
be s h a r e d s i m p l y by t h e c o m m u n i c a t i o n of p r i m e r Fraula Kini
sequences. Both methods, however, are limited by the
necessity to compare genetically ambiguous gel images in Note: For the wine grapes, names and spelling are those in common
order to exchange results. R A P D results, in particular, use in the United States. For the table grapes, the names and spelling
often vary between laboratories (Biischer et al. 1993). are those that accompanied each accession when it was introduced into
the University of California at Davis collection.
The advantages of simple sequence repeat (SSR) markers
for grape cultivar identification (and other genetic analyses)
have been thoroughly articulated by Thomas et al. (1994).
We report here the development of four new SSR loci in
Of particular importance is the ease with which both mark-
grape and describe allelic polymorphism at these loci in
ers and results can be exchanged internationally. Like
a group of 77 cultivars of L! vinifera. We further demon-
RAPDs, SSR markers can be shared by the communication
strate the use of silver staining to resolve alleles.
of primer sequences. But unlike RAPDs, SSR results can
be objectively expressed as allele lengths and can thus be
communicated as quantitative data rather than as images of Materials and methods
band patterns. T h e availability of SSR markers is limited Plant material and DNA
by the difficulty with which they are developed. The process Plant material was obtained from the vineyards of the University
of discovering and sequencing SSR regions is beyond the of California at Davis and the National Clonal Germplasm
scope of many grape research groups and thus to date only Repository in Davis, California. Grapevine DNA was isolated
one laboratory has reported the development of grape SSR from shoot tips and young leaves as previously reported (Bowers
markers (Thomas and Scott 1993). et al. 1993). Seventy-seven cultivars were surveyed, including
The very large number of grape cultivars and the like- 46 wine grapes and 3 1 table grapes (Table I ) . Each cultivar
lihood that some of them are genetically very similar argues was analyzed at least twice, in some cases from independent
DNA preparations.
for an increased number of markers by which to improve
the resolution with which cultivars can be distinguished. The
Cloning and sequencing of SSR regions
legal requirements of grape and wine production and trade DNA from C! vinifera 'Pinot noir' was digested with TaqI and
bring an added level of scrutiny to questions of identity. separated on a 2% agarose gel. DNA fragments ranging in size
Grape DNA typing may in some cases be held to a very from 300 to 600 base pairs (bp) were purified from the gel
high standard and thus requires the high level of confidence and used to make a size fractionated genomic library with
that can be provided by a larger number of polymorphic pBluescript I1 SK + (Stratagene, La Jolla, California, U.S.A.)
markers. and XL-1 Blue bacteria. Bacterial clones were grown on
 630 Genome, Vol. 39, 1996

Table 2. Characteristics of 4 SSR loci analyzed in 77 cultivars of V vinifera.

No.of No.of %
Locus Primer (5'-3') Repeat Repeat typeu alleles genotypes Heterozygotes

VVMD5 CTAGAGCTACGCCAATCCAA ,
(CT),AT(CT), ATAG(AT), Compound 8 26 90%
TATACCAAAAATCATATTCCTAAA imperfect
VVMD6 ATCTCTAACCCTAAAACCAT (CT),C(CT),TTAG(CT)TAAT- Imperfect 5 13 93 %
CTGTGCTAAGACGAAGAAGA (CT),C(CT),C(CT),
,
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12

VVMD7 AGAGTTGCGGAGAACAGGAT (CT),, Perfect 11 27 84%

CGAACCTTCACACGCTTGAT
VVMD8 TAACAAACAAGAAGAGGAAT (TC),, ,(TA), Compound 6 13 75%
AGCACATCCACAACATAATG perfect

Table 3. Allelic frequencies in 77 V vinifera cultivars analyzed at 4 SSR loci (VVMD5, VVMD6,
VVMD7, and VVMD8).

VVMD5 VVMD6 VVMD7 VVMD8

Allele Allele Allele Allele Allele Allele Allele Allele

size (bp) frequency size (bp) frequency size (bp) frequency size (bp) frequency
For personal use only.

Note: Frequencies do not add up to 1.00 because genotypes with only one allele were not scored as homozygotes.

Zetaprobe membranes (Bio-Rad Laboratories, Hercules,
California, U.S.A.) placed on Luria-Bertani agar petri plates,
treated according to the protocol of Sambrook et al. (1989),
and probed with ',P end-labeled CT,, probes. Hybridization
was overnight in 6X SSC (1 X SSC: 0.15 M NaCl plus 0.015 M
sodium citrate) plus 0.1% SDS at 65°C. The final wash was
with 0.5 X SSC plus 0.1% SDS at 65°C. Positive clones were
selected, retested, and sequenced by [,,P]~cTP sequencing
with the Sequenase kit (U.S. Biochemical Corporation,
Cleveland, Ohio, U.S.A.). Primers corresponding to unique
sequences flanking the repeat region were designed with
OLIGO VERSION 4.0 (National Biosciences, Plymouth, Minnesota,
U.S.A.).
Amplification conditions
PCR amplifications were performed in a Perkin Elmer
Model 480 Thermal Cycler in 20-p,L reactions consisting of
10 ng DNA, 20 pmoles each primer, 200 p,M each NTP, 2.0 p,L
10X PCR buffer (Perkin Elmer), 0.5 U Taq polymerase (Perkin
Elmer), and 1.0 mM MgCl, (except that 2 mM MgCl, was
used for locus VVMD8). Amplification protocols were optimized
for individual loci as follows: VVMD5: 2 min at 94"C, 40 cycles
of (30 s at 92"C, 30 s at 56"C, 2 min at 72"C), and 7 min at
72°C; VVMD6 and VVMD7: 2 min at 94"C, 40 cycles of (30 s
at 92"C, 30 s at 52"C, 2 min at 72"C), and 7 min at 72°C;
VVMD8: 2 min at 94"C, 5 cycles of (30 s at 92"C, 30 s at
54"C, 1 min at 72"C), and 35 cycles of (30 s at 80°C, 30 s at
54"C, 1 min at 72"C), and 7 min at 72°C.
Amplification was confirmed by running 5 p,L of the PCR
reaction product on 2% agarose gels. Thirty microlitres of
denaturing dye solution (95% formamide, 0.5% bromophenol
blue, plus 0.5% xylene cyanol) was added to the remaining
15 p,L of the reaction product. One to three microlitres of this
mixture was electrophoresed in a 42-cm sequencing gel (6%
acrylamide plus 7 M urea) and then silver stained according
to the protocols and reagents provided with the Promega Silver
Sequencing Kit (Promega, Madison, Wisconsin, U.S.A.). Product
sizes were determined by comparison with a standard sequencing
reaction (provided with the kit) that was electrophoresed in
adjacent lanes in the same gel.
Results
From approximately 3 0 0 0 bacterial clones, 17 positive
clones were obtained and sequenced, of which 4 yielded
useful primers. Of the other 13, 2 were false positives,
1 w a s a d u p l i c a t e , p r i m e r s c o u l d not b e o b t a i n e d f o r
8 because of the position of the repeat in the sequence,
and the original primers failed for 2 others. (Redesigned
 Bowers et al.

Fig. 1. SSR genotypes of 32 wine cultivars at locus VVMD7. Amplification products were detected by silver staining. From the
left, lane: 1-4, the sequencing reaction used as a size standard; 5, Zinfandel; 6, Sangiovese; 7, Nebbiolo Lampia; 8, Dolcetto;
9, Barbera; 10, Muscat blanc; 1 1, Malvasia bianca; 12, Viognier; 13, Riesling; 14, Gewiirztraminer; 15, Petite Sirah; 16, Syrah;
17, Black Malvoisie; 18, Mataro; 19, Grenache; 20, French Colombard; 21, Melon; 22, Chardonnay; 23, Meunier; 24, Pinot
blanc; 25, Pinot gris; 26, Pinot noir; 27, Gamay noir; 28, Napa Gamay; 29, Chenin blanc; 30, Semillon; 3 1, Sauvignon blanc;
32, Petit Verdot; 33, Malbec; 34, Merlot; 35, Cabernet franc; and 36, Cabernet Sauvignon.
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12
For personal use only.

primers were subsequently successful (unpublished results)).
The nature of each repeat region and the flanking primer
sequences for the 4 successful loci are presented in Table 2.
Each locus was designated by a number preceded by
"VVMD" to indicate "Vitis vinifera Microsatellite, Davis."
The number of alleles detected per locus ranged from
5 to 1 1 (Tables 2 and 3; Fig. 1) and the number of diploid
genotypes per locus ranged from 13 to 27 (Table 2).
Amplification products ranged in size from 141 to 263 bp
(Table 3). At each locus, at least 75% of the cultivars were
heterozygous. Cultivars in which only one allele was
detected were scored as having only one copy of the allele
rather than as homozygotes.
We report the genotypes for some of the cultivars in
Table 4. Genotypes for the other cultivars, as well as acces-
sion information and vineyard locations for all cultivars
analyzed, are available at the following web site: http://wine-
server.ucdavis.edu/CPM/grapedna.html.
Discussion
Silver staining is a reliable alternative to other methods
for sizing SSR alleles. It is faster and less hazardous than
radioactive sequencing methods and less expensive than
automated fluorescence detection. While SSR amplification
products can also be analyzed by ethidium bromide visu-
alization in high resolution agarose gels (Cipriani et al.
1994), allele sizes cannot be reliably estimated by this
method and small size differences cannot be resolved as
they can in acrylamide sequencing gels.
Allele sizes determined by silver staining were within
1 or 2 bp of those obtained by Thomas et al. (1994) by
automated fluorescence detection when the same loci
(VVS1, VVS2, VVS4, and VVS29) were analyzed in the
same cullivars. For VVS 1, VVS2, and VVS29, allele sizes
determined by silver staining were consistently 1 bp larger
than those reported using automated fluorescence detection,
and for VVS29, allele sizes were 2 bp larger. The size off-
set was the same for all cultivars and all alleles. This
degree of error is typical of allele size estimates based on
different methods (Weber 1990) and is easily reconciled
by including previously characterized cultivars in the gel as
references when a locus is first analyzed. A set of such
cultivars can also be routinely used as size standards as
an alternative to the sequencing reaction. Because allele
sizes at some of the loci do not overlap, amplification

Table 4. Genotypes for selected cultivars at 4 SSR loci.
Locus
Cultivar VVMD5 VVMD6
Cabernet Sauvignon 240 232 212 211
Chardonnay 238 234 214 205
Merlot 236 226 212 205
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12
Pinot noir 238 228 205 - 243
Riesling 234 226 214 211
Sangiovese 236 226 212 194
Thompson Seedless 234 - 212 214
products for two or even three loci can be multiplexed.
For example, VVMD6, VVMD7, and VVMD8 can be elec-
trophoresed together.
For the most part, alleles differed in length by multiples
of 2 bases, as would be expected for dinucleotide SSRs.
This was not the case with VVMD6, in which two alleles
differed by only a single base. These two alleles were ana-
lyzed repeatedly and could be distinguished reliably.
VVMD6 is a complex imperfect repeat (Table 2) and new
alleles could have been generated by events at regions
other than the several dinucleotide repeats within the locus.
For personal use only.
These data illustrate the importance of surveying a
diverse range of cultivars. Cultivar identification should
not only be based on matching the allelic profile of an
unknown with that of a known cultivar, but should also
incorporate an estimate of the frequency of that genotype
in the population of V vinifera cultivars as calculated from
allelic frequencies. An accurate estimate of the frequency
of each allele must be based on a representative sample
of cultivars. Frequency estimates obtained from a small
or biased sample will not only likely be skewed, but less
common alleles may not be detected. For example, at locus
VVMD7, allele 239 is prevalent in the wine grapes ( p =
0.39) but is much less so in the table grapes ( p = 0.19),
while the converse is true for allele 249 ( p = 0.14. vs. p =
0.34). VVMD7 allele 245 would not have been detected
had only wine grapes been surveyed, as it was found only
in 1 Greek table grape cultivar ('Kritico'). At VVMD8,
allele 145 was detected only in two Middle Eastern table
grapes ('Monukka' and 'Thompson Seedless'). For the
most part, however, allelic frequencies were generally sim-
ilar between the wine and table grape groups. The most
common alleles in one group were usually also the most
common in the other group.
Additional alleles will undoubtedly be detected at these
loci as more germplasm is examined. At locus VVMD5,
for example, a new 230-bp allele was detected in a group
of wild V vinifera from the Pyrenees (unpublished results).
The existence of other alleles that will fill in gaps in the
series can be predicted, for example 242- and 244-bp alleles
at VVMD5.
Cases in which only one allele was detected were scored
as having only one copy of the allele, in accordance with
the precedent established by Thomas et al. (1994) and con-
sistent with heterozygosity for a null allele that did not
amplify. No homozygous null genotypes were detected in
Genome, Vol. 39, 1996
VVMD7 VVMD8
239 - 157 143
243 239 147 141
247 239 157 143
239 143 141
257 249 147 143
263 239 147 143
239 253 145 -
the wine cultivars, but three of the table grape cultivars
failed to amplify in three instances (one at VVMD6 and
two at VVMD8). While these cases might represent
homozygous null alleles, inhibited amplification due to
poor DNA quality cannot be ruled out. Some of these cul-
tivars are undoubtedly homozygous for alleles that were
scored as only single copies. Scoring only one copy of the
allele (i.e., scoring them as heterozygous nulls) results in
an overall underestimation of the allelic frequency, while
scoring two copies (i.e., assuming homozygosity) over-
estimates the frequency. The true allelic frequency probably
lies between these estimates.
The very high level of heterozygosity found in this
study is similar to that observed for other grape microsatel-
lite loci (Thomas and Scott 1993) and is consistent with
the natural breeding system of the species. Because most
cultivars are heterozygous, the large number of alleles is fur-
ther multiplied into a much larger number of observed
genotypes at each locus, providing considerable resolving
power for the separation of cultivars. VVMD5 and VVMD7
are particularly useful loci, being represented by 8 and
11 alleles and 26 and 27 genotypes, respectively, in this
group of 77 cultivars. Many of the alleles of VVMD7 are
relatively infrequent, at least in this group (5 alleles with
a frequency of less than 0.05), so some of the possible
genotypes at this locus may be detected only rarely.
VVMD6 is a less informative locus because of the relatively
small number of alleles detected. VVMD8 is problematic
in that stutter from the 143-bp band makes it difficult to
distinguish the 1411143 heterozygote from the 1431
143 homozygote.
The 77 cultivars analyzed here were uniquely charac-
terized by the four markers, with the exception of one
group of wine grapes (consisting of 'Pinot noir', 'Pinot
blanc', 'Pinot gris', and 'Meunier') and two groups of
table grapes (one group consisting of 'Keshmesh' and
'Thompson Seedless' and the other of 'Dattier', 'Rhazaki
Arhanon', and 'Markandi'). Four SSR markers developed
by Thomas and Scott (1993) also failed to break up these
groups (VVMS1, VVMS2, VVMS4, and VVMS29; data
not shown). The four wine grapes are generally held to
be somatic variants of the same cultivar (Galet 1990).
'Keshmesh' and 'Thompson Seedless' are considered to
be synonyms for the same cultivar, which is also widely
called 'Sultanina' and 'Sultana' (Alleweldt 1988). 'Dattier'
has been suggested to be a type of 'Rhazaki' (Galet 1964)
 Bowers et al
but we have been unable to determine whether 'Markandi'
is considered synonymous. We have not yet made a morpho-
logical comparison of the three cultivars, and doing s o
would obviously shed light on this question.
Four or five moderately polymorphic SSR loci might
be sufficient to separate all important V vinnifera cultivars.
Theoretically, five unlinked loci, each with five equally
frequent alleles producing 15 possible genotypes per locus,
could produce 15' o r over 700 000 different genotypes.
Genome Downloaded from www.nrcresearchpress.com by UNIVERSITY OF ARIZONA LIBRARY on 11/18/12
In reality, however, a larger number of loci is needed and
are being developed in our laboratory. The legal implications
of grape cultivar identification argue that a very high level
of confidence should be attached to determinations made by
DNA typing. The degree to which some cultivars are genet-
ically related is unknown and some similar genotypes may
be difficult to distinguish.
T h e relatively small number of V vinifera cultivars
grown in the Western and Southern hemispheres are not
likely to be closely related, having been independently
introduced as distinct cultivars from Europe and the Middle
East. In some regions of the Old World, however, there
are large numbers of indigenous cultivars, many of which
may share a relatively narrow genetic base, having been
domesticated in situ from wild populations or derived by
selection from ancient cultivated types and spontaneous
For personal use only.
seedlings. These will be more difficult to distinguish.
T h e g r o w i n g n u m b e r of polymorphic S S R markers
available for characterizing grape cultivars (and for other
genetic analyses) and the relative technical simplicity of
the analysis should encourage their wider use by interested
groups throughout the world. In particular, the ease with
which results can be exchanged can facilitate greater coop-
eration w i t h i n t h e i n t e r n a t i o n a l c o m m u n i t y of g r a p e
researchers. If data sets produced with commonly used
SSR markers are made generally available by workers
investigating grape cultivars in their own countries, par-
ticularly European and Middle Eastern regions that are
home to ancient and autochthonous cultivars, the number
of characterized cultivars will grow and the cumulative
data will become increasingly representative of cultivated
V vinifera a s a whole. T h e growing accuracy of allelic
frequency estimates that will follow will further improve the
strength of SSR-based identification. Furthermore, as more
cultivars are analyzed, the objective genetic information
generated by SSR analysis may reveal genetic relationships
among them that will shed some light on the history of
this ancient and venerable crop.
Acknowledgment
This research was supported by the Fruit Tree, Nut Tree and
Grapevine Improvement Advisory Board of the California
Department of Food and Agriculture.
References
Alleweldt, G. 1988. The genetic resources of Vitis. Genetic
and geographic origin of grape cultivars, their prime names
and synonyms. 2nd ed. Federal Research Center for Grape
Breeding, Geilweilerhof, Germany.
Bowers, J.E., Bandman, E.B., and Meredith, C.P. 1993. DNA
fingerprint characterization of some wine grape cultivars.
Am. J. Enol. Vitic. 44: 266-274.
Biischer, N., Zyprian, E., and Blaich, R. 1993. Identification
of grapevine cultivars by DNA analyses: pitfalls of random
amplified polymorphic DNA techniques using lOmer primers.
Vitis, 32: 187-188.
Cipriani, G., Frazza, G., Peterlunger, E., and Testolin, R. 1994.
Grapevine fingerprinting using microsatellite repeats. Vitis,
33: 211-215.
Galet, P. 1964. Cdpages et vignobles de France. Tome IV. Les
raisins de table, la production viticole franqaise. Imprimerie
du Paysan du Midi, Montpellier, France.
Galet, P. 1990. Cdpages et vignobles de France. Tome 11.
L'ampdlographie f r a n ~ a i s e .2nd ed. Imprimerie Charles
Dehan, Montpellier, France.
Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular
cloning, a laboratory manual. 2nd ed. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.
Thomas, M.R., and Scott, N.S. 1993. Microsatellite repeats in
grapevine reveal DNA polymorphisms when analysed as
sequence-tagged sites (STSs). Theor. Appl. Genet. 86:
985-990.
Thomas, M.R., Cain, P., and Scott, N.S. 1994. DNA typing of
grapevines: a universal methodology and database for describ-
ing cultivars and evaluating genetic relatedness. Plant Mol.
Biol. 25: 939-949.
Weber, J.L. 1990. Informativeness of human (dC-dA),.(dG-dT),
polymorphisms. Genomics, 7: 524-530.