A LABORATORY MANUAL FOR THE

ISOLATION,
IDENTIFICATION, AND
CHARACTERIZATION -

OF AVIAN
UH* ** w/ «

Fifth Edition

THE AMERICAN ASSOCIATION OF AVIAN PATHOLOGISTS

 A LABORATORY MANUAL FOR THE
ISOLATION, IDENTIFICATION
AND CHARACTERIZATION
OF AVIAN PATHOGENS

Fifth Edition

American Association of Avian Pathologists

Editorial Committee

Louise Dufour-Zavala, Editor-in-Chief

David E. Swayne
John R. Glisson
Janies E. Pearson
Willie M. Reed
Mark W. Jackwood
Peter R. Woolcock

Copies Available from:

American Association of Avian Pathologists
953 College Station Road
Athens, GA 30602-4875
Frederic J. Hoerr

Cover:
1. Direct fluorescent antibody test on primary chicken embryo kidney cells showing
syncytia formed by ILT virus in primary chick embryo kidney cells. (Rey Resurreccion,
GPLN, Oakwood, GA) 2. Ninety well serum plate prepared for ELISA testing for the
detection of AE antibodies. (Len Chappell, GPLN, Oakwood, GA). 3. Bacterial culture on
a TSI slant. (Doug Waltman, GPLN, Oakwood, GA). 4. Reverse transcriptase-polymerase
chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis if
the spike (SI) glycoprotein gene of the Arkansas strain of infectious bronchitis virus
(IBV). Lanes 1 and 2 are molecular weight markers. Lane 3 is the IBV amplicon digested

9 with BstYI, lane 4 is the IBV amplicon digested with Haein, and lane 5 is the IBV
amplicon digested with XcmI. (Mark Jackwood, PDRC, Athens, GA). 5. Ten-fold
dilution series of avian influenza virus RNA run with the USDA type A influenza M gene
real-time RT-PCR test on the Applied Biosystems 7500 FAST system. (Erica Spackman,
1 SEPRL, Athens, GA). 6. Microphotograph of Mycoplasma gallisepticum colonies on agar
(35x) (Stan Kleven, PDRC, Athens, GA). 7. Bio Merieux API 20 system for bacteria
identification using a series of biochemical tests. (Doug Waltman, GPLN, Oakwood, GA).
3 4
8. Embryonated egg candling to locate the chorio-allantoic sac for inoculation of a virus
isolation sample. (Rey Resurreccion, GPLN, Oakwood, GA). 9. Wet mount of Aspergillus

2 sp. conidiofores after culture in Sabouraud's dextrose agar (100X). The isolate was
obtained from a case of systemic aspergillosis in 9-wk-old broiler breeder pullets.
(Guillermo Zavala, PDRC, Athens, GA).
Pictures 2,3,7,8 and Page design by HMM Photography (Heidi Migalla).

5 6
7 1-------- 1 8

Copyright © 1975, 1980, 1989,1998,2008 by American Association of Avian Pathologists, Inc. Athens, Georgia

All rights reserved

Copyright is not claimed for Chapters 22, 36

Chapters 16,29, 35,40,44, 49: US Government copyrighted, user rights reserved, printed by permission

Chapters 30, 31: (British) Crown copyrighted and (British) Crown user rights reserved, printed by permission

Chapter 6: (Australian) Crown copyrighted and (Australian) Crown user rights reserved, printed by permission

Mention of a trademark or proprietary product does not constitute a guarantee or warranty of the product by the author, the supporting
institutions or the American Association of Avian Pathologists and does not imply its approval to the exclusion of other products that also
may be suitable

Fifth edition 2008

Previously entitled Isolation and Identification ofAvian Pathogens

Library of Congress Catalog Card Number: 2008924452

ISBN 978-0-9789163-2-9

All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means,
electronic, mechanical, photocopying, recording, or otherwise, without the prior written permission of the copyright owner.

Printed in the United States of America

10 987654321

Printed by
OmniPress, Inc., Madison, Wisconsin 53704

ii
 A Laboratory Manual for the Isolation, Identification and Characterization
of Avian Pathogens

TABLE OF CONTENTS

1. Diagnostic Principles. Frederic J. Hoerr...................................................................................................................................1

2. Salmonellosis. W. Douglas Waltman and Richard K. Gast.................................................................................................... 3
3. Colibacillosis. Margie D. Lee and Lisa K. Nolan..................................................................................................................10
4. Pasteurellosis, Avibacteriosis, Gallibacteriosis, Riemerellosis, and Pseudotuberculosis.
John R. Glisson, Tirath S. Sandhu, and Charles L. Hofacre....................................................................................................12
5. Bordetellosis. Mark W. Jackwood........................................................................................................................................ 20
6. Infectious Coryza. Pat J. Blackall........................................................................................................................................ 22
7. Campylobacter in Poultry. Jaap A. Wagenaar and Wilma F. Jacobs- Reitsma..................................................................... 27
8. Spirochetosis. Stephen R. Collett........................................................................................................................................... 31
9. Erysipelas. George L. Cooper and Arthur A. Bickford........................................................................................................ 36
10. Listerosis. George L. Cooper and Arthur A. Bickford........................................................................................................ 39
11. Staphylococcosis. Stephan G. Thayer and W. Douglas Waltman.........................................................................................42
12. Streptococcosis and Enterococcosis. Stephan G. Thayer and W. Douglas Waltman............................................................ 44
13. Clostridial Diseases. Stephan G. Thayer and David A. Miller............................................................................................. 47
14. Tuberculosis. Susan Sanchez and Richard M. Fulton.......................................................................................................... 53
15. Mycoplasmosis. Stanley H. Kleven......................................................................................................................................59
16. Chlamydiosis. Arthur A. Andersen and Daisy Vanrompay................................................................................................. 65
17. Omithobacteriosis. Richard P. Chin and Bruce R. Charlton................................................................................................ 75
18. Mycoses and Mycotoxicoses. R.D. Wyatt............................................................................................................................ 77
19. Adenovirus. Brian M. Adair and J. Brian McFerran.............................................................................................................84
20. Hemorrhagic Enteritis of Turkeys Marble Spleen Disease of Pheasants. F. William Pierson and Sctott D. Fitzgerald....... 90
21. Infectious Laryngotracheitis. Deoki N. Tripathy and Maricarmen Garcia........................................................................... 94
22. Marek’s Disease. Patricia S. Wakenell and Jagdev M. Sharma........................................................................................... 99
23. Duck Virus Enteritis. Peter R. Woolcock............................................................................................................................ 106
24. Herpesviruses of Free-Living and Pet Birds. Erhard F. Kaleta........................................................................................... 110
25. Pox. Deoki N. Tripathy and Willie M. Reed....................................................................................................................... 116
26. Budgerigar Fledgling Disease and Other Avian Polyomavirus Infections. Branson W. Ritchie and Phil D. Lukert........ 120
27. Psittacine Beak and Feather Disease. Branson W. Ritchie and Phil D. Lukert................................................................... 122
28. Chicken Anemia Virus. M. Stewart McNulty and Daniel Todd......................................................................................... 124
29. Avian Influenza. David E. Swayne, Dennis A. Senne and David L. Suarez....................................................................... 128
30. Newcastle Disease Virus and Other Avian Paramyxoviruses. Dennis J. Alexander and Dennis A. Senne.........................135
31. Avian Metapneumovirus. Richard E. Gough and Janice C. Pedersen................................................................................. 142
32. Infectious Bronchitis. Jack Gelb, Jr. and Mark W. Jackwood............................................................................................. 146
33. Turkey Coronavirus. Mark W. Jackwood and James S. Guy.............................................................................................. 150
34. Enteric Viruses. Don Reynolds and Ching Ching Wu.................................................................................................... 153
35. Oncornaviruses, Leukosis/Sarcomas and Reticuloendotheliosis. Aly M. Fadly, Richard L. Witter, and Henry D. Hunt.. 164
36. Avian Encephalomyelitis. Louis van der Heide................................................................................................................... 173
37. Duck Hepatitis. Peter R. Woolcock............................................................................................................................ 175
38. Turkey Viral Hepatitis. Willie M. Reed.............................................................................................................................. 179
39. Viral Arthritis/Tenosynovitis and Other Reovirus Infections. John K. Rosenberger and Erica Spackman.........................181
40. Arbovirus Infection. Eileen N. Ostlund and James E. Pearson........................................................................................... 184
41. Infectious Bursal Disease. John K. Rosenberger, Y.M. Saif, and Daral J. Jackwood......................................................... 188
42. Parvovirus of Waterfowl. Richard E. Gough...................................................................................................................... 191
43. Cell-Culture Methods. Karel A. Schat and Holly S. Sellers................................................................................................ 195
44. Virus Propagation in Embryonating Eggs. Dennis A. Senne..............................................................................................204
45. Virus Identification and Classification. Pedro Villegas and Ivan Alvarado........................................................................209
46. Titration of Biological Suspensions. Pedro Villegas........................................................................................................... 217
47. Serologic Procedures. Stephan G. Thayer and Charles W. Beard.......................................................................................222
48. Molecular Identification Procedures. Daral J. Jackwood and Mark W. Jackwood..............................................................230
49. Antigen Detection Systems. Mary J. Pantin-Jackwood and Sandra S. Rosenberger.......................................................... 233
Appendix of Abbreviations and Acronyms used in the Text...................................................................................................... 241
Quick Reference Diagnostic Chart.............................................................................................................................................. 244
Index............................................................................................................................................................................................ 247

iii
 CONTRIBUTING AUTHORS

Brian Adair Richard P. Chin

Veterinary Sciences Division California Veterinary Diagnostic Laboratory System
Agri-Food and Biosciences Institute Fresno Branch
Stoney Road School of Veterinary Medicine
Stormont University of California - Davis
Belfast BT4 3SD 2789 S. Orange Ave.
Northern Ireland Fresno, California 93725
E-mail: Brian.Adair@afbini.gov.uk E-mail: rpchin@ucdavis.edu
FAX: +44(0)2890525773 FAX: (559) 485-8097

Dennis J. Alexander Stephen R. Collett

Central Veterinaiy Laboratory (Weybridge) Department of Population Health
New Haw, Addlestone College of Veterinary Medicine
Surrey KT15 3NB The University of Georgia
United Kingdom 953 College Stations Road
E-mail: d.j.alexander@vla.defra.gsi.gov.uk Athens, Georgia 30602-4875
FAX: +44-1932-357856 E-mail: colletts@uga.edu
FAX: (706) 542-5630
Ivan R. Alvarado
120 Spring Lake Pointe George L. Cooper
Athens, GA 30605 School of Veterinary Medicine
E-mail: ialvarado@lahintemational.com University of California-Davis
FAX: (404) 506-9013 Calif. Vet. Diagnostic Lab. System
Turlock Branch
Dr. Arthur A. Andersen P.O. Box P
USDA-ARS Turlock, California 95381
Former Address: E-mail: gcooper@cvdls.ucdavis.edu .
National Animal Disease Center FAX: (209) 667-4261
P.O.Box 70, Ames, IA 50010
Email: aanderse@nadc.usda.gov Aly M. Fadly
USDA- Agricultural Research Service
Charles W. Beard Avian Disease and Oncology Laboratory (ADOL)
130 Red Fox Run 3606 East Mount Hope Road
Athens, GA 30605 East Lansing, Michigan 48823
E-mail: charlesb9@charter.net E-mail: fadly@msu.edu
FAX: (706) 548-6410 FAX: (517) 337-6776

Arthur A. Bickford Scott D. Fitzgerald

University of California-Davis Diagnostic Center for Population and Animal Health
California Veterinaiy Diagnostic Laboratory System College of Veterinary Medicine
Turlock Branch Michigan State University
1650 Simon Drive PO Box 30076
Turlock, California 95382 Lansing, Michigan 48909-7576
E-mail: aabickford@ucdavis.edu E-mail: fitzgerald@dcpah.msu.edu
FAX: (209) 632-4258 FAX: (517)355-2152

Pat J. Blackall Richard M. Fulton

Animal Research Institute Diagnostic Center for Population and Animal Health
Locked Mail Bag No. 4 Michigan State University
Moorooka, Queensland 4105 PO Box 30076
Australia Lansing, Michigan 48909
E-mail: blackap@dpi-qld.gov.au E-mail: fulton@dcpah.msu.edu
FAX: +61-7-33629-429 FAX: (517)355-2152

Bruce R. Charlton Maricarmen Garcia

California Veterinary Diagnostic Laboratory System Department of Population Health
Turlock Branch College of Veterinary Medicine
School of Veterinary Medicine The University of Georgia
University of California - Davis 953 College Station Rd.
3327 Chicharra Way Athens, Georgia 30602-4875
Coulterville, California 95311 E-mail: mcgarcia@uga.edu
E-mail: brcharlton@ucdavis.edu FAX: (706) 542-5630
FAX: (209) 667-4267

iv
Richard K. Gast Daral J. Jackwood
USDA, ARS Food Animal Health Research Program
Russell Research Center Ohio Agricultural Research and Development Center
950 College Station Road The Ohio State University
Athens, GA 30605 1680 Madison Ave
E-mail: rgast@seprl.usda.gov Wooster, Ohio 44691
FAX: (706) 546-3035 E-mail: jackwood.2@osu.edu
FAX: (330) 263-3760
Jack Gelb, Jr.
Department of Animal and Food Sciences Mark W. Jackwood
College of Agricultural Sciences Department of Population Health
531 South College Avenue College of Veterinary Medicine
University of Delaware The University of Georgia
Newark, Delaware 19716-2150 953 College Station Road
E-mail: jgelb@udel.edu Athens, Georgia 30602-4875
FAX: (302)831-2822 E-mail: mjackwoo@uga.edu
FAX: (706) 542-5630
John R. Glisson
Department of Population Health Wilma F. Jacobs-Reitsma
College of Veterinary Medicine RIKILT Institute of Food Safety
The University of Georgia Bomsesteeg 45
953 College Station Rd. 6708 PD Wageningen
Athens, Georgia 30602-4875 The Netherlands
E-mail: iglisson@uga.edu E-mail: Wilma.jacobs@wur.nl
FAX: (706) 542-5630 FAX: +31-317-417717

Richard E. Gough Erhard F. Kaleta

Central Veterinary Laboratory (Weybridge) Institute for Avian and Reptile Medicine
New Haw, Addlestone Justus-Liebig-University
Surrey KT15 3NB Frankfurter Strabe 91, D-35392 Giefien
United Kingdom Germany
E-mail: r.e.gough@vla.defra.gsi.gov.uk E-mail: erhard.f.kaleta@vetmed.uni-giessen.de
FAX: +44-1932-357856 FAX: +49-641-201548

Janies S. Guy Stanley H. Kleven

North Carolina State University Department of Population Health
College of Veterinary Medicine College of Veterinary Medicine
Department of Population Health & Pathobiology University of Georgia
4700 Hillsborough Street 953 College Station Rd
Raleigh, North Carolina 27606 Athens, Georgia 30602-4875
E-mail: Jim Guy@NCSU.edu E-mail: skleven@uga.edu
FAX: (919)513-6464 FAX: (706) 542-5630

Frederic J. Hoerr Margie D. Lee

Thomas Bishop Sparks Department of Population Health
State Diagnostic Laboratory Poultry Diagnostic and Research Center
P. O. Box 2209 The University of Georgia
Auburn, Alabama 36831-2209 953 College Station Road
E-mail: hoerrfj@vetmed.auburn.edu Athens, Georgia 30602-4875
FAX: (334) 8244-7206 E-mail: mdlee@uga.edu
FAX: (706) 542-5771
Charles Hofacre
Department of Population Health Phil D. Lukert
College of Veterinary Medicine Department of Medical Microbiology
The University of Georgia College of Veterinary Medicine
953 College Station Road University of Georgia
Athens, Georgia 30602-4875 Box 207
E-mail: chofacre@uga.edu Colbert, Georgia 30628
FAX: (706) 542-5630 E-mail: plukert@uga.edu
FAX: (706) 542-5771
Henry Hunt
USDA- Agricultural Research Service J. Brian McFerran
Avian Disease and Oncology Laboratory (ADOL) 19 Knocktem Gardens
3606 East Mount Hope Road Belfast BT4 3LZ
East Lansing, Michigan 48823 Northern Ireland
E-mail: hunt@msu.edu FAX: +44-1232-658040
FAX: (517) 337-6776

v
M. Stewart McNulty Willie M. Reed
Department of Agriculture Purdue University
Veterinary Sciences Division Dean, School of Veterinary Medicine
Stormont, Belfast BT4 3SD Lynn Hall Room 1176
Northern Ireland West Lafayette, Indiana 47907-2026
FAX: +44-1232-525773 E-mail: wreed@purdue.edu
E-mail: m-mcnulty @utvintemet. com FAX: (765) 496-1261

David A. Miller Donald L. Reynolds

National Veterinary Services Laboratories 2520 Veterinary Administration
USDA-APHIS-VS Iowa State University
1800 Dayton Road 1802 Elwood Drive
Ames, Iowa 50010 Ames, Iowa 50011
E-mail: damiller@aphis.usda.gov E-mail: DLR@iastate.edu
FAX: (515) 239-8569 FAX: (515) 294-8956

Lisa K, Nolan Branson W. Ritchie

Dept, of Vet Microbiology and Preventive Medicine Department of Medical Microbiology
College of Veterinary Medicine College of Veterinary Medicine
1802 Elwood Dr VMRI #2 University of Georgia
Iowa State University Athens, Georgia 30602
Ames, LA 50011 FAX: (706) 542-6460
E-mail: lknolan@iastate.edu Email: britchie@uga.edu
FAX: (515) 233-2136
John K. Rosenberger
Eileen N. Ostlund Aviserve, LLC
Head Equine Ovine Viruses Section Delaware Technology Park
Diagnostic Virology 1 Innovation Way, Suite 100
NVSL Newark, DE 19711
Ρ,Ο,Βοχ 844 E-mail: aviserve@aol.com
Ames, IA 50010 FAX: (302) 368-2975
E-mail: Eileen.Ostlund@aphis.usda.gov
FAX: (515) 663-7348 Sandra S. Rosenberger
Aviserve, LLC
Mary J. Pantin-Jackwood Delaware Technology Park
Southeast Poultry Research Laboratory USDA-ARS 1 Innovation Way, Suite 100
934 College Station Road Newark, DE 19711
Athens, Georgia 30605 E-mail: aviserve@aol.com
E-mail: mary.pantin-jackwood@ars.usda.gov FAX: (302) 368-2975
FAX: (706) 546-3161
Y. M. Saif
Janies E. Pearson Food Animal Health Research Program
4016 Phoenix Ohio Agricultural Research and Development Center
Ames, Iowa 50014 The Ohio State University
(515) 292-9435 1680 Madison Avenue
E-mail: ipearson34@aol.com Wooster, Ohio 44691
E-mail: saif.l@osu.edu
Janice C. Pedersen FAX: (330) 263-3677
Avian Section, Diagnostic Veterinary Services Laboratory
NVSL Susan Sanchez
1437 270th Street Athens Diagnostic Laboratory
Madrid, Iowa 50156 0103 Athens V.M. Diag Lab
E-mail: Janice.c.pedersen@aphis.usda.gov 501 D.E. Brooks Dr
FAX: (515) 663-7348 Athens, GA 30602
E-mail: ssanchez@uga.edu
Frank W. Pierson FAX: (706)542-5568
Center for Molecular Medicine and Infectious Diseases
Virginia-Maryland Reg. College of Vet. Medicine Tirath S. Sandhu
Virginia Polytechnic Institute and State University Cornell University Duck Research Laboratory
Blacksburg, Virginia 24061 37 Howell Place
E-mail: pierson@vt.edu P.O. Box 427
FAX: (540) 231-3426 Speonk, New York 11972
E-mail: Sandhu37@optonline.net

vi
Karel A. Schat Stephen G. Thayer
Unit of Avian Health Department of Population Health
College of Veterinary Medicine
College of Veterinary Medicine The University of Georgia
Cornell University 953 College Station Road
Ithaca, New York 14853 Athens, Georgia 30602-4875
E-mail: kas24@comell.edu E-mail: sthayer@uga.edu
FAX: (607) 253-3384 FAX: (706) 542-0252

Holly Sellers Daniel Todd

Department of Population Health Dept of Agriculture and Rural Development from N. Ireland
Poultry Diagnostic and Research Center Veterinary Sciences Division
The University of Georgia Stormont, Belfast BT4 3SD
953 College Station Road UK
Athens, GA 30602-4875 E-mail: Daniel.Todd@dardni.gov.uk
E-mail: hsellers@uga.edu Tel: +44 2890 525773
FAX: (706)542-5630
Deoki N. Tripathy
Dennis A. Senne Department of Veterinary Pathobiology
National Veterinary Services Laboratories College of Veterinary Medicine
Veterinary Services University of Illinois
Animal and Plant Health Inspection Service 104 West McHenry
United States Department of Agriculture Urbana, Illinois 61801
1800 Dayton Road E-mail: tripathy@uiuc.edu
Ames, Iowa 50010 FAX: (217) 244-7421
E-mail: dennis.a.senne@aphis.usda.gov
FAX: (515) 663-7348 Daisy Vanrompay
Ghent University
Jagdev M. Sharma Faculty of Bioscience engineering
Department of Veterinary PathoBiology Department of molecular biotechnology
258 Veterinary Science Building Coupure Links 653
College of Veterinary Medicine 9000 Ghent, Belgium
University of Minnesota E-mail: daisy.vanrompay@UGent.be
1971 Commonwealth Avenue FAX: +32 09 2646219
St. Paul, Minnesota 55108
E-mail: sharmOO 1 @umn.edu Louis Van Der Heide
FAX: (612) 625-5203 Dept. Of Pathobiology U-89
PO Box 37
Erica Spackman 12 Yeomans Road
USDA-Agriculture Research Service Columbia, Connecticut 06237
Southeast Poultry Research Laboratory E-mail: louisandingrid@yahoo.com
934 College Station Road FAX: (860) 486-2794
Athens, GA 30605
E-mail: erica.spackman@ars.usda.gov Pedro Villegas
FAX: (706)546-3161 Department of Population Health
College of Veterinary Medicine
David L. Suarez University of Georgia
USDA-Agriculture Research Service 953 College Station Road
Southeast Poultry Research Laboratory Athens, Georgia 30602-4875
934 College Station Road E-mail: pedrov@uga.edu
Athens, GA 30605 FAX: (706) 542-5630
E-mail: david.suarez@ars.usda.gov
FAX: (706)546-3161 Jaap A. Wagenaar
Department of Infectious Diseases and Immunology
David E. Swayne OIE Reference Laboratory for Campylobacteriosis
USDA-Agricultural Research Service and WHO Collaboration Centre for Campylobacter
Southeast Poultry Research Laboratory Faculty of Veterinary Medicine
934 College Station Road Utrecht University
Athens, Georgia 30605 P.O. Box 80.165
E-mail: david.swayne@ars.usda.gov 3508 TD Utrecht
FAX: (706) 546-3161 The Netherlands
E-mail: i .wagenaar@uu.nl
FAX: +31 (0)30-2533199

vii
Patricia S. Wakenell Peter R. Woolcock
Department of Veterinary Medicine California Veterinary Diagnostic Laboratory System
Population Health & Reproduction Fresno Branch
University of California School of Veterinary Medicine
Davis, California 95616 University of California - Davis
E-mail: pswakenell@ucdavis. edu 2789 South Orange Ave
FAX: (530) 752-5845 Fresno, California 93725
E-mail: prwoolcock@ucdavis.edu
W. Douglas Waltman FAX: (559) 485-8097
Georgia Poultry Laboratory
P.O. Box 20 Ching-Ching Wu
4457 Oakwood Road Purdue University
Oakwood, Georgia 30566 Animal Disease Diagnostic Laboratory
E-mail: dwaltman@gapoultrylab.org 406 South University Street
FAX: (770) 535-1948 West Lafayette, Indiana 47907-2065
E-mail: Wuc@purdue.edu
Richard L. Witter FAX: (765) 497-1405
USDA- Agricultural Research Service
Avian Disease and Oncology Laboratory Roger Wyatt
3606 East Mount Hope Road 195 Edgewood Dr. SW
East Lansing, Michigan 48823 Athens, GA 30606
E-mail: witterr@msu.edu (706) 548-2297
FAX: (517) 349-0817 E-mail: mycotec@charter.net

viii
 PREFACE

This manual has its origins in the need for a book to codify standardized method for testing and evaluating poultry vaccines. The
National Academy of Sciences sponsored the original publication entitled Methods for the Examination of Poultry Biologies, and completed
two successive revisions. In 1975, the American Association of Avian Pathologists (AAAP) accepted responsibility for the publication, but
because the need for standardizing testing of vaccines had been met, the scope and purpose of the manual was broadened to be a resource for
laboratory procedures for the isolation and identification of disease-causing agents. The title was changed to Isolation and Identification of
Avian Pathogens for the 1st edition and to A Laboratory Manual for the Isolation and Identification of Avian Pathogens for the 3rd edition.
The manual was intended as a bench resource for daily use in the diagnostic laboratory.

With the 4th edition, the focus had shifted from a manual of procedures for isolation and identification of pathogens to a more
encompassing manual for diagnosis of the disease and isolation and/or demonstration of the pathogen. This change was needed because
many clinical specimens are presented as unknowns for determination of etiology and some pathogens are difficult to isolate, but can be
demonstrated with newer molecular or immunologic techniques.

With the 5th edition, the AAAP appointed Dr. Louise Dufour-Zavala as Editor-in-Chief. David Swayne served as advisor to the Editor-
in-Chief and section editor. John Glisson, Willie M. Reed, Mark W. Jackwood and James E. Pearson continued as section editors for their
expertise in bacteriology, veterinary diagnostics, molecular biology, and virology. Peter Woolcock was newly appointed to support the
virology section.

The 5th edition has a new title to reflect the molecular advances and modem testing procedures allowing us to characterize, type,
speciate and serotype several avian pathogens. It also has a new chapter on Turkey Coronavirus. A color plate with tissue culture images is
included. Improvements to individual chapters include updated terminology and information on molecular techniques.

In the appendix section, we removed the appendix of sources and the appendix of reference antisera as they are now readily available on
the Internet.

The editorial committee thanks all of the 67 contributors who prepared new chapters or revised existing chapters for the 5th edition. We
also thank Crissie Boyd, Georgia Poultry Laboratory Network, for her tremendous clerical support in formatting the Manual. We thank Heidi
Migalla, HMM photography, for the design of the cover and Aaron Nord at Omni Press for the printing services.

Editorial Committee:

Louise Dufour-Zavala, Editor-in-Chief

David E. Swayne
John R. Glisson
Mark W. Jackwood
James £. Pearson
Willie M. Reed
Peter Woolcock

ix
X
 1
Diagnostic Principles
Frederic J. Hoerr
In avian diagnostic medicine the usual immediate challenge is
making a definitive diagnosis for the presenting problem of
morbidity or mortality. When the case is probed deeper, however,
evidence may emerge of a concurrent or preceding infectious
disease, management or nutritional problem, or other condition that
contributes to the presenting problem. In food supply medicine
involving a population of animals, the challenge is to evaluate one
or more diagnoses for priority of response. In practice, the
diagnostic results are considered along with animal welfare,
production economics, and public health in the development of
strategies for treatment, prevention, and control of the disease.
Three factors influence the expression of an infectious disease: the
virulence of the causative organism, the level of exposure or dose of
the inoculum, and the susceptibility of the host. Within a poultry
flock, each individual reacts according the net influence of these
factors. The uniformity of exposure and resistance among the
individuals in the flock will eventually influence flock performance
and possibly food safety.
HISTORICAL PERSPECTIVE
The very existence of this book makes a statement about the
importance of infectious diseases that affect avian species.
Detection and characterization of infectious pathogens have
advanced substantially in recent decades, building on classical
methods for cultivation, isolation, characterization, and
immunological assay. Procedures based on the specific molecular
genetic characteristics of disease agents are now extensively applied
for the detection and characterization of infectious pathogens.
Diagnostic technology today uses a variety of sensitive and specific
methods that may not require the actual cultivation and isolation of
an organism for a diagnosis. Isolation of an agent still has an
important place in the investigative process. Isolates are important
in assessing virulence and pathogenesis, and in the development of
vaccines. Detection technologies offer significant gains and
substantial advantages in the number of samples that can be tested
in a short time, and in the overall efficiency of testing. Enzyme-
linked immunological detection (antigen capture ELISA) is used for
viral and bacterial diseases. The polymerase chain reaction and
nucleotide probes offer many approaches for identification of
fragments of genetic code specific to a species or biotype of
organism. A panel or multiplex of serological assays can reveal the
spectrum of infectious agents that have infected an individual bird.
Simultaneous statistical analysis of ELISA titers for various
infectious pathogens helps to assess the frequency and distribution
of the infection or vaccine-induced humoral immunity within the
flock. Advances in diagnostic expertise that improve sensitivity and
specificity, and reduce the time required for the test generally lead
to improvements in disease prevention and control. This is essential
to safeguarding poultry health in the ever larger size of poultry
flocks under the care of food supply medicine.
SIGNIFICANCE OF IDENTIFIED PATHOGENS
An isolated or detected disease agent should be evaluated for
diagnostic significance relative to the case history, clinical disease,
and lesions. Poultry in commercial flocks may experience
sequential or simultaneous disease challenges, as well as exposure
to agents in attenuated live vaccines. In a diagnostic investigation,
both field challenge agents and attenuated live agents may be
detected and require further characterization and differentiation.
Examples of live vaccines include those for Newcastle disease
1
pneumovirus, infectious bronchitis, infectious laryngotracheitis,
infectious bursal disease, chicken infectious anemia, reovirus,
hemorrhagic enteritis virus, mycoplasmosis, infectious coryza,
pasteurellosis, and others. For example, isolation of infectious
bronchitis virus is an important first step in understanding a
respiratory disease. If the virus is determined to be a new serotype,
a significant change in vaccine virus serotype will be required to
control the disease. If the isolated virus is indistinguishable from a
vaccine strain administered at an earlier age, it may indicate the
need for improvements in vaccine administration, or point to
immunosuppression from infectious bursal disease, chicken
infectious anemia, or other diseases.
Some vaccine viruses are readily isolated for several days post­
administration. Extended periods of virus shedding in a flock may
reflect variable immunity existing at the time of vaccine
administration. For respiratory viruses, isolation of a vaccine virus
for a prolonged period after administration can be indicative of so-
called rolling reactions. In this situation, poor uniformity in flock
immunity will result in some chicks being resistant to virus
infection at the time of vaccine administration, then becoming
susceptible during the end of the shedding period of a pen mate.
The attenuated virus infection spreads from bird-to-bird resulting in
vaccination reactions of prolonged duration. Attenuated vaccine
viruses may re-acquire virulence characteristics during this process.
Rolling reactions and lengthened periods of vaccine virus isolation
also occur with uneven or ineffective vaccine administration
technique. Vaccine virus shed from infected pen mates eventually
infects susceptible chicks causing uneven and sometimes harsh
reactions within the flock. Differentiating vaccine strains from wild­
type or field-challenge viruses or bacteria in the laboratory may
require molecular genetic sequencing and analysis.
The presence of co-pathogens can increase the severity of a viral
disease such as infectious bronchitis or the respiratory form of
Newcastle disease. Mycoplasma infections and elevated
concentrations of ammonia and airborne dust increase the severity
of respiratory viral disease. In these situations, the actual cause of
death or economic loss in the form of condemnations at slaughter
from respiratory compromise or septicemia caused by Escherichia
coli. While the laboratory effort may focus on the viral infection,
the cumulative effects of the co-pathogens must also take into
consideration for effective treatment and control. This situation
requires a comprehensive approach to diagnostics, including
virology, bacteriology, serology, and pathology.
Specific-pathogen-free sentinel birds are useful in identifying
specific primary infectious pathogens. These are typically used
when interference from overwhelming co-pathogens or vaccine
strains obscures the isolation effort of primary pathogen. Sentinel
birds can be placed in a flock for a specific time and then brought
into the laboratory for pathogen isolation and identification
procedures. Selective immunization of the sentinels focuses the
susceptibility and thereby increases the efficiency of identifying the
challenge strain.
The relative significance of an isolate also depends on whether it
has food safety or public health significance. For example,
Salmonella, Escherichia, and Campylobacter can be pathogenic for
poultry but even in the apparent absence of disease they can be
significant contaminants on processed poultry or poultry products.
Avian influenza virus has strain-variable virulence among different
poultry species, and some strains have considerable public health
significance.
Frederic J. Hoerr
DISEASE REPORTING
The isolation and identification of certain pathogens carries the
responsibility of reporting to state/provincial or federal regulatory
officials, who in turn have responsibilities to report internationally
to the World Organization for Animal Health (OIE) (1). The OIE
website maintains a current list of internationally reportable
diseases which includes Newcastle disease, turkey rhinotracheitis,
any H5 or H7 avian influenza, Pullorum disease, and others.
Reporting regulations vary among countries, states, and provinces,
as do the definitions of reportable strains of an agent. Laboratory
diagnosticians generally report to the next level of authority in their
organization. Question about the responsibility to report a disease
should be directed to the state or regional veterinary regulatory
health official. Trade, regulatory and other legal issues may
surround the isolation and accurate identification of certain
pathogens, or serological evidence thereof. Erroneous reporting,
misidentification or failure to identify an agent may carry serious
consequences. In the United States, the USDA National Veterinary
Services Laboratory is the agency that should be consulted about
agent identification, and in other countries, the appropriate central
reference laboratory.
QUALITY MANAGEMENT
A quality management program to include standard operating
procedures for the isolation and identification of infectious
pathogens improves the overall consistency and quality of the
laboratory effort. A quality management program evaluates
laboratory procedures for the yield of relevant and timely data. It
involves quality assessment by specifying performance parameters
and setting limits for acceptable performance, and quality
improvement by correcting problems and preventing their
reoccurrence. Quality management helps to ensure that the
laboratory information is accurate, reliable and reproducible, with
the goal of eliminating or reducing test variation within and
between laboratories. The elements of a quality program comprise
written procedure manuals, record keeping, documentation, and
retention, training, education and evaluation of personnel,
proficiency testing, laboratoiy safety, and maintenance and
monitoring of equipment.
The International Standards Organization (ISO) is a developer and
publisher of international standards for laboratoiy quality
management (2). ISO is a non-governmental organizational network
composed of the national standards institutes that currently
represent 157 countries. ISO document 17025 is the main standard
for diagnostic laboratories worldwide, including the USDA
National Veterinary Services Laboratory. These standards are
reflected in the essential requirements for accreditation by the
American Association of Veterinary Laboratoiy Diagnosticians
(AAVLD), which accredits publically-supported diagnostic
laboratories in the United States and Canada (3). The AAVLD
defines laboratoiy quality management to involve validation of test
methods, among other criteria. Validation of a test requires ongoing
documentation of internal or inter-laboratory performance using
known reference standard(s) for the species and/or diagnostic
specimen(s) of interest, and one or more of the following: the test is
endorsed or published by reputable technical organization
(including the American Association of Avian Pathologists
Isolation and Identification of Avian Pathogens); published in a
peer-reviewed journal with sufficient documentation to establish
diagnostic performance and interpretation of results; or
documentation of an internal or inter-laboratory comparison to an
accepted methodology or protocol.
In the avian diagnostic laboratory, quality management may
include the utilization of check tests, reference sera, and reference
strains of infectious agents, and maintenance of stock cultures of
2
microorganisms. Maintenance and calibration of equipment should
include but not be limited to scales, precision pipettes, incubators,
refrigerators, freezers, autoclaves, spectrophotometers and other
visualization apparatuses, and electrophoresis equipment.
Recording, documentation and review of laboratory procedures
should be routine. Commercial test kits should be used according to
manufacturer’s recommendations. Inventories of reagents and test
kits should be managed with respect to expiration dates.
LABORATORY SAFETY
The avian diagnostic laboratory today should operate under
standard biosafety criteria (4). Although some avian procedures can
be conducted at biosafety level 1, biosafety level 2 is desirable
because some avian pathogens are agents of moderate potential
hazard to personnel. Biosafety level 3 may be required for viruses
and bacteria that may cause serious or potentially lethal disease as a
result of exposure by the inhalation route. Salmonella,
Campylobacter, Chlamydia, Erysipelas, Escherichia and Newcastle
disease can infect persons causing clinical disease from mild
conjunctivitis to systemic illness. Certain strains of highly
pathogenic influenza virus may cause human fatalities. Fungal
cultures carelessly handled can result in massive release of spores
into the laboratory environment. Laboratory workers should be
informed about these risks and trained in proper procedures for
routine and specialized aspects of laboratory duties. Laboratories
should be kept clean and orderly, and surfaces frequently cleaned
and disinfected. Warning notices should be displayed by
laboratories which contain hazardous substances or conditions.
Biosafety cabinets of adequate rating should be maintained and
fully functional. Eating, drinking, and smoking should be prohibited
in laboratory work areas. Personal protective equipment including
appropriate laboratory clothing is always in order, and respiratory
masks and protective eye glasses should be worn when zoonotic
pathogens are suspected.
STORAGE AND ARCHIVING OF ISOLATES
A diagnostic laboratory has a wealth of information and valuable
material pass through it. The agents isolated from commercial
poultry represent a selection process involving large homogeneous
animal populations under performance rearing conditions. These
isolates have value for investigations of virulence and pathogenesis;
epidemiology of emerging agents; evaluation of new drugs and
vaccines, and potentially as new vaccines. Isolates from
noncommercial poultry have value in comparative studies and in
epidemiology. All viruses and most bacteria require ultracold (-70
F or lower) storage that can be achieved with specialty freezers or
liquid nitrogen storage. Some bacteria and fungi can be stored in
special media at room temperature. Specific information about
storage and archiving of samples is provided in the text.
References
1. OIE: World Organization for Animal Health,
http://www.oie.int/eng/maladies/en classification2007.htm?eld7.
2. International Organization for Standardization,
http://www.iso.org/iso/home.htm.
3. American Association of Veterinary Laboratory Diagnosticians.
AAVLD Essential Requirements for An Accredited Veterinary
Medical Diagnostic Laboratory.
http://web.memberclicks.com/mc/page.do?sitePageId=27915&orgl
d=aavld.
4. Centers for Disease Control and Prevention. BMBL Section ΙΠ:
Laboratoiy Biosafety Criteria.
http: //www.cdc. gov/od/ohs/biosfty/bmbl4/bmbl4 s3 .htm.
 2
SALMONELLOSIS
W. Douglas Waltman and Richard K. Gast

SUMMARY. Avian Salmonella infections are important as both a cause of clinical disease in poultry and as a source of food-bome
transmission of disease to humans. Host-adapted salmonellae (5. pullorum and S. gallinarum) are responsible for severe systemic diseases,
whereas numerous serotypes of non-host-adapted paratyphoid salmonellae are often carried subclinically by poultry and thereby may
contaminate poultry products. Crowding, mal-nutrition, and other stressful conditions as well as unsanitary surroundings can exacerbate
mortality and performance losses due to salmonellosis, especially in young birds.
Agent Identification. Salmonella infections in poultry flocks are diagnosed principally by the isolation of the bacteria from clinical tissue
samples, such as pooled internal organs and sections of the intestinal tract. Egg contents may also be cultured to detect S. enteritidis.
Preliminary identification of infected or colonized flocks is often obtained by culturing poultry house or hatchery environmental samples,
such as drag swabs, litter, dust, feed, and hatch residue. Clinical and environmental samples are generally subjected to selective enrichment,
with nonselective preenrichment sometimes employed when salmonellae are present in very small numbers or are potentially injured.
Delayed secondary enrichment often improves Salmonella recovery from many sample types. Samples are plated on selective agar and
bacterial colonies are identified as Salmonella by further biochemical and serological testing.
Serologic Detection in the Host. Serologic identification of infected poultry plays an important role in programs for controlling the spread
of Salmonella in commercial flocks, especially in regard to S. pullorum and 5. gallinarum. Agglutination tests, particularly the rapid whole­
blood plate test, are used for verification of the Salmonella status of flocks participating in the National Poultry Improvement Plan.

INTRODUCTION measures be followed any time individuals go onto a farm or into a

Avian Salmonella infections are important as both a cause of
clinical disease in poultry and as a source of food-bome
transmission of disease to humans. Host-adapted salmonellae are
responsible for pullorum disease (S. pullorum) and fowl typhoid
(S. gallinarum), which are severe systemic diseases that have
become relatively rare in countries with testing and eradication
programs (13). Infections with non-host-adapted (paratyphoid)
salmonellae are common in all types of birds (9,10), although some
serotypes are found predominantly in a fairly limited range of hosts
(e.g., S. arizonae is isolated mostly from turkeys). Crowding, mal­
nutrition, and other stressful conditions as well as unsanitary
surroundings can exacerbate mortality and performance losses due
to salmonellosis. Paratyphoid salmonellae can also cause human
illness, and food-bome Salmonella outbreaks can lead to severe
economic losses to poultry producers as a result of regulatory
actions, market restrictions, or reduced consumption of poultry
products.
CLINICAL DISEASE
Most salmonellae are transmitted horizontally, but some serotypes
(such as S. pullorum and S. enteritidis) can be transmitted vertically
and often produce highly persistent flock infections. Pullorum
disease primarily affects chickens, turkeys, and other fowls during
the first few weeks of life. Fowl typhoid is also observed in mature
poultry. These diseases are uncommon in pet birds species and
pigeons. Paratyphoid salmonellae, particularly some strains of
S. enteritidis, can occasionally cause morbidity or mortality in
young birds of diverse species.
Histopathologic lesions associated with avian salmonellosis include
fibrinopurulent perihepatitis and pericarditis; purulent synovitis;
focal fibmoid necrosis, lymphocytic infiltrations, and small
granulomae in various visceral organs; and serositis of the
pericardium, the pleuroperitoneum, and the serosa of the intestinal
tract and mesentery (9,10,13). Infections with S. arizonae can
produce encephalitis and hypopyon in young turkeys and chickens.
SAMPLE COLLECTION
Both clinical tissue and environmental samples should be collected
as aseptically as possible to prevent cross-contamination. This
includes the use of sterile sampling materials (e.g., swabs, scoops,
bags) and disposable gloves. It is critical that strict biosecurity
3
hatchery.
Clinical Cases
Samples taken from the internal organs of the birds with systemic
salmonellosis are typically free of competing bacteria. In such
cases, isolation is usually relatively simple, and may only require
direct plating on nonselective media. Liver, spleen, heart, heart
blood, ovary or yolk sac, synovial fluid, eye, and brain (if torticollis
is observed) are excellent sources for recovery. Sterile cotton-tipped
swabs are preferred to wire inoculating loops, except for small
organs in young birds, because swabs transfer more tissue. Several
tissues should be cultured from each bird, as tissues with lesions do
not always yield salmonellae. Portions of several tissues may be
pooled and added to selective enrichment broth to increase the
possibility of isolation (Fig. 2.1). Sections of the intestinal tract,
especially the ceca and cecal tonsils, may be cultured by inoculation
into selective enrichment broth.
Serologic Reactors
Because of the potential consequences involved in culturing
serologic reactors, especially pullorum-typhoid, these cases should
be cultured more intensively than routine clinical cases. Also, in
some situations reactor birds may be asymptomatic, the salmonellae
may be present in smaller numbers than in clinical cases, or they
may be more localized. Recent use of antimicrobial agents may
prevent the recovery salmonellae, although they may not
completely clear the organism from the bird.
Reactors should be evaluated by both direct and selective culture
procedures (Fig. 2.1) (15,17). Tissues showing any pathologic
lesions should be sampled using a sterile cotton-tipped swab and
inoculated onto a nonselective plating medium. If desired the swab
may be broken off into a tube of nonselective broth, incubated at
35-37 C for 24 hr, and plated onto nonselective agar.
Portions of the liver, spleen, heart, gall bladder, ovaiy and oviduct
should be pooled (10-15 g total) and then minced, blended, or
stomached. Selective enrichment broth is added to the tissue (one
part tissue homogenate to 10 parts broth) and incubated at 35-37 C
for 24 hr, and if negative they are incubated for an additional 24 hr.
After the internal organ samples have been removed, the intestinal
samples may be taken. Portions of the ceca and the cecal tonsils
(and other sections of the intestinal tract including the crop may
added) should be pooled and minced, blended, or stomached.
Selective enrichment broth is added to the sample (one part sample
to 10 parts broth), incubated typically at 41 C for 24 hr, and plated
on selective plating media.
W. Douglas Waltman and Richard K. Gast
One-Day-old Hatchlings
It is often important to determine the presence of Salmonella
contamination or infection in 1-day-old chicks or poults. Four
methods have been used. The first method, approved by the
National Poultry Plan(NPIP), takes 25 1-day-old chicks (in groups
of 5) and pools the internal organs, yolk sac, and intestinal tracts
from each group in three separate sterile plastic bags (16). Selective
enrichment broth is added to all five groups of pooled samples.
A second method cultures chick meconium collected during chick
handling for sexing. Pools of about 5 g of meconium are collected
from the chicks into sterile plastic bags and inoculated with
selective enrichment broth.
A third method cultures papers that line the boxes the chicks are
transported in from the hatcheiy to the farm. The surface of these
chick papers may be swabbed with double-strength skim milk
(DSSM)-moistened gauze pads or by directly placing pieces of the
paper into a sterile plastic bag and adding selective enrichment
broth.
A fourth method, with good sensitivity, uses 50-100 chicks that
have been held for 48-72 hr with only clean water available for
consumption. This promotes widespread dissemination of infection
among boxmates and increases the likelihood of detection by
culturing the paper liner or even by cloacal swabbing of the birds in
some cases. However, an important difficulty in using this method
is that the chicks must be maintained without cross contamination
from external sources of Salmonella.
Cloacal Swabs
Cloacal swabs have been shown to be an unreliable means of
detecting salmonellae from birds (4). Generally, salmonellae are
excreted intermittently, and often in low numbers. Furthermore
cloacal swabbing of birds requires laborious culture of 300-500
birds to provide dependable results.
Egg Culture
The surface of intact eggs can be sampled by immersion in 30-50
ml of selective enrichment broth in a plastic bag, with soaking or
manual rubbing for at least 30 sec before removal of the egg.
Eggshells can also be manually crushed in selective enrichment
broth to allow more complete access of the media to internal
surfaces. After disinfection of eggshells (generally in 70% ethanol
or 2% tincture of iodine), egg contents can be cultured at a standard
1:10 ratio in selective or nonselective media.
The contents of 10-30 eggs are often pooled for culturing because
of the usual low incidence and level of Salmonella contamination.
To allow salmonellae to multiply to easily detectable levels (and to
minimize media consumption), pools of egg contents should be
incubated for at least 1 day at 37 C or 3 days at 25 C before
subculturing into broth media. Incubated egg pools can be
transferred directly onto selective agar, but significantly greater
detection sensitivity can be attained by using one or more
enrichment steps.
Environmental Monitoring
Environmental monitoring or surveillance has become a useful
method for predicting potential infection or colonization of flocks
with the paratyphoid salmonellae. Environmental sampling has been
shown to be effective and less invasive than other sampling
methods. Although environmental monitoring may show good
predictive evidence of salmonellae in a flock, it is an indirect
indicator and flocks should not be diagnosed as infected based
solely on the environmental sampling.
The probability of detecting salmonellae in environmental samples
depends on the number of salmonellae excreted into the
environment by the flock, the survival of salmonellae in the sample
locations, the intensity of sampling, and the culture methods used.
Fecal shedding of salmonellae is often greatest during the first few
weeks of life, when the susceptibility of chicks to infection is
greatest. Litter surface water activity (equilibrium relative humidity)
4
levels above 0.85 appear to promote the environmental survival and
multiplication of salmonellae.
The frequency and extent of sampling often varies according to the
purpose of the monitoring. For example, the NPIP has established
guidelines for testing breeding flocks for salmonellae (15).
Environmental samples pose a challenge to the detection of the
salmonellae, because salmonellae are often present in low numbers,
salmonellae may be present but injured, and large populations of
other bacteria are often present. Therefore, highly selective
enrichment and plating media must be used.
Drag Swabs. Flock infection or contamination can be conveniently
detected by use of drag swabs. Properly assembled and sterilized 3-
or 4-square inch gauze pads moistened with DSSM are drawn by 3-
4-ft lengths of cord across the surface of the floor litter or dropping
pit for 15-20 min. The full length of the occupied building is
traversed one or more times. The swabs are placed in individual
sterile plastic bags at the farm and transported as soon as possible to
the laboratory on ice packs. Selective enrichment broth is added
directly to the bags containing the swabs (15). An alternative to the
gauze pad is a commercially available sponge. Caution is advised to
make sure these sponges are specially made for culturing purposes,
because many household-type sponges contain bacteriocidal or
bacteriostatic substances.
In studies with broiler chickens, results from several unpooled drag
swabs closely reflected intestinal excretion rates of salmonellae in
the flock (7). Such sampling circumvents more cumbersome
methods of environmental monitoring (5).
Floor Litter. Samples should be collected from representative dry
areas of floor litter; wet and caked ateas, including those around
waterers and feeders, should be avoided because salmonellae
survival may be poor in such areas. A sterile wooden tongue
depressors or similar device is used to collect 5 g of dry litter from
the upper 2.5-5.0 cm (1-2 inches) of floor litter into a sterile plastic
bag from five sites in the pen or house. Additional sample pools
should be collected from other areas of the house or pen to obtain
the following ratio of samples to birds per pen: fewer than 500
birds, 5 pooled samples; 500-2500 birds, 10 pooled samples; 2500
birds or more, 15 pooled samples (15). The sample numbers
suggested above are necessary for reasonable dependability in
monitoring semimature or mature flocks in which excretion rates
may be very low.
Nest Boxes or Egg Belts. Loose litter in nests is a preferred sample
site after breeder hens have been in lay 2-4 wk. Following the same
procedure for the nest litter as given for the floor litter, collect fine
material from the bottoms of at least five nests for each pooled
sample. Samples need not be weighed or measured after some
experience is acquired, but weight should not exceed 10-15 g per
pooled sample.
Many companies no longer use wood shavings in their nest boxes
because of automated egg collection. In lieu of sampling nest
shavings, swabbing the inside of an equal number of nest boxes
using DSSM moistened gauze pads has been shown to be effective.
Each pad may be used to sample 5-10 nest boxes and then placed
into a sterile bag for culture. It is a good practice to combine
sampling the floor, by using either litter or drag swabs, with nest
sampling.
In lieu of swabbing the nest boxes in houses with mechanical nests,
the egg belts may be swabbed with DSSM-moistened swabs,
usually at the front of the house.
Dust. In some regions, dust has been a more dependable source for
isolation of salmonellae than litter. Local experience should be a
guide for determining the most dependable source. Samples are
collected by DSSM moistened gauze pads or by wooden tongue
depressors from 15 or more sites of dust accumulation per pen.
Depending on the volume collected, five samples may be pooled
into one. Use cotton-tipped swabs only for hard-to-reach areas.

Cage Housing. The best methods of sampling for cage houses have
not been fully determined. Methods in current use include sterile
gauze pads moistened with DSSM to aseptically collect material
from egg transport belts and elevators, rollers, diverters, and manure
scrapers or cables. All segments of the house should be sampled.
The drag swab method is also used with layer cages that allow
droppings to accumulate under cages.
Hatcheries. The area most likely to yield salmonellae is the
hatcher during or following hatching. Selective Agar plates, opened
and exposed for 5-10 min to the air in various parts of the hatcheiy
building, have been used to monitor hatcheries. However, failure to
find salmonellae on such plates is not a reliable indication of
freedom from hatchery contamination.
A sterile tongue depressor may be used to collect at least one
heaping tablespoonful of fluff and dust from each hatcher. This
sample is placed into a sterile plastic bag with selective enrichment
broth.
The most reliable sample has been the hatch residue (2). About 10-
15 g of eggshells and other hatch residue remaining after the chicks
are removed from the hatch trays is placed into a sterile plastic bag
to which selective enrichment broth is added. Alternatively, several
hatch trays may be swabbed with gauze pads and pooled.
Feed and Feed Ingredients. About 100 g of feed or feed
ingredients should be collected into a sterile plastic bag representing
multiple sites in a lot of feed. Care should be taken to prevent cross
contamination of the samples.
The Association of Official Analytical Chemists (AOAC)
International method is the most widely accepted procedure for
culturing feed and feed ingredients (1). Twenty-five grams of feed
is mixed with 225 ml of lactose broth. The mixture is allowed to
stand for 1 hr and the pH is adjusted to 6.8 + 0.2. The culture is
incubated at 35 C for 24 hr. One milliliter of the culture is
transferred into 10 ml of tetrathionate (TT) broth and 0.1 ml is
transferred into Rappaport-Vassiliadis (RV) broth. The two
enrichment broths are incubated at 43 C and 42 C, respectively.
After 24 hr, the cultures are inoculated onto bismuth sulfite,
Hektoen enteric (HE), and xylose lysine desoxycholate (XLD)
agars.
Some investigators have suggested that this procedure be modified
by using universal preenrichment or buffered peptone water (BPW)
as the preenrichment broth; by reducing the selective enrichment
incubation temperatures to 41 C; and by replacing the plating media
with more selective agars, such as brilliant green supplemented with
novobiocin (BGN) and xylose lysine tergitol 4 (XLT4) agars.
Shipping and Storing Samples
Holding Media. Studies have shown that the best moistening agent
and holding media for environmental swabs is DSSM (12). This
medium is prepared by dissolving 200 g Bacto Skim Milk (BD
Diagnostics Systems, Sparks, MD) in 1 liter distilled or deionized
water in a large flask and autoclaving. The DSSM may be stored in
the refrigerator.
Sample Storage Times and Temperatures. Specimens from
clinical diagnostic consignments and serologic reactors should be
cultured immediately upon collection and no more that 24 hr after
collection even if they are refrigerated. Meconium, freshly voided
feces, and water should be refrigerated at Ί-b C as soon as possible
and inoculated into appropriate culture media within 24 hr. Drag
swabs and other swabs containing DSSM may be refrigerated for 3
days or frozen for 7 days before inoculation of selective enrichment
broth (12). Because the survival rate of salmonellae in floor litter
samples varies considerably, even under refrigeration, it is best to
culture floor litter within 2 days of collection. This is advisable
despite the fact that some dry environmental samples have yielded
salmonellae when held for several months at room temperature and
low humidity.
5
Chapter 2 Salmonellosis
PREFERRED CULTURE MEDIA AND SUBSTRATES
Recommended Steps, Media, and Incubation Times and
Temperatures.
The isolation and identification flow chart in Fig. 2.1 details the
selection and use of preferred media in a variety of testing
situations. Selective enrichment broths are typically inoculated at a
1:10 ratio of sample to broth, except for RV enrichment, which is
inoculated at a 1:100 ratio from a pre-enrichment broth.
Typically, internal organ samples and samples having lower
background levels of bacteria may be incubated at 35-37 C.
Intestinal and environmental samples having higher levels of
background bacteria are commonly incubated at 40-43 C. Because
of potential incubator problems and the sensitivity of some strains
to higher temperatures, the preferred incubation temperature is
41+0.5 C. Routine monitoring of the temperature of incubators is
critical when using the higher temperatures.
Selective enrichment broths should be incubated 20-24 hr and
plated. Use of a delayed secondary enrichment (DSE) procedure is
highly recommended (see below), but if not, the enrichment broths
should at least be incubated an additional 24 hr and replated.
Precautions for Environmental and Intestinal Samples
Isolation of salmonellae from environmental and intestinal
monitoring samples is much more demanding than isolation from
samples collected from bacteremic (clinically affected) or carrier
(serologic reactor) birds. In bacteremic or carrier birds, salmonellae
populations are often high, particularly with respect to bacterial
competitors. In contrast, salmonellae levels are ordinarily low in
environmental or intestinal samples where competing bacteria are
found in high levels. These competitors, if not controlled, seriously
impair media detection efficiency, resulting in false negatives.
The dependable isolation of salmonellae from environmental and
intestinal samples is, therefore, significantly improved by
incubation of enrichment broths at 41 + 0.5 C for a full 24-36-hr
period, use of novobiocin- or tergitol (niaproof) 4-supplemented
media, DSE of primary selective enrichment broths, and use of a
plate-streaking technique that produces well-separated colonies.
Non-Selective Media
Salmonellae grow well on such nonselective broth media as veal
infusion, brain-heart infusion, or nutrient broth. Nonselective agars
that may be used include blood agar and nutrient agar. MacConkey
agar, although mildly selective, is frequently used as a nonselective
medium.
These media are preferred for tissues from clinical cases and
serologic reactors in which the likelihood of competing bacteria is
low. Use of nonselective media is important when S. pullorum or S.
gallinarum are suspected, as some strains may be inhibited by
selective media.
Pre-enrichment
Preenrichment is the process of inoculating nonselective broth
media with the sample and incubating it for 24 hr at 35-37 C.
Typically, 1.0 ml of the preenriched culture is transferred to 10 ml
of a TT enrichment broth or 0.1 ml is transferred to 10 ml of RV
enrichment broth. The purpose of preenrichment is to revive injured
salmonellae that may be present in some samples. Typical
preenrichment media include lactose broth and BPW.
Selective Enrichment Broths
Tetrathionate Enrichments. Tetrathionate broths are the preferred
selective enrichments for salmonellae isolation. Older formulations,
such as Mueller-Kauffrnann TT brilliant green broth, require the
addition of both iodine and brilliant green solutions to the broth
immediately before use. However, newer formulations, such as TT
broth, Hajna, or TT, Hajna and Damon (BD Diagnostic Systems,
W. Douglas Waltman and Richard K. Gast
Sparks, MD) are supplied already containing brilliant green and
require only the addition of an iodine solution to the broth base. The
newer TT formulations contain more nutrients and buffers. The
iodine solution differs for the individual TT formulations, so care
must be taken to ensure the appropriate one is used and that it is
prepared and stored correctly.
Selenite Enrichments. The use of selenite enrichments are no
longer recommended because they have a short shelf life, are not as
effective at higher incubation temperatures (3), potentially
mutagenic (11), and in many geographic areas are considered to be
a hazardous waste.
Rappaport-Vassiliadis Enrichments. A selective enrichment that
is gaining acceptance and appears to be replacing selenite
enrichments is RV broth. The RV enrichment procedure begins with
preenrichment of the sample in BPW and then inoculation into RV
broth at a ratio of 1:100. The RV broth should be incubated at 41-
42 C.
Delayed Secondary Enrichment (DSE)
After the 24-hr incubation of the TT and plating onto BGN and
XLT4 agars, the TT culture is left at room temperature for 5-7 days.
If the original plating was negative for salmonellae, 0.5-1.0 ml of
the original TT broth is transferred into 10 ml of fresh TT broth and
incubated at 37 C for 24 hr. The new TT broth is plated and
processed as before (16). Studies have shown that DSE increases
the recovery rates of salmonellae from most sample types (18).
Selective Plating Media
Rationale for Using. Because of the high levels of nonsalmonellae
bacteria in most intestinal and environmental samples, selective
plating media must be used to assist the selective enrichment broth
in inhibiting other bacteria. Conventional salmonellae plating media
lacks the selectivity necessary for these samples. Many media can
inhibit most coliforms, however, the primary problems are with
species of Proteus, Providencia, Morganella, and Pseudomonas.
These bacteria resemble salmonellae on some plating media and
must be screened, resulting in high percentages of false-positive
cultures. The addition of 20 pg of novobiocin (N1628 Sigma
Chemical Co., St. Louis, Mo.) per ml of plating media, especially
brilliant green (BG) (14) and XLD agars, results in the inhibition of
Proteus. Another plating medium that has proven to be effective is
XLT4 (BD Diagnostic Systems, Sparks, MD). This medium inhibits
Proteus and Pseudomonas aeruginosa. A combination of two
plating media that are predicated on different selective and
differential characteristics is advocated. BGN and XLT4 are two
good choices (8). The use of BGN agar, which demonstrates the
positive hydrogen sulfide (H2S) production characteristic, increases
the likelihood of detecting atypical strains. Hydrogen sulfide­
negative strains undetected on XLT4 should be obvious on BGN,
because they usually remain lactose-negative. Conversely, lactose­
positive strains (eg., S. arizonae and others) undetected on BGN
should be obvious on XLT4 because they usually remain MS­
positive.
Brilliant Green (BG) Supplemented with Sulfapyridine or
Sulfadiazine (BGS), and BGN Agars. Brilliant green agar has
been supplemented with antimicrobial compounds to make it more
selective. The purpose of adding sulfapyridine or sulfadiazine and
novobiocin was primarily to inhibit Proteus species. Salmonellae
colonies on these media are usually transparent pink to deep
fuchsia, surrounded by a reddish medium. These colonies may lose
this characteristic appearance if there is a heavy growth of lactose-
fermenting colonies or if the colonies are not well separated. Some
nonsalmonellae bacteria produce colonies similar in appearance to
salmonellae and must be screened further. Host-adapted S. pullorum
and 5. gallinarum colonies are smaller and grow slower than non-
host-adapted salmonellae. Consequently, all plates should be
incubated for 48 hr.
6
Xylose Lysine Desoxycholate, XLD Supplemented with
Novobiocin, and XLT4 Agars. The differential characteristics of
these media include the lysine decarboxylation and H2S-producing
abilities of most salmonellae. Hydrogen sulfide-positive
salmonellae colonies are nearly or fully jet black. Proteus (inhibited
on XLDN and XLT4) colonies may appear blackish, but the color is
less brilliant, tending to have a gray or green cast as the colonies
age. Colonies of Citrobacter freundii ordinarily have black centers
and prominent creamy-colored borders on these media.
Other Plating Media. Bismuth sulfite and Hektoen enteric agars,
although widely used in human clinical situations and advocated by
the Food and Drug Administration (FDA) and AOAC International
for food and feed, lack the sensitivity and specificity of BGN and
XLT4. Modified lysine iron agar (MLIA) incorporates novobiocin
and is similar in recovery to BGN or XLDN. Rambach agar, a new
chromogenic agar, appears to be effective, but it is more expensive
than other options. Recently, several other chromogenic agars have
been developed for the isolation of Salmonella. The most
thoroughly studied of these, Miller-Mallinson (MM) media, has
been found to be very effective.
Rapid Salmonella Detection Techniques
A number of rapid tests have been approved for detecting
salmonellae in various samples. Typically these have been approved
based on comparison to AOAC International culture procedures (1).
The rapid tests have several advantages over conventional culture,
such as obtaining results in less than 48 hr, being less labor
intensive, and having the possibility of automation. For many
sample types, especially clinical, processing plant, and food
samples, these rapid tests appear to be veiy effective. However,
some sensitivity and specificity problems are apparent with feed
and environmental samples.
A variety of rapid detection systems are commercially available,
including antigen-capture enzyme-linked immunosorbent assay
(AC-ELISA) systems, DNA probes, polymerase chain reaction
systems, immunodiffusion, immunofluorescence, magnetic bead
systems, bioluminescence, and other novel applications. A listing of
these tests may be found at the FDA-BAM website. Currently,
NPIP has approved a rapid ruthenium-labeled sandwich
immunoassay and two PCR systems for detecting Salmonella in
environmental samples (15). As technology advances the sensitivity
and specificity of rapid systems will surely increase and allow more
widespread use.
AGENT IDENTIFICATION
Basic Identification Screening Media
The combined use of TSI and LI agar slants is generally sufficient
for presumptive identification of most salmonellae-suspect colonies.
At least three well-separated colonies are selected for transfer to
each set of TSI and LI agar slants. Each colony is stabbed into the
butt of the TSI and LI agars and streaked across the slants. The
tubes are read after incubation for 24 hr at 37 C. The use of more
selective plating media (BGN and XLT4) to screen these
salmonellae suspect colonies results in fewer false positives
(nonsalmonellae bacteria).
The presence of multiple serotypes may be more likely in some
samples than in others. Also, in situations where S. enteritidis, S.
pullorum, qt S. typhimurium are being monitored, and other
salmonellae are present, screening many more colonies may be
necessary to ensure the absence of S. enteritidis, S. pullorum, or S.
typhimurium serotypes. The Colony Lift Immunoassay (Synbiotics
Corp., San Diego, CA) may be useful in detecting group D
salmonellae in these situations (6).
Triple Sugar Iron (TSI) Agar. Most salmonellae produce an
alkaline (red) slant and acid (yellow) butt, with gas bubbles in the
agar and a blackening due to H2S production that often obscures the

acid reaction in the butt of the tube. Salmonella gallinarum does not
form gas in TSI, whereas S. pullorum may show weak gas
production. Both of these Salmonella may or may not show H2S
production. Some paratyphoid strains may be H2S-negative in this
medium.
Lysine Iron (LI) Agar. Salmonellae will show lysine
decarboxylation, with a deeper purple (alkaline) slant and alkaline
or neutral butt with slight blackening due to H2S production, with
the exceptions noted in the previous paragraph. LI agar is useful in
differentiating common intestinal flora such as Proteus and
Citrobacter from further consideration. Proteus (also Providencia
and Morganella) produces a reddish or port-wine colored slant,
indicating lysine deamination, and a yellow (acid) butt on LI agar
medium. Citrobacter gives a purple (alkaline) slant and a yellow
(acid) butt, with some H2S production. Rarely, both slant and butt
are yellow.
Biochemical and Serological Confirmation
Biochemical Identification. Further biochemical tests may be
necessary to confirm an isolate as Salmonella. Table 2.1 lists
several typical biochemical reactions of salmonellae. Key tests for
differentiating salmonellae from other bacteria include those for
urea {Proteus and most Providencia and Morganella are urease
positive), beta-galactocidase (salmonellae with the exception of
S. arizonae, are negative whereas C. freundii and other coliforms
are positive), and indole (Escherichia coli and Escherichia tarda
produce indole, salmonellae do not).
Commercially available identification systems may also be very
useful in confirming isolates. They use a number of biochemical
tests in a simple to use format.
Serological Typing. The presumptive salmonellae colonies
identified by the TSI and LI agar reactions should be serologically
typed. The first phase of serologic typing is to serogroup the isolates
based on their somatic O-group antigens using commercially
available polyvalent somatic antisera. Individual polyvalent antisera
are tested against each isolate in a simple plate agglutination assay.
Bacterial growth from an agar plate is emulsified in a small amount
of physiologic saline to form a milky suspension, and one drop of
polyvalent O antisera is mixed with it on a slide or plate. The
agglutination reaction is read within 60 sec. After determining
which polyvalent antiserum agglutinates with the isolate, additional
testing is performed using individual single factor O-group antisera
that comprised the polyvalent antiserum. In this maimer, each
isolate is typed to a specific serogroup.
The next step, which is often performed at a reference laboratory,
is to determine the serotype. The serotype is based on the flagellar
antigen present on almost all salmonellae, except 5. pullorum and
S. gallinarum. Commercially produced antisera are available for
serotyping most isolates (BD Diagnostic Systems, Sparks, MD).
The serotyping procedure involves an antigen extraction step with
formalin, followed by a microtube agglutination test.
7
Chapter 2 Salmonellosis
SEROLOGIC DETECTION IN THE HOST
Serologic Testing of Poultry Flocks
Several serologic tests have been developed for detecting
antibodies to salmonellae. The most commonly used tests for
pullorum-typhoid include the whole blood plate (WBP) (not
approved for use in turkeys), rapid serum plate, standard
macroscopic tube agglutination, microagglutination, and
microantiglobulin tests (9,15). Possibly the most widely used of
these tests is the WBP test, which can be performed in the field
using commercially available antigens. A drop of fresh blood is
mixed with a drop of antigen on a plate, mixed, and observed for
agglutination within 2 min.
The tube agglutination test is also commonly used. It requires sera
for testing with an antigen that may be obtained from the NVSL. In
the macroscopic tube agglutination test the sera are diluted 1:25 to
1:50 for chickens or 1:25 for turkeys. The sera are mixed with the
antigen, incubated at 37 C for 20-24 hr, and observed for
agglutination. Because the WBP test is not approved for turkeys, the
tube agglutination or rapid serum agglutination tests are typically
used.
Agglutination tests have also been used for detecting antibodies to
various paratyphoid salmonellae, especially S. typhimurium, S.
arizonae, and S. enteritidis. These tests have met with varying
degrees of success due to sensitivity and specificity problems and
thus have not found widespread commercial application. Because S.
enteritidis and S. pullorum share somatic antigens, pullorum-
typhoid antigen preparations have sometimes been applied for
detecting antibodies to S. enteritidis.
Enzyme-linked immunosorbent assays (ELISAs) have been
developed for detecting antibodies to various salmonellae. The most
widely used ELISAs have been developed for detecting antibodies
to S. enteritidis. These ELISAs have been used with some success,
particularly in Europe, but concerns about their specificity still
persist.
The various serologic tests for detecting antibodies to salmonellae,
especially the agglutination tests, are subject to false positive
reactions. Confirmation of all positive serologic tests by culturing
the bird for salmonellae is important.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Young birds with generalized Salmonella infections may show
signs and lesions identical to any bacteremia. In severe outbreaks of
salmonellosis, fibrinous liver and heart lesions may be very similar
to those seen with air sac disease (colibacillosis). The heavy
yellowish white cheesy exudate covering the retina of turkey poults
with S. arizonae infection and occasionally with other paratyphoid
infections can be confused with signs of aspergillosis. Nervous
signs associated with infection of the brain of fowl may resemble
those of Newcastle disease or other diseases affecting the central
nervous system. Joint involvement may be mistaken for synovitis or
bursitis due to other infectious agents.
W. Douglas Waltman and Richard K. Gast

Figure 2.1 General Salmonella /solation and identification

A Hajna TT or Mueller-Kauffmann tetrathionate enrichment broths.

For RV broth, follow special inoculation and preenrichment instructions of manufacturer
B Beef extract, veal infusion, or comparable non-selective media.
A broth detect can help detect low Salmonella levels in live birds.
C BGN in combination with XLT4 is preferred (refer to text)
D Colony lift immunoassays can significantly increase the reliability detecting Group D Salmonella
(S. enteritidis, S. pullorum, etc. on plating agars (refer to text)
E If combined results with TSI and LI agars, additional identification media, and O-group screening
procedures are inconclusive, restreak original colony onto selective plating agar to check for purity.
F Reevaluate if epidemiologic, necropsy or other information strongly suggests the presence of an unusual
strain of Salmonella.

8
 Chapter 2 Salmonellosis

Table 2.1 Typical biochemical reactions of Salmonella K 4. Fanelli, M J., W. W. Sadler, C. E. Franti, and J. R. Brownell.
Paratyphoid Localization of salmonellae within the intestinal tract of chickens. Avian
Media S. pullorum S. gallinarum S. arizonae
salmonellae Dis. 15:366-375. 1971.
Dextrose A(G)b A AG AG 5. Kingston, D. J. A comparison of culturing drag swabs and litter for
Lactose - - - (-)C identification of infections with Salmonella spp. in commercial chicken
flocks. Avian Dis. 25:513-516. 1981.
Sucrose - - - - 6. Lamichhane, C. M, S. W. Joseph, W. D. Waltman, T. Secott, E. M Odor,
Mannitol A(G) A AG AG J. deGraft-Hanson, E. T. Mallinson, V. Vo, and M Blankford. Rapid
Maltose (-)D A AGe AG detection of Salmonella in poultry using the colony lift assay. In:
Dulcitol - A AG - Proceedings of the Southern Poultry Science Society. Atlanta, Ga. Poult.
Sci. (Suppl. 1)74:198. 1995.
Malonate - - - +F
7. Mallinson, E. T., C. R. Tate, R. G. Miller, B. Bennett, and E. Russek-
Urea - - - - Cohen. Monitoring poultry farms for Salmonella by drag swabs sampling
Motility - - + + and antigen capture immunoassay. Avian Dis. 33:684—690. 1989.
A = acid produced; G = gas produced; 0 = variable reaction 8. Miller, R. G., C. R. Tate, E. T. Mallinson, and J. A. Scherrer. Xylose
B Blood agar is generally used as the non-selective agar plate. If desired, the lysine tergitol 4: an improved selective agar medium for the isolation of
Salmonella. Poult. Sci. 70:2429-2432. 1991.
swabs or pieces of tissue may be inoculated into a non-selective broth, such
9. Gast, R. K. Paratyphoid infections. In: Diseases of poultry, 11th ed. Y. M
cas brain-heart infusion or nutrient broth. Saif, H. J. Barnes, J. R. Glisson, A M Fadly, L. R. McDougald, and D. E.
Brilliant green agar supplemented with novobiocin (BGN) in combination
Swayne, eds. Iowa State University Press, Ames, Iowa. pp. 583-613. 2003.
with xylose-lysine-tergitol (niaproof) 4 (XLT4) agar are preferred (refer to 10. Nagaraja, K. V., B. S. Pomeroy, and J. E. Williams. Arizonosis. In:
text). If S. pullorum is suspected, MacConkey (MAC) agar may be Diseases of poultry, 9th ed. B. W. Calnek, H. J. Bames, C. W. Beard, W. M
substituted for XLT4 agar).
Reid, and H. W. Yoder, Jr., eds. Iowa State University Press, Ames, Iowa,
D Colony lift immunoassays may increase the reliability of detecting Group
pp. 130-137. 1991.
D Salmonella (e.g. S. enteritidis, S. pullorum, etc) on plating media (refer to 11. Noda, Μ, T. Takano, and H. Sakurai. Mutagenic activity of selenium
text). compounds. Mutat. Res. 66:175-179. 1979.
E Salmonella typhimurium var. Copenhagen, as isolated from pigeons, 12. Opara, Ο. O., L. E. Carr, C. R. Tate, R. G. Miller, E. T. Mallinson, L. E.
frequently forms no acid in maltose broth and can be confused with S. Stewart, and S. W. Joseph. Evaluation of possible alternatives to double­
pullorum. However, it is motile. strength skim milk used to saturate drag swabs for Salmonella detection.
F Turns deep Prussian blue within 24 hr. Avian Dis. 38:293-296. 1994.
13. Shivaprasad, Η. N. Pullorum Disease and Fowl Typhoid. In: Diseases of
poultry, 11th ed. Y.M Saif, H. J. Bames, J; R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, eds. Iowa State University Press, Ames,
ACKNOWLEDGMENT Iowa. pp. 568-582. 2003.
14. Tate, C. R., R. G. Miller, E. T. Mallinson, and L. W. Douglass. The
The guidance supplied by Edward T. Mallinson is very gratefully isolation of salmonellae from poultry environmental samples by several
acknowledged enrichment procedures using plating media with and without novobiocin.
Poultry Sci. 69:721-726. 1990.
REFERENCES 15. United States Department of Agriculture (USDA). National Poultry
Improvement Plan and Auxiliary Provisions. Animal and Plant Health
1. Association of Official Analytical Chemists (AOAC) International. Inspection Service, 91-55-063. USDA, Washington, D.C. Feb 2004.
Official methods of analysis, 16th ed. P. Cunniff, ed. AOAC International, 16. Waltman, W. D., A. M Home, C. Pirkle, and T. G. Dickson. Use of
Gaithersburg, Md. pp. 55-94. 1996. delayed secondary enrichment for the isolation of Salmonella in poultry and
2. Bailey, J. S., N. A. Cox, and Μ E. Berrang. Hatchery-acquired poultry environments. Avian Dis. 35:88-92. 1991.
salmonellae in broiler chicks. Poult. Sci. 73:1153-1157. 1994. 17. Waltman, W. D., and A. M Home. Isolation of Salmonella from
3. Carlson, V. L., and G. H. Snoeyenbos. Comparative efficacies of selenite chickens reacting in the pullorum-typhoid agglutination test. Avian Dis.
and tetrathionate enrichment broths for the isolation of Salmonella 37:805-810. 1993.
serotypes. Am. J. Vet. Res. 35:711-718. 1974. 18. Waltman, W. D., A. M Home, and C. Pirkle. Influence of enrichment
incubation time on the isolation of Salmonella. Avian Dis. 37:884—887.
1993.

9
 3
COLIBACILLOSIS
Margie D. Lee and and Lisa K. Nolan

SUMMARY. Escherichia coli is the causative agent of colibacillosis in poultry. The disease results from a systemic infection involving the
blood, joints, and/or air sacs of birds. Young birds (4-8 wk old) may die of acute septicemia that is preceded by only a brief period of
anorexia and depression. At necropsy, lesions are sparse but may include swollen, dark-colored liver and spleen and increased fluid in the
body cavities. Birds surviving the acute phase may develop fibrinopurulent airsacculitis, pericarditis or arthritis. Whether lesion-associated
isolates are primary pathogens or whether environmental factors are responsible is unknown at this time.
Agent Identification. Isolation of E. coli is significant if made from the internal organs or blood from fresh carcasses. MacConkey agar is
selective and differential for E. coli and is preferred for primary isolation. Presumptive positive colonies (pink on MacConkey that produce
A/A reaction on triple sugar iron agar and that are oxidase-negative, gram-negative rods should be confirmed as E. coli by a positive indole
test and the inability to produce H2S. But some isolates do not form pink colonies on MacConkey, therefore multiple colonies should be
separately inoculated on triple sugar iron agar to detect these pathogens.
Serologic Detection in the Host. Host serology is not useful for diagnosis because many birds have antibody to normal intestinal flora
isolates of E. coli.

INTRODUCTION fibrinopurulent lesions suggest subacute colibacillosis, swab

Colibacillosis of poultry is a common systemic infection caused by
avian pathogenic Escherichia coli (APEC). The disease is
economically important to poultry production worldwide.
Colibacillosis occurs in many forms. It may occur as
colisepticemia, which typically leads to death. However, some
birds fully recover from colisepticemia, and others may recover
with sequelae (2). Colibacillosis may also be localized, manifesting
as omphalitis, yolk sac infection, cellulitis, swollen head syndrome,
enteritis, acute vaginitis, salpingitis, or peritonitis (2,12). For E. coli
infections to become clinically apparent, adverse environmental
factors or other infectious agents are usually required (2, 3). A
foodbome link between human disease and APEC has not been
established. However, recent reports of similarities between the
virulence attributes of APEC and human extraintestinal pathogenic
E. coli, suggest that some APEC may be capable of causing disease
in human beings (4,10).
CLINICAL DISEASE
Clinical signs of colibacillosis are nonspecific and vaiy with the
age of bird, duration of infection, organs involved, and concurrent
disease conditions. In young (4 to 8-wk-old) broilers and poults
dying of acute septicemia, death is preceded by a brief period of
anorexia, inactivity, and somnolence. At necropsy, lesions are
sparse except for swollen, dark-colored liver and spleen and
increased fluid in all body cavities. Birds surviving the septicemia
phase of the disease are unthrifty and develop subacute
fibrinopurulent airsacculitis, pericarditis, perihepatitis, and
lymphocyte depletion in the bursa and thymus. Airsacculitis,a
classic lesion of colibacillosis, occurs following respiratory
exposure to large numbers of E. coli, but also occurs as a sequel to
bacteremia. Other less common lesions are arthritis, osteomyelitis,
salpingitis, and pneumonia (1,3,6). Cellulitis, responsible for
substantial economic losses for the poultry industry, has also been
associated with E. coli infection (12).
SAMPLE COLLECTION
Only internal organs or blood, not feces or intestine, are useful
samples. Because normal intestinal flora E. coli readily invade
other tissues after death, specimens from fresh carcasses are
necessary. When acute colisepticemia is suspected, heart blood and
liver should be sampled aseptically. One ml of blood collected by
needle and syringe can be used to inoculate broth media (1:10),
which is used to streak agar plates. Sterile culture swabs or
inoculation loops can be stabbed into the liver parenchyma after
searing the capsule with a flamed scalpel or spatula. When
10
samples of exudate should be collected from the pericardial sac, air
sacs, and joints. Lesions present more than 1 wk are often sterile.
When postmortem changes are obvious, bone marrow samples may
be useful because they are less likely than other tissues to contain
intestinal E. coli. Escherichia coli isolates survive well on sealed
agar slants for storage and shipping. For long-term storage, mix E.
coli broth culture with sterile glycerol 1:1 and store at -20 to -60 C.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Escherichia coli grows well in most commonly used culture
media, but differential media are useful for primary isolation.
MacConkey's agar is a selective and differential medium for the
isolation of enteric organisms. Tryptose blood agar with 5% bovine
blood can be used as a primary culture medium to support growth of
E. coli and other bacterial pathogens. Several differential
biochemical characteristics can be obtained through use of Kligler’s
iron agar or triple sugar iron agar slants. All the above media are
readily available from BD Diagnostics (Sparks, Md.).
Microbiology identification kits such as the API 20E (bioMerieux
Vitek, Hazelwood, Mo.) and Enterotube (Becton Dickinson
Microbiology Systems) are useful for performing the biochemical
tests and are available commercially.
AGENT IDENTIFICATION
Colony Morphology and Biochemical Features
Blood samples should be diluted 1:10 in brain-heart infusion broth
then inoculated directly onto MacConkey’s plates. Swabs from
lesions can be used to streak MacConkey’s plates. MacConkey’s
agar should be incubated aerobically for 18-24 hr at 37 C for the
primary isolation of E. coli. Escherichia coli, Enterobacter, and
Klebsiella ferment lactose and can be distinguished from the other
enteric organisms. On MacConkey's agar, most E. coli and some
Enterobacter isolates produce 1-2-mm-diameter hot-pink colonies
(lactose positive) whereas Klebsiella and Enterobacter aerogenes
form large mucoid pink colonies (8). However slow lactose-
fermenting E. coli are frequently isolated from cases of
colibacillosis and these may not form pink colonies. If primary
cultures reveal large numbers of a predominant colony type
suggestive of E. coli, pick several of these colonies and use them to
separately inoculate triple sugar iron agar (or Kligler’s iron agar),
sulfide-indole-motility (SIM) medium, and blood agar plates. If the
clinical signs suggest colibacillosis infection, and no hot-pink
colonies are seen on the MacConkey’s plates, pick a couple of non­
pink colonies to inoculate blood agar, triple sugar iron agar and
SIM. A Gram stain and the oxidase reaction can be performed on
colonies from blood agar plates. Escherichia coli, Enterobacter,

and Klebsiella are oxidase-negative, gram-negative rods. On triple
sugar iron agar (or Kligler’s iron agar), these organisms produce
acid (even the slow lactose-fermenting E. coli) and gas but not H2S.
On SIM medium, E. coli is positive for the indole reaction, positive
or negative for motility, and negative for H2S, whereas
Enterobacter and Klebsiella are usually indole-negative (Fig. 3.1).
The site of sample collection, condition of the carcass, and nature
of the lesion are important when deciding whether isolation of E.
coli is relevant. The isolation of a pure culture of E. coli from the
organs or blood of moribund birds or freshly dead carcasses is
indicative of colibacillosis. Pathogenicity of E. coli isolates has
traditionally been established by inoculating young (less than 3-wk-
old) chicks or poults parenterally with 0.1 ml of overnight broth
culture. Pathogenic isolates should produce death or characteristic
lesions of colibacillosis within 3 days. Alternately, inoculation of
embryonated eggs may be used to establish the pathogenicity of E.
coli isolates (7). Also, many APEC share a complex of plasmid-
associated virulence genes, whose presence may be helpful in
distinguishing APEC from non-pathogenic strains (9). Hence,
multiplex PCR, targeting these common genes, may have value in
confirming the pathogenic nature of E. coli isolates (11).
Figure 3.1. Escherichia coli identification scheme .Diagnosis of
colibacillosis is dependent on distinguishing pathogenic isolates from
nonpathogenic, normal intestinal flora isolates of E. coli.
Serogrouping of Isolates
Escherichia coli serogroups are based on O antigens; but serotypes
of E. coli are based on O antigens, as well as flagellar and/or
capsular antigens (5). There is great diversity of serogroups/types
among APEC, although some occur more commonly than others
(e.g., 078 and 02), and many isolates are not typable (9). Routine
serotyping of APEC is usually impractical, but for epidemiologic
studies, isolates can be serotyped for a fee by the Gastroenteric
Disease Center (Pennsylvania State University, University Park,
Penn.).
11
Chapter 3 Colibacillosis
Antimicrobial Susceptibility
APEC isolates are frequently resistant to more than one antibiotic.
Seventy to 90% of isolates are resistant to sulfa drugs, tetracyclines,
streptomycin, and gentamicin. It is not uncommon to find isolates
that are multi-resistant to greater than 3 antibiotics. Resistance to
fluoroquinolones is less frequently detected; a recent study (13)
reported that 84% of isolates were susceptible to enrofloxacin.
SEROLOGIC DETECTION IN THE HOST
Serology is not commonly used to detect E. coli infection.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Colibacillosis should be distinguished from other bacterial
infections causing fatal septicemia or fibrinopurulent inflammation
of air sacs, pericardium, joints, and other viscera. Diseases to be
considered in the differential diagnosis include mycoplasmosis,
salmonellosis, pasteurellosis, pseudotuberculosis, erysipelas,
chlamydiosis, and staphylococcosis. Colibacillosis is a common
complication of concurrent viral respiratory or enteric infections.
REFERENCES
1. Arp, L.H. Pathology of spleen and liver in turkeys inoculated with
Escherichia coli. Avian Pathol. 11:263-279. 1982.
2. Barnes, H.J., J.-P. Vaillancourt, and W.B. Gross. Colibacillosis. In:
Diseases of poultry, 11th ed Y.M Saif, H. J. Bames, J.R. Glisson, A.M
Fadly, L.R. McDougald, and D.E. Swayne, eds. Iowa State University
Press, Ames, Iowa. pp. 631-652. 2003.
3. Gross, W.B. Colibacillosis. In: Diseases of poultry, 9th ed. B.W.
Calnek, H.J. Bames, C.W. Beard, W.M Reid, and H.W. Yoder, eds. Iowa
State University Press, Ames, Iowa. pp. 138-144. 1991.
4. Johnson, J.R., A.C. Murray, A. Gajewski, M Sullivan, P. Snippes, MA.
Kuskowski, and K.E. Smith. Isolation and Molecular Characterization of
nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from
retail chicken products. Antimicrob Agents Chemother. 47: 2161-2168.
2003.
5. Kaper, J. B., J.P. Nataro, and H.L.T. Mobley. Pathogenic Escherichia
coli. Nature Rev. Microbiol. 2: 123-140. 2004.
6. Nakamura, K., M Maecla, Y. Imada, T. Imada, and K. Sato. Pathology of
spontaneous colibacillosis in a broiler flock. Vet. Pathol. 22:592-597. 1985.
7. Nolan, L.K., R.E. Wooley, J. Brown, K.R. Spears, H.W. Dickerson, and
M Dekich. Comparison of a complement resistance test, a chicken embryo
lethality test, and the chicken lethality assay for determining virulence of
avian Escherichia coli. Avian Dis. 36:395-397. 1992.
8. Quinn, P.J., ME. Carter, B.K. Markey, and G.R Carter. Clinical
veterinary microbiology. Mosby-Year Book Limited, London, England,
pp. 209-236. 1994.
9. Rodriguez-Siek, K.E., C.W. Giddings, M Fakhr, C. Doetkott, T.J.
Johnson, and L.K. Nolan. Characterizing an APEC pathotype. Vet Res. 36:
1-16. 2005.
10. Rodriguez-Siek, K.E., C.W. Giddings, T.J. Johnson, M Fakhr, C.
Doetkott, and L.K. Nolan. Comparison of Escherichia coli implicated in
human urinary tract infection and avian colibacillosis. Microbiol. 151:
2097-2110. 2005.
11. Skyberg, J.A, S.M Home, C.W. Giddings, R.E. Wooley, P.S. Gibbs, and
L.K. Nolan. Characterizing avian Escherichia coli isolates with multiplex
PCR Avian Dis. 47:1441-1447,2003.
12. Vaillancourt, J.-P., and H.J. Bames. Coliform Cellulitis. In: Diseases
of poultry, 11th ed. Y.M Saif, H. J. Bames, J.R Glisson, A.M Fadly, L.R.
McDougald, and D.E. Swayne, eds. Iowa State University Press, Ames,
Iowa. pp. 652-656. 2003.
13. Zhao, S., J.J. Maurer, S. Hubert, J.F. De Villena, P.F. McDermott, J.
Meng, S. Ayers, L. English, and D.G. White. Antimicrobial susceptibility
and molecular characterization of avian pathogenic Escherichia coli isolates.
Vet. Microbiol. 107:215-24,2005.
 4
PASTEURELLOSIS, AVIBACTERIOSIS, GALLIBACTERIOSIS, RIEMERELLOSIS, AND PSEUDOTUBERCULOSIS
John R. Glisson, Tirath S. Sandhu, and Charles L. Hofacre

SUMMARY. In avian hosts, certain members of the genera Pasteurella, Avibacterium, Gallibacterium and the species Riemerella
anatipestifer and Yersenia pseudotuberculosis cause septicemic and respiratory disease. Acute diseases caused by these Gram-negative
bacteria are often characterized by high flock mortality and morbidity. Clinical signs of acute disease include ruffled feathers, depression,
increased respiratory rate, cyanosis, emaciation, and diarrhea. Lesions may consist of hemorrhages, swollen liver and spleen, focal necrotic
areas in the liver, airsacculitis, and increased pericardial and peritoneal fluids. With R. anatipestifer infection, common gross lesions in ducks
are fibrinous pericarditis, hepatitis and airsacculitis. Chronic disease signs produced by Pasteurella sp., R. anatipestifer and Y.
pseudotuberculosis can include ocular and nasal discharge, swelling of tissues such as joints and wattles, and stunted growth.

Pasteurella
This genus includes P. multocida, the cause of fowl cholera. Two similar organisms, Avibacterium gallinarum (formerly Pasteurella
gallinarum) and Gallibacterium anatis biovar haemolytica (formerly Pasteurella haemolytica) are include in this chapter because they can be
isolated from the respiratory tract and have been associated with respiratory disease in poultry (1,4). Five serogroups of P. multocida (A, B,
D, E and F) have been isolated from avian species, but serogroup A strains are the major cause of fowl cholera. Sixteen somatic serotypes
may occur among strains of P. multocida. However, somatic serotypes 1, 3 and 4 are most commonly isolated.
Agent Identification. Pasteurellas are identified by cell and colony morphology, Gram stain, and reactions in biochemical and other tests. A
mucopolysaccharidase test can be used for presumptive identification of P. multocida serogroups A, D and F. Gel diffusion precipitin tests
are used to determine somatic serotype.
Serologic Detection in the Host. Serologic tests are not commonly used to detect infections by Pasteurella sp. in poultry.

Riemerella anatipestifer
Riemerella anatipestifer infection occurs in ducklings usually at 1-8 wk of age. Primary isolations of R. anatipestifer are made on blood or
trypticase soy agar incubated at 37C in a candle jar or CO2 incubator. At least twenty one serotypes have been identified using agglutination
tests.
Agent Identification. Riemerella anatipestifer is identified by cell and colony morphology, Gram stain, and biochemical characteristics.
Fluorescent-antibody technique can be used to detect and identify R. anatipestifer in tissues or exudates from infected birds.
Serologic Detection in the Host. Serum antibodies against R. anatipestifer can be detected in poultry by ELISA.

Yersenia pseudotuberculosis
Pseudotuberculosis, caused by infection with Y pseudo tuberculosis, is infrequently reported in poultry. Selective media are used for
isolation of the bacterium from feces. There are six serotypes (I-VI) based upon heat-stable antigens using agglutination and agglutination­
adsorption tests. Among strains isolated from birds, serotype I is the most common. Serotypes V and VI have not been reported in birds.
Agent Identification. Yersenia pseudotuberculosis is identified by cell and colony morphology, Gram stain, and reactions in biochemical
and other tests. The bacterium is motile at 25 C.
Serologic Detection in the Host. Serologic tests are not used to detect Y. pseudotuberculosis infections in poultry.

Pasteurella multocida
INTRODUCTION
The disease caused by infection with Pasteurella multocida is
usually called fowl cholera; however, the term avian cholera is
frequently used when the disease occurs in wild birds. The name
Pasteurella septica infection was sometimes used in older European
literature. Fowl cholera is a common, widely distributed disease of
major economic importance in the United States. The disease
affects all species of birds. Among commercially raised birds,
turkeys and Japanese quail are particularly susceptible. Outbreaks
in wild waterfowl are common and frequently cause high mortality.
Fowl cholera occurs as a primary disease that does not require
predisposing factors, although predisposing factors may increase
severity of outbreaks. Subclinical infections apparently do not exist
in normal flocks, but normal-appearing birds that have survived
outbreaks of the disease frequently remain infected and may serve
as carriers.
CLINICAL DISEASE
Fowl cholera may affect birds of any age, but it rarely occurs in
commercially raised poultry of less than 8 wk of age. The infection
often occurs as an acute septicemic disease with high morbidity and
mortality (5). Chronic fowl cholera may follow the septicemic
12
stage, particularly when the infection is caused by organisms of low
virulence. Finding dead birds may be the first sign of fowl cholera.
Other typical signs are depression, diarrhea, ruffled feathers,
increased respiratory rate, and cyanosis. Commonly observed
lesions in birds dying of acute fowl cholera include passive
hyperemia, hemorrhages, swollen liver, focal necrotic areas in the
liver and spleen, and increased pericardial and peritoneal fluids. In
general, the signs of chronic fowl cholera include swelling of
affected tissues, such as joints and sternal bursae, and exudate from
conjunctivae and turbinates. The focal lesions are generally
characterized by fibrinosuppurative exudate and various degrees of
necrosis and fibroplasia.
SAMPLE COLLECTION
Pasteurella multocida can be isolated readily from the liver, bone
marrow, and heart blood of birds that die of acute fowl cholera and
usually from localized lesions of chronic cholera (5). Bone marrow
and brain are recommended when specimens are not fresh or when
contamination of tissues seems likely (25). To obtain specimens for
microbiologic examination, the surface of the tissue is seared with a
heated spatula, and a sterile cotton swab or wire loop is inserted
through the seared surface. The specimen is transferred to an agar
 Chapter 4 Pasteurellosis, Avibacteriosis, Gallibacteriosis, Riemerelloisis, And Pseudotuberculosis
medium and incubated at 37 C. Pasteurella multocida grows
aerobically and anaerobically.
Cultures of P. multocida are moderately stable, generally surviving
storage or transportation if maintained in a humid environment,
such as on agar slants in screw-capped tubes. Stab cultures in agar
medium in screw-capped tubes generally survive for weeks. Long­
term storage is best accomplished using lyophilization.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Dextrose starch agar (DSA), blood agar, or trypticase soy agar
(Becton Dickinson Microbiology Systems, Sparks, Md.) are
recommended for primary isolation of P. multocida. The likelihood
of isolation may be improved by supplementing these media with
5% heat-inactivated serum. The organisms grow readily in tryptose
or trypticase soy broth.
AGENT IDENTIFICATION
Colony Morphology
On DSA, 24-hr colonies are circular, 1-3 mm in diameter, smooth,
transparent, glistening, and butyrous. Colonies on blood agar are
similar to those on DSA but are grayish and less translucent.
Observation of 24-hr colonies on DSA or other translucent agar
using a dissection microscope and obliquely transmitted lighting (5)
provides information on whether or not cells are capsulated.
Colonies that are iridescent contain capsulated cells, whereas
colonies that are noniridescent (blue or blue-gray) contain
uncapsulated cells. Pasteurella multocida produces a distinctive
odor when grown on agar media.
Cell Morphology
Pasteurella multocida cells are typically rods of 0.2-0.4 χ 0.6-2.5
pm occurring singly or occasionally in pairs or short chains. When
grown under unfavorable conditions or after repeated subculture,
cells tend to become pleomorphic. Cells in tissues or exudate
usually show bipolar staining with Giemsa or Wright’s stain.
Capsules can be demonstrated using an indirect india-ink method of
staining. A loopful of dilute bacterial specimen is mixed with a
loopful of india ink on a microscope slide, a coverslip is applied,
and the preparation is examined microscopically at a high
magnification. Capsules appear as clear halos around the bacterial
cells when examined in this manner.
Biochemical and Other Tests
Evaluation of reactions in differential media is generally made
after 2 days of incubation at 37 C and again after 5 days of
incubation at room temperature (21 C), in case of delayed reactions.
The carbohydrate broth media used for identification (Table 4.1) is
phenol red broth base containing 1% of the carbohydrate substrate.
For detection of hydrogen sulfide (H2S), a filter paper strip
impregnated with lead acetate is suspended above modified H2S
broth (10) during incubation. The presence of indole is indicated by
development of a dark red color when a small amount of modified
Kovac’s indole test reagent is added to a 24-hr culture consisting of
2% tryptose in 0.85% NaCl solution (7). Oxidase production is
determined using Kovac’s oxidase-test reagent and indirect filter
paper procedure (12).
Fructose, galactose, glucose, and sucrose are fermented without
gas production. Inositol, inulin, maltose, salicin, and rhamnose are
not fermented. Indole and oxidase are almost always produced.
Neither hemolysis of blood nor growth on MacConkey’s agar occur.
Differential characteristics are listed in Table 4.1.
Serologic Identification
Serologic tests are rarely used for identification of P. multocida.
However, these are commonly used for antigenic characterization of
13
strains of P. multocida. A gel-diffusion precipitin test (GDPT) is
used for serotyping based on differences in somatic antigens
(somatic serotyping) (9). Sixteen serotypes (1-16) have been
reported (2); strains representing each of these 16 serotypes have
been isolated from avian hosts. Frequently, antigens from a single
strain react with more than one type of serum, resulting in serotypes
such as 3,4 and 3, 4, 12. An indirect (passive) hemagglutination
test is used for serogrouping based on differences in capsular
antigens (capsular serogrouping) (3). Five capsular serogroups (A,
B, D, E, and F) have been reported (20). Serogroup A, D, and F
strains produce capsules containing mucopolysaccharides, and
presumptive identification of these serogroups can be made using
specific mucopolysaccharidases in a disk-diffusion test (16). Except
for serogroup E, strains representing all serogroups have been
isolated from avian hosts.
Antisera used in determining somatic serotypes are prepared in
chickens (9, 17). Such typing antisera are available from the
National Veterinary Services Laboratories, Animal and Plant Health
Inspection Service (APHIS), United States Department of
Agriculture (USDA), Ames, Iowa. Laboratories wishing to obtain
such sera should contact the APHIS-USDA Veterinarian-in-Charge
in their state.
Antigens for the GDPT are prepared from 18-to-24-hr growth of
heavily seeded DSA in petri dishes. The cells from one dish are
suspended in 1.0 ml of 0.85% NaCl, 0.02M phosphate, and 0.3%
formalin solution, pH 7.0. The suspension is heated in a water bath
at 100 C for 1 hr and centrifuged at 4000 x g for 30 min. The
supernatant fluid is used for antigen.
The agar gel consists of 0.9% Noble hgar (Difco, Detroit, Mich.)
in 8.5% NaCl solution. Five milliliters of warm (46 C) melted agar
is flooded onto a 25 x 75-mm microscope slide; wells, 4 mm in
diameter and 6 mm from center to center, are cut. Antigen is placed
in a well and antisera are placed in opposing wells. The slide is
placed in a petri dish to prevent drying, and the results are recorded
after 24 hr at 37 C.
Antisera used in the indirect hemagglutination test for capsule
serogrouping are prepared in Pasteurellα-free rabbits (18, 20).
Preparation of high-titered sera requires repeated intravenous
inoculations with formalin-killed capsulated organisms. Currently,
antisera for capsule serogrouping are not available from commercial
or government laboratories.
SEROLOGIC DETECTION IN THE HOST
Commercially available enzyme-linked immunosorbent assay
(ELISA) kits may be used to detect a serological response to P.
multocida infection in poultry (IDEXX, Westbrook, Maine and
Synbiotics, Gaithersbury, MD). ELISAs are used primarily to
measure the serologic response following the use of inactivated P.
multocida vaccines in poultry. Serologic tests are rarely used for
diagnosis of fowl cholera.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differentiation of fowl cholera from other diseases caused by
Pasteurella, Avibacterium, Gallibacterium, Riemerella
anatipestifer, and Yersinia pseudotuberculosis depends primarily
upon isolation and differentiation of causative organisms.
Differential physiologic reactions of these organisms are indicated
in Table 4.1. Several other diseases that are not caused by closely
related agents, such as infectious coryza, fowl typhoid, fowl plague,
duck plague, and infectious synovitis may have histories, signs, or
lesions similar to those of fowl cholera. Differentiation of fowl
cholera from these diseases also depends upon isolation and
identification of causative organisms.
John R. Glisson, Tirath S. Sandhu, and Charles L. Hofacre

Table 4.1. Differential characteristics of Pasteurella, Avibacterium, Gallibacterium, Riemerella, and Yersinia.

Test P. multocida A. gallinarum G.anatis biovar R. anatipestifer Y. pseudotuberculosis

haemolytica
Arabinose -U - - - +
Dextrin -u + -U +
Dulcitol -u - - -
Fructose + + + +
Galactose + + + +
Glucose + + + +
Glycerol +u + + +
Inositol - V +u -
Inulin - - - -
Lactose u - +u -
Maltose + -u +
Mannitol + - + +
Mannose + + + +
Melibiose +
Raffinose -u + V -
Rhamnose -u - - +
Salicin - - - +U
Sorbitol +u V + -
Sucrose + + + V
Trehalose -u +u +u . +
Xylose +u - +u +
Gelatin - - - +U +
Hemolysis - - + - -
H2S +u +u +u - V
Indole + - - -
Litmus milk - si. acid U si. alk si. Alk
MacConkey - V - +U
Motility - - - +(25 C)
Methyl red - - - +
Nitrate reduced + + + - +
Oxidase + + + + +
Urease - - - V +
A+ = reaction, - = no reaction, U = usual reaction, V = variable reaction, si. Acid = slightly increased acidity, si. alk = slightly increased
alkalinity, (25 C) =- incubated at 25 C.

Avibacterium gallinarum
INTRODUCTION
Infection with A. gallinarum often occurs in the respiratoiy tracts
of chickens and turkeys (6, 13), but disease is generally manifested
only when this infection occurs with other respiratoiy tract
infections. Attempts to isolate A.gallinarum from normal flocks
have not been successful. The infection is widely distributed. It has
been reported in the United States, Australia, Japan, Nigeria, Iran,
and Israel. Generally it is not considered to be of economic
significance.
CLINICAL DISEASE
Swollen and inflamed wattles resulting from infection with only A.
gallinarum have been reported in chickens (13).
SAMPLE COLLECTION
Avibacterium gallinarum often can be isolated from the sinuses,
nasal cleft, trachea, air sacs, and lungs of birds exhibiting
respiratory disease. The organism is less frequently isolated from
livers, heart blood, and joints. Avibacterium gallinarum grows
aerobically and anaerobically. Specimens are collected using the
same methods as described for P. multocida.

Disease manifestations in which A. gallinarum infection occurs PREFERRED CULTURE MEDIA AND SUBSTRATES
usually affect the respiratory tract and have a chronic course.
The same media are used as described for P. multocida.
14
 Chapter 4
AGENT IDENTIFICATION
Colony and Cell Morphology and Biochemistry
On DSA or blood agar at 37 C, 24-hr colonies are 1-2 mm in
diameter, smooth, entire, low convex, and transparent. Colonies on
DSA are iridescent when observed with obliquely transmitted light,
often with concentric rings.
Avibacterium gallinarum cells are similar to P. multocida; that is,
Gram-negative short rods that occur as single organisms and short
chains, stain bipolarly, and are capsulated. They become
pleomorphic with repeated subculturing and growth under less than
optimum conditions.
Glucose, sucrose, and maltose are fermented without gas
production. Lactose is not fermented, and indole is not produced.
Neither hemolysis of blood nor growth on MacConkey’s agar occur.
Differential characteristics are listed in Table 4.1.
Serologic Identification
Serologic tests are rarely used for identification of A. gallinarum.
Antigenic differences have been demonstrated among strains of A.
Gallibacterium anatis biovar haemolytica
INTRODUCTION
Gallibacterium anatis biovar haemolytica is generally considered
to be a secondary pathogen that requires some predisposing factor
before producing disease. However, too little information is
available to clearly establish the role of this organism in avian
disease production. In normal-appearing flocks, the reported
incidence of infection is quite high in chickens but low in turkeys
and geese. Infections in avian hosts are widely distributed, as
indicated by isolations in the United States, England, Germany,
France, Israel, Syria, Nigeria, Taiwan, and Australia. This disease
is not considered economically important.
CLINICAL DISEASE
Disease manifestations related to G. anatis biovar haemolytica
infections most frequently involve the respiratory tract. Septicemic
manifestations with petechial hemorrhages in the viscera and areas
of liver necrosis have been reported. Salpingitis and peritonitis may
occur in laying hens.
SAMPLE COLLECTION
G. anatis biovar haemolytica usually can be isolated from the
trachea, lungs, liver, or oviduct of an infected bird.
Riemerella anatipestifer
INTRODUCTION
Riemerella anatipestifer infection, also known as infectious
serositis, duck septicemia, new duck disease, or anatipestifer
syndrome is a septicemic disease of ducks, geese, turkeys, and
various other birds caused by R. anatipestifer. The disease is
prevalent worldwide and causes significant economic loss due to
high mortality, weight loss, and condemnations. The acute form of
Pasteurella, Avibacteriosis, Gallibacteriosis, Riemerellosis, and Pseudotuberculosis
gallinarum using serologic tests, but specific serotypes have not
been defined. Serologic testing has indicated that minor antigens of
some strains of A. gallinarum are shared with P. multocida.
SEROLOGIC DETECTION IN THE HOST
Serologic tests are not used to detect A. gallinarum infections in
poultry.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differentiation of A. gallinarum infections from those caused by
Pasteurella and Y. pseudotuberculosis is accomplished by
determination and comparison of selected physiologic
characteristics (Table 4.1). Other infections that may cause similar
signs or lesions include infectious coryza, mycoplasmosis, and
bordetellosis. Differentiation depends upon isolation and
identification or differentiation of the agents.
AGENT IDENTIFICATION
Colony Morphology
On blood agar at 37 C, 24-hr colonies are generally 0.5 mm in
diameter, smooth, entire, low convex, and translucent. A wide zone
of β-hemolysis is produced on blood agar. On DSA, the colonies
are iridescent when observed with obliquely transmitted light and
often exhibit concentric rings.
Cell Morphology
G. anatis biovar haemolytica cells are Gram-negative, nonmotile,
non-spore-forming, pleomorphic rods (0.5 x 1.6 pm) that often
exhibit bipolar staining. They generally occur singly but
occasionally form short chains.
Biochemical and Other Tests
Glucose, sucrose, mannose, glycerol, and fructose are fermented
without gas production within 24 hr of incubation at 37 C. Lactose
is usually fermented after 3 days. Arabinose, dulcitol, rhamnose,
inulin, and salicin are not fermented. Indole is not produced.
Differential characteristics are indicated in Table 4.1.
Serologic Identification
Serologic tests are not used for identification of G. anatis biovar
haemolytica. Little effort has been made to serotype strains isolated
from avian hosts, and no avian serotypes have been established.
SEROLOGIC DETECTION IN THE HOST
Serologic tests are not used to detect G. anatis biovar haemolytica
infection in poultry.
the disease can cause mortality as high as 75% in ducks, especially
at farms where infection persists because hatches are frequently
moved from one pen to another to create space for the next hatch.
Adverse environmental conditions and concomitant disease often
predispose flocks to epomitics of R. anatipestifer infection. The
disease is not of public health importance. In the United States,
federal or state notification is not required.
15
John R. Glisson, Tirath S. Sandhu, and Charles L. Hofacre
CLINICAL DISEASE
The acute form of the disease usually occurs in ducklings 1-8 wk
of age. Chronic infections may occur in older birds. High mortality
has been reported in turkeys 6-15 wk of age (23). Riemerella
anatipestifer infections have also been reported in swans, pheasants,
guinea fowl, partridges, quail, and chickens. Clinical signs of the
disease include ocular and nasal discharge, sneezing, greenish
diarrhea, tremors of the head, neck and legs, ataxia, and coma. The
common gross lesions are fibrinous pericarditis, perihepatitis,
airsacculitis, and meningitis. In females, the oviduct is filled with
caseous yellowish white exudate. Chronic and localized infections
result in synovitis/arthritis and dermatitis. Infections originate from
exposure via the respiratory tract or through abrasions or cuts in the
skin.
SAMPLE COLLECTION
Riemerella anatipestifer can readily be isolated from heart blood,
brain, pericardial exudate, air sacs, lungs, oviduct, and liver.
Isolations should be attempted from infraorbital sinuses and trachea
to detect carriers or inapparent infections. Specimens should be
obtained by a wire loop or sterile swab through a seared surface. In
chronic or localized infections, R. anatipestifer can be isolated from
the exudate. The specimen is streaked directly onto the surface of
agar media, which are then incubated at 37 C in a candle jar for 24-
72 hr. Incubation under increased CO2 and humidity in a candle jar
or CO2 incubator enhances the growth for primary isolation. If the
cultures cannot be made within a reasonable time, the specimens or
tissues should be kept at 4 C or frozen for shipping or later
processing.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Although R. anatipestifer grows readily on routine media, growth is
enhanced by using enriched media such as blood agar or trypticase
soy agar containing 0.05% yeast extract. Tryptose broth or
trypticase soy broth is used for broth cultures. Addition of
gentamicin (5 mg/liter) to enriched solid medium has proven
helpful for isolation of R. anatipestifer from sinuses, skin, and
contaminated specimens from the processing plant, even though
growth of other organisms is not completely inhibited.
AGENT IDENTIFICATION
Colony and Cell Morphology and Biochemistry
Riemerella anatipestifer is identified on the basis of growth,
morphologic and biochemical characteristics. After 24 hr of growth
on blood agar, colonies are 1-2 mm in diameter, convex, entire,
transparent, glistening, and butyrous. Some strains may produce
mucoid growth on solid media. On trypticase soy agar, colonies
appear bluish and are iridescent when observed with obliquely
transmitted light. Some strains have been observed to produce off-
white growth, which may change to grayish brown after 3-5 days.
Growth in broth produces slight turbidity.
Most R. anatipestifer strains become nonviable after 3^4 days on a
solid medium at room temperature or 37 C. In broth the organisms
may survive for 2-3 wk under refrigeration. Cultures can be stored
as freeze-dried for longer periods. Riemerella anatipestifer cells are
Gram-negative, nonmotile, non-spore-forming rods that occur
singly, in pairs, or occasionally in chains. The cells are 1-5 pm
16
long and 0.1-0.4 pm wide and may show bipolar staining. A
capsule has been shown with the india ink method of staining.
Riemerella anatipestifer does not ferment sugars in routine media
(Table 4.1), but has been reported to produce acid in glucose,
mannose, maltose and dextrin when grown in buffered single
substrate medium (11). The organism liquefies gelatin and
produces a slight alkaline reaction in litmus milk. Some strains
produce urease and arginine dihydrolase. No growth occurs on
MacConkey’s agar and no hemolysis takes place on blood agar.
The organism produces oxidase, catalase, and phosphatase, but is
indole negative.
Riemerella anatipestifer is identified by enzymatic activity
(Apizyme - API laboratory Products Ltd., St-Laurent, Quebec,
Canada). It is positive for leucine-, valine-, and cystine-arylmidases,
phosphoamidase, α-glucosidase, and negative for a- and β-
galactosidases, β-glucuronidase, β-glucosidase, α-mannosidase, β-
glucosaminidase, ornithine and lysine decorboxylases (22).
Serologic Identification
Using agglutination tests, 21 serotypes have been reported (15,
21). Antisera are made in rabbits. Antigen for rabbit inoculation is
made by harvesting 24 to 48-hr growth from an agar plate in 0.85%
NaCl solution containing 0.3% formalin. The inactivated cells are
washed twice by centrifugation in the above solution and adjusted
to an optical density of 0.2 at 525 nm in a spectrophotometer.
Young rabbits are immunized by inoculating through the marginal
ear vein successive doses of 0.05, 0.1, 0.2, 0.5, 1.0, 1.0, 1.5, and 2.0
ml of standardized cell suspension, at 3- to 4-day intervals. Rabbits
are bled for serum collection when maximum titers are obtained.
Agglutination titers are low, usually on the order of 1:50 to 1:400.
The plate agglutination test is done by mixing a drop of undiluted
antiserum with one or two colonies from a 24-hr growth.
Agglutination within a few seconds indicates a homologous
serotype reaction. The tube agglutination test is performed by
mixing an equal amount of formalinized cell suspension (adjusted
to 0.2 optical density at 525 nm) with each dilution of serum and
incubating at 37 C. Agglutination is recorded after 24 and 48
hr.The fluorescent antibody technique may be used to detect and
identify R. anatipestifer cells directly in tissues or exudate from
infected birds.
SEROLOGIC DETECTION IN THE HOST
Enzyme-linked immunosorbent assay (ELISA) is commonly used
for early detection of R. anatipestifer infections (8). Cell lysate is
used as an antigen in ELISA. It is not serotype specific and will
show positive reactions with antisera against heterologous
serotypes, but ELISA is more sensitive than agglutination test. The
GDPT is unreliable because of an apparent discrepancy in duck
immunoglobulins, which are almost nonfunctional in precipitin
reactions (24).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Diagnosis should be based on isolation and identification of the
causative organism, because similar gross lesions are produced by
P. multocida, Escherichia coli, and fecal streptococcal infections.
Ducklings infected with Salmonella may sometime show nervous
signs similar to those of R. anatipestifer infection. Chlamydiosis
should also be considered in differential diagnosis.
 Chapter 4
Yersinia pseudotuberculosis
INTRODUCTION
The disease caused by infection with Y.pseudotuberculosis is
pseudotuberculosis (19). It can affect domesticated, feral, or caged
birds and a variety of mammals, including humans. Although this
disease is infrequently reported in the United States and is not
considered economically important, it has caused death losses as
high as 80% in turkey flocks.
CLINICAL DISEASE
Pseudotuberculosis usually occurs as a septicemia or bacteremia of
short duration, followed by chronic focal infections. In very acute
cases, birds may die before other signs of disease are observed,
although signs usually are present for 2 wk or more. Affected birds
exhibit weakness, ruffled feathers, diarrhea, and breathing
difficulties. Emaciation and paralysis occur occasionally. Swollen
livers and spleens and enteritis are common lesions in acute cases.
Necrotic foci in visceral organs and muscles and enteritis are
common lesions in chronic cases. Osteomyelitis occurs in some
affected turkey flocks.
SAMPLE COLLECTION
Yersinia pseudotuberculosis can usually be isolated from blood,
liver, spleen, or lung using blood or trypticase soy agar and
incubation at 37 C (19). The method of Paterson and Cook (14) is
recommended for isolation of Y pseudotuberculosis from feces. To
use this method, inoculate the surface of Paterson and Cook agar
medium with a 10% suspension of feces in phosphate buffer (pH
7.6). Recovery of Y. pseudotuberculosis is enhanced by storing the
fecal suspension at 3-4 C for 7 days or longer before inoculating
agar. The organism grows both aerobically and anaerobically.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Trypticase soy agar and blood agar are effective for primary
isolation. Differential media are as described for P. multocida. For
isolation from feces, Paterson and Cook medium is recommended
(14) (Table 4.2).
AGENT IDENTIFICATION
Colony Morphology
After incubation at 37 C for 24 hr on trypticase soy agar, colonies
are smooth, round, entire, grayish yellow, butyrous, and 0.5-1 mm
in diameter. Older colonies are 2-3 mm in diameter, raised, flat,
dry, and irregular with rough edges.
Table 4.2. Medium of Paterson and Cook.
Constituents Amount (ml)
Trypsinized meat agar
200.0
Peptic digest of sheep blood
10.0
Novobiocin (0.2%)
0.5
Erythromycin (0.2%)
0.5
Mycostatin (50,000 units/ml)
0.8
Crystal violet (0.1%)
0.5
Pasteurella, Avibacteriosis, Gallibacteriosis, Riemerellosis, and Pseudotuberculosis
Cell Morphology
Yersinia pseudotuberculosis cells are Gram-negative rods of 0.5 x
0.8-5.0 pm. Coccoid forms usually stain bipolar. Neither spores
nor capsules are formed. Peritrichous flagella usually develop
between 20 C and 30 C. Motility is best shown in semisolid media
at 25 C.
Biochemical and Other Tests
Maltose, trehalose, and usually sucrose are fermented, and acid but
not gas is produced. Production of H2S is variable. Urease and
catalase are produced, but not indole and oxidase. No hemolysis
occurs on blood agar. Differential characteristics are listed in Table
4.1.
Serologic Identification
Serologic testing is not used for identifying strains of
Y. pseudotuberculosis but is used to characterize strains (19). There
are six serotypes (I-VI), four of which have two subtypes each (A
and B). These serotypes and subtypes are based on 15 heat-stable
somatic antigens (1-15), which are demonstrated by agglutination
and agglutination-adsorption tests. Additional serotypes VH and
Vin and a subtype C of serotype Π have been proposed. Among
strains from birds, serotype I is most common, followed by
serotypes Π and IV. Serotypes V and VI have not been reported in
birds, and type ΠΙ is rare. Five heat-labile flagellar antigens (a, b, c,
d, e) are recognized but are rarely used for serologic
characterization.
SEROLOGIC DETECTION IN THE HOST
Serologic techniques are not used to detect Y. pseudotuberculosis
infection in poultry.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differentiation of Y. pseudotuberculosis from avian Pasteurella is
based on differences in biochemical characteristics, as indicated in
Table 4.1. Diseases with similar lesions or signs, such as
tuberculosis, E. coli infections, and salmonellosis, are differentiated
from pseudotuberculosis through isolation and identification or
biochemical differentiation of causative agents.
REFERENCES
1. Blackall, P.J. H. Christensen, T. Beckenham, L.L. Blackall, and M
Bisgaard Reclassification of Pasteurella gallinarum, [Haemophilus]
paragallinarum, Pasteurella avium and Pasteurella volantium as
Avibacterium gallinarum gen. nov., comb, nov., Avibacterium
paragallinarum comb, nov., Avibacterium avium comb, nov. and
Avibacterium volantium comb. nov. Int. J. Evol. Microbiol. 55: 353-362,
2005.
2. Brogden, K. A., K. R. Rhoades, and K. L. Heddleston. A new serotype
of Pasteurella multocida associated with fowl cholera. Avian Dis. 22:185-
190. 1978.
3. Carter, G. R. Studies on Pasteurella multocida. I. A hemagglutination
test for the identification of serological types. Am. J. Vet. Res. 16:481^484.
1955.
4. Christensen, Η., M. Bisgaard, A.M Bojesen, R. Mutters, and J.E. Olsen.
Genetic relationships among avian isolates classified as Pasteurella
haemolytica, Actinobacillus salpingitidis or Pasteurella anatis with proposal
of Gallibacterium anatis gen. nov., comb. nov. and description of additional
genomospecies with Gallibacterium gen. nov. Int. J. Syst. Evol. Microbiol.
53: 275-287,2003.
5. Glisson, J. R., C. L. Hofacre and J. P. Christensen. Fowl cholera. In:
Diseases of poultry, 11th ed Y. M. Saif, H. J. Barnes, J. R. Glisson, A M
Fadly, L. R. McDougald, and D. E. Swayne, eds. Iowa State University
Press, A Blackwell Publishing Company, Ames, Iowa. pp. 658-676. 2003.
17
John R Glisson, Tirath S. Sandhu, and Charles L. Hofacre

6. Hall, W. J., K. L. Heddleston, D. H. Legenhausen, and R. W. Hughes.
Studies on pasteurellosis. I. A new species of Pasteurella encountered in
chronic fowl cholera. Am. J. Vet. Res. 16:598-604. 1955.
7. Hans, G. H., and S. Gabriel. Modified stable Kovac’s reagent for
detection of indole. Am. J. Clin. Pathol. 26:1373-1375. 1956.
8. Hatfield, R. Μ., B. A Morris, and R. R. Henry. Development of an
enzyme-linked immunosorbent assay for the detection of humoral antibody
to Pasteurella anatipestifer. Avian Pathol. 16:123-140. 1987.
9. Heddleston, K. L., J. E. Gallagher, and P. A. Rebers. Fowl cholera: gel
difiusion precipitin test for serotyping Pasteurella multocida from avian
species. Avian Dis. 16:925-936. 1972.
10. Heddleston, K. L., T. Goodson, L. Liebovitz, and C. I. Angstrom.
Serological and biochemical characteristics of Pasteurella multocida from
free-flying birds and poultry. Avian Dis. 16:925-936. 1972.
11. Hinz, K. Η., M Ryll, and B. Kohler. Detection of acid production from
carbohydrates by Rimerella anatipestifer and related organisms using the
buffer^ single substrate test. Vet. Microbiol. 60:277-284. 1998.
12. MacFaddin, J. F. Oxidase test. In: Biochemical tests for identification
of medical bacteria, 2nd ed. Williams and Wilkins, Baltimore, Md. pp.
249-253. 1980.
13. Mushin, R., R. Bock, and M Abrams. Studies on Pasteurella
gallinarum. Avian Pathol. 6:415-423. 1977.
14. Paterson, J. S. and R Cook. A method for the recovery of Pasteurella
pseudotuberculosis from feces. J. Pathol. Bacteriol. 85:241-242. 1963.
15. Pathanasophon, P., P. Phuektes, T. Tanticharoenyos, W. Narongsak, and
T. Sawada. A potential new serotype of Riemerella anatipestifer isolated
from ducks in Thailand. Avian Pathol. 31:267-270. 2002.
16. Rimler, R. B. Presumptive identification of Pasteurella multocida
serogroups A, D, and F by capsule depolymerisation with
mucopolysaccharidases. Vet. Rec. 134:191-192. 1994.
17. Rimler, R B., R. D. Angus, and M Phillips. Evaluation of the
specificity of Pasteurella multocida somatic antigen-typing antisera
prepared in chickens using ribosome-lipopolysaccharide complexes as
inocula. Am. J. Vet. Res. 50:29-31. 1989.
18. Rimler, R. B., and K. A. Brogden. Pasteurella multocida isolated from
rabbits and swine: serologic types and toxin production. Am J. Vet. Res.
47:730-737. 1986.
19. Rimler, R B., and J. R. Glisson. Pseudotuberculosis. In: Diseases of
poultry, 10th ed. B. W. Calnek, H. J. Bames, C. W. Beard, L. R.
McDougald, and Y. M Saif, eds. Iowa State University Press, Ames, Iowa,
pp. 314-317. 1997.
20. Rimler, R. B., and K. R. Rhoades. Serogroup F, a new capsule
serogroup of Pasteurella multocida. J. Clin. Microbiol. 25:615-618. 1987.
21. Sandhu, T. S. Riemerella anatipestifer infection. In: Diseases of
poultry, 11th ed. Y. M Saif, H. J. Bames, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, eds. Iowa State University Press, A
Blackwell Publishing Company Ames, Iowa. pp. 676-682. 2003.
22. Segers, P., W. Mannheim, M Vancanneyt, K. DeBrandt, K. H. Hinz,
K. Kersters, and P. Vandamme. Riemerella anatipestifer gen. nov., comb,
nov., the causative agent of septicemia anserum exudativa, and its
phylogenetic affiliation within the Flavobacterium-Cytophaga rRNA
homology group. Int. J. Syst. Bacteriol. 43:768-776. 1993.
23. Smith, J. M, D. D. Frame, G. Cooper, A. A. Bickford, G. Y.
Ghazikhanian, and B. J. Kelly. Pasteurella anatipestifer infection in
commercial meat-type turkeys in California. Avian Dis. 31:913-917. 1987.
24. Toth, T. E., and N. L. Norcross. Precipitating and agglutinating
activity in duck anti-soluble protein immune sera. Avian Dis. 25:338-352.
1981.
25. Waltman, W.D. and A.M Home. Characteristics of fowl cholera
diagnosed in Georgia 1989-1991. Avian Dis. 37:616-621, 1993.

18
 5
BORDETELLOSIS
Mark W. Jackwood

SUMMARY. Bordetellosis is an acute highly contagious disease of the upper respiratory tract of young turkeys (4-8 wk of age). The
disease is caused by a gram-negative nonfermentative bacteria, Bordetella avium. Members of the genus Bordetella are well known for their
ability to colonize and damage ciliated epithelial surfaces in the respiratory tract and B. avium is no exception. Bordetellosis is most severe
when it occurs in conjunction with other respiratory infections, especially Newcastle disease, or when turkeys are immunosuppressed.
Mortality can be high when poor management (inadequate ventilation, dust, chilling, or filthy conditions) is a complicating factor and there is
an associated colibacillosis. Bordetella avium is an opportunistic pathogen in chickens.
Agent Identification. Bordetellosis can be diagnosed using a combination of clinical signs (snick or cough with a catarrhal nasal discharge)
and bacterial culture.
Serologic Detection in the Host. Enzyme-linked immunosorbent assays and microagglutination tests are accurate and sensitive for detecting
antibodies in turkeys. Test results can be an aid in diagnosis as well as monitoring vaccination.

INTRODUCTION
In the 1970s an acute upper respiratory disease emerged as a major
disease problem in young turkeys. The disease was more severe the
earlier posthatch turkeys become infected. Initially some confusion
occurred as to the identification of the causative agent but a
definitive study established the agent as a new species in the genus
Bordetella and it was given the name Bordetella avium (7). In the
early years following its recognition, the disease and associated
colibacillosis produced high mortality but in recent years the
disease or the susceptibility of turkeys to the disease has changed
and the number and severity of reported outbreaks has lessened.
Some of the possible explanations for the change in the character of
the disease include the presence of maternal antibody, as it is well
established that passive immunity is highly protective (9), or that
strains of B. avium have emerged that are not as virulent. The
significance of bordetellosis is not as great now as when it was first
recognized but it still is considered to be a major cause of
respiratory disease in young turkeys.
Bordetella avium has also been isolated from chickens. Bordetella
avium is an opportunistic pathogen in chickens because clinical
disease can only be reproduced following initial infection with an
upper respiratory disease virus vaccine such as infectious bronchitis
virus or Newcastle disease virus (4). Recent studies have reported
B. avium in mallards, wild turkeys, and a Canada goose, (10) and
antibodies against B. avium have been detected in peafowl (2).
CLINICAL DISEASE
Bordetellosis is characterized by an abrupt onset of a snick
(sneezing) in young turkeys. Other signs include watery eyes,
submaxillary edema, and a clear nasal discharge that can usually be
expressed by placing gentle pressure on the nares. Mouth breathing,
altered vocalization, dyspnea, huddling, and decreased consumption
of feed and water are also common. Morbidity is high 80-100% in
young turkeys, and mortality is low (1% to 10%) except when other
infections occur simultaneously (colibacillosis) or when
management is poor, then mortality can be high (>50%). The
infection also adversely affects growth rate and toxins associated
with the bacteria damage tracheal cartilage beneath colonized
ciliated respiratory epithelium. Mortality has been reported from
suffocation due to excessive mucus production in the trachea and
when damaged tracheas collapse (12).
SAMPLE COLLECTION
The bacterium is best cultured by swabbing the anterior trachea
through a midcervical aseptic opening. Bacterial culture of sinus
material is usually not productive because of overgrowth by Proteus
19
sp. Cultures should be taken early during the infection while cilia
are heavily colonized with B. avium. If cultures are taken late in the
infection the most predominant bacteria isolated will likely be
Escherichia coli.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Bordetella avium grows on a variety of enriched agar-based media
but the bacteria is usually isolated from clinical material using
MacConkey agar because this agar quickly demonstrates the
bacteria’s nonfermenting characteristic and differentiates it from E.
coli, another common bacteria found in the trachea of turkeys with
respiratory disease. Initial isolation of B. avium is best done on
MacConkey agar increased to 2.5% agar content to slow the spread
of faster growing organisms (6). Growth of B. avium in liquid
media requires that the cultures be aerated by agitation or other
means because it is a strict aerobe.
AGENT IDENTIFICATION
After 24 hr of incubation on MacConkey agar, colonies of
B. avium are clear and pinpoint in size. If cultures have been
secured early they are often pure but when cultures are taken late
there is often contamination with other bacteria especially E. coli.
When such contamination occurs it is important to look in the more
diluted part of the streak for typical colonies.
Three colony types of B. avium have been identified. The most
typical type is that described above with colonies being small,
compact, translucent, and pearl-like with entire edges and glistening
surfaces. These colonies will be 0.2-1 mm in diameter after 24 hr
and 1-2 mm after 48 hr. Many isolates develop a raised brown-
tinged center when grown to >48 hr on MacConkey’s agar. A
smaller percentage of isolates dissociate into a rough colony type
having a dry appearance and a serrated irregular edge. Rough
colonies represent a phase-shift to a nonpathogenic form of the
bacterium (3).
Biochemical tests that are used in distinguishing B. avium from
other nonfermenting bacteria include the oxidase test (+), catalase
test (+), urease test (-), nitrate reduction test (-), and the ability to
alkalinize certain amides and organic salts. A microcupule test kit
called the Rapid API 20 NE (Non-Fermenter Test, bioMerieux-
Vitek, Hazelwood, Mo.) can be used to identify B. avium.
A very useful correlation has been made between the ability of
strains of B. avium to hemagglutinate guinea pig red blood cells
and pathogenicity (6). This association with pathogenicity is
thought to be related to the ability of pathogenic strains to adhere to
cilia. The hemagglutination assay is performed by heavily
inoculating solid media (blood agar, brain-heart infusion agar, or
MacConkey’s agar) with suspected B. avium isolates and incubating
Mark W. Jackwood
36-48 hr at 37 C. Bacterial growths are washed from the plate with
phosphate-buffered saline (PBS) and diluted to a concentration of
approximately 5 χ 109 cells/ml (0.5 optical density at 600 nm).
Equal volumes of bacterial suspension and erythrocyte suspension
(2% packed-cell volume in PBS) are mixed on a glass slide or plate
and observed for agglutination after gentle rocking. Alternatively,
50:1 mixture of bacterial suspension and erythrocyte suspension
(0.5% packed-cell volume in PBS) are mixed in U-bottom shaped
wells of microtitration plates and allow to stand 1 hr at 25 C. A
reference strain of B. avium and a negative control should be
included with each test run.
Comparable results can be obtained using erythrocytes fixed in
formaldehyde (F. W. Pierson, Virginia Polytechnic Institute and
State University, pers. comm.). Fixed guinea pig erythrocytes are
prepared as follows:
1. Collect 5 ml of guinea pig blood with 1 ml of 3% sodium citrate
and mix well.
2. Centrifuge at 500 x g (2000 rpm) for 10 min. Resuspend
erythrocytes in fixative containing 40 ml of PBS and 10 ml of 40%
formaldehyde. The final pH of the solution should be
approximately 7.4.
3. Mix gently on a rotary shaker at room temperature overnight.
4. Centrifuge at 500 x g (2000 rpm) for 10 min and wash pellet 10
times with PBS.
5. Resuspend fixed erythrocytes in PBS at a final concentration of
2% and store at 4 C. lite fixed cells are stable for at least 6 mos.
SEROLOGIC DETECTION IN THE HOST
An in-house enzyme-linked immunosorbent assay (ELISA) can be
produced to detect B. avium antibodies in turkeys (8,9). A
commercially available ELISA has been developed and marketed
for B. avium in turkeys (Synbiotics Corporation, San Diego, CA.).
The commercially available ELISA kit is excellent and the results
are very compatible with the in-house ELISA test (9).
Prior to the development of the ELISA a microagglutination
procedure was performed (5) as outlined below.
Microagglutination antigen is produced as follows:
1. Inoculate 10 ml of veal infusion broth or brain-heart infusion
broth with an isolated colony of B. avium and incubate aerobically
at 37 C for 48 hr in a shaking-water bath or shaking incubator.
2. Inoculate 500 ml of sterile broth in a 1000-ml flask with 10 ml of
broth culture from step 1. Incubate in a shaking-water bath or
incubator at 37 C for 48 hr. When given ideal growth conditions, B.
avium will sometimes produce a filamentous form in broth culture,
which interferes with the microagglutination test (1). This problem
can be circumvented by growing the bacterium on agar and
harvesting the cells in PBS. Then, continue with step 3.
3. At 48, 49, and 50 hr, add 2.5 ml of a 1% solution of
neotetrazolium chloride stain. Incubate 4 hr at 37 C following the
last addition of neotetrazolium chloride.
4. Add 0.2 ml of a 0.1% solution of merthiolate and incubate
overnight at 37 C.
5. Centrifuge for 30 min at 10,960 x g. Wash and centrifuge
antigen three times in PBS with 0.01% merthiolate.
6. Centrifuge antigen in a graduated tube at 10,960 x g for 20 min,
discard the supernatant, and resuspend to make a 1:20 dilution of
packed cells in PBS with 0.01% merthiolate. This is the stock
antigen. Pass the stock antigen through a 22-gauge needle with a
syringe, run a block titration, aliquot the remaining antigen, and
freeze the aliquots at -30 C or below.
Microagglutination antigen standardization (block titration) is as
follows:
1. Use separate microtitration plates for both B. avzwm-positive and
negative sera. First make serial twofold dilutions of sera in test
tubes beginning with 1:10 and ending with 1:640. About 0.5 ml of
each dilution is needed for one microtitration plate.
20
2. Drop 0.1 ml of stock antigen into row A, columns 1-8 of each
plate.
3 Drop 0.05 ml of PBS with 0.01% merthiolate into rows B
through H, columns 1-8.
4 Make twofold dilutions of B. avium antigen down from row A
through row H.
5. Add 0.05 ml of the appropriate serum dilution (1:10 through
1:640, in columns 1 through 7, respectively) to rows A through H.
6. Add 0.05 ml PBS with 0.01% merthiolate to column 8, rows A
through H, for the antigen control.
7. Incubate plates at room temperature for 24 hr and read. A
positive test has complete absence of a button, whereas a negative
test has a distinct button in the bottom of the well. For the optimum
B. avium antigen dilution, pick the antigen dilution well that has a
well-defined, visible button in the negative control serum and
detects antibody (no button) in the positive control serum. It is
necessary to do a block titration only once for each lot of B. avium
antigen produced. Mark the appropriate dilution on the stock
antigen for later reference.
The actual microagglutination test is run as follows:
1. Make a 1:5 dilution of each serum sample, including both
positive and negative controls.
2 Drop 0.05 ml PBS with 0.01% merthiolate into each well of a
microtitration plate.
3. Drop 0.05 ml of diluted serum to the first row of wells. Be sure
to include positive and negative control sera with each plate.
4. Make twofold dilutions of the sera from 1:10 to 1:1280 down the
plate.
5. Dilute B. avium stock antigen in PBS with 0.01% merthiolate
using the dilution factor from the block titration. The antigen
should be passed through a syringe with a 22 gauge needle to break
up all antigen clumps.
6. Drop 0.05 ml of diluted B. avium antigen into all wells.
7. Incubate the test plate at room temperature for 24 hr and read.
Any titer 1:20 or greater is considered to be positive.
The microagglutination test is not as user friendly as the ELISA
but the test is sensitive and accurate. It detects immunoglobulin M
(IgM), which is the first antibody produced following infection. The
microagglutination test will not detect maternal antibody, which is
immunoglobulin G (IgG). High levels of maternal antibody protect
poults during the first 2 wk of life when the birds are most
susceptible to the disease (12). Antibody titers (IgG) to B. avium
can be detected by ELISA 2 wk postinfection, with peak titers
occurring between 3 and 4 wk postinfection (5,8,9).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Bordetellosis in poultry should be differentiated from
mycoplasmosis, chlamydiosis, cryptosporidiosis, Omithobacterium
rhinotracheale, and viral respiratory diseases, particularly
Newcastle disease, influenza, and turkey rhinotracheitis
(pneumovirus infection). The most closely related agents to be
differentiated are Bordetella bronchiseptica and Bordetella hinzii
(also referred to as B. avium-tike bacteria in the literature). Both can
be isolated from the upper respiratory tract, but neither have shown
to cause disease in turkeys. B. avium causes agglutination of guinea
pig erythrocytes, is urease-negative, and does not grow on minimal
essential medium agar or in 6.5% NaCl broth. B. bronchiseptica
may cause hemagglutination, but it produces a positive reaction for
urease. B. hinzii does not hemagglutinate but will grow on minimal
essential medium agar and in 6.5% NaCl broth (6). Molecular tests
have been used to distinguish between B. avium and B. hinzii.
Ribotyping using PvuH or restriction endonuclease analysis using
Hinfl and DdeV enzymes clearly distinguish between the two
organisms but the REA test was found to be best as a routine
epidemiologic tool (11).

REFERENCES
1. Domingo, D. D., M. W. Jackwood, and T. P. Brown. Filamentous forms
of Bordetella avium', culture conditions and pathogenicity. Avian Dis.
36:706-713. 1992.
2. Hollamby, S., J. G. Sikarskie, and J. Stuht. Survey of peafowl (Pavo
cristatus) for potential pathogens at three Michigan zoos. J. Zoo Wild. Med.
34:375-379. 2003.
3. Jackwood, M W., D. A. Hilt, S. M Mendes, and P. D. Cox. Bordetella
avium phase-shift markers: characterization of whole cell, cell envelope, and
outer membrane proteins. J. Vet. Diag. Invest. 7:402-404. 1995.
4. Jackwood, M. W., S. M McCarter, and T. P. Brown. Bordetella avium'.
an opportunistic pathogen in leghorn chickens. Avian Dis. 39:360-367.
1995.
5. Jackwood, D. J., and Y. M Saif. Development and use of a
microagglutination test to detect antibodies to Alcaligenes faecalis in
turkeys. Avian Dis. 24:685-701. 1980.
6. Jackwood, M W.,Y. M. Saif, P. D. Moorhead, and R. N. Dearth.
Further characterization of the agent causing coryza in turkeys. Avian Dis.
29:690-705. 1985.
7. Kersters, K., K.-H. Hinz, A. Hertle, P. Segers, A. Lievens, O.
Siegmann, and J. De Ley. Bordetella avium sp. nov. isolated from the
respiratory tracts of turkeys and other birds. Int. J. Syst. Bacteriol. 34:56-
70. 1984.
21
Chapter 5 Bordetellosis
8. Lindsey, D. G., P. D. Andrews, G. S. Yarborough, J. K. Skeeles, B.
Glidewell-Erickson, G. Campbell, and Μ B. Blankford. Evaluation of a
commercial ELISA kit for detection and quantification of antibody against
Bordetella avium. In: Proc. 75th Annual Meeting of the Conference of
Research Workers in Animal Diseases, Chicago, Ill. Abstract #31. Nov.
14—15,1994.
9. Neighbor, N. K., J. K. Skeeles, J. N. Beasley, and D. L. Kreider. Use of
an enzyme-linked immunosorbent assay to measure antibody levels in
turkey breeder hens, eggs, and progeny following natural infection or
immunization with a commercial Bordetella avium bacterin. Avian Dis.
35:315-320. 1991.
10. Raffel, T. R., K. B. Register, S. A. Marks, and L. Tempel. Prevalence
of Bordetella avium infection in selected wild and domesticated birds in the
eastern USA. J. Wildl. Dis. 38:40-46. 2002.
11. Register, K. B., R. E. Sacco, and G. E. Nordholm. Comparison of
ribotyping and restriction enzyme analysis for inter- and intraspecies
discrimination of Bordetella avium and Bordetella hinzii. J. Clin. Microbiol.
41:1512-1519. 2003.
12. Skeeles, J. K., and L. H. Arp. Bordetellosis (turkey coryza). In:
Diseases of Poultry, 10th ed. B. W. Calnek, H. J. Barnes, C. W. Beard, L. R.
McDougald, and Y. M Saif. Iowa State University Press, Ames, Iowa. pp.
275-287. 1997.
 6
INFECTIOUS CORYZA
Pat J. Blackall

SUMMARY. Infectious coryza, an acute upper respiratory tract disease of chickens, is caused by the bacterium Avibacterium
paragallinarum. The main impact of the disease is a drop in egg production. Other manifestations such as airsacculitis in broilers, swollen
head-like syndrome, arthritis, and septicemia are either unusual or probably due to complications associated with other infectious agents.
Agent Identification. Diagnosis of infectious coryza is preferably made by the isolation and identification, by biochemical properties, of the
bacterium. A polymerase chain reaction (PCR) test, which can be applied either to suspect colonies or directly to samples from chickens, is
now available. The PCR test is particularly suited for those laboratories that lack suitable expertise and experience in the growth and
phenotypic identification of A. paragallinarum or where samples are transported for long periods to the laboratory. Although most isolates
of A. paragallinarum are dependent upon V factor for growth in artificial media (meaning they show the traditional satellitic growth), some
isolates are V factor-independent. This variation in growth factor requirements, along with the existence of nonpathogenic V factor­
dependent organisms, increases the need for biochemical identification or the use of the PCR test. Serotyping of isolates is important to
guide the use of vaccines.
Serologic Detection in the Host. A range of serologic tests to detect antibodies has been described with hemagglutination-inhibition tests
now being the most widely used.

INTRODUCTION When the disease occurs in chicken flocks in developing countries,

Infectious coryza is an acute respiratory disease of chickens. The
clinical syndrome has been recognized since the 1930s and has been
described in the early literature as roup, contagious or infectious
catarrh, and uncomplicated coryza (6). Early workers identified the
causative agent as Haemophilus gallinarum, an organism that
required both X (hemin) and V (nicotinamide adenine dinucleotide;
NAD) factors for growth in vitro. However, from the 1960s to the
1980s, all isolates of the disease-producing agent have been shown
to require only V factor and have been termed Haemophilus
paragallinarum (6). V factor-independent H. paragallinarum
isolates have been encountered in the Republic of South Africa (21)
and Mexico (15). Most recently, a polyphasic taxonomic study has
shown that the Haemophilus paragallinarum is not a member of the
genus Haemophilus (2). Thus, H. paragallinarum was allocated to
a new genus - Avibacterium - along with several other chicken
associated members of the family Pasteurellaceae (2). Hence, the
causal agent of infectious coryza is now called Avibacterium
paragallinarum, an organism that can be either V factor-dependent
or -independent. This text will use the new terminology of A.
paragallinarum - even if the primary publications being cited used
the older terminologies.
The disease occurs worldwide and causes economic losses due to
an increased number of culls and a marked reduction from 10% to
more than 40% in egg production, particularly on multiage farms.
The disease is essentially limited to chickens and does not threaten
public health.
CLINICAL DISEASE
Infectious coryza may occur in growing chickens and layers. The
most common clinical signs are nasal discharge, facial swelling,
lacrimation, anorexia, and diarrhea. Decreased feed and water
consumption retards growth in young stock and reduces egg
production in laying flocks (6). In layers, the disease can have a
modi greater impact than the relatively simple scenario described
above. As an example, an outbreak of the disease in older layer
birds in California, which was not associated with any other
pathogen, caused a total mortality of 48% and a drop in egg
production from 75 to 15.7% over a 3 wk period (8). The disease
can have significant impact in meat chickens. In California, two
cases of infectious coryza, one complicated by the presence of
Mycoplasma synoviae, caused a swollen head like syndrome and
increased condemnations, mainly due to airsacculitis, that varied
from 8.0 to 15% (14).
22
the added presence of other pathogens and stress factors can result
in disease outbreaks that are associated with greater economic
losses than those reported in high health flocks in developed
countries. In China, outbreaks of infectious coryza have been
associated with morbidities of 20 to 50% and mortalities of 5 to
20% (13). In India, outbreaks of infectious coryza are often
complicated with fowl cholera and can result in high mortalities e.g.
one farm experienced 50% mortality in a 14,000 bird layer flock
(33). Arthritis and septicemia, possibly complicated by the presence
of other pathogens, have been reported in broiler and layer flocks in
South America (27). Infectious coryza can also be a problem in the
village production system e.g. there are reports of outbreaks in such
chickens in Thailand (32) and Indonesia (24). Overall, there is
considerable evidence that infectious coryza outbreaks can have a
much greater impact in developing countries than in developed
countries.
SAMPLE COLLECTION
Two to three acutely diseased chickens should be killed and the
skin over their sinuses seared with a heated spatula. The skin is
then incised with a sterile scalpel blade, and a sterile cotton swab is
inserted into the sinus cavity. Typically, in the early phase of the
disease, A. paragallinarum is found in pure culture in the sinus.
Swabs of the trachea and air sacs may be taken, although the
organism is less frequently isolated from these areas. Avibacterium
paragallinarum is a fragile organism that does not survive for more
than 5 hr outside of birds. Sinus swabs held in Ames Transport
medium (without charcoal) can yield positive cultures for up to 8
days at transport temperatures of either 25 C or room temperature
(9).
Live bird sampling is also possible. In this technique, gentle
milking pressure is exerted on the sinus area and mucus forced from
the nostril. The expressed mucus should be sampled by a
bacteriologic loop, with care being taken to avoid touching the
surface of beak or nostril. A swab of the expressed mucus is also
the optimal sample for the A. paragallinarum PCR. Swabs
collected by this method will still yield a PCR positive reaction
after storage in glycerol-enriched phosphate buffered saline for 180
days at either 4 C or -20 C (12).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Artificial Media
Blood agar is commonly used for the isolation of A.

paragallinarum. The medium is prepared from a dehydrated base
such as Bacto-tryptose-blood-agar base (Difco, Detroit, Mich.) and
is enriched with 5% erythrocytes, which may be from any animal.
The inoculum is streaked onto the blood agar plate in the
conventional maimer, after which the plate is cross-streaked with a
nurse culture. Blood agar is deficient in V factor, and the role of the
nurse culture is to excrete excess V factor to support the growth of
A. paragallinarum . Although several bacterial species are possible
nurse cultures, it is recommended that Staphylococcus hyicus, a
normal inhabitant of the skin of chickens, be used. Avibacterium
paragallinarum is typically grown in the presence of 5% CO2 at 37
C. A convenient procedure is to use candle jars if CO2 incubators
are not available.
An alternative isolation (and maintenance) medium that is
particularly suited to laboratories in developing countries has been
described by Terzolo et al. (31). This medium consists of Columbia
blood agar base (Becton Dickinson Microbiology Systems, Sparks,
Md.) with 7% lysed equine blood. The lysed equine blood is
prepared by holding fresh equine blood at 56 C for 40 min with
occasional stirring. The lysed blood can be stored at -20 C. A
selective version of the medium, which should only be used in
parallel with the nonselective medium, contains bacitracin (5 U/ml),
cloxacillin (5 pg/ml), and vancomycin (25 pg/ml). The plates are
incubated under a microaerophilic atmosphere.
Several complex media have been described that support growth
of avian hemophili (a term used generically to refer to bacteria
within this group). Such media, although not suitable for isolation
due to problems with overgrowth by contaminants, are particularly
useful for characterization tests following initial isolation. Two
media that have proven very useful are Haemophilus maintenance
medium (HMM) and supplemented test medium agar (TM/SN),
originally described by Rimler et al. (25, 26). HMM base consists
of 1% polypeptone (BBL), 1% biosate peptone (BBL), 0.24% beef
extract, 0.005% para-aminobenzoic acid, 0.005% nicotinamide,
0.1% starch, 0.05% glucose, 0.9% NaCl, 0.23% leptospira base
Ellinghausen-McCullaugh-Johnson-Harris (EMJH) (Difco), and
2% Noble agar (Difco). Immediately before being poured, this
medium is supplemented with 0.0025% reduced NAD and 1%
chicken serum. TM/SN base consists of 1% biosate peptone (BBL),
1% NaCl, 0.1% starch, 0.05% glucose, and 1.5% Noble agar
(Difco) and is supplemented with 5% oleic albumin complex, 1%
chicken serum, 0.0005% thiamine, and 0.0025% reduced NAD. A
modified version of TM/SN which consists of brain heart infusion
agar that is supplemented with 5% oleic albumin complex, 1%
chicken serum, 0.0005% thiamine, and 0.0025% reduced NAD has
proven to be as suitable as the original formula given above. Broth
versions of HMM and TM/SN are prepared by omission of the agar.
Chicken Embryos
Avian hemophili can be propagated in 5 to 7-day-old chicken
embryos, commonly by inoculation via the yolk sac route. After
overnight incubation, large numbers of hemophili are present in the
yolk, which then can be harvested and preserved by freezing at -70
C (or lower) or by lyophilization.
Chicken Inoculation
Another efficient diagnostic procedure is to inoculate suspect
exudate into the infraorbital sinus of two or three susceptible
chickens (preferably 4 wk old or more). The appearance of the
typical clinical signs of infectious coryza in 24-48 hr is diagnostic.
On occasion, if the number of viable organisms is low, particularly
in chronic cases, the incubation period may be delayed for up to 1
wk. In such cases, a second passage may be required to produce the
typical rapid onset of clinical signs. If the exudate is heavily
contaminated with extraneous bacteria, the chicken inoculation test
can be more reliable than culture. In such instances, most of the
extraneous bacteria will be cleared by the host defense mechanisms,
23
Chapter 6 Infectious Coryza
whereas A. paragallinarum will colonize and produce typical
disease.
AGENT IDENTIFICATION
Background
Avibacterium paragallinarum is not the only growth factor­
dependent organism that can be isolated from chickens.
Nonpathogenic avian hemophili have been recognized since the
1930s. The organisms have been the subject of several taxonomic
changes - being initially named as Haemophilus avium (16) and
then as Pasteurella volantium, Pasteurella avium, and Pasteurella
species A (22). In a recent polyphasic study, these non-pathogenic
organisms have been transferred to the genus Avibacterium as A.
avium, A. volantium and Avibacterium species A (2). The final
member of the new genus is A. (Pasteurella) gallinarum.
A range of other hemophili, none of which are yet assigned to
named species, have been isolated from birds other than chickens.
The identification of these other hemophili will not be discussed
further here.
Morphology
Examination of a direct smear of the exudate by Gram stain can be
useful for initial assessment of the microbial flora. The finding of
gram-negative rods in direct smears, however, is not sufficient
grounds for definitive diagnosis and must be followed by culture.
After incubation of blood agar plates for 24—^48 hr, V factor­
dependent isolates of A. paragallinarum produce tiny dewdrop
colonies up to 0.3 mm in diameter adjacent to the nurse culture.
The colonies become smaller with increasing distance from the
nurse culture. For the satellitic growth to be obvious, cultures must
be examined within 24-48 hr. The V factor-independent A.
paragallinarum isolates produce small colonies (1-2 mm) that do
not show satellitic growth. Colonies of A. avium, A. volantium,
Avibacterium species A show satellitic growth and are typically
much bigger than V factor-dependent A. paragallinarum. Some
isolates of A. volantium may produce a yellowish pigment.
Growth Requirements
Most avian hemophili have a requirement for V factor but not for
X factor (6). The determination of the growth factor requirements
of these organisms is not an easy process. The use of some brands
of commercial growth factor discs on media such as brain-heart
infusion agar or susceptibility test agar can result in a high
percentage of cultures that falsely appear to be both X and V factor­
dependent. The combination of Oxoid growth factor discs
(Unipath, Ltd., distr. Unipath, Ogdensburg, N.Y.) and TM/S
(TM/SN without added NAD) has been shown to be suitable for
growth factor testing (5). Some isolates of avian hemophili may
have such lowered V factor requirements that the serum must be
omitted from TM/S.
Alternative tests such as the porphyrin test (18) for X factor testing
or the use of purified hemin (X factor) and NAD (V factor) as
supplements to otherwise complete media are possible but are
generally too complex for diagnostic laboratories.
V factor-independent isolates of A. paragallinarum have been
recognized to date in the Republic of South Africa (21) and Mexico
(15). Hence, diagnostic bacteriologists need to be aware of the
possibility of such variants emerging in other areas.
Typically, A. paragallinarum isolates fail to grow in air, although
some strains will develop this ability on subculturing. A. avium,
A. volantium and Avibacterium species A all grow vigorously in air.
Physicochemical Properties
The ability to reduce nitrate to nitrite and ferment glucose without
the formation of gas is common to all of the avian hemophili.
Oxidase activity, the presence of the enzyme alkaline phosphatase,
Pat J. Blackall
and a failure to produce indole or hydrolyse urea or gelatin are also
uniform characteristics. A. paragallinarum is catalase-negative,
whereas all other members of the genus Avibacterium including the
hemophilic species of A. avium, A. volantium and Avibacterium
species A are catalase-positive (2).
Carbohydrate fermentation patterns of the avian hemophili are
generally determined using a phenol red broth (Difco) containing
1% NaCl, 0.0025% NADH, 1% chicken serum, and 1%
carbohydrate. For routine identification, the use of this broth and a
dense inoculation (i.e., the modified reference technique of Blackall
(1)), is a most suitable approach for determining fermentation
patterns. For larger studies, a replica plating technique is more
suitable (1).
Table 6.1 presents those properties that allow full identification of
the avian hemophili. The properties of all members of the genus
Avibacterium are presented. The failure of A. paragallinarum to
ferment either galactose or trehalose clearly separates it from all
other members of the genus, both hemophilic and non-hemophilic.
Serotyping Tests
Two different, but interrelated, serotyping schemes for A.
paragallinarum have been used mainly the Page (23) and the Kume
(19) schemes. The most widely recognized and applied scheme is
the Page scheme, which recognizes three serovars (A, B, and C) of
A. paragallinarum . Although the original scheme was based on an
agglutination test, the Page serovars are best recognized by a
hemagglutination-inhibition (HI) test. The antigen for this HI test
can be produced by either of two methods. In the first method,
whole bacterial cells are harvested from an overnight broth and
stored at 4 C in 1/100 of the initial broth volume for at least 3 days
(3). Alternatively, the antigen can be produced by the technique
originally used in the Kume scheme (19). In this method, cells of A.
paragallinarum are harvested, washed in phosphate-buffered saline
(PBS) (pH 7.0), resuspended in 0.5 M KSCN/0.425 M NaCl to a
density equivalent to a MacFarland nephelometer tube number 5
(Difco), held at 4 C for 2 hr with agitation, and then sonicated. The
antigen is washed three times in PBS and resuspended in PBS with
0.01% merthiolate to a density equivalent to a MacFarland
nephelometer tube number 5. With either antigen type, the HI test
should be performed with glutaraldehyde-fixed chicken
erythrocytes. The erythrocytes are prepared by collecting fresh
chicken blood into an equal volume of Alsever’s solution. The
suspension is centrifuged and the erythrocytes are washed three
times in 0.15 M NaCl. The erythrocytes are then suspended to 1%
(v/v) in a glutaraldehyde-salts solution and held at 4 C for 30 min.
The glutaraldehyde-salts solution is prepared by diluting 25%
glutaraldehyde to 1% in a solution containing one volume of 0.15 M
Na2HPO4 (pH 8.2), nine volumes of 0.15 M NaCl, and five volumes
of distilled water. The fixed erythrocytes are collected by
centrifugation, washed five times in 0.15 M NaCl and five times in
distilled water and finally resuspended to 30% (v/v) in distilled
water containing 0.01% merthiolate. This stock of fixed
erythrocytes is held at 4 C, and a working dilution of 1% is prepared
in PBS (pH 7.0) containing bovine serum albumin (0.1%) and
gelatin (0.001%) (PBS-B-G). Reports that Page serovar B is not a
true serovar (28) have been discounted, and Page serovar B has
been conclusively shown to be serologically distinct (34).
The Kume scheme is a hemagglutination-inhibition serotyping
scheme using bacterial cells that have been treated with potassium
thiocyanate and then sonicated, and glutaraldehyde-fixed chicken
erythrocytes. The preparation of the antigen and the chicken
erythrocytes for the Kume scheme has already been described in the
section on the Page serotyping scheme. The nomenclature of the
Kume scheme has been changed since the original publication.
Under die altered terminology the three Kume serogroups are
termed A, B, and C (4). This terminology emphasizes that the
Kume serogroups correspond to the Page serovars. Within the
24
Kume serogroups, the use of absorbed antisera allows the
recognition of serovars, with the nine currently recognized Kume
serovars being A-l, A-2, A-3, A-4, B-l, C-l, C-2, C-3, and C-4 (4).
The antisera, with the exception of the antisera for B-l and C-3,
need to be absorbed to allow recognition of the Kume serogroups.
The antisera to be absorbed are diluted 1 in 40 in PBS-B-G. The
absorption is performed using antigens adjusted to 64 HA units and
at five times die volume of the diluted serum. The adjusted antigen
is centrifuged and the supernatant discarded. The pelleted antigen
is resuspended in the diluted antiserum. The suspension is left at
room temperature for 2 hr and then overnight at 4 C. The
suspension is then centrifuged and the supernatant retained as the
absorbed antiserum (still at 1 in 40 dilution). Depending on the
antiserum, a succession of absorptions may need to be performed.
Once the antigen absorption has been completed, the sera need to be
absorbed with fixed erythrocytes, using 5 times the volume of fixed
erythrocytes compared with the serum. The relevant volume of
erythrocytes is centrifuged and the supernatant discarded. The
pelleted erythrocytes are resuspended in the diluted antiserum. The
suspension is left at room temperature for 2 hr and then overnight at
4C. The suspension is then centrifuged and the supernatant retained
as the absorbed antiserum (still at 1 in 40 dilution). The Kume
scheme has not been widely applied as it is technically demanding
to perform.
Molecular Identification
A polymerase chain reaction (PCR) test that is specific for A.
paragallinarum has been described (11). The test has been
evaluated with a wide range of A. paragallinarum isolates and is
specific and sensitive. The test, termed the HP-2 PCR, has been
shown to be suitable for use on purified DNA extracts as well as on
crude colony preparations obtained from isolation plates. The HP-2
PCR can be used directly on swabs of nasal mucus obtained from
the squeezing of the nostril. The test can be inhibited in the
presence of blood and swabs obtained via by slicing open the infra­
orbital sinus during necropsy are not optimal for use in the HP-2
PCR. Direct PCR examination of swabs has been shown to
outperform culture in China (10, 12). The HP-2 PCR is particularly
useful in regions where both NAD-independent A. paragallinarum
and Omithobacterium rhinotracheale are present. Molecular typing
methods such as restriction endonuclease analysis (7) and
ribotyping (20) have proved useful in epidemiologic studies. A
PCR-based typing method - ERIC-PCR - has also shown a capacity
to sub-type isolates of A. paragallinarum (30).
Maintenance
Although the initial isolation of A. paragallinarum from acute
infectious coryza is not difficult, it is a fragile organism requiring
special care for propagation and maintenance in the laboratory.
Cultures can be maintained on blood agar plates by weekly
passages. Cultures incubated for 24-48 hr at 37 C and then stored
at 4 C in a candle jar will remain viable for up to 2 wk. Cultures
can be preserved by the lyophilization or freezing (at -70 C or
lower) of infected yolk (see the section on chicken embryos).
Storage at -70 C of a heavy suspension in the commercial bead
systems now commonly available is also possible.
SEROLOGIC DETECTION IN THE HOST
Although a range of serologic tests for the detection of antibodies
to A. paragallinarum have been described (6), only
hemagglutination-inhibition (HI) tests are in widespread use. The
various HI tests differ in the methods used to prepare the antigen
and the type of red blood cells used. For the purposes of this
overview, the three main HI tests have been termed the simple,
extracted, and treated HI tests. Although most of these HI tests
were originally described as tube or macroplate tests, all can also be

performed in microtiter trays using appropriate volumes. The
simple HI test is based on whole bacterial cells of a Page serovar A
organism (17). Cells are harvested and suspended in PBS
containing 0.01% merthiolate (pH 7.0). Pretreatment of the sera
may be necessary to eliminate nonspecific agglutinins. A 5%
suspension of chicken erythrocytes is added to the sera (1:5
proportion) and the mixture is incubated for 2 hr at room
temperature and 12 hr at 4 C (29). Two-tenths milliliter of antigen
(containing 20 HA units/ml) is added to 0.2 ml of serially diluted
serum (initial dilution of 1:5). After incubation at room temperature
for 10 min, 0.4 ml of 0.5% chicken erythrocyte suspension
containing 0.02% (v/v) gelatin is added. The HI titers are
determined after incubation for 30-40 min at room temperature.
This test has been performed mainly using antigen prepared from A.
paragallinarum strain 221.
The extracted HI test is based on potassium thiocyanate-extracted
and sonicated cells of A. paragallinarum and glutaraldehyde-fixed
chicken erythrocytes (29). The preparation of the antigen and the
chicken erythrocytes has already been described in the section on
the Page serotyping scheme. Although the methodology of the
extracted HI test is as described for the simple HI test, the sera are
pretreated with 10% glutaraldehyde-fixed erythrocytes to eliminate
nonspecific hemagglutinins, and PBS containing 0.1% bovine
serum albumin and 0.001% gelatin is used as the diluent.
The extracted HI test has been used to detect antibodies in
chickens receiving inactivated vaccines based on Page serovar C
organisms (29). In chickens infected with a serovar C organism, the
majority of the birds remain negative in this test (36). Note that, in
this report, the erythrocytes were fixed in formalin instead of
glutaraldehyde (36).
The treated HI test is based on hyaluronidase-treated whole
bacterial cells of A. paragallinarum and formaldehyde-fixed
chicken erythrocytes (37). Whole bacterial cells that have been
adjusted to 10 times the optical density of 0.4 at 540 nm are treated
with hyaluronidase (50 units/ml) in phosphate buffer (pH 6.0) in a
waterbath at 37 C for 2 hr. The treated antigen is then washed twice
in PBS and then resuspended in the original volume of PBS.
The test uses the same methodology as that described for the
extracted HI test except that the erythrocytes are 1.0%
formaldehyde-fixed chicken erythrocytes. The diluent used in this
HI test is the same as that used in the extracted HI test. All sera are
pretreated with 50% (v/v) formaldehyde-fixed chicken erythrocytes
Table 6.1. Distinguishing properties of the species within the genera A vibacteriumK
Property Avibacterium Avibacterium
gallinarum paragallinarum
Catalase +B - +
Symbiotic growth - V
Growth in Air + -
Acid from
L-arabinose - -
D-galactose + -
Lactose V -
D-mannitol - +
Maltose + V
D-sorbitol - +
Trehalose + -
ONPG V -
A All species are Gram-negative and non-motile. All species reduce nitrate, are oxidase positive and ferment glucose. Most isolates of Avibacterium
paragallinarum require an enriched carbon dioxide (5-10%) atmosphere and most will show an improved growth in the presence of 5-10% chicken serum.
Most isolates of Avibacterium gallinarum show an improved growth in an enriched carbon dioxide (5-10%) atmosphere.® + = positive (>90%), - = negative
(>90%), V = variable reaction
25
Chapter 6 Infectious Coryza
(one volume of antigen with eight volumes of erythrocytes for 2 hr
at 37 C with serum recovered by centrifugation and regarded as
being a one in five dilution).
The extracted HI test has been used to detect antibodies to Page
serovars A, B, and C in vaccinated chickens (35). Vaccinated
chickens with HI titers of 1:5 or greater in the HI tests based on the
simple and extracted antigens have been found to be protected
against subsequent challenge (29).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Infection with A. paragallinarum must be differentiated from other
diseases, such as chronic respiratory disease, chronic fowl cholera,
fowl pox, omithobacteriosis (due to O. rhinotracheale), swollen
head syndrome (associated with avian pneumovirus) and
hypovitaminosis A, which can produce similar clinical signs.
Because A. paragallinarum often occurs in mixed infections, one
should consider the possibility of other bacteria or viruses as
complicating agents, particularly if mortality is high and the disease
takes a prolonged course.
The simple isolation of a satellitic, gram-negative organism is not
sufficient to identify an isolate as A. paragallinarum. For
laboratories with limited facilities, sufficient evidence for a
diagnosis of infectious coryza would be the isolation of a catalase­
negative, gram-negative organism that exhibits satellitic growth and
fails to grow in air, together with a history of a rapidly spreading
acute coryza in a flock.
The use of the PCR is recommended as the definitive test.
Laboratories without access to PCR technology should determine
growth factor requirements and the ability to ferment glucose,
galactose, and trehalose. At this level, A. paragallinarum can be
differentiated from the other members of the genus Avibacterium.
For laboratories with extensive resources, a complete phenotypic
identification based on the properties shown in Table 6.1 is
possible. As V factor-independent A. paragallinarum have been
isolated, diagnostic microbiologists must be aware of the fact that
non-satellitic bacteria should be considered as suspect
A. paragallinarum if they show the typical biochemical properties
of the species and have been obtained from chickens showing upper
respiratory disease.
Avibacterium Avibacterium avium Avibacterium sp. A.
volantium
+ +
+ + +
+ + +
- - +
+ + +
V - -
+ - V
+ - V
V - -
+ + +
+ - V
Pat J. Blackall
ACKNOWLEDGEMENT
The authors would like to acknowledge the contribution of Dick Yamamoto
who has been the senior author or co-author for previous editions of this
text
REFERENCES
1. Blackall, P. J. An evaluation of methods for the detection of carbohydrate
fermentation patterns in avian Haemophilus species. J. Microbiol. Methods
1.275-281. 1983.
2. Blackall, P. J., H. Christensen, T. Beckenham, L. L. Blackall, and M.
Bisgaard. Reclassification of Pasteurella gallinarum, [Haemophilus]
paragallinarum, Pasteurella avium and Pasteurella volantium as
Avibacterium gallinarum gen. nov., comb, nov., Avibacterium
paragallinarum comb, nov., Avibacterium avium comb. nov. and
Avibacterium volantium comb. nov. International Journal of Systematic and
Evolutionary Microbiology 55:353-362. 2005.
3. Blackall, P. J., L. E. Eaves, and G. Aus. Serotyping of Haemophilus
paragallinarum by the Page scheme: comparison of the use of agglutination
and hemagglutination-inhibition tests. Avian Dis 34:643-645. 1990.
4. Blackall, P. J., L. E. Eaves, and D. G. Rogers. Proposal of a new serovar
and altered nomenclature for Haemophilus paragallinarum in the Kume
hemagglutinin scheme. J. Clin. Microbiol. 28:1185-1187. 1990.
5. Blackall, P. J., and J. G. Farrah. An evaluation of commercial discs for the
determination of the growth factor requirements of the avian haemophili.
Vet Microbiol. 10:125-131. 1985.
6. Blackall, P. J., and M. Matsumoto. Infectious coryza. In: Diseases of
Poultry, 11th ed. Y. M. Saif, H. J. Bames, J. R. Glisson, A. M. Fadly, L. R.
McDougald, and D. A. Swayne, eds. Iowa State University Press, pp. 691-
703
7. Blackall, P. J., C. J. Morrow, A. Mclnnes, L. E. Eaves, and D. G. Rogers.
Epidemiologic studies on infectious coryza outbreaks in northern New South
Wales, Australia, using serotyping, biotyping, and chromosomal DNA
restriction endonuclease analysis. Avian Dis 34:267-276. 1990.
8. Bland, Μ. P., A. A. Bickford, B. R. Charlton, G. C. Cooper, F. Sommer,
and G. Cutler. Case Report: A severe infectious coryza infection in a multi­
age layer complex in central California. In 51st Western Poultry Disease
Conference/XXVH convention anual ANECA. Peurto Vallajarta, Mexico, p.
56-57. 2002
9. Bragg, R. R., P. Jansen Van Rensburg, E. Van Heerden, and J. Albertyn.
The testing and modification of a commercially available transport medium
for the transportation of pure cultures of Haemophilus paragallinarum for
serotyping. Onderstepoort J Vet Res 71:93-98. 2004.
10. Chen, X., Q. Chen, P. Zhang, W. Feng, and P. J. Blackall. Evaluation of
a PCR test for the detection of Haemophilus paragallinarum in China.
Avian Pathol. 27:296-300. 1998.
11. Chen, X., J. K. Miflin, P. Zhang, and P. J. Blackall. Development and
application of DNA probes and PCR tests for Haemophilus paragallinarum.
Avian Dis 40:398-407. 1996.
12. Chen, X., C. Song, Y. Gong, and P. J. Blackall. Further studies on the
use of a polymerase chain reaction test for the diagnosis of infectious
coryza Avian Pathol. 27:618-624. 1998.
13. Chen, X., P. Zhang, P. J. Blackall, and W. Feng. Characterization of
Haemophilus paragallinarum isolates from China. Avian Dis 37:574-576.
1993.
14. Droual, R., A. A. Bickford, B. R. Charlton, G. L. Cooper, and S. E.
Channing. Infectious coryza in meat chickens in the San Joaquin Valley of
California. Avian Dis 34:1009-10016. 1990.
15. Garcia, A. J., E. Angulo, P. J. Blackall, and A. M. Ortiz. The presence of
nicotinamide adenine dinucleotide-independent Haemophilus
paragallinarum in Mexico. Avian Dis 48:425-429. 2004.
16. Hinz, K.-H., and C. Kunjara. Haemophilus avium, a new species from
chickens. Int. J. Syst. Bacteriol. 27:324-329. 1977.
26
17. Iritani, Y., G. Sugimori, and K. Katagiri. Serologic response to
Haemophilus gallinarum in artifically infected and vaccinated chickens.
Avian Dis 21:1-8. 1977.
18. Kilian, M. A rapid method for the differentiation of Haemophilus strains.
Acta. Pathol. Microbiol. Immunol. Scand. Sect. B 82:835-842. 1974.
19. Kume, K., A. Sawata, T. Nakai, and M. Matsumoto. Serological
classification of Haemophilus paragallinarum with a hemagglutinin system
J. Clin. Microbiol. 17:958-964. 1983.
20. Miflin, J. K., R. F. Homer, P. J. Blackall, X. Chen, G. C. Bishop, C. J.
Morrow, T. Yamaguchi, and Y. Iritani. Phenotypic and molecular
characterization of V-factor (NAD)-independent Haemophilus
paragallinarum. Avian Dis 39:304-308. 1995.
21. Mouahid, Μ., M. Bisgaard, A. J. Morley, R. Mutters, and W. Mannheim.
Occurrence of V-factor (NAD) independent strains of Haemophilus
paragallinarum. Vet. Microbiol. 31:363-368. 1992.
22. Mutters, R., K. Piechulla, K.-H. Hinz, and W. Mannheim Pasteurella
avium (Hinz and Kunjara 1977) comb. nov. and Pasteurella volantium sp.
nov. Int. J. Syst. Bacteriol. 35:5-9. 1985.
23. Page, L. A. Haemophilus infections in chickens. 1. Characteristics of 12
Haemophilus isolates recovered from diseased chickens. Am. J. Vet. Res.
23:85-95. 1962.
24. Poemomo, S., Sutarma, M. Rafiee, and P. J. Blackall. Characterization
of isolates of Haemophilus paragallinarum from Indonesia. Aust. Vet. J.
78:759-762. 2000.
25. Rimler, R. B. Studies of the pathogenic avian haemophili. Avian Dis
23:1006-1018. 1979.
26. Rimler, R B., E. B. Shotts Jr, J. Brown, and R. B. Davis. The effect of
sodium chloride and NADH on the growth of six strains of Haemophilus
species pathogenic to chickens. J. Gen. Microbiol. 98:349-354. 1977.
27. Sandoval, V. E., H. R. Terzolo, and P. J. Blackall. Complicated
infectious coryza cases in Argentina. Avian Dis 38:672-678. 1994.
28. Sawata, A., K. Kume, and Y. Nakase. Biologic and serologic
relationships between Page's and Sawata's serotypes of {THaemophilus
paragallinarum}. Am. J. Vet. Res. 41:1901-1904. 1980.
29. Sawata, A., K. Kume, and Y. Nakase. Hemagglutinin of Haemophilus
paragallinarum serotype 2 organisms: occurrence and immunologic
properties of hemagglutinin. Am J. Vet. Res. 43:1311-1314. 1982.
30. Soriano, V. E., G. Tellez, B. M. Hargis, L. Newberry, C. Salgado-
Miranda, and J. C. Vazquez. Typing of Haemophilus paragallinarum strains
by using enterobacterial repetitive intergenic consensus-based polymerase
chain reaction. Avian Dis 48:890-895. 2004.
31. Terzolo, H. R, F. A. Paolicchi, V. E. Sandoval, P. J. Blackall, T.
Yamaguchi, and Y. Iritani. Characterization of isolates of Haemophilus
paragallinarum from Argentina. Avian Dis 37:310-314. 1993.
32. Thitisak, W., O. Janviriyasopak, R S. Morris, S. Srihakim, and R. V.
Kruedener. Causes of death found in an epidemiological study of native
chickens in Thai villages. Proc. 5th. Inter. Sym Vet. Epidemiol. Economics
pp. 200-202. 1988.
33. Tongaonkar, S., S. Deshmukh, and P. Blackall. Characterisation of
Indian isolates of Haemophilus paragallinarum. In 51st Western Poultry
Disease Conference/XXVII convention anual ANECA. Peurto Vallajarta,
Mexico, p. 58. 2002
34. Yamaguchi, T., P. J. Blackall, S. Takigami, Y. Iritani, and Y. Hayashi.
Pathogenicity and serovar-specific hemagglutinating antigens of
Haemophilus paragallinarum serovar B strains. Avian Dis 34:964-968.
1990.
35. Yamaguchi, T., P. J. Blackall, S. Takigami, Y. Iritani, and Y. Hayashi.
Immunogenicity of Haemophilus paragallinarum serovar B strains. Avian
Dis 35:965-968. 1991.
36. Yamaguchi, T., Y. Iritani, and Y. Hayashi. Serological response of
chickens either vaccinated or artificially infected with Haemophilus
paragallinarum. Avian Dis 32:308-312. 1988.
37. Yamaguchi, T., Y. Iritani, and Y. Hayashi. Hemagglutinating activity
and immunological properties of Haemophilus paragallinarum field isolates
in Japan. Avian Dis 33:511-515. 1989.
 7
Campylobacter INFECTIONS IN POULTRY
Jaap A. Wagenaar and Wilma F. Jacobs-Reitsma

SUMMARY. Poultry may easily become colonized with Campylobacter jejuni and/or Campylobacter coli. These bacterial species do not
cause clinical disease in poultry but contamination of the meat during laughter and processing is a well recognized source of foodbome
illness in humans.
Agent Identification. Campylobacter is isolated from poultry feces and cecal contents using selective agar media under microaerobic
conditions. Subsequently, suspect isolates are confirmed to be Campylobacter and identified to the species level by using a limited number of
biochemical tests or appropriate PCR tests.
Serologic Detection in the Host. Campylobacter infections are not routinely diagnosed by serologic assays.

INTRODUCTION CLINICAL DISEASE

The gut of poultry easily becomes colonized with the thermophilic
Campylobacter species C. jejuni and C. coli. Other Campylobacter
species are very rarely (< 1%) isolated from poultry. Also wild birds
frequently are found to carry Campylobacter spp., with a strong
association of C. lari present in seagulls. Campylobacters are
commensal organisms without causing any clinical disease in
poultry, though there is an immune response and the presence of the
organism is detected by the host. The significance of
Campylobacter in poultry is for reasons of human public health and
not for reasons of clinical poultry diseases. Vertical transmission of
the infections does not occur, and eggs are not contaminated.
Contamination of meat products is the main issue and consequently
C. jejuni and C. coli are of importance only in broilers and other
meat producing avian species.
Many broiler flocks are colonized at the age of slaughter because
poultry can be infected with low numbers of Campylobacter and
Campylobacter is generally present in the environment with
reservoirs in both domesticated and wild warm-blooded animals
(18, 32). The fact that the organism colonizes in high concentrations
results in shedding of high levels of Campylobacter and intense
contamination of the environment. Cleaning and disinfection of
poultry houses and the surroundings of the houses between
production cycles is difficult. When the houses are stocked with a
new flock of day-old chickens, the infection cycle can easily start
again. When Campylobacter-^QsitiNQ birds are processed in the
slaughterhouse, the meat may easily become contaminated with
bacteria from the gut contents. Campylobacter will only multiply
under specific atmospheric conditions with reduced oxygen tension
and within a temperature range of 30 - 45 C. These conditions are
not present during processing, transport and storage of the meat. In
contrast with e.g. Salmonella, the Campylobacter concentration will
not increase along the food chain in case of troubles with
maintaining chilled conditions. At the consumer level,
Campylobacter will easily die off during proper heating of the meat
but the risk for humans is mainly in cross contamination from the
raw meat to ready-to-eat products like salads. Campylobacter is a
highly infectious organism so even ingesting low doses is
associated with a relatively high probability of human illness.
In addition to foodbome infections, humans may become ill from
direct contact with infected animals like poultry, but also pets like
(young) cats and dogs. Petting zoos are identified as a risk factor
especially when less attention is paid to personal hygiene.
Campylobacter is one of the most important causes of bacterial
gastro-enteritis in humans (30). Campylobacteriosis in humans is
characterized by diarrhea and abdominal cramps. Complications
that may occur are reactive arthritis and the Guillain-Barre
syndrome (10, 25).
Sporadic cases of vibrionic hepatitis in poultry have been
described, supposedly caused by Campylobacter. However, there is
only the suggestion of a causative role of Campylobacter without
any proof (7). C. jejuni may cause illness in ostriches but the
economic loss due to Campylobacter infections are assumed to be
very limited (28).
Both C. jejuni and C. coli have a high prevalence in poultry, but
both species generally are considered as normal gut inhabitants. Co­
infections with multiple strains frequently occur. There is a strong
seasonality in the prevalence in broiler flocks with higher isolation
rates in summer (18).
Control programs in poultry to reduce the number of infected
flocks are implemented to prevent human illness from contaminated
poultry meat. Epidemiology of Campylobacter infections in broiler
flocks is still not completely elucidated. Recently a systematic
review based on UK data and comprising 159 research papers was
published on risk factors for introduction of Campylobacter into
broiler flocks (1). Partial depopulation (thinning) and multiple
poultry houses on a farm were identified as contributing factors
associated with increased risk, and hygiene barrier, parent company
and certain seasons of rearing were associated with decreased risk.
Diagnostics
Testing poultry for presence of Campylobacter is performed for
particular research objectives, for more general monitoring reasons
(observing trends), or to identify the Campylobacter status of the
individual flock. The latter may be used to decide on scheduled
slaughter of negative flocks followed by positive flocks.
Monitoring programs
Monitoring programs are implemented to identify trends in
Campylobacter infections and to evaluate the feasibility of control
programs. It offers the possibility to link the poultry data to the
human Campylobacter data in order to assess the contribution of
poultry to the human burden of illness. A good example is the
obligatory monitoring of Campylobacter in broilers in the EU as
prescribed by Zoonoses Directive 2003/99/EC. According to this
directive the monitoring of broiler flocks started on January 1st,
2005 with the European Food Safety Authority (EFSA) as the
responsible agency for compilation and reporting of data collected
by the EU member states. At this moment (February 2006) the EU
is unique in the world for this monitoring program.
(http ://www.efsa. eu.int/science/monitoring zoonoses/reports/catind
ex en.html).
Individual flocks
In some European countries (Denmark, Iceland, Norway) poultry
flocks are tested for Campylobacter prior to slaughter, and negative
and positive flocks are slaughtered separately. The meat from
positive flocks is treated (freezing or heat treatment) to reduce the
Campylobacter concentration, whereas the meat from negative

27
Jnp A Wagenaar and Wilma F. Jacobs-Reitsma
flocks is sold as fresh meat. As consumers are exposed to reduced
levels of Campylobacter compared to the situation without
separation, this approach aims to reduce the burden of illness. The
effect of this approach is strongly dependent on the reliability (in
particular sensitivity) of the diagnostic procedure, including
collection and transport of samples, and performance of the
detection assay.
SAMPLE COLLECTION
Isolation of Campylobacter from feces and contents of the ceca is
described here as these samples are commonly used for the
diagnosis of a Campylobacter infection in poultry. Carcass samples
can be analyzed but this needs a specific approach including
selective enrichment. Isolation of Campylobacter from carcass and
meat samples is described in detail elsewhere (12,13).
Collection of samples
A Campylobacter infection rapidly spreads within a flock (31),
and close to 100% of the animals become colonized, shedding >106
cfu Campylobacter per gram feces for a prolonged period of time
(at least till slaughter age of broilers). At a within-flock prevalence
of >40%, 10 samples will be sufficient to detect the Campylobacter
infection at a 95% confidence level. In case of scheduled slaughter
it is most important to know the actual Campylobacter status of the
flock just prior to slaughter. Consequently, the samples should be
taken as close to slaughter as possible: at the farm or even at the
slaughterhouse. In the latter case, reliable results can be obtained by
taking intact ceca for examination. Living birds can be sampled by
taking fecal/cecal droppings or cloacal swabs. For reliable detection
of Campylobacter by culture, freshly voided feces should be
collected. All samples must be prevented from drying out before
culture. At the slaughterhouse, ceca can be cut with sterile scissors
from the remaining part of the intestines and submitted intact to the
laboratory in a plastic bag or Petri-dish.
Transport of samples
Campylobacter easily dies off during transport of samples and
precautions have to be taken to prevent the samples from
dehydration, atmospheric oxygen, sunlight and elevated
temperature. When swabs are used, a transport medium (like Amies,
Cary Blair or Stuart) must be used. These transport swabs are
available commercially.
When only small amounts of fecal/cecal samples can be collected
and transport swabs are not available, shipment of the specimen in
transport media is recommended. Several transport media have been
described: Cary-Blair, modified Cary-Blair, modified Stuart
medium, Campythioglycolate medium, alkaline peptone water and
semisolid motility test medium. Good recovery results have been
reported using Cary-Blair (15, 23).
No specific recommendation on the temperature for transportation
can be made, but it is clear that freezing and high temperatures
reduce viability. In general high temperatures (>20 C), low
temperatures (<0 C) and especially fluctuations in temperature must
be avoided. During laboratory processing, samples can be kept at
room temperature for short periods to avoid unnecessary
temperature shocks. When the time between sampling and
processing is longer, storage at 4 (±2) C is advised. Transport to the
laboratory and subsequent processing should therefore be as rapid
as possible (preferably the same day, but within at least 3 days).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Isolation of Campylobacter from fecal/cecal or intestinal samples
is usually performed by direct plating onto selective medium or by
using the filtration method on nonselective agar. As enrichment of
28
fecal samples is not performed routinely, enrichment media will not
be discussed in this chapter.
Several commercial enzyme immunoassays are available for the
detection of Campylobacter in human stool samples but these tests
are not validated for routine use in poultry fecal samples.
Selective media for isolation
Many media currently are in use for the bacteriological culture of
Campylobacter spp. and the majority also are commercially
available. A recommendation for a specific medium cannot be
given. Experience in laboratories is an important factor in the
choice of the medium. There are differences in medium preferences
in different places in the world. Many European countries use
mCCDA whereas in the US Campy-cefex and CVA are more
commonly used (see list below). A detailed description of the
developments in Campylobacter detection and the variety of
existing media is given by Corry et al. (8, 9). Campylobacter-
selective media can be divided into two main groups: blood­
containing media and charcoal-containing media. Both blood
components and charcoal remove toxic oxygen derivatives. The
selectivity of the media is determined by the antimicrobials used.
Cefalosporins (generally cefoperazone) are used, sometimes in
combination with other antibiotics (e.g. vancomycin, trimethoprim).
Cycloheximide (actidione) or amphotericin B are used to inhibit
yeasts and molds (17). All media allow the growth of C. jejuni and
C. coli but the main difference between the media is the degree of
inhibition of contaminating flora depending on the combination of
antimicrobials used. There is no medium available that allows
growth of C. jejuni and inhibits C. coli or vice versa. To some
extent, other Campylobacter species (e.g. C. lari, C. upsaliensis,
C. helveticus, C. fetus and C. hyointestinalis) will also be able to
grow on some of these media, especially at the less selective
temperature of 37 C. Examples of selective blood-containing solid
media are: Preston agar (4), Skirrow agar (24), Campy-cefex (29),
CVA (22).
Examples of selective charcoal-based solid media are:mCCDA
(modified Charcoal Cefoperazone Deoxycholate Agar)(ll), slightly
modified version of the originally described CCDA (5), Karmali
agar or CSM (Charcoal-Selective Medium) (14), CAT agar
(Cefoperazone, Amphotericin, Teicoplanin agar), facilitating
growth of C. upsaliensis (2).
Inoculation of selective media
Samples are sown on to the solid selective agar medium by using a
loop or a swab. Plating for single colonies needs special attention.
Passive filtration
Passive filtration avoids the use of selective media and is useful
for the isolation of the more antimicrobial-sensitive Campylobacter
species (26). In resource-poor countries this method can be used as
an alternative for the use of expensive selective media. For passive
filtration, a suspension of the feces is made in PBS (approximately
1/10 dilution). Approximately 100 μΐ of this suspension are then
carefully layered on to a 0.45 or 0.65 pm filter, which has been
previously placed on top of a nonselective blood agar plate. Care
must be taken not to allow the inoculum to spill over the edge of the
filter. The bacteria are allowed to migrate through the filter for 30-
45 min at 37 C or room temperature. The filter is then removed, the
fluid that has passed through the filter is spread with a loop or
spreader to facilitate the isolation of single colonies. The plate is
incubated microaerobically at 41.5 C (or at 37 C for isolation of
non-thermophilic Campylobacter species).
Incubation Atmosphere
A microaerobic atmosphere of 5-10% oxygen, 5-10% carbon
dioxide (and preferably 5-9% hydrogen) is required for optimal
growth (9). Appropriate microaerobic atmospheric conditions may

be produced by commercial gas generator kits or by (repeated) gas
jar evacuations followed by atmosphere replacement with bottled
gasses. Variable atmosphere incubators can be used but they usually
need large gas volumes in particular when they are frequently
opened.
Temperature of incubation
Media may be incubated at 37 C or 41.5 C, but it is common
practice to incubate at 41.5 C to reduce growth of contaminants and
to select for optimal growth of C. jejuni/C. coli. (6). Incubation at
41.5 C instead of at 42 C was chosen to harmonize with Salmonella
and Escherichia coli 0157 isolation protocols (12).
Time of incubation
C. jejuni and C. coli usually show growth on solid media within
24M8 hr at 41.5 C. As the additional number of positive samples
obtained by prolonged incubation is very low, 48 hr of incubation is
recommended for routine diagnosis (12, 6).
AGENT IDENTIFICATION
Growth characteristics
On Skirrow or other blood-containing agars, characteristic
Campylobacter colonies are slightly pink, round, convex, smooth
and shiny, with a regular edge. On charcoal-based media such as
mCCDA, the characteristic colonies are greyish, flat and moistened,
with a tendency to spread, and may have a metal sheen.
Confirmation
A pure culture is required for confirmatory tests, but a preliminary
confirmation can be obtained by direct microscopic examination of
suspect colony material.
According to ISO Campylobacter confirmation is based upon the
characteristics listed in Table 7.1 (12).
Table 7.1. Confirmatory tests for thermophilic Campylobacter.
Confirmatory test Result for thermophilic Campylobacter
Morphology Small curved bacilli
Motility Characteristic (highly motile and cork­
screw like)
Oxidase + disks are used, follow the manufacturer’s instructions.
Micro-aerobic growth at 25 C
Aerobic growth at 41.5 C
Key: + = positive; - = negative
Microscopic examination of morphology and motility.
Freshly grown material from a suspect colony is suspended in saline
and evaluated, preferably by a phase-contrast microscope, for
characteristic, spiral or curved slender rods with a corkscrew-like
motility. Older cultures show less motile coccoid forms.
Detection of oxidase. Take material from a suspect colony and
place it on to a filter paper moistened with oxidase reagent. The
appearance of a violet or deep blue colour within 10 sec is a
positive reaction. If a commercially available oxidase test kit is
used, follow the manufacturer’s instructions.
Microaerobic growth at 25 C. Inoculate the pure culture onto a
non-selective blood agar plate and incubate at 25 C in a
microaerobic atmosphere for 48 hr. Examine the plate for visible
growth of Campylobacter.
Aerobic growth at 41.5 C. Inoculate the pure culture onto a non-
selective blood agar plate and incubate at 41.5 C in an aerobic
atmosphere for 48 hr. Examine the plate for visible growth of
Campylobacter.
Latex agglutination tests. In addition to the described
confirmatory tests latex agglutination tests for confirmation of pure
29
Chapter 7 Campylobacter Infections in Poultry
cultures of C. jejuni/C. coli (often also including C. lari) are
commercially available.
Identification of Campylobacter to the species level. When
incubation takes place at 42 C, the most frequently encountered
species from poultry samples are C. jejuni and C. coli. However,
low frequencies of other species have been described. Few
biochemical tests are available to discriminate between C. jejuni, C.
coli and C. lari. A positive hippurate test surely indicates C. jejuni
because this is the sole hippurate-positive species within the
Campylobacter genus, though some hippurate-negative C. jejuni
strains have been reported (27).
Table 7.2 gives some basic classical phenotypic characteristics of
the most important thermophilic Campylobacter species in poultry
(12). More extensive speciation schemes have been described in the
literature (20).
Table 7.2. Basic phenotypic characteristics of selected thermophilic
Campylobacter species.
Characteristics C. jejuni C. coli C. lari
Hydrolysis of hippurate + - -
Indoxyl acetate + + -
Key: + = positive; - = negative
Susceptibility testing to identify Campylobacter to the species
level formerly could be used to discriminate between nalidixic acid­
sensitive C. jejuni/C. coli and nalidixic acid- resistant C. lari. Due
to the frequently acquired resistance In C. jejuni/C. coli and the
identification of nalidixic acid-susceptible C. lari strains, this
identification method nowadays is obsolete. Biochemical speciation
may be supplemented or even replaced with molecular methods.
Speciation results always should be confirmed using defined
positive and negative controls.
Detection of hippurate hydrolysis. Suspend a loopful of growth
from a suspect colony in 400 μΐ of a 1% sodium hippurate solution
(care should be taken not to incorporate agar). Incubate at 37 C for
2 hr, then slowly add 200 μΐ 3.5% ninhydrin solution to the side of
the tube to form an overlay. Reincubate at 37 C for 10 min, and read
the reaction. Positive reaction: dark purple/blue. Negative reaction:
clear or grey. If commercially available hippurate hydrolysis test
Detection of indoxyl acetate hydrolysis. Place a suspect colony
on an indoxyl acetate disk and add a drop of sterile distilled water.
If indoxyl acetate is hydrolysed a color change to dark blue occurs
within 5-10 min. No color change indicates hydrolysis has not
taken place. If commercially available indoxyl acetate hydrolysis
test disks are used, follow the manufacturer’s instructions.
Molecular Detection and Identification of Campylobacter
PCR-based methods for the detection of Campylobacter in animal
fecal samples and enriched meat samples have been previously
described in the literature (16, 19). One of these assays is in use in
Denmark for routine screening of cloacal swabs from broilers at the
slaughterhouse (3, 16).
A variety of DNA probes and polymerase chain reaction (PCR)-
based identification assays have been described for Campylobacter
species. On et al. evaluated the specificity of 11 PCR-based
identification assays for C. jejuni and C. coli (21).
Typing
For several foodbome pathogens like Salmonella serotyping and
phage typing of isolates are important tools to trace infections and
to perform epidemiological studies. Many typing methods for
Campylobacter have been described, both phenotypic (serotyping
and phage typing) and molecular based (33). For outbreak
investigations any typing method will be suitable. It has to be
noticed that for Campylobacter the current typing methods can only
Jaap A Wagenaar and Wilma F. Jacobs-Reitsma

be used for tracing infections restricted in time and geographical isolation of Campylobacter organisms from feces. J. Clin. Microbiol.
area. Although further typing of strains is often requested for 23:456-459. 1986.
epidemiological reasons, the biology of Campylobacter (natural 15. Luechtefeld, N.W., W.L. Wang, MJ. Blaser, and L.B. Reller.
Evaluation of transport and storage techniques for isolation of
competent species with DNA-uptake) hampers the use of large-
Campylobacter fetus subsp. jejuni from turkey cecal specimens. J. Clin.
scale typing in Campylobacter epidemiology. Microbiol. 13:438-443. 1981.
16. Lund, M, A. Wedderkopp, M Waino, S. Nordentoft, D.D. Bang, K.
SEROLOGIC DETECTION IN THE HOST Pedersen, and M Madsen. Evaluation of PCR for detection of
Campylobacter in a national broiler surveillance programme in Denmark. J.
Although intestinal Campylobacter colonisation of poultry is Appl. Microbiol. 94:929-935. 2003.
associated with circulating and mucosal antibody responses, no 17. Martin, K.W., K.L. Mattick, M Harrison, and T.J. Humphrey.
validated serological tests are commonly used for detection of Evaluation of selective media for Campylobacter isolation when
cycloheximide is replaced with amphotericin B. Lett. Appl. Microbiol.
infected birds.
34:124-129. 2002.
18. Newell, D.G., and J. A. Wagenaar. Poultry infections and their control at
REFERENCES
the farm level. In: Campylobacter, Second Edition. I. Nachamkin, and MJ.
Blaser, eds. ASM Press, Washington DC, USA. pp. 497-509. 2000.
1. Adkin, A, E. Hartnett, L. Jordan, D. Newell, and H. Davison. Use of a
19. Olsen, J.E., S. Abo, W. Hill, S. Notermans, K. Wemars, P.E. Granum,
systematic review to assist the development of Campylobacter control
T. Popvic, H.N. Rasmussen, and O. Olsvik. Probes and polymerase chain
strategies in broilers. J. Appl. Microbiol. 100:306-315. 2006.
reaction for the detection of food-borne bacterial pathogens. Int. J. Food
2. Aspinall, S.T., D.R.A. Wareing, P.G. Hayward, and D.N. Hutchinson.
Microbiol. 28:1-78. 1995.
Selective medium for thermophilic Campylobacters including
20. On, S.L.W. Identification methods for Campylobacters, Helicobacters,
Campylobacter upsaliensis. J. Clin. Pathol. 46:82^-831. 1993.
and Related organisms. Clin. Microbiol. Rev. 9:405-422. 1996.
3. Bang, D.D., K. Pedersen, and M Madsen. Development of a PCR assay
21. On, S.L.W., and P.J. Jordan. Evaluation of 11 PCR assays for species­
suitable for Campylobacter spp. mass screening programs in broiler
level identification of Campylobacter jejuni and Campylobacter coli. J. Clin.
production. J. Rapid Meth. Automat. Microbiol. 9:97-113. 2001.
Microbiol. 41:330-336. 2003.
4. Bolton, F.J., and L. Robertson. A selective medium for isolating
22. Reller, L.B., S. Merritt, and L. G. Reimer. Controlled evaluation of an
Campylobacter jejuni/coli. J. Clin. Pathol. 35:462-467. 1982.
improved selective medium for isolation of Campylobacter jejuni from
5. Bolton, F.J., D.N. Hutchinson, and D. Coates. Blood-free selective
human faeces. Abstr. C274 ASM Annual Meeting, p 357. 1983.
medium for isolation of Campylobacter jejuni from faeces. J. Clin.
23. Sjogren, E., G.B. Lindblom, and B. Kaijser. Comparison of different
Microbiol. 19:169-171. 1984.
procedures, transport media, and enrichment media for isolation of
6. Bolton, F.J., D.N. Hutchinson, and G. Parker. Reassessment of selective
Campylobacter species from healthy laying hens and humans with diarrhea.
agars and filtration techniques for isolation of Campylobacter species from
J. Clin. Microbiol. 25:1966-1968. 1987.
faeces. Eur. J. Clin. Microbiol. Infect. Dis. 7:155-160. 1988.
24. Skirrow, MB. Campylobacter enteritis: a new disease. Brit. Med. J.
7. Burch, D. Avian vibrionic hepatitis in laying hens. Vet. Rec. 157:528.
2:9-11. 1977.
2005.
25. Skirrow, MB., and MJ. Blaser. Clinical aspects of Campylobacter
8. Corry, J.E.L., H.I. Atabay, S.J. Forsythe, and L.P. Mansfield Culture
infection. In: Campylobacter, Second Edition. I. Nachamkin, and MJ.
media for the isolation of Campylobacters, helicobacters and arcobacters. In:
Blaser, eds. ASM Press, Washington DC, USA. pp. 69-88. 2000.
Handbook of Culture Media for Food Microbiology, Second Edition. J.E.L.
26. Steele, T.W., and S.N. McDermott. The use of membrane filters applied
Corry, G.D.W. Curtis, and R.M Baird, eds. Elsevier, Amsterdam, The
directly to the surface of agar plates for the isolation of Campylobacter
Netherlands, pp. 271-315. 2003.
jejuni from feces. Pathology 16:263-265. 1984.
9. Corry, J.E.L., D.E. Post, P. Colin, and MJ. Laisney. Culture media for
27. Steinhauserova, I., J. Ceskova, K. Fojtikova, and I. Obrovska.
the isolation of Campylobacters. Int. J. Food Microbiol., 26:43-76. 1995.
Identification of thermophilic Campylobacter spp. by phenotypic and
10. Friedman, C.R., J. Neimann, H.C. Wegener, and R.V. Tauxe R.V.
molecular methods. J. Appl. Microbiol. 90:470-475. 2001.
Epidemiology of Campylobacter jejuni infections in the United States and
28. Stephens, C.P., S.L. On, and J.A. Gibson. An outbreak of infectious
other industrialized nations. In: Campylobacter, Second Edition. I.
hepatitis in commercially reared ostriches associated with Campylobacter
Nachamkin, and MJ. Blaser, eds. ASM Press, Washington DC, USA pp.
coli and Campylobacter jejuni. Vet. Microbiol. 61:183-190. 1998.
121-138. 2000.
29. Stem, N. J., B. Wojton, and K. Kwiatek. A differential-selective
11. Hutchinson, D.N., and F.J. Bolton. Improved blood-free selective
medium and dry ice-generated atmosphere for recovery of Campylobacter
medium for the isolation of Campylobacter jejuni from faecal specimen. J.
jejuni. J. FoodProt. 55:515-517. 1992.
dim Pathol. 37:956-957. 1984.
30. Tauxe, R.V. Emerging food home pathogens. Int. J. Food Microbiol.
12. ISO 10272-1:2006(E) and ISO/TS 10272-2:2006(E). Microbiology of
78:3141. 2002.
food and animal feeding stuffs - Horizontal method for the detection and
31. Van Gerwe, T.J.W.M, A. Bouma, W.F. Jacobs-Reitsma, J. van den
enumeration of Campylobacter spp. Part 1: Detection method, Part 2:
Broek, D. Klinkenberg, J.A. Stegeman, and J.A.P. Heesterbeek. Quantifying
Colony-count technique. International Organization for Standardization
transmission of Campylobacter spp. among broilers. Appl. Environm.
(ISO), ISO Central Secretariat, 1 rue de Varembe, Case Postale 56, CH -
Microbiol. 71:5765-5770. 2005.
1211, Geneva 20, Switzerland, www.iso.org.
32. Waldenstrom, J., T. Broman, I. Carlsson, D. Hasselquist, R.P.
13. Jacobs-Reitsma, W.F. Campylobacter in the food supply. In:
Achterberg, J.AWagenaar, and B. Olsen. Prevalence of Campylobacter
Campylobacter, Second Edition. I. Nachamkin, and MJ. Blaser, eds. ASM
jejuni, C. lari, and C. coli in different ecological guilds and taxa of
Press, Washington DC, USA. pp. 467-481. 2000.
migrating birds. Appl. Environ. Microbiol. 68:5911-5917. 2002.
14. Karmali, MA, A.E. Simor, M Roscoe, P.C. Fleming, S.S. Smith, and
33. Wassenaar, T.M, and D.G. Newell. Genotyping of Campylobacter spp.
J. Lane. Evaluation of a blood-free, charcoal-based, selective medium for the
Appl. Environ. Microbiol. 66:1-9. 2000.

30
 8
SPIROCHETOSIS
Stephen R. Collett

SUMMARY. Spirochete infections of birds are caused by helical-shaped bacteria of the order Spirochaetales, family Spirochaetaceae. Two
distinct syndromes exist because of differences in spirochete colonization, pathogenesis, and lesion production- nonrelapsing, tickbome,
acute septicemic borreliosis caused by Borrelia anserina, and subacute-to-chronic intestinal disorders of varying severity caused by a diverse
group of spirochetes.

SEPTICEMIC BORRELIOSIS

Soft ticks in the genus Argas are the reservoir and transmit B. anserina to poultry and free-living avian species. Transmission is through
ingestion of ticks or penetration through mucous membranes or skin and results in septicemia. Strains of B. anserina vary in virulence.
Infection may result in a mild illness or one characterized by mortality approaching 100%. Clinical signs are not specific, but finding larval
ticks on the bird or nymph and adult ticks in the bird’s environment, or presence of pinpoint, cutaneous hemorrhages, especially on the
shanks, where ticks have been feeding, associated with an ill bird increase the likelihood of the disease. Diagnosis is based on identifying the
organism or its antigen in affected birds or finding antibodies in unvaccinated, recovered birds.
Agent Identification. When clinical signs are present, slender, spiral organisms usually can be identified in stained or wet smears of blood
or bufiy coat cells. Darkfield microscopy of bufiy coat smears is especially useful. Spirochetal antigens can be demonstrated by serologic
methods in spleen and liver for several days after organisms disappear from the circulation. Borrelia anserina cannot be grown in
conventional media, but can be isolated by subinoculation of blood into young birds or in chick embryos via yolk-sac inoculation.
Serologic Detection in the Host. Several serologic tests have been developed in areas where the disease is prevalent, but none has been
adopted for widespread use. Serology has proved useful in distinguishing antibodies of B. burgdorferi, which can also infect birds, from
those of B. anserina, and for differentiation of serotypes.

INTESTINAL SPIROCHETOSIS

Spirochetes can be part of the normal large-intestinal flora in many avian species. In other birds, spirochete infection of the large intestine
results in avian intestinal spirochetosis (AIS). Three clinical entities have been described in field cases or experimental studies associated
with intestinal spirochete infection-subclinical infections, mild-to-moderate enteric disease, and severe enteric disease.
Agent Identification. A presumptive diagnosis of AIS is made if clinical signs and lesions of large intestinal disease are present and
spirochetes are visualized in cecal droppings, cecal tissue, or fecal specimens by dark-field, light, or immunofluorescent microscopy.
Isolation of spirochetes on antibiotic-containing agar plates under anaerobic conditions is needed for confirmation. Taxonomic classification
requires biochemical and/or molecular characterization.
Serologic Detection in the Host. Serologic detection is of limited value because of poor sensitivity and specificity of currently available-
methods. Serology will not differentiate infections of non-pathogenic from pathogenic intestinal spirochetes.

SEPTICEMIC BORRELIOSIS

INTRODUCTION it causes significant economic losses. It has occasionally been

Avian septicemic borreliosis (spirochetosis) is a tickbome,
nonrelapsing septicemia of chickens, turkeys, geese, ducks, and a
number of nondomesticated avian species caused by the spirochete
Borrelia anserina. The disease was first identified in affected geese
in Russia in 1891 (3).
Certain species of soft ticks in the genus Argas, including Argas
persicus, A. sanchezi, and A. arboreus, serve as reservoirs and
vectors of the organism. Infection of avian species is not essential
for survival of the organism; transovarial and transstadial
transmission within the tick ensure the continuing survival of
B. anserina (40). Horizontal infection can occur by cannibalism,
accidental transfer of contaminated blood or infective excreta to
susceptible birds, mechanically via other biting arthropods, or by
ingestion of organisms in carcasses or secretions from infected birds
or infected ticks (21). Virulent strains can cause infection by direct
penetration of intact mucous membranes, including conjunctiva,
and skin (18). Recovered birds are not carriers, but may have a
prolonged period of poor growth and production and persistent
neurologic signs. Relapses do not occur (10).
Occurrence of spirochetosis coincides with distribution of tick
vectors and a seasonal pattern often occurs that is related to tick
activity. The disease is endemic in most tropical, subtropical, and
warm temperate areas, particularly arid and semiarid regions, where
31
identified in the southwestern United States (7). Free-ranging
poultry are more commonly affected, although introduction into
intensively reared commercial flocks can result in high losses.
Indigenous breeds of chickens are generally more resistant than
imported breeds (19). Where the disease is endemic, exposure erf
young chicks to infective ticks while the chicks still have high
maternal antibodies results in mild or nonclinical infections and
subsequent resistance, which is maintained by continued,
intermittent exposure. Clinical disease occurs when susceptible
populations are placed in contact with infective ticks through
introduction of birds into flocks or environments where ticks are
present or birds parasitized by larval ticks are placed into
susceptible flocks (21,29).
CLINICAL DISEASE
Infection ranges from inapparent to very severe depending on
degree and type of exposure and virulence of the strain <rf
spirochete infecting the bird. Strains causing outbreaks in the
United States are usually of intermediate to low virulence (7). Onset
of clinical signs generally occurs 3-12 days after exposure to
infective ticks, although it may be shorter following experimental
inoculation (19,21).
Clinical signs are not specific for spirochetosis. Affected birds «
inactive, cyanotic, anorexic, dehydrated, experience rapid weight
Stephen R. Collett
loss, have fluid to mucoid green fecal droppings containing excess
bile and white to pale yellow urates, and are usually febrile. Birds
may show nervous signs, become comatose, and have subnormal
body temperatures prior to death. Recovered birds often have a
prolonged convalescent period and residual weakness or paralysis
of one or both wings and/or legs (21,26,29).
Nonhemolytic anemia in affected birds results from
erythrophagocytosis causing decreased total erythrocytes,
hemoglobin, and packed cell volumes. Anemia is most severe after
organisms disappear from the blood. Other hematologic changes
include leucocytosis, primarily resulting from increased
mononuclear cells, granulocytopenia, and prolonged blood clotting
(31,32).
Enlargement of the spleen with a prominent mottled appearance is
characteristic of spirochetosis. Mottling is caused by hyperplasia
and/or fibrinoid necrosis of mononuclear phagocytes surrounding
sheathed capillaries. Liver enlargement, occasionally with pale or
red foci, and renal swelling and pallor are also typical lesions of
spirochetosis. Pale and red foci in the liver result from necrosis and
hemorrhage, respectively (2,26). Extensive muscle necrosis and
hemorrhage occurred in infected pheasants (23). Serositis, which is
typical of most other bacterial septicemias, is not a finding in
spirochetosis, although mild pericarditis can infrequently be seen.
Lesions are less evident or may be absent when infection results
from strains of low virulence (7,9).
SAMPLE COLLECTION
Spirochetes are usually present in the blood during the febrile
period but may be too few to detect very early in the disease and
rapidly disappear following recovery (11,15,26). If death occurs
prior to their disappearance, spirochetes can be easily identified in
wet smears of clotted blood for several days, especially if carcasses
have been refrigerated (26). Stained smears of decomposed tissues
are generally unsatisfactory due to background staining.
Subinoculation of blood or tissues from dead birds may or may not
result in infection as organisms identified in wet smears may be
nonviable. Spirochetal antigen can be demonstrated in tissues,
especially spleen and liver, by agar-gel immunodiffusion (AGID)
for several days after spirochetes are no longer present in the
circulation (1). Mucoid droppings passed by affected birds contain
spirochetes and are infective when fed to susceptible chicks or
poults (23,26).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Borrelia anserina cannot be cultured using routine bacteriologic
media or techniques. The organism has been grown in Barbour-
Stoenner-Kelly medium, but lost virulence after 12 passages (22).
Subinoculation of blood or tissues into susceptible young chicks or
poults, with daily examination of blood for 10-14 days
postinoculation is the best method for isolating the spirochete.
Inoculation of susceptible 1-day-old chicks or embryos after 18
days of incubation will result in birds with prolonged, high
spirochetemia persisting for as long as 21 days with spirochetes
comprising as much as 4% of total blood volume. The organism is
also readily isolated by yolk-sac inoculation of chicken or turkey
embryos (24). Embryo mortality generally occurs 4-7 days
postinoculation; if not, viable embryos should be checked on the
sixth day following inoculation. Spirochetes are present in high
numbers in tissues, blood, and blood-contaminated embryonic
fluids. Mammals are resistant to infection.
Strains can be maintained in infective blood stored at -70 C (an
equal volume of dimethylsulfoxide can be added to assist in
cryoprotection), in infected ticks, or by weekly transfer of blood
into 1-day-old chicks. Frozen blood can be stored in capillary tubes,
which can be used to puncture the skin and expose the bird by
32
expressing the tube's contents subcutaneously. Weekly transfer of
virulent strains is easily accomplished by clipping a toenail of an
infected chick short enough to obtain a drop of blood and then
instilling the drop into the eye of a 1-day-old chick to be exposed-
Use of 1-day-old chicks will ensure that spirochetemia is still
present at 7 days postinoculation.
AGENT IDENTIFICATION
Finding B. anserina in blood or tissues from ill birds is diagnostic
of septicemic borreliosis. The organism is usually readily identified
in dried or wet blood smears. On stained smears it is a long, slender,
helical bacterium, usually with 5-8 spirals, that measures 6-30 x
0.3 pm. Borrelia anserina stains blue to purple with dyes used
routinely for hematology (5). It can also be stained with most other
dyes used for demonstrating bacteria although the Gram-stain
procedure is generally not used because of considerable background
staining of the blood. Stained blood films can be held for later
examination, provide a permanent record, and do not require special
microscopic equipment.
Spirochetes are also readily identified in wet smears by dark-field,
phase-contrast, or interference-contrast microscopy. Wet smears are
preferred for identifying low numbers of organisms as may occur in
the early or late stages of the disease or when infections are caused
by low-virulent strains, and for demonstrating spirochetes in
decomposed tissues or ticks. Care needs to be taken to differentiate
pseudospirochetes from spirochetes when examining wet smears.
Spirochetes have a definite, uniform, spiral (wavy) appearance, are
highly motile and show directed, purposeful movement when
viable, and may or may not adhere to blood cells.
Pseudospirochetes, which are most likely extrusions from
degenerating erythrocytes, are slender but do not have a spiral
shape, are of variable lengths and morphology, tend to alter in shape
as they float in the medium, frequently have a small terminal hook
or mass, have no purposeful movement, and are frequently attached
to blood cells (14).
Spirochetes in blood can be concentrated in the buffy coat by
centrifugation (13). A convenient method of demonstrating
spirochetes is to centrifuge blood in a microhematocrit tube, score
the tube with a diamond-tipped pen at the interface of the packed
erythrocytes and buffy coat, break the tube, and express the buffy
coat and plasma onto a microscopic slide. Place a cover slip on the
sample and gently press it to spread the buffy coat into an even
circle. Allow the wet smear to sit for approximately 5 min and then
examine the margin of the buffy coat for spirochetes that have
emerged into the plasma. Samples can be quickly and efficiently
evaluated with this technique.
In histopathologic sections, spirochetes can be demonstrated by a
number of silver impregnation procedures (7,21).
On electron microscopy, borreliae have 15-22 periplasmic flagella
subterminally that overlap centrally so that 30-44 flagella are
present in the middle of the spirochete (5).
SEROLOGIC DETECTION IN THE HOST
Several serologic tests including agglutination, immobilization,
precipitin, and fluorescent antibody procedures (27) been developed
and used in areas where spirochetosis is prevalent to detect
antibodies in serum and egg yolk (3). Spirochetal antigens can be
detected in organs, especially liver and spleen, after organisms have
disappeared from the blood by immunodiffusion or
immunofluorescence (2). Serology has also been used to determine
that there are different antigenic strains of B. anserina (8,20,38).

DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Spirochetosis must be differentiated from other types of
septicemia. Negative bacteriologic cultures will rule out
colibacillosis, pasteurellosis, and other less common systemic
bacterial diseases. Absence of serositis (except for occasional mild
pericarditis) will usually distinguish spirochetosis from
chlamydiosis. Splenomegaly occurring in spirochetosis, although
not a constant finding when birds are infected with low-virulent
strains of B. anserina, must be distinguished from splenomegaly
INTESTINAL SPIROCHETES
INTRODUCTION
Intestinal spirochetes are a heterogenous group of spiral bacteria
that colonize the large intestine of a variety of mammalian and
avian hosts including swine, humans, and domestic poultry (36,37).
Such colonization may be part of the normal intestinal flora, or can
be associated with or be the cause of clinical disease. Avian
intestinal spirochetes are related to but distinct from B. anserina, the
spirochetal etiology of nonrelapsing tickbome acute septicemic
borreliosis.
Spirochetes isolated from intestinal tracts of birds include
Brachyspira (Serpulina) hyodysenteriae, B .innocens, B. pilosicoli
B. intermedia, B. alvinipulli and B. murdochii. However, most
avian intestinal spirochetes are unclassified.
CLINICAL DISEASE
Avian intestinal spirochetosis (AIS) is a subacute to chronic,
nonsepticemic, intestinal disorder characterized by spirochetes in
the cecum and/or rectum, and variable clinical illness, morbidity,
and mortality. Three clinical entities exist - subclinical infections,
mild to moderate disease, and severe disease. In the first of these
clinical entities, spirochetes identified in ceca of most wild and
many domestic birds are not associated with clinical disease and are
considered to be nonpathogenic (35). In the second clinical form,
AIS in domestic poultry presents with diarrhea, pasty vents, wet
feces containing increased crude fat, retarded growth rates, delayed
onset of laying, production of fecal-stained eggshells, and frothy,
yellow to brown fluid in dilated ceca (36,37). Daily mortality rates
are normal or minimally increased. In the third clinical entity, AIS
in juvenile common rheas presents with necrotizing typhlitis and
mortality rates up to 80% (4,23). Some birds show depression, have
reduced body weights, and pass watery feces with caseous cores 1-
2 days before death (37). However, production of AIS in rheas may
require synergism between spirochetes and indigenous, anaerobic
bacilli of the ceca.
SAMPLE COLLECTION
Colonization is most frequent in the cecum and rectum,
occasionally extending into the ileum (37). Spirochetes primarily
colonize the ciypt lumina, and to a lesser extent the intestinal
contents adjacent to villous epithelium.
Fresh cecal droppings or cecal mucosa are optimal specimens for
isolation or direct demonstration of intestinal spirochetes. Samples
chilled at 4 C for up to 1 wk are acceptable, but frozen samples,
especially those stored at -20 C, will have low success rates for
primary isolation. For live birds, use of noninvasive sampling such
as cloacal swabs or feces are practical alternatives for spirochete
33
Chapter 8 Spirochetosis
resulting from Marek’s disease, leukosis, and type Π adenovirus
infection. Lesions characteristic of Marek's disease and leukosis
should be present in other tissues and typical intranuclear inclusions
and/or antigen can usually be demonstrated when splenomegaly
results from type Π adenovirus infection.
Borrelia burgdorferi will infect birds but does not cause clinical
illness. Spirochetemia may or may not be present but would
probably be low making it unlikely that organisms would be found
in blood smears. Specific antigens and antibodies can be used to
differentiate B. anserina from B. burgdorferi infections (12,39).
isolation, but success of isolation is lower than for cultures of cecal
mucosa.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Avian intestinal spirochetes are anaerobic (36,37). Primary
isolation has been accomplished on various solid media systems
used originally to isolate swine intestinal spirochetes. Typically,
these systems contain a blood agar base, such as trypticase-soy agar
with 5-10% sheep blood, and one to five selective antibiotics (i.e.,
400 pg/ml spectinomycin, 6.25 pg/ml rifampin, 25 pg/ml
spiramycin, 12.5 pg/ml vancomycin, or 12.5 pg/ml colistin) to
inhibit indigenous anaerobic intestinal microflora (4). An anaerobic
atmosphere such as 94% N2/6% CO2 provides a good environment
for primary isolation, but the addition of 1% O2 enhances growth of
some isolates. Incubation is at 37-42 C for a minimum of 10 days;
however growth usually occurs within 2-5 days.
AGENT IDENTIFICATION
Visual demonstration of helical-shaped bacteria in feces or cecal
droppings by dark-field or light microscopy is sufficient for
tentative identification of spirochetes. Confirmation of helical­
shaped bacteria as spirochetes requires visualization of distinctive
ultrastructural features, demonstration of spirochete antigens
(immunofluorescent microscopy), or isolation in culture. However,
ultrastructural morphology or antigen demonstration will not
distinguish between spirochete groups or species. Culturing with
further biochemical or molecular characterization is necessary for
categorization or taxonomic classification. In addition, because
spirochetes can be normal flora or produce subclinical infections,
characteristic clinical signs and lesions must be present to
distinguish spirochetes of normal flora from those of AIS.
Cell Morphology and Staining
Spirochetes are gram-negative, helical-shaped bacteria (6). Avian
intestinal spirochetes are readily identified by the characteristic
corkscrew type of motility in wet mounts of cecal contents using
dark-field microscopy. Spirochete cells are easily visualized in
impression smears or tissue sections of cecal mucosa. Spirochetes
are dark brown to black using silver-stain techniques and blue using
Wright-Giemsa stains.
On electron microscopy, each spirochete cell contains a central
protoplasmic cylinder, two sets of endocellular periplasmic flagella
(axial filaments), and an outer envelope (outer sheath) (6).
Visualization of periplasmic flagella is diagnostic of spirochetes.
Individual cells have lengths of 7-19 pm, diameters of 0.25-0.6
pm, amplitudes of 0.45-0.79 pm, and wavelengths of 2.7-3.7 pm
(37).
Stephen R Collett

Table 8.1. Multilocus enzyme electrophoresis (MEE), phenotypic, and biochemical characteristics of avian intestinal spirochetes
(16,25,33,34,36).

Taxonomic classification

Brachyspiraa Brachispira Brachyspira. Unnamed Brachispira Brachyspira Brachyspira

hyodysenteriae intermedia innocens alvinipulli murdochii pilosicoli

Host species Common rhea Chicken Chicken Chicken Chicken Chicken Chicken,
(Rhea waterfowl
americana)

Pathogenicity Severe Moderate None Unknown Mild Unknown Mild

MEE profile A b c d e F g

Periplasmic 8:16:8 8:16:8 8:16:8 8:16:8 8:16:8 8:16:8 5:10:5

flagellar ratios

β-Hemolysis Strong Variable Weak Weak Weak Weak Weak

Indole + + + - - - -

API ZYM profile 14.0.13.11.1

10.0.4.10.1
14.0.15.11.1 14.0.12.3.0
14.0.4.2.1 14.0.12.7.1
14.0.4.10.1 14.0.12.3.0 14.0.12.3.1 14.0.4.3.1 14.0.4.3.0
14.0.12.10.1 6.0.12.6.1
14.0.13.3.1 14.0.13.11.8
10.0.13.10.1
14.0.13.15.1

Colony Morphology
Because of the vigorous motility, spirochetes spread rapidly over
agar plates and do not form discrete colonies. With some isolates,
growth is detectible by hemolysis of the blood agar. However, with
nonhemolytic or slow-growing weakly β-hemolytic spirochetes,
areas of growth are evident as a dull sheen on the agar surface.
Bacterial growth on plates should be confirmed as spirochetes by
characteristic motility on wet mounts using dark-field microscopy
or spiral morphology as visualized in Wright-Giemsa or Gram-
stained smears.
Isolated bacteria can be verified as spirochetes by transmission
electron microscopy. However, demonstration of spirochete
antigens by direct or indirect fluorescent (27) or
immunohistochemical methods is easier and more rapid than
electron microscopy. Categorization or taxonomic classification
requires additional testing such as serotyping, growth-inhibition
testings, biochemical differentiation profiling, rRNA restriction
pattern analysis, or multilocus enzyme electrophoresis (MEE)
(17,36,37).
Biochemical Properties
Avian intestinal spirochetes contain alkaline and acid
phosphatases, esterase, esterase lipase, β-galactosidase, and
phosphorylase (34). Differences in hemolysis patterns, indole
production, and the presence or absence of α-galactosidase and a-
glucosidase activities have been used to categorize avian and
mammalian intestinal spirochete isolates and to predict the potential
for causing disease (Table 8.1). Use of an API ZYM® (bioMerieux-
Vitek, Hazelwood, Mo.) biochemical coding system and MEE have
been useful in characterizing avian and mammalian isolates
(17,25,34).
PCR Assay
Phillips et al. (28) recently reported a two-step nested duplex PCR
(2S-N-D-PCR) assay for detection of the two most commonly
reported species in chicken (B. pilosicoli and B. intermedia). When
performed on fecal samples this 2S-N-D-PCR assay has a detection
34
threshold of ~ 103 cells/g feces making it more sensitive and rapid
(1 day vs. 7-10 days) than the traditional culture/PCR techniques.
SEROLOGIC DETECTION IN THE HOST
Serologic tests have been used to survey avian species and swine
to determine exposure to intestinal spirochetes (35,37). The tests are
not based on species-specific antigens, have low specificity and
sensitivity, and do not distinguish between infections of
nonpathogenic and pathogenic spirochetes. AGID provides a single
test method to screen birds from diversely different orders and
families for spirochete infections (35).
Agar gel immunodiffusion plates (0.6% agar, 0.6% agarose, 7%
NaCl, 3% polyethylene glycol, and 0.05 mg/ml sodium azide) have
spirochete antigen placed into the center well and two-fold dilutions
of unknown, nonhemolyzed sera in surrounding wells (35). Plates
are incubated at 20 C and read on day 3. Positive and negative
control sera should be included in each test run. The spirochete test
antigen is derived by washing known spirochete cells from culture
plates (brain-heart infusion agar plates with 10% fetal calf serum)
with 0.9% phosphate- buffered saline (PBS), centrifugation twice to
pellet, final resuspension in 2% sodium dodecyl sulfate in PBS,
sonication for 30 sec at 4 C, and heating at 60 C for 30 min.
Other tests for antispirochete antibody detection include enzyme-
linked immunosorbent assay, plate and microagglutination tests,
passive hemolysis assay, and indirect fluorescent antibody test (36).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
In poultry, spirochetes identified in fecal specimens should be
distinguished from other spiral bacteria including Campylobacter,
Arcobacter, Helicobacter, and Spirillum (36). Many spiral bacteria
can be nonpathogenic indigenous flora of gastrointestinal tracts of
birds. In cases of chronic diarrhea or pasty vents nutritional
problems such as excess dietary salt or fats should be investigated.
Other causes of chronic diarrhea include enteric salmonellosis,
colibacillosis, and coccidiosis.

In rheas, intestinal spirochetes as the cause of necrotizing typhlitis
must be distinguished from other potential causes including group B
Salmonella, Clostridium perfringens, C. sordelli, and Histomonas
meleagridis (36). Furthermore, the gross cecal lesions of eastern
equine encephalitis virus (EEEV) infection can be confused with
AIS, but EEEV also produces hemorrhage in the small intestine and
widespread petechiation and necrosis in visceral organs.
REFERENCES
1. Al-Attar, M A., and F. M. Jahanly. Demonstration by immunodiffusion
agar-gel test of Borrelia anserina antigens in the organs of infected chickens.
Avian Dis. 18:463^166. 1974.
2. Bandopadhyay, A. C., and J. L. Vegad. Observations on the pathology of
experimental avian spirochaetosis. Res. Vet. Sci. 35:138-144. 1983.
3. Bames, H. J. Spirochetosis (borreliosis). In: Diseases of Poultry, 10th ed.
B. W. Calnek, H. J. Bames, C. W. Beard, L. R. McDougald, and Y. M Saif,
eds. Iowa State University Press, Ames, Iowa. pp. 318-324. 1997.
4. Buckles, E. L., K. A. Eaton, and D. E. Swayne. Cases of
spirochete_associated necrotizing typhlitis in captive common rheas (Rhea
americana). Avian Dis. 41:144-148. 1997.
5. Burgdorfer, W., and T. G. Schwan. Borrelia. In: Manual of clinical
microbiology, 5th ed. A. Balows, W. J. Hausler, Jr., K. L. Herrmann, H. D.
Isenberg, and H. J. Shadomy, eds. American Society of Microbiologists,
Washington, D.C. pp. 560-566. 1991.
6. Canale Parola, E. Order I. Spirochaetales Buchanan 1917, 163. In:
Bergey's manual of systematic bacteriology, vol. 1. N. R. Krieg, ed.
Williams and Wilkins, Baltimore, Md. pp. 38 70. 1984.
7. Cooper, G. L., and A A Bickford. Spirochetosis in California game
chickens. Avian Dis. 37:1167-1171.1993.
8. DaMassa, A. J., and Η. E. Adler. Avian spirochetosis: natural
transmission by Argas (Persicargas) sanchezi (Ixodoidea:Argasidae) and
existence of different serologic and immunologic types of Borrelia anserina
in the United States. Am. J. Vet. Res. 40:154-157. 1978.
9. DaMassa, A. J., and Η. E. Adler. Avian spirochaetosis: enhanced
recognition of mild strains of Borrelia anserina with bursectomized and
dexamethasone-treated chickens. J. Comp. Pathol. 89:413-420. 1979.
10. Dickie, C. W., and J. Barrera. A study of the carrier state of avian
spirochetosis in the chicken. Avian Dis. 8:191-195. 1964.
11. Djankov, I., I. Soumrov, T. Lozeva, and P. Penev. Persistence and
excretion of Treponema anserinum (Sakharoff, 1891) in hens. Zentralbl.
Veterinaermed. ReiheB 17:544-548. 1970.
12. Fabbi, Μ, V. Sambri, A. Marangoni, S. Magnino, F. S. Basano, R.
Cevenini, and C. Genchi. Borrelia in pigeons: no serological evidence of
Borrelia burgdorferi infection. J. Vet. Med. Ser. B 42:503-507. 1995.
13. Goldschmid, J. M, and K. Mahomed. The use of the microhematocrit
technic for the recovery of Borrelia duttoni from the blood. Am. J. Clin.
Pathol. 58:165-169. 1972.
14. Greene, R. T., R. L. Walker, and C. E. Greene. Pseudospirochetes in
animal blood being cultured for Borrelia burgdorferi. J. Vet. Diagn. Invest.
3:350-352. 1991.
15. Gross, W. M., and M R. Ball. Use of fluorescein-labeled antibody to
study Borrelia anserina infection (avian spirochetosis) in the chicken. Am. J.
Vet. Res. 25:1734-1739. 1964.
16. Hampson, D. J., and T La. Reclassification of Serpulina intermedia and
Serpulina murdochii in the genus Brachyspira as Brachyspira intermedia
comb. nov. and Brachyspira murdochii comb. nov. Int. J. of Systematic
Evolutionary Microbiology 56,1009-1012. 2006
17. Hunter, D., and T. Wood An evaluation of the API ZYM system as a
means of classifying spirochaetes associated with swine dysentery. Vet. Rec.
104:383 384. 1979.
18. Kapur, H. R. Transmission of spirochaetosis through agents other than
Argas persicus. Indian J. Vet. Sci. Anim. Hush. 10:354-360. 1940.
Chapter 8 Spirochetosis
19. Khogali, A. R., and A.M Shomein. Studies on spirochaetosis in fowls
in the Sudan. I. Epizootiology and experimental transmission. Bull. Epizoot
Dis. Afr. 22:251-254. 1973.
20. Kligler, I. J., D. Hermoni, and M Perek. Studies on fowl spirochetosis.
Π. Presence of serologically differentiated types of spirochetes. J. Comp.
Pathol. Ther. 51:206-212. 1938.
21. Knowles, R., B. M Das Gupta, and B. C. Basu. Studies in avian
spirochaetosis. Indian Med. Res. Mem 22:1-113. 1932.
22. Levine, J. F., M J. Dykstra, W. L. Nicholson, R. L. Walker, and G.
Massey. Attenuation of Borrelia anserina by serial passage in liquid
medium. Res. Vet. Sci. 48:64-69. 1990.
23. Mathey, W. J., Jr., and P. J. Siddle. Spirochetosis in pheasants. J. Am.
Vet. Med Assoc. 126:123-126. 1955.
24. McKercher, D. G. The propagation of Borrelia anserina in embryonated
eggs employing the yolk sac technique. J. Bacteriol. 59:446-447. 1950.
25. McLaren, A. J., D. J. Trott, D. E. Swayne, S. L. Oxberry, and D. J.
Hampson. Genetic and phenotypic characterization of intestinal spirochetes
colonizing chickens, and allocation of known pathogenic isolates to three
distinct genetic groups. J. Clin. Microbiol. 35:412-417. 1997.
26. McNeil, E., W. R. Hinshaw, and R. E. Kissling. A study of Borrelia
anserina infection (spirochetosis) in turkeys. J. Bacteriol. 57:191-206. 1949.
27. Prudovsky, S., A. Hadani, M Rubina, and A. Skiair. The use of the
indirect fluorescent antibody technique in avian spirochaetosis. Avian
Pathol. 7:421-425. 1978.
28. Phillips, N. D., T. La, and D. J. Hampson. Development of a two-step
nested duplex PCR assay for the rapid detection of Brachyspira pilosicoli
and Brachyspira intermedia in chicken faeces. Veterinary Microbiology
116. 239-245. 2006.
29. Rao, S. B. V. Spirochaetosis in poultry. Research Series No. 18. ndian
Council of Agricultural Research, New Delhi, India. 1958.
30. Sagartz, J. E., D. E. Swayne, K. A. Eaton, J. R. Hayes, K. D. Amass, R.
Wack, and L. Kramer. Necrotizing typhlocolitis associated with a spirochete
in rheas (Rhea americana). Avian Dis. 36:282 289. 1992.
31. Soliman, Μ K., A. A. S. Ahmed, S. El Amrousi, and I. H. Moustafa.
Cytological and biochemical studies on the blood constituents of normal and
spirochete-infected chickens. Avian Dis. 10:394-400. 1966.
32. Soni, J. L., and A. G. Joshi. A note on strain variation in Akola and
Jabalpur strains of Borrelia anserina. Zentralbl. Veterinaermed. Reihe B
27:70-72. 1980.
33. Stanton, T. B., D. Postic, and N. S. Jensen. Serulina alvinipulli sp.
Nov., a new Serpulina species that is enteropathogenic for chickens. Int J.
of Systematic Bacteriology. 48, 669-676. 1998.
34. Stoutenburg, J. W. Studies of intestinal spirochetes in avian species.
MS. Thesis. Ohio State University, Columbus, Ohio. 1993.
35. Stoutenburg, J. W., D. E. Swayne, T. M Hoepf, R. Wack, and L.
Kramer. Frequency of intestinal spirochetes in avian species from a zoologic
collection and private rhea farms in Ohio. J. Zoo Wildl. Med. 26:272_278.
1995.
36. Swayne, D. E. Avian intestinal spirochetosis. In: Diseases of poultry,
10th ed. B. W. Calnek, H. J. Bames, C. W. Beard, L. R. McDougald, and Y.
M Saif, eds. Iowa State University Press, Ames, Iowa. pp. 325-332. 1997.
37. Swayne, D. E., and A J. McLaren. Avian intestinal spirochaetes and
avian intestinal spirochaetosis. In: Intestinal spirochaetes in domestic
animals and humans. D. J. Hampson and T. B. Stanton, eds. CAB
International, Wallingford, United Kingdom, pp. 267_300. 1997.
38. Verma, R. K., A. R. Muley, and K. N. P. Rao. Some observations on the
strain variation of Borrelia anserina. Indian Vet. J. 68:818-821. 1991.
39. Walker, R. L., R. T. Greene, W. L. Nicholson, and J. F. Levine. Shared
flagellar epitopes of Borrelia burgdorferi and Borrelia anserina. Vet
Microbiol. 19:361-371. 1989.
40. Zaher, M A., Z. R. Soliman, and F. M Diab. An experimental study of
Borrelia anserina in four species of Argas ticks. 2. Transstadial survival and
transovarial transmission. Z. Parasitenkd 53:213-223. 1977.
 9
ERYSIPELAS
George L. Cooper and Arthur A. Bickford

SUMMARY. Erysipelothrix rhusiopathaiae, the causal agent of erysipelas, is one of two species of bacteria included in the genus
Erysipelothrix (Erysipelothrix tonsillarum is a recent addition).
Agent Identification. The organism can be cultured directly onto blood agar plates, on selective media such as Packer’s, or in
Erysipelothrix selective broth. Cultures should be incubated at 37 C in 5%-10% CO2 Presumptive identification of the bacterium is based on
morphologic and Gram-staining characteristics, and on the ability of the organism to produce H2S in triple sugar iron agar. Definitive
identification requires further biochemical characterization or animal inoculation. Twenty-two serovars of E. rhusiopathiae have been
identified on the basis of heat-stable somatic antigens. Most isolates are serovar 1 or 2, however, pathogenicity and immunogenicity are
apparently not associated with serotype. Multilocus enzyme electrophoresis (MLEE) and ribotyping methods have been used to characterize
different strains of E. rhusiopathiae. A PCR amplification system has been developed for the rapid identification of E. rhusiopathiae DNA
in tissues.
Serologic Detection in the Host. Host serology is not useful for diagnosis of erysipelas.

INTRODUCTION
Erysipelas is an acute septicemic disease that occurs worldwide in
turkeys, chickens, waterfowl, numerous additional avian species,
and in mammals, including humans. The disease is caused by the
bacteria Erysipelothrix rhusiopathiae. Carrier animals and bacteria
persisting in decomposing animal carcasses, meat or fish and their
processed products, ectoparasites, sewage, water, and soil present
obvious sources of infection. Maturing male turkeys are
predisposed to infection through skin lacerations inflicted by
fighting, whereas the disease in mature turkey hens has been
attributed to insemination with E. rhusiopathiae-conianahiated
semen from carrier males. Erysipelothrix rhusiopathiae can cause a
painful localized would infection (erysipeloid) in humans and is an
occupational hazard for veterinarians and for people processing
fresh meat and fish.
CLINICAL DISEASE
Among birds, male turkeys from 18-20 wk of age are most
frequently affected, although the disease has been documented in
chickens, ducks, geese, pheasants, emus, and other birds. Wound
infections associated with de-toeing procedures in day-old turkeys
have been reported as well. The onset of acute septicemic erysipelas
is sudden, with only a few hours of rapidly progressing signs
(depression, somnolence, ruffled feathers, and prostration) before
death. The lesions, apart from irregular areas of erythema and
edema of infected skin, are those expected with bacterial septicemia
(i.e., generalized congestion with scattered serosal hemorrhages and
swelling of parenchymous organs). Purulent arthritis and vegetative
valvular endocarditis may be seen in chronic erysipelas. The
dominant microscopic lesions in acute erysipelas involve vascular
damage, as evidenced by generalized congestion, edema, focal
hemorrhage, disseminated septic fibrin thrombi, and numerous
bacterial aggregates engulfed by cells of the macrophage-
phagocytic system (1). Focal to diffuse necrosis may be seen in
liver and spleen.
brachial vein or the carefully exposed heart. For direct culture of
various internal organs (liver, spleen, kidney, lungs and bone
marrow), wire culture loops or cotton-tipped swabs can be inserted
into tissues after flaming or searing die exposed surface. Solid
media should be streaked immediately, and the swabs may be
broken off into tubes of broth medium. Cultures of blood and
parenchymatous organs should be prepared from several birds to
assure recovery during optimal stages of infection. Samples from
decomposed cadavers or from organs likely to be contaminated with
other bacteria should be directly cultured or collected in media
containing inhibitors such as erysipelothrix selective broth (ESB)
(7). This is also true of cultures of feces, soil, sewage, feeds, and
other materials which may be done as part of flock-or plant­
monitoring programs.
If specimens are to be shipped without being cultured on site, it is
recommended that they be taken as soon as possible after death or,
preferably, from moribund birds. Livers, spleens, and bone marrow
(unopened femur or tibia) are the best sources, but hearts and
affected joints might also be included from birds with subacute or
chronic infections. Specimens for shipping should be removed from
cadavers as aseptically as possible, placed in sterile leak-proof
containers, packed on ice or cold packs, and transported to the
bacteriology laboratory as expeditiously as possible. Organ
specimens or joint exudates may be frozen if immediate shipment is
not possible. Storage at 70 C is recommended.
Erysipelothrix rhusiopathiae is remarkably persistent in
environmental specimens. The bacterium remains viable for up to 5
days in water and up to 15 days in sewage. The bacterium persists
for long periods in smoked or pickled meats and for up to 9 mo in
buried carcasses. Erysipelothrix rhusiopathiae is killed by heating
at 60 C for 15 min, and growth is inhibited by 10% (w:v) NaCl.
Low temperatures and alkaline conditions in organic matter favor
survival of the bacterium, whereas heat and direct sunlight diminish
its viability. Erysipelothrix rhusiopathiae can be preserved for
months by stab inoculation of screw-cap tubes of nutrient agar (pH
7.4). After overnight growth, the cap is tightly closed and tubes are
maintained in the dark at room or refrigerator temperatures.

SAMPLE COLLECTION PREFERRED CULTURE MEDIA AND SUBSTRATES

Handling of potentially infectious material can be hazardous in
that even minor scratches and abrasions can become infected. The
use of rubber gloves, disinfectants, and sterile instruments is
recommended.
In birds with fulminant septicemia, E. rhusiopathiae is distributed
widely in blood and all parenchymatous organs, which are the
preferred sources of samples for isolation of the bacteria. Aseptic
collection of blood for culture can be achieved from either the
36
Samples from acutely affected birds should be inoculated onto
blood agar, McConkey’s agar, and triple sugar iron (TSI) agar for
rapid preliminary isolation of E. rhusiopathiae as well as other
septicemic bacteria. Because specimens from carrier birds may
contain few bacteria, isolation of E. rhusiopathiae will be enhanced
by use of heavier inocula in enriched broth media (brain-heart
infusion broth with 5% serum). Isolation of E. rhusiopathiae from
potentially contaminated specimens (feed, intestine, cecal tonsils,

decomposed organs, and other materials) requires selective media
with inhibitory chemicals (5). For such isolation, ESB consisting of
tryptose broth with added antibiotics and Packer’s medium
consisting of tryptose agar with sodium azide, crystal violet, and
serum are recommended (7). ESB medium should not be stored
longer than 2 wk. Broth cultures should be inoculated 18-24 hr at 37
C, and cultures on solid media should be incubated 24-48 hr.
Pure cultures of E. rhusiopathiae can be propagated successfully
in embryonated chicken eggs (6). Colonies can be picked directly
from solid media with a bacteriologic needle that is then inserted
into the yolk sac of embryonated eggs at 6-8 days of incubation.
Alternatively, 0.01 ml of pure broth culture can be delivered into
the yolk sac using a hypodermic needle. Embryos are killed by the
bacterium within 24-48 hr. Harvested yolk is an excellent source of
high-titered bacterial inoculum and can be preserved for long
periods of storage at 70 C or by lyophilization.
Mouse inoculation can be used as a means of purifying mixed
cultures and of assessing pathogenicity of E. rhusiopathiae isolates.
To eliminate other bacteria, mice are exposed by swabbing scarified
ear skin with a cotton swab from broth cultures at 24, 48, and 96 hr
of incubation. Mice usually die 3-6 days after exposure, and E.
rhusiopathiae can be isolated in pure culture from heart blood or
livers. Apparently, bacteria other than E. rhusiopathiae do not have
the ability to invade scarified skin of mice. For pathogenicity
assessment, mice are inoculated subcutaneously or intraperitoneally
with 0.1 ml of 24 hr broth culture; pathogenic isolates should kill
mice within 6 days. Not all turkey isolates are pathogenic to mice,
so pathogenicity may also need to be assessed directly in
susceptible turkeys by skin scarification or subcutaneous routes.
AGENT IDENTIFICATION
In stained smears from the serosal or cut surface of liver or spleen,
E. rhusiopathiae appears as a straight or curved rod (0.2-0.4 x 0.5-
2.5 um) often occurring in clumps. The bacterium is Gram-positive
but decolorizes readily. It has no capsule, does not form spores, and
is non motile.
Cultural Characteristics
Although E. rhusiopathiae will grow aerobically, growth is
enhanced if cultures are incubated in an atmosphere of 5%-10%
CO2 . After incubation of agar plates for 24-72 hr at 37 C, tiny
pinpoint colonies progress to small, round, translucent 0.7-1-mm-
diameter colonies. In mixed cultures these colonies can be easily
overshadowed by larger, more rapidly growing contaminant
bacteria. On blood agar, a very narrow zone of greenish hemolysis
frequently occurs around smooth colonies. In older cultures,
colonies may dissociate to flat, opaque, rough forms that are slightly
larger than the smooth colonies. Bacterial morphology in rough
colonies is dramatically different from that noted above, in that the
cells become long, filamentous, and beaded, 4-15 pm in length, and
often form tangled chains. In stab cultures in nutrient gelatin, E
rhusiopathiae forms a characteristic “bottlebrush” growth pattern
along the stab line after 3-5 days of incubation, but gelatin is not
liquefied.
Biochemical Properties
Erysipelothrix rhusiopathiae is catalase and oxidase negative, does
not produce indole, does not reduce nitrate, does not hydrolyze
esculin, and produces no change or weak acid in litmus milk, and
most strains produce H2S in TSI agar. The latter change is one of
the most reliable presumptive tests for the identification of E.
rhusiopathiae. TSI agar tubes should be fresh (not more than 2 wk
in storage); the butt is stabbed and the slant is streaked. The black
discoloration along the stab line is usually well developed by 24-48
hr, and there is an acid (yellow) butt and an acid slant. Carbohydrate
fermentation patterns are variable and require a standardized
37
Chapter 9 Erysipelas
medium (Andrade’s base with 10% rabbit serum). Running known
strains of E. rhusiopathiae for comparison with the test isolate is
recommended. Lactose, glucose, levulose, and dextrin are usually
fermented; some acid production may be noted in sucrose,
arabinose, dulcitol, mannitol, xylose, galactose, and fructose.
Hyaluronidase and neuraminidase are elaborated by many strains
(4,10), and a recent report notes the consistent production of
coagulase by numerous isolates tested (9). Vitex automated
systems, as well as API Coryne System (bioMerieux Vitek, Inc.,
Hazelwood, Mo.), a miniaturized biochemical test kit, can be used
to identify E. rhusiopathiae (1).
Antigen Detection
The definition of antigenic types of E. rhusiopathiae has been
primarily a research endeavor, largely because there is no
established relationship between serotype and immunogenicity or
pathogenicity. From an epidemiological standpoint, however,
maintaining a database on existing serotypes could be of value. The
procedures for serotyping, including preparation of antigens and
antisera for the 26 known serotypes, are well established (3,4,8,10).
One serologic procedure potentially critical to identification of
some E rhusiopathiae strains is the mouse protection test (6). Each
of two or more mice are injected in the loose skin of the flank with
0.1 ml of a 24 hr broth culture. The opposite flank is injected with
0.3 ml of equine hyperimmune anti-erysipelas serum (Anchor
Laboratories, St. Joseph, Mo.). Another group of mice receives the
culture only. It is recommended that a third group of mice receive a
known mouse-virulent E. rhusiopathiae strain and antiserum. If the
test mice are killed by the unknown bacterium within a 6-day
observation period and are protected by specific erysipelas
antiserum, one can conclude that the bacterium is E. rhusiopathiae.
A fluorescent antibody technique has been found to be useful as an
aid in identifying E. rhusiopathiae isolates and in detecting
intestinal infection (6), but like other serologic procedures it is not
widely applied in diagnostic laboratories. Fluorescein-labeled
antibody to E. rhusiopathiae is not commercially available (4).
Molecular Identification
A genus specific PCR amplification system has been used with pig
samples for the rapid detection of E. rhusiopathiae. (2). Testing
methodologies utilized for the classification of different strains of E.
rhusiopathiae include restriction fragment length polymorphism
(ribotyping) (2), and multilocus enzyme electrophoresis (MLEE)
(2). Erysipelothrix tonsillarum, the only other species in the genus
Erysipelothrix, differs from E. rhusiopathiae only by DNA-DNA
homology. All strains belong to serovar 7.
SEROLOGICAL DETECTION IN THE HOST
The absence of a widely applied serologic test for erysipelas in
birds suggests either a lack of demand or the unavailability of
practicable testing technology. A tube agglutination test applied
primarily to research and epidemiology problems has been
described (6).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The acute septicemic form of avian erysipelas might be confused
with a number of other acute infectious diseases, including fowl
cholera (pasteurellosis), staphylococcosis, colibacillosis,
streptococcosis, salmonellosis, and highly virulent avian influenza
or Newcastle disease. However, Gram staining of smears prepared
directly from affected organs or from isolated bacterial colonies will
clearly distinguish E. rhusiopathiae from most other septicemic
bacteria. The only significant exception might be septicemic
listeriosis. Distinction of E. rhusiopathiae from Listeria
monocytogenes has been addressed in Chapter 10 on listeriosis.
George L. Cooper and Arthur A. Bickford
REFERENCES
1. Bickford, A.A, RE. Corstvet, and A S. Rosenwald. Pathology of
experimental erysipelas in turkeys. Avian Dis. 22:503-518. 1978.
Σ Bille, J., J.R Rocourt, and B. Swaminathan. Listeria and Erysipelothrix,
In: Manual of Clinical Microbiology, 8th ed P.R. Murray, E.J. Baron, J.H.
Jorgensen, MA. Pfaller, and R.H. Yolken, eds. American Society for
Microbiology, Washington, D.C. pp. 461-471. 2003.
3. Bisgaard, Μ, V. Norrung, and N. Tomoe. Erysipelas in poultry,
prevalence of serotypes and epidemiological investigations. Avian Pathol.
9:355-362. 1980.
4. Bricker, J.M, and Y.M Saif. Erysipelas, In: Diseases of Poultry, 11th ed.
Y.M Saif, H.J. Barnes, J.R. Glisson, A.M. Fadly, L.R. McDougald, and
DE. Swayne, eds. Iowa State University Press, Ames, Iowa. Pp. 845-862.
2003.
5. Carter, G.R Diagnostic procedures in veterinary bacteriology and
mycology, 4th ed Charles C. Thomas, Springfield, Π1. 1984.
38
6. Corstvet, R. Erysipelas, In: Isolation and identification of avian
pathogens, 2nd ed. S B. Hitchner, C.H. Domermuth, H.G. Purchase, and J.E.
Williams, eds. American Association of Avian Pathologists, College Station,
Tex., pp.23-26. 1980.
7. Cottral, G.E. Manual of standardized methods for veterinary
microbiology. Cornell University Press, Ithaca, N.Y. 1978.
8. Eamans, G.J., MJ. Turner, and R.E. Catt. Serotypes of Erysipelothrix
rhusiopathiae in Australian pigs, small ruminants, poultry and captive wild
birds and animals. Aust. Vet. J. 65:249-252. 1988.
9. Tesh, MJ., and R.L. Wood Detection of coagulase activity in
Erysipelothrix rhusiopathiae. J. Clin. Microbiol. 26:1058-1060. 1988.
10. Wood, R.L. Erysipelas, In: Diseases of swine, 6th ed A.D. Leman, B.
Straw, R.D. Glock, W.L. Mengeling, RH.C. Penny, and E. School, eds.
Iowa State University Press, Ames, Iowa. Pp. 571-583. 1986.
 10
LISTERIOSIS
George L. Cooper and Arthur A. Bickford

SUMMARY. Listeria monocytogenes, the causal agent of listeriosis, grows well on most laboratory media, and can be cultured directly on
blood agar or blood agar with 0.05% potassium tellurite. Isolation of the organism directly from tissues is usually not difficult; however
isolation from the brain can be troublesome and may require culturing from the floor of the medulla. Listeria monocytogenes has been
subdivided into 13 serovars, based on the presence of different flagellar (H) and somatic (O) antigens, however, most cases of listeriosis are
caused by only three serotypes, l/2a, l/2b, and 4B.
Agent Identification. A definitive diagnosis of listeriosis usually requires the isolation and identification of the etiologic agent and the
demonstration of characteristic histologic lesions. Immunoassays that use monoclonal antibodies, DNA probe assays, and a PCR test are
available commercially for the rapid detection of L. monocytogenes in food products. L. monocytogenes can be detected in tissues (fresh or
paraffin block) by PCR-based tests, or direct immunofluorescence using specific monoclonal antibodies conjugated to fluorescein
isothiocyanate. Methodologies used to characterize the various strains of L. monocytogenes include phage typing, multilocus enzyme
electrophoresis, rRNA typing, DNA restriction enzyme analysis, pulsed-field gel electrophoresis, and random amplification of polymorphic
DNA.
Serologic Detection in the Host. Diagnostic serologic tests have not been reliable due to cross-reactions and the tendency of the organism
to autoagglutinate.

INTRODUCTION a glass tissue grinder at a ratio of 1:10 in a general nutrient broth

Listeria monocytogenes has been isolated from a broad range of
mammals, birds, and fish, and is widely distributed in nature. The
bacterium is especially common in the temperate zones of both
hemispheres, where it can be found in soil, in animal feces, and on
vegetable matter such as silage. Although ordinarily thought of as a
disease of ruminants and humans, listeriosis has been well
documented in domestic fowl, where it is generally considered as
opportunist and is often associated with other disease conditions.
Outbreaks are usually sporadic and mortality rates low, although
losses of up to 40% have been reported in some chicken flocks. L.
monocytogenes has been recognized as a serious food bom
pathogen in humans and is of major public health concern and to the
food industry. Outbreaks have been traced to raw or undercooked
poultry meat products which are considered a significant source of
human infection (6).
CLINICAL DISEASE
The most common avian hosts of L. monocytogenes are chickens,
ducks, turkeys, geese, and canaries (1). Infection in other avian
species has been reported less frequently. All age groups are
susceptible, but the disease is primarily one of young birds, where it
may cause a septicemic infection, with focal necrosis in the liver
and myocardium, pericarditis, and, occasionally, encephalitis.
Outbreaks of the encephalitic form have been seen in commercial
broiler flocks, where the predominant clinical sign is torticollis (4).
Lesions seen microscopically include perivascular cuffing, focal
microabscesses in the midbrain and medulla, and gliosis and
satellitosis in the cerebellum. In the septicemic form, multiple focal
hepatic abscesses and myocardial degeneration are common.
Salpingitis occurred in hens following the acute systemic phase of
the infection. Bacteria may be found in Kupffer’s cells of liver or in
the periphery of brain lesions.
Infiltration of plasma cells, lymphoid cells, and macrophages are
characteristic of the lesions (1).
SAMPLE COLLECTION
Listeria monocytogenes grows well on most laboratory media and
can be isolated readily from blood, but isolation directly from the
brain, may be difficult. Culturing directly from the floor of the
medulla may increase the chances of isolation. Alternatively, tissue
specimens may be macerated with a mortar and pestle or blended in
39
such as trypticase soy broth or brain-heart infusion broth (3).
Inoculated broth media should be incubated at 35 C for 5-7 days
and examined daily for growth.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Samples can be cultured directly onto blood agar plates or blood
agar containing 0.05% potassium tellurite (which inhibits many
gram-negative bacteria). Specimens can be held at temperatures of
4 C for cold enrichment, and samples may be removed for culturing
at weekly intervals for periods of up to 4 mo. The cold enrichment
technique is reportedly useful for culturing contaminated specimens
(3). Contaminated clinical specimens, feces, and food products can
be cultured with a two-stage enrichment procedure. The U.S.
Department of Agriculture (USDA) method and the Netherlands
Government Food Inspection Service (NGFIS) methods are used
together at the Centers for Disease Control and Prevention to isolate
L. monocytogenes from non-sterile clinical specimens and foods (2).
The USDA method involves enrichment of the specimen in
University of Vermont (UVM) primary selective enrichment broth
(1 part sample plus 9 parts of broth) for 24 hr at 30 C. 0.1ml of
broth is then plated onto lithium chloride-phenylethanol-
moxalactam (LPM) agar and Oxford or modified Oxford (MOX)
agar plates, and 0.1 ml of the primary enrichment broth is added to
10 ml of UVM secondary selective enrichment broth. The
secondary enrichment broth is incubated for 24 hr at 30 C before
being subcultured onto selective agar plates. The NGFIS method
involves primary enrichment of the specimen in liquid polymyxin-
acriflavin-lithium-chloride-ceftazidime-esculin-mannitol
(PALCAM) egg yolk broth for 24-48 hr at 30 C. The secondary
enrichment broth is plated onto PALCAM agar plates and incubated
for an additional 24-48 hr under microaerobic conditions (5%
oxygen, 7.5% hydrogen, and 80% nitrogen). LPM agar plates are
examined with oblique lighting (Henry illumination), where Listeria
colonies appear blue and colonies of other bacteria appear yellowish
or orange. On Oxford and MOX agars, Listeria colonies appear
black due to hydrolysis of esculin, and the formation of black iron­
phenol compounds in the medium. On PALCAM agar, Listeria
colonies have a gray-green appearance. A chromogenic medium has
been recently developed to help distinguish L. monocytogenes and
L. ivanovii from other Listeria spp. on culture plates (5). Tests
utilizing this medium include the BCM chromogenic agar test
(Biosynth International, Naperville), and the CHROMagar Listeria
test (Mast Diagnostics, Reinfeld, Germany). On chomogenic agar
George L. Cooper and Arthur A. Bickford
plates, colonies L. monocytogenes and L. ivanovii appear blue with
a white halo, while other species of Listeria are either inhibited, or
appear colorless, or blue without the halo (5). Suspect colonies can
be subcultured on nutrient agar slants. Pure cultures may be
lyophilized or stored indefinitely in defribrinated rabbit blood at 70
C.
AGENT IDENTIFICATION
Morphology
Listeria monocytogenes is a slender, non-spore forming, gram­
positive, rod-shaped bacterium. In older or rough cultures, long
filaments 6-20 pm in length may develop. In young cultures the
organism may appear as a coccobacillus. In stained preparations
the organisms may have a diphtheroid appearance.
Biological properties
Listeria monocytogenes grows at a temperature range of 4-42 C,
with an optimum of 35 C. The organism is somewhat resistant to
heat but is killed in 60 min at 55 C. It can grow in 10% salt at pH
9.6 and can survive in 20% salt. It can survive for years at 4 C in
broth and survives for long periods of time in the environment on
silage, hay, or in the soil. The organism will grow aerobically, but
the addition of 5%-10% CO2 to the atmosphere enhances growth.
Positive motility can be demonstrated by an umbrellalike growth
pattern produced along the stab line in motility test medium. The
end-over-end tumbling motion that is characteristic of Listeria
monocytogenes can best be demonstrated in a hanging drop
preparation of a 2-hr broth culture incubated at room temperature
(25 C). After 24-48 hr of growth, small, smooth, gray translucent
colonies, 0.2-0.4 mm in diameter, are formed, and on blood agar a
narrow zone of beta hemolysis is usually produced. On clear media,
such as LPM, the colonies appear blue (small young colonies) to
white (older colonies) when viewed with an oblique light source (45
degree angle). Turbidity is produced in broth cultures, which tends
to settle on standing.
Physicochemical properties
Acid without gas is produced from glucose, maltose, lactose,
sucrose, trehalose, rhamnose, and salicin. No fermentation of
arabinose, dulcitol, inulin, raffinose, or xylose occurs. The organism
is usually methyl red-positive, Voges-Proskauer-positive, catalase­
positive, esculin-positive, and produces a positive reaction on the
Christie, Atkins and Muench-Peterson (CAMP) test with
Staphylococcus aureus. B-lysin discs (Remel, Lenexa, Kans.) can
be used for enhancement of L. monocytogenes hemolysis. The
bacterium is urease and gelatinase-negative, and no H2S produced
in die butt of triple sugar iron agar. Several miniaturized
biochemical test kits are available commercially for identifying
Listeria spp., and include M *\-Listeria test (bioMerieux-Vitex, Inc.,
Hazelwood, Mo.) and Micro ID Listeria (Organon-Teknika,
Tumhoout, Belgium).
Mice, rabbits, and guinea pigs are susceptible to experimental
infection, and have been used to isolate the organism and to
evaluate pathogenicity. The Anton test has been used as a
presumptive test, wherein a purulent conjunctivitis occurs 24-36 hr
after the instillation of a drop of broth culture in the conjunctival sac
of a rabbit or guinea pig. An immunocompromised-mouse model
has been developed in which relatively small numbers of virulent
Listeria can cause death within 3 days, and a cell culture
cytotoxicity assay using the human intestinal epithelial cell line
Caco-2 has been developed to determine the virulence of Listeria
isolates in vitro (2). The organism can also be isolated in 10-day-old
chicken embryos inoculated via the allantoic sac.
40
Molecular Identification
Based on DNA-DNA hybridization analysis and 16S rRNA
studies, Listeria have been divided into seven species (2).
Listeria monocytogenes has been subdivided into 13 serotypes, or
serovars, based on the possession of different flagellar (H) and
somatic (O) antigens. More than 90% of all cases of listeriosis
reported worldwide in humans and animals are produced by
serotypes 4B, l/2a, and l/2b. A commercial kit is available for
serotyping Listeria isolates (Denka Seiken, Tokyo, Japan), and
antisera for serotyping can be obtained from Difco (Difco
Laboratories/ Becton Dickinson and Co., Sparks, MD) (2). Other
methods used for typing L. monocytogenes include phage typing,
multilocus enzyme electrophoresis (MLEE), ribotyping, random
fragment length polymorphism (RFLP), and pulsed-field gel
electrophoresis (PFGE) (5). An automated RiboPrinter System
(Qualicon, Wilmington, Del.) facilitates rapid and easy subtyping of
L. monocytogenes, and the CDC has established a network of public
health laboratories that routinely subtype food-borne pathogens
using PFGE pattern analysis (PFGE@cdc.gov) (2).
The rapid detection of Listeria spp. in food samples from selective
enrichment broths can be facilitated by immunoassays using
monoclonal antibodies, such as Listeria Tek (Organon-Teknika,
Tumhoout, Belgium) and VIDAS Listeria Assay (bioMerieux,
Marcy-Etoile, France). These tests are genus specific, whereas
DNA probes such as L. monocytogenes assay (Gene-Trak,
Naperville, Iowa), and Accuprobe (Gen-Probe Inc., San Diego,
Calif.) are specific for L. monocytogenes (2). Commercially
available PCR tests used for testing food products include the BAX
PCR system (Qualicon, Wilmington, Del.), and the Probelia assay
(Sanofi Diagnostic Pasteur, Marne la Coquette, France). Real-time
PCR tests are being developed to identify L. monocytogenes in food
and clinical samples, with the added advantage of being able to
quantify the bacteria as well (5). Listeria monocytogenes can be
detected in tissues (either fresh or in paraffin blocks) by PCR-based
tests, and by a direct immunoflorescence test using specific L.
monocytogenes monoclonal antibodies conjugated to Fluorscein
isothiocyanate. (2). A 30-min chemiluminescence DNA probe
(Gen-Probe, San Diego, Calif.) is available for rapid confirmation
of L. monocytogenes from colonies on primary isolation plates (2).
Table 10.1 Characteristics to differentiate Listeria species.
Type of
Rhamnose
Listeria species Mannitol Xylose Nitrate
Hemolysis
+
L. monocytogenes β - - -
L. ivanovii β - - + -
L. innocua β - +/- - -
L. seeligeri β - - + -
L. welsh β - +/- + -
L. grayi β + - - -
L. murrayi β + +/- - +
SEROLOGIC DETECTION IN THE HOST
Diagnostic immunologic tests have been used with various degrees
of success. These include hemagglutination-inhibition, complement
fixation, gel diffusion and precipitation. The tendency of the
organism to autoagglutinate, and problems with cross reaction have
limited the usefulness of many serologic tests. Cross reactions are
common with Staphylococcus aureus, some group D Streptococcus,
and also some gram-negative organisms such as coliforms.

DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The systemic form of listeriosis may resemble many other
septicemic diseases, such as staphylococcosis, streptococcosis,
erysipelas, salmonellosis, pasterellosis, colisepticemia, and other
bacterial or viral infections in which nonspecific findings such as
depression and acute mortality are often seen. A differential
diagnosis of the neuologic form of the disease should include avian
encephalomyelitis; Newcastle disease; encephalomalacia; Marek’s
disease; chronic localized Pasteurella multocida infection of the
middle ear, meninges, and cranial bones; and the neurologic form of
aspergillosis. The histologic lesions seen in the brain are suggestive
of listeriosis, and isolation and identification of the etiologic agent
should confirm the diagnosis. Listeria monocytogenes is sometimes
overlooked on culture plates when it is confused with
nonpathogenic “diphtheroid” organisms, Lactobacillus, Brochothrix
spp., Kurthia spp., or with a beta hemolytic Streptococcus. Listeria
monocytogenes is easily discolorized and can be confused with a
gram-negative bacillus. A positive catalase reaction will separate L.
monocytogenes from the streptococci, and the positive motility and
the ability to hydrolyze esculin should separate it from the
corynebacteria. Lactobacillus spp. generally are nonmotile and
catalase-negative. Brochothrix spp. is unable to grow at 37 C, and
Kurthia spp. are strictly aerobic and esculin negative. The CAMP
test is useful for differentiating nonhemolytic Listeria innocua,
41
Chapter 10 Listeriosis
which is often isolated from mixed flora specimens on selective
media, from some strains of L. monocytogenes, which may produce
only faint or narrow zones of hemolysis. Erysipelas is also caused
by a slender gram-positive rod-shaped bacterium, but unlike L.
monocytogenes, Erysipelothrix rhusiopathiae produces hydrogen
sulfide, does not produce catalase, and gives a negative reaction on
the Anton test.
REFERENCES
1. Barnes, H.J. Miscellaneous and Sporadic Bacterial Infections, In:
Diseases of Poultry, 11th ed., Y.M Saif, H.J. Barnes, J.R. Glisson, A M
Fadly, L.R. McDougald, and D.E. Swayne, eds. Iowa State University Press,
Ames, Iowa. Pp. 845-862. 2003
2. Bille, J., J.R. Rocourt, and B. Swaminathan. Listeria and Erysipelothrix,
In: Manual of Clinical Microbiology, 8th ed. P.R. Murray, E.J. Baron, J.H.
Jorgensen, MA. Pfaller, and R.H. Yolken, eds. American Society for
Microbiology, Washington, D.C. Pp. 461-471. 2003.
3. Carter, G.R. Diagnostic procedures in veterinary bacteriology and
mycology, 4th ed. Charles C. Thomas, Springfield Ill. Pp 191-195. 1994.
Cooper, G.L. An encephalitic form of listeriosis in broiler chickens. Avian
Dis. 33:182-185. 1989.
4. Gasanov, U., D. Hughes, and P.M Hansbro. Methods for the Isolation
and Identification of Listeria Spp. and Listeria monocytogenes: A Review.
FEMS Microbiology Review 29(5), 851-75. 2005.
5. Gray, ML., and A.H. Killinger. Listeria monocytogenes and Listeria
Infections. Bacteriol. Rev. 30:339-382. 1966.
 11
STAPHYLOCOCCOSIS
Stephan G. Thayer and W. Douglas Waltman

SUMMARY. Staphylococcosis is a common disease condition in both chickens and turkeys. It is almost always associated with a break in
the skin or mucus membrane or with immunosuppression.
Agent Identification. The causative agent, Staphylococcus aureus, is easy to isolate using almost any bacterial culture media but 5% sheep
or bovine blood agar is preferred. Staphylococcus aureus produces circular smooth colonies that are 1-3 mm in diameter within 18-24 hr
with most strains being β-hemolytic and pigmented white to yellow. Gram-staining yields gram positive cocci in grapelike clusters.
Staphylococcus aureus is catalase positive. S. aureus can be identified with the latex agglutination test.
Serologic Detection in the Host. There is no serologic test available to diagnose Staphylococcus infection.

INTRODUCTION is some evidence that certain major histocompatibility B complex

In recent years, staphylococcosis has become one of the most
important bacterial diseases of poultry. This has resulted from the
common practice of growing chickens and turkeys to a greater
weight because of product demands for further processing.
Chickens and turkeys also have been highly selected for their ability
to achieve rapid growth. Such selection has added to stress by
creating various leg problems that predispose poultry to the
development of staphylococcosis.
Historically, staphylococcosis has been a significant problem
because of the ubiquitous nature of the bacterium in the poultry
farm environment. The portals of entry start with the open navel of
newly hatched chicks from contaminated hatchers and infection is
associated with contaminated hatching eggs. The sources of
infection progress to wounds associated with beak trimming, toe
trimming, toe scratches, wood splinters, and sharp metal edges, with
increasing opportunities for injury as birds rapidly gain weight.
Numerous Staphylococcus spp. are found in the poultry
environment, but S. aureus is the most frequent disease causing
agent. Staphylococcus spp. are normal inhabitants of skin and
mucus membranes and readily reside in all the environments where
poultry are hatched, reared, and even processed. Staphylococcus
aureus definitely can cause disease, but it, along with other
Staphylococcus spp. especially S. epidermidis, is thought to
suppress other possible pathogens through interference or
competitive exclusion. Other Staphylococcus spp. that have been
isolated from lesions or possible disease situations include S. hyicus
(fibrinoheterophilic blepharitis) (4) and S. cohnii (liver spots) (13).
CLINICAL DISEASE
genotypes may play a role in susceptibility to staphylococcal
skeletal disease (6).
SAMPLE COLLECTION
Specimens from which staphylococci are cultured are blood,
exudate from swollen joints or foot pads, yolk, and swab stabs from
internal organs such as liver, spleen, and kidneys. In the field,
exudate from swollen joints can be conveniently collected by
arthrocentesis using a 1-ml syringe and a 20 to 26-gauge needle;
care must be taken to first disinfect the skin where the needle is
introduced. No special precautions are needed beyond standard
procedures in handling and transporting specimens, as
staphylococci are very hardy.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Staphylococci grow readily on ordinary culture media. Specimens
from internal organs or fluids, where background contamination
would normally be low, can be inoculated directly onto sheep or
bovine blood agar plates. The blood used in the agar must be free
of antibiotics. Culture materials taken from external tissues or the
environment, where heavy background contamination exists, should
be inoculated onto selective media. Phenyethanol (PEA), Mannitol-
salt agar or Staphylococcus medium 110 (BD Diagnostic Systems,
Sparks, MD) are commonly used, and Mannitol salt agar and Staph
medium 110 function as both a selective and differential medium
for S. aureus. Other selective media that might be used are
Columbia CNA agar or tellurite glycine agar (BD Diagnostic
Systems, Sparks, MD).

Staphylococcosis is a term used to describe any of several clinical AGENT IDENTIFICATION

conditions in poultry where S. aureus is the causative agent.
Infections occur when there is a disruption of the skin or a mucus
membrane allowing entrance or penetration of S. aureus into deeper
tissues. Staphylococcus aureus infections have been observed most
frequently in the bones, tendon sheaths, and joints, but infections
are also observed, although less frequently, in the skin, sternal
bursa, yolk sac, heart, vertebrae, eyelids, and as granulomas in the
liver and lungs. In older birds, usually in lay, S. aureus can cause a
septicemia with acute deaths (1).
The most common important clinical conditions associated with
staphylococcosis are osteomyelitis, arthritis, periarthritis, and
synovitis. The bones most frequently involved are the proximal
tibiotarsus and proximal femur. Less commonly involved sites are
the proximal tarsometatarsus, distal femur, distal tibiotarsus,
proximal humerus, ribs, and vertebrae. In affected birds, the
femoral head often separates from the shaft by a fracture through
the neck of the femur when the coxofemoral joint is disarticulated
(femoral head necrosis). Grossly affected bones have focal yellow
crumbly areas that contain caseous exudate. Affected joints are
swollen and filled with white to yellow exudate (1, 7, 8, 11). There
42
A rapid tentative identification can be made by spreading a thin
film of material from synovial fluid or tissues such as the liver
(impression smear) directly onto a microscope slide and observing
for gram-positive cocci. Diagnosis is confirmed by isolating
staphylococci (S. aureus) from tissues with lesions. In most cases
where classical lesions of staphylococcosis are present, S. aureus is
readily isolated in large numbers from the involved tissues.
On agar cultures, staphylococci produce 1 to 3 mm diameter,
opaque, smooth, circular, entire, raised, colonies in 18-24 hr.
Staphylococcus aureus isolates are mostly hemolytic but
occasionally non-hemolytic at 24 hr on blood agar. Non-hemolytic
can be a misinterpretation of colonies with weak hemolysis hidden
behind the colony. Avian isolates are frequently white developing
cream to yellow pigmentation after 48 hr or more. On mannitol-salt
agar, S. aureus colonies are surrounded by a yellow halo indicating
mannitol fermentation. Typical colonies are examined
microscopically to confirm that they are composed of gram-positive
staphylococci. The latex agglutination test (Remel, Inc. Lenexa,
KS) is sufficient, in most cases, to differentiate S. aureus from other

Staphylococcus species. Coagulase testing can be accomplished
using commercially available desiccated rabbit plasma containing
either citrate or ethylenediaminetetracetic acid. A rapid slide
coagulase test can be performed by making a heavy, smooth
suspension of a colony in one drop of reconstituted plasma on a
glass slide and observing for clumping in 10 sec; this detects the
clumping factor (cell-bound coagulase). A tube coagulase test is
more accurate than the rapid slide test and detects extracellular
(free) coagulase. The tube test uses 0.5 ml of reconstituted plasma
that is thoroughly mixed with either 0.1 ml of an overnight broth
culture or a portion of a well isolated colony. The mixture is
incubated for 4 hr at 37 C, and any degree of clotting represents a
positive test. Since S. aureus, S. hyicus, and S. intermedius are all
positive for coagulase there is still a need for a test specific for S.
aureus. Commercial latex agglutination tests for S. aureus have
been found specific and reliable when used for the identification of
avian isolates (2, 5, 14).
When latex agglutination positive (coagulase-positive)
staphylococci are isolated in large numbers from birds presenting
typical signs of staphylococcosis, a diagnosis is confirmed.
Isolation of low numbers of S. aureus is not always indicative of
staphylococcosis since they are part of the normal flora of healthy
birds.
Various species of coagulase-negative staphylococci can be
isolated from poultry. Occasionally these may appear as
opportunists when they can be isolated repeatedly from the same
flock however none of these species have been incriminated as a
cause of major disease in poultry. Should it be necessary to identify
these staphylococci, the following scheme can be used:
1) Isolate onto blood agar. Employ selective medium such as PEA
or mannitol salt agar where necessary to isolate from contaminated
specimens. Colonies from selective media need to be subcultured
onto TSA/blood agar before testing.
2) After confirmation of Gram positive cocci, test for the
production of catalase by picking 24-hr colonies from TSA and
immersing the bacteria in a drop of 3% H2O2 on a glass slide.
Observe for vigorous bubbling indicating breakdown of H2O2 and
release of oxygen gas. Catalase-positive cultures are of the family
Micrococcaceae.
3) Test for sensitivity to lysostaphin (Sigma Chemical, St. Louis,
MO) by placing 5 drops of lysostaphin solution into 5 ml of a 24
hour heart infusion broth culture of the suspect catalase positive
cocci. Add 5 drops of PBS (control) to a second suspension.
Incubate at 35C for up to 2 hr. Observe at 30, 60 and 120 min.
Clearing of the suspension is a positive test indicating sensitivity to
lysostaphin. Turbidity indicates insensitivity. Species of the genus
Staphylococcus are sensitive to lysostaphin, and species of the
genus Micrococcus are resistant to it.
4) Confirm S. aureus identification with one of the latex
agglutination tests since coagulase-positive isolates can be S.
aureus, S. hyicus, or S. intermedius.
5) Test latex-negative and coagulase-negative cultures with a
battery of biochemical tests to identify the species. Several
commercial microassay kits are available that include the API
Staph, ID 32 Staph and RAPIDEC Staph (bioMerieux-Vitek,
Hazelwood, Mo.).
More extensive coverage of the above diagnostic procedures is
published elsewhere (2, 5, 9, 10, 14).
SEROLOGIC DETECTION IN THE HOST
Serologic tests are not used for the diagnosis of staphylococcosis.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Lameness and leg disorders have several causes in poultry. These
include other bacteria (Escherichia coli, Mycoplasma synoviae, and
43
Chapter 11 Staphylococcosis
others), viruses (viral arthritis), and nutritional deficiencies. Other
bacteria and molds are also responsible for hatchery related
infections. Staphylococcal septicemia can resemble any bacterial
septicemic condition of poultry, including fowl cholera,
colibacillosis (E. coli), and fowl typhoid (Salmonella gallinarum).
To differentiate Staphylococcosis from these diseases the laboratory
testing described in this chapter is essential.
REFERENCES
1. Andreason, Claire B. Staphylococcosis. In: Diseases of poultry, 11th ed
Y. M Saif, H. J. Bames, J. R. Glisson, A.M Fadly, L. R. McDougald, and
D.E. Swayne, eds. Iowa State Press, Ames, Iowa. pp. 798-804. 2003.
2. Boynukara, B., K. Gurturk, T. Golhan, I. H. Ekin, and E. Ogun.
Comparison of latex agglutination test with protein A, clumping factor, and
coagulase tests for identification of staphylococci isolated from avian. Eur.
J. of Med 4:58-60. 1999.
3. Butterworth, A. Infectious components of broiler lameness: A review.
World’s Poultry Science Journal. 56:327-352.1999
4. Cheville, N. F., J. Tappe, M Ackermann, and A. Jensen. Acute
fibrinopurulent blepharitis and conjunctivitis associated with
Staphylococcus hyicus, Escherichia coli, and Streptococcus sp. in chickens
and turkeys. Vet. Pathol. 25:369-375. 1988.
5. Doem, G.V. Evaluation of commercial latex agglutination test for
identification of Staphylococcus aureus. J. Clin. Microbiol. 15:416-418.
1982.
6. Finegold, S. M, and E. J. Baron. Micrococcaceae: Staphylococci,
Micrococci, and similar organisms. In: Bailey and Scott's diagnostic
microbiology, 10th ed B. A. Forbes, D. F. Sahm, and A. Weissfeld, eds. C.
V. Mosby Co., St. Louis, Mo. pp. 606-618. 1999.
7. Glisson, J. R. , and J. A. Smith. Staphylococcal synovitis in broiler
breeders. In: Proceedings of the avian skeletal disease symposium. 127th
Annual Meeting of the American Veterinary Medical Association/American
Association of Avian Pathologists. San Antonio, TX. 1990.
8. Joiner, K.S., F.J. Hoerr, E. Van Santen, and S.J. Ewald The Avian Major
Histocompatibility Complex Influences Bacterial Skeletal Disease in Broiler
Breeder Chickens. Vet. Pathol. 42:275-281. 2005.
9. MacFaddin, Jean F. Biochemical tests for the identification of medical
bacteria. 3rd edition. Lippincott, Williams and Wilkins, Baltimore, MD.
2000.
10. Mannerman, Tammy L. Staphylococcus, Micrococcus, and other
catalase positive cocci that grow aerobically. In: Manual of clinical
microbiology, 8th ed Patrick R. Murray, Ellen Jo Barron, James H.
Jorgensen, Michael A. Pfaller, and Robert H. Yolken. eds. American
Society for Microbiology, Washington, D.C. pp. 384-404. 2003.
11. Mutalib, A., C. Riddell, and A. D. Osborne. Studies on the
pathogenesis of staphylococcal osteomyelitis in chickens. I. Effect of stress
on experimentally induced osteomyelitis. Avian Dis. 27:141-156. 1983.
12. Naim, Μ E. Bacterial osteomyelitis and synovitis of the turkey. Avian
Dis. 17:504—517. 1973.
13. Norton, R. A., G. R. Bayyari, J. K. Skeeles, W. E. Huff, and J. N.
Beasley. A survey of two commercial turkey farms experiencing high levels
of liver foci. Avian Dis. 38:887-894. 1994.
14. Roberson, J. R., L.K. Fox, D.D. Hancock, T.E. Besser. Evaluation of
Methods for differentiation of coagulase-positive staphylococci. J. Clin.
Microbiol. 30:3217-3219. 1992.
 12
STREPTOCOCCOSIS AND ENTEROCOCCOSIS
Stephan G. Thayer and W. Douglas Waltman

SUMMARY. Streptococcosis is caused by Streptococcus zooepidemicus from the Lancefield type C antigenic serogroup and Enterococcus
spp. reclassified from the Lancefield type D streptococcal antigenic serogroup. Streptococcus zooepidemicus most commonly affects mature
chickens. The Enterococcus spp. are commonly referred to as fecal streps and include E. faecalis, E. /aecium, E. durans, E. avium and E.
hirae. Enterococcus spp. can affect almost all avian species. Disease caused by both bacterial groups can be either acute, subacute, or
chronic. Septicemia, omphalitis, arthritis, salpingitis, valvular endocarditis, myocarditis, and osteomyelitis are common lesions associated
with infection.
Agent Identification. Blood and MacConkey’s agar and other selective media can be used to isolate these organisms. Differential
characteristics can be identified using selective media, hemolysis on blood agar, and fermentation of mannitol, L-arabinose, and sorbitol.
Differential diagnosis of streptococcal and enterococcal infections should include staphylococcus, colibacillosis, pasteurellosis, and
erysipelas.
Serologic Detection in the Host. Serologic techniques are not commonly employed to detect infection by streptococci in poultry.

INTRODUCTION
Streptococcosis of avian species is worldwide in distribution
occurring as acute septicemic or chronic infections with mortality
ranging from 0.5% to 50% (19). Streptococci are ubiquitous in
nature and are commonly found in poultry environments. These
organisms also are part of the normal intestinal flora of poultry and
wild birds. Streptococcoses are considered to be secondary
infections (21).
The application of new bacteriologic techniques, especially DNA-
DNA and DNA-rRNA hybridization, has led to the reclassification
of many bacterial species, including Streptococcus spp. (10, 17).
The most common Streptococcus spp. associated with avian disease
is Streptococcus zooepidemicus, from the Lancefield antigenic
serogroup type C. The Lancefield serogroup D has been
reclassified as Enterococcus spp. Members of this group are found
as opportunists in the intestinal tract. Potential pathogenic
enterococci in avian species are Enterococcus faecalis), E. faecium,
E. durans, and E. avium (5). Enterococcus hirae has been identified
as the cause of growth depression in young chickens but has not
been associated with embryo mortality or disease in young chicks
(1,6).
less commonly, infarcts in the lung, kidney, and brain. Lesions in
the heart valves consist of fibrin, bacteria, heterophils,
macrophages, and fibroblasts. Other microscopic lesions related to
endocarditis include cerebral vasculitis and infarcts;
leptomeningitis; glomerulonephritis; and thrombosis of pulmonary
vessels (13). Focal granulomas may be observed in any tissue due
to septic thrombi. Liver infarcts are characterized by portal venous
thrombosis and necrosis. Molecular tools such as 16S rRNA
sequencing offer discriminatory power not seen in conventional
biochemical approaches. The result is* description of new species
such as S. gallinaceus. It is considered an opportunistic pathogen
which is associated with septicemia (5, 6). Another new species S.
gallolyticus is associated with septicemic disease in pigeons.
Enterococcus spp. affect avian species of all ages. The most
serious infections cause early embryonic death and mortality of
very young birds. Transmission can be by oral, aerosol, and egg
transmission routes (3, 9 ). Entry may also occur through skin
injuries. Enterococcus species such as E. faecalis, E. faecium appear
to be the most common with other species showing occasional
involvement. Enterococcus durans has been reported with
bacteremia and encephalomalacia in young chickens 4 to 10 days of
age from two separate flocks (4, 22).

CLINICAL DISEASE SAMPLE COLLECTION

Streptococcus zooepidemicus infection occurs almost exclusively
in mature chickens, but may cause mortality in wild birds (11).
With acute S. zooepidemicus infections, clinical signs include
lassitude, blood-stained tissue and feathers around the head, yellow
droppings, emaciation, and pale comb and wattles. In some cases,
the presence of dead birds may be the only sign.
Gross lesions of acute streptococcosis include splenomegaly,
hepatomegaly (with or without red, tan or white foci; the latter
being miliary to 1 cm in diameter), enlarged kidneys, subcutaneous
congestion, serosanguinous subcutaneous and/or pericardial fluid,
and peritonitis. Omphalitis is observed in chicks and poults.
Microscopically the liver has dilated sinusoids with increased
intrasinusoidal heterophils. Thrombosis, infarction, and multiple
areas of necrosis with heterophil accumulation are observed if gross
liver foci are present. Splenomegaly is characterized by congestion
and hyperplasia of the macrophage-phagocytic system (13). With
subacute or chronic streptococcosis, signs include loss of body
weight, lameness, pyrexia, and occasional head tremors. Gross
lesions may include fibrinous arthritis, tenosynovitis, salpingitis,
pericarditis, and peritonitis; necrotic myocarditis; and valvular
endocarditis.
Osteomyelitis has been observed in turkeys. Associated with
valvular endocarditis are infarcts of the liver, spleen, and heart, and,
Preferred tissues for collection include liver, spleen, blood, yolk,
embryonic fluids, subcutaneous fluid, and material from suspected
lesions. Such samples usually yield large numbers of organisms,
often in pure culture. Cultures should be taken from clinically
affected birds immediately after euthanasia. Embryo fluids,
especially yolk, are preferred specimens for culturing unpipped
eggs. Culture of pipped eggs is to be confined to yolk and body
tissue and/or fluids. Embryonic pipped egg samples should be
aseptically taken as soon after hatch as possible. Sterile swabs
should be used to obtain adequate quantities of material for culture.
Best results are obtained by immediately streaking swabs on blood
agar after sample collection. If swabs remain uncultured for more
than 2 hr, they should be incubated in a general purpose broth (heart
infusion, trypticase soy (BD Diagnostic Systems, Sparks, Md.),
tryptose, etc.) for 2-^ hr before being streaked onto blood agar. If
increased bacterial numbers are desired, overnight incubation in
nutrient broth is recommended. Swabs to be processed the
following day should be transported in a silica gel or a dry filter
transport system (10) (Carter, Rice, Storrs & Bennett, East Hartford,
Conn.). Streptococcal cultures may be stored on tightly capped agar
slants at 4 C (several months), stored in blood at -70 C (1-2 yr), or
lyophilized (20 yr).

44

Table 12.1 Differential Characteristics of Streptococci and Enterococci from poultry (9,11,16,18,19, 21).
Growth on
Identification Hemolysis
*MacConkey
E. avium α/γ + /-
E. durans
** α /γ + /-
E. faecalis α/γ + /-
E. faecium a /γ + /-
***
E. hirae α/γ + /-
S. equi ss. zooepidemicus β -
* Literature - without / with crystal violet
** Sucrose (-), Raffinose (-)
*** Sucrose (+), Raffinose (+)
PREFERRED CULTURE MEDIA AND SUBSTRATES
Blood agar, MacConkey’s agar, or a selective medium with 6.5%
NaCl combination of equal ionic strength can be used for primary
or secondary culture (7, 10, 11). The selective medium will also
favor growth of staphylococci that can be differentiated by the
catalase test. Another selective medium for enterococci is the use
of bile esculin medium (BD Diagnostic Systems, Sparks, Md.) on
which enterococci form a dark brown to black pigment after 24 h of
incubation at 35 C. Listeria monocytogenes and some of the
Enterobacteriaceae spp. can display the same reaction on esculin
medium (9, 17, 18, 19). Group D streptococci can be further
differentiated by their ability to grow at 45 C and by being
thermostable at 60 C for 30 min.
AGENT IDENTIFICATION
Streptococci and Enterococci are nonmotile facultative anaerobes.
In gram-stained histopathologic sections and/or gram-stained tissue
and blood smears, the streptococci are non-spore-forming, gram­
positive, spherical bacteria occurring singly, in pairs, or as short
chains. For routine diagnostic purposes, S. zooepidemicus and the
enterococci can be identified on the basis of colony and microscopic
morphology, gram-stain reaction, a negative catalase reaction, and
difference in the type of hemolysis on blood agar. Streptococcus
zooepidemicus is β-hemolytic and enterococci are a- or γ-hemolytic.
Enterococci can be differentiated into species on the basis of growth
or no growth on MacConkey’s agar and fermentation of mannitol,
sorbitol, and L-arabinose (Table 12.1) (17, 19, 20, 22). Colonies
are small and usually grayish in 24 hr and can appear from mucoid
to rough. Enterococci may or may not grow on MacConkey,
depending on the formulation. Several formulations exist and those
with crystal violet will prevent the growth of enterococci.
Another approach is the application of the Strep ID triplate
(Remel, Inc, Lenexa, KS.) which includes blood agar, bile esculin
agar, and PYR agar. The combination of Gram stain, catalase
reaction, hemolytic character, bile esculin reaction and PYR
reaction will identify most avian streptococci to the Lancefield
grouping. It must be emphasized that the characterization and
differentiation described are presumptive diagnostic procedures.
More comprehensive identification can be accomplished through
the use of additional biochemical tests or commercial systems.
45
Chapter 12 Streptococcosis and Enterococcosis
FermentsM Ferments
Ferments Sorbitol
annitol L-arabinose
+ + +
- - -
+ - +
+ + -
- - -
- + +
Serologic Identification
For positive identification of streptococci, one must conduct
group-specific precipitin, agglutinin, and/or fluorescent antibody
tests. Several descriptions of these tests have been published (10).
A latex agglutination test for rapid detection of Lancefield Group C
streptococci has been developed that can be used for identification
of 5. zooepidemicus (14).
SEROLOGIC DETECTION IN THE HOST
Serologic techniques are not commonly employed to detect
infection by streptococci in poultry.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differential diagnosis should exclude other bacterial septicemic
diseases, such as staphylococcosis, colibacillosis, pasteurellosis, and
erysipelas.
REFERENCES
1. Abdul-Aziz, T. A. Pathogenicity of Enterococcus hirae for chicken
embryos and betamethazone-treated chicks. Res. Vet. Sci. 56:397-398.
1994.
2. Baele, M, L. A. Devriese, P. Butaye, andF. Haesebrouck. Composition
of enterococcal and streptococcal flora from pigeon intestines.
J. of Appl. Microbiol. 92:348-351.2002
3. Brittingham, M C., S. A. Temple, and R. M Duncan. A survey of the
prevalence of selected bacteria in wild birds. J. Wildl. Dis. 24:299-307.
1988.
4. Cardona, C. J., A. A. Bickford, B. R. Charlton, and G. I. Cooper.
Enterococcus durans infection in young chickens associated with bacteremia
and encephalomalacia. Avian Dis. 37:234-239. 1993.
5. Chadfield, M S., J. P. Christensen, H. Christensen, and M Bisgaard
Characterization of streptococci and enterococci associated with septicaemia
in broiler parents with high prevalence of endocarditis. Avian Pathol.
33:610-617. 2004
6. Chadfield, M S., J. P. Christensen, J. Juhl-Hansen, H. Christensen, and
M Bisgaard Characterization of Enterococcus hirae outbreaks in broiler
flocks demonstrating increased mortality because of septicemia and
endocarditis and/or altered production parameters. Avian Dis. 49:16-23.
2005
7. Chapin, Kimberle C., and Patrick R Murray. Media. In: Manual of
clinical microbiology, 7th ed P. R Murray, E. J. Baron, M A. Pfaller, F. C.
Tenover, and RH. Yolken, eds. American Society for Microbiology Press,
Washington, D.C. pp. 297-305. 1999.
8. Devriese, Luc A., P. Vandamme, B. Pot, M Vanrobaeys, K. Kersters,
and F. Haesebrouck. Differentiation between Streptococcus gallolyticus
strains of human clinical and veterinary origins and Streptococcus bovis
strains from the intestinal tracts of ruminants. J. Clin. Microbiol. 36:3520-
3523. 1998.
9. Domermuth, C. H., and W. B. Gross. A medium for isolation and
tentative identification of fecal streptococci, and their role as pathogens.
Avian Dis. 13:394-399. 1969.
Stephan G. Thayer and W. Douglas Waltman
10. Farrow, J. A. and M D. Collins. Enterococcus hirae, a new species that
includes amino acid assay strain NCDO 1258 and strains causing growth
depression in young chickens. Int. J. Syst. Bacteriol. 35:73-75. 1985
11. Farrow, J. A., E. D. Jones, B. A. Phillips, and M D. Collins.
Taxonomic studies on some group streptococci. J. Gen. Microbiol.
129:1423-1432. 1983.
12. Hernandez, D. J., E. D. Roberts, L. G. Adams, and T. Vera.
Pathogenesis of hepatic granulomas in turkeys infected with Streptococcus
faecalis var. liquefaciens. Avian Dis. 15:201-216. 1972.
13. Inzana, T. J., and B. Iritani. Rapid detection of group C streptococci
from animals by latex agglutination. J. Clin. Microbiol. 27:309-312. 1989.
14. Jensen, W. I. An outbreak of streptococcosis in eared grebes (Podiceps
nigricollis). Avian Dis. 23:543-546. 1979.
15. Jortner, B. S., and C. F. Helmboldt. Streptococcal bacterial endocarditis
in chickens. Vet. Pathol. 8:54—62. 1971.
16. MacFaddin, Jean F. Biochemical tests for the identification of medical
bacteria. 3rd edition. Lippincott, Williams and Wilkins, Baltimore, MD.
2000.
46
17. Quinn, P. J., Μ E. Carter, B. K. Markey, and G. R. Carter Streptococci
and related cocci. In: Clinical Veterinary Microbiology. Wolfe Publishing-
Mosby Yearbook Limited. London. 1994.
18. Rouff, K. L., RA. Whiley, and D. Beighton. Streptococcus. In:
Manual of clinical microbiology, 8th ed. P. R. Murray, E. J. Baron, J. H
Jorgensen , M A. Pfaller, and R. H. Yolken., eds. American Society for
Microbiology, Press, Washington, D.C. pp. 405-421. 2003.
19. Teixeira, L. M and R. R. Facklam. Enterococcus. In: Manual of
Clinical Microbiology, 8th ed. P. R. Murray, E. J. Baron, J. H. Jorgensen,
M A. Pfaller, and R. H. Yolken, eds. American Society for Microbiology
Press, Washington, D.C. pp. 422-433, 2003.
20. Vanrobaeys, M, F. Haesebrouck, R. Ducatelle, and P. De HerdL
Identification of virulence associated markers in the cell wall of pigeon
Streptococcus gallolyticus strains. Vet. Microbiol. 73:319-325. 2000.
21. Wages, D. P. Enterococcosis. In: Diseases of poultry, 11th ed. Y.M
Saif, H. J. Bames, J. R. Glisson, A. M Fadly, L. R. McDougald, and D. E.
Swayne, eds. Iowa State Press, Ames, Iowa. pp. 809-812. 2003.
22. Wages, D. P. Streptococcosis. In: Diseases of poultry, 11th ed. Y.M
Saif, H. J. Bames, J. R. Glisson, A. M Fadly, L. R. McDougald, and D. E
Swayne, eds. Iowa State Press, Ames, Iowa. pp. 805-808. 2003.
 13
CLOSTRIDIAL DISEASES
Stephan G. Thayer and David A. Miller

SUMMARY. The genus Clostridium includes the Gram-positive, spore-forming, catalase-negative, anaerobic bacilli. More than 100
species of Clostridium have been described, and many have been recovered from environmental and clinical specimens of wild and domestic
avian species. Pathogenicity of Clostridia is mediated primarily through potent exotoxins. Clostridial diseases may occur as soft tissue
infections, intoxications, and toxico-infections. Four economically significant avian clostridial diseases are discussed in this chapter
botulism, ulcerative enteritis, necrotic enteritis, and gangrenous dermatitis.

BOTULISM

Botulism is caused by intoxication with one of eight neurotoxins produced by the anaerobic bacillus Clostridium botulinum. Most avian
outbreaks have been caused by toxin type C. Outbreaks of high mortality have occurred in free-ranging and confined poultry and wild avian
species worldwide. Mortality may reach 40% in chickens and turkeys and has reached 100% on pheasant farms. Sources of preformed toxin
include feed, carcasses, maggots, or decaying plant material. In some outbreaks, no source of toxin could be identified, leading to the
conclusion that toxin production can occur in vivo.
Agent Identification. A presumptive diagnosis is made based on clinical signs including a characteristic flaccid paralysis that begins in the
legs and progresses cranially to the wings, neck, and eyelids.
Serologic Detection in the Host. Serologic testing is of little value because the intoxicating dose of neurotoxin is less than the dose required
to produce detectable levels of antitoxin. Confirmation of a diagnosis of botulism is usually based on demonstration of the toxin in serum of
affected birds by mouse bioassay or PCR. Isolation of C. botulinum from tissues of affected birds is not definitive evidence for diagnosis of
botulism, because the organism has been isolated from healthy birds.

ULCERATIVE ENTERITIS

Ulcerative enteritis, known as quail disease, is an acute infection of young chickens, turkeys, and game birds caused by Clostridium
colinum. Quail are more susceptible than other avian species. The disease typically occurs along with or after periods of stress or other
diseases, such as coccidiosis, aplastic anemia, or bursal disease. Typical outbreaks are characterized by sudderi deaths without prior clinical
signs, watery white diarrhea in quail, and mortality up to 10% in chickens and 100% in quail.
Agent Identification. Presumptive diagnosis is based on gross lesions, including multiple necrotic areas and ulceration in small intestine and
cecum, liver necrosis, and enlarged hemorrhagic spleen. Confirmation is by isolation and biochemical characterization or demonstration of
C. colinum antigens by fluorescent antibody tests. An enterotoxemic syndrome in young broilers characterized by duodenitis, nephrosis, and
high mortality has also been associated with C. colinum infection.
Serologic Detection in the Host. A complement fixation test has been used to detect carrier birds.

NECROTIC ENTERITIS

Necrotic enteritis, caused by Clostridium perfringens types A and C, is characterized by intestinal mucosal necrosis in chickens, turkeys,
and other avian species. Predisposing factors include high-energy-high-protein rations and mucosal damage mediated by high-fiber litter and
coccidia. Occurrence of the disease also appears to be influenced by age and genetic factors. Outbreaks have been reported most frequently in
2 to 5-wk-old broilers on litter. Clinical signs are nonspecific and birds may die without prior signs. Gross lesions include necrosis of the
mucosa in the jejunum and ileum and the formation of pseudomembranes that adhere to mucosal surfaces.
Agent Identification. A presumptive diagnosis is based on gross and microscopic lesions and is confirmed by isolation of the etiologic
agent.
Serologic Detection in the Host. Serologic testing is not used in diagnosis of necrotic enteritis.

GANGRENOUS DERMATITIS

Gangrenous dermatitis, a sporadic disease of complex etiology, is characterized by necrosis of skin, subcutaneous tissue, and underlying
musculature. Signs include depression, inappetence, incoordination, leg weakness, and ataxia. C. perfringens type A, Clostridium septicum,
and Staphylococcus aureus have been most frequently associated with the disease. Predisposing factors include infection with agents that
cause immunosuppression, including infectious bursal disease virus, chick anemia virus, and avian adenoviruses. Outbreaks have been
reported in chickens and turkeys 17 days to 20 wk of age, but most commonly 4 to 8-wk old broilers have been affected. Mortality rates have
ranged from 1% to 60%.
Agent Identification. The disease is usually diagnosed on the basis of gross and microscopic lesions and isolation of Clostridium znAJtx
Staphylococcus species.
Serologic Detection in the Host. Serologic tests are not used for diagnosis of gangrenous dermatitis.

47
Stephan G. Thayer and David A. Miller
BOTULISM
INTRODUCTION
Botulism, sometimes referred to as limbemeck or western duck
sickness, results from intoxication or toxico- infection with
Clostridium botulinum. The disease occurs worldwide in free-
ranging and confined poultry and wild avian species (8). Although
the disease is usually sporadic and highly fatal, it may appear in a
variety of different ways, including a recurrent paralytic condition
in successively reared flocks on some farms (10). Eight toxigenic
types (A, B, C alpha, C beta, D, E, F, and G) of C. botulinum have
been identified. Most avian outbreaks have been caused by C.
botulinum type C. Although rare, botulism of types A and E has
occurred in small chicken flocks fed human food waste. A
contaminated feed source was incriminated in one type A outbreak
in chickens (7, 25). Epizootics of type E botulism have occurred in
wild birds in the Great Lakes area and research has suggested that
live fish can be a vector for type E toxin to waterfowl (2, 44). The
disease most often results from ingestion of preformed neurotoxin,
but no source of toxin could be identified in many broiler outbreaks.
This has lead to the conclusion that ingested bacteria elaborate the
toxin in vivo as has been shown to occur in humans with toxin type
B (8,15). Litter, decaying plant matter, feed, maggots and other
insect larvae, small crustaceans, animal carcasses, and feces have
been incriminated as sources of preformed toxin (7,13,24,25,35).
Maggots have been shown to contain up to 40,000 mouse lethal
doses of toxin per gram (13).
CLINICAL DISEASE
The neurotoxin acts at peripheral cholinergic nerve termini by
blocking release of acetylcholine (8,24). Flaccid paralysis of legs,
wings, neck, and eyelids is a characteristic sign. In mild
intoxications, only leg paralysis may be observed and affected birds
may appear dull and reluctant to move. If forced to move, birds
appear lame. Paralysis progresses cranially from the legs to the
wings, neck, and eyelids. Birds may sit with their necks and wings
outstretched and legs tucked underneath, unable to rise. The eyelids
may droop or be closed completely and birds may appear comatose
(8.25.35) . The characteristic flaccid neck paralysis seen in chickens
and turkeys may not be seen in pheasants (8,24,35). If the birds are
lifted, a curled-toe paralysis may be evident in turkeys. Broilers
may have diarrhea with increased urates in feces and turkey feces
may be darker than normal (8,35). In some outbreaks, the disease
has been limited to certain pens or sections of a chicken or turkey
house and only male turkeys have been affected (8,35). Attack rates
of 30-50% are common in chickens and turkeys. Mortality rates
may reach 40% in chickens and turkeys and have reached 100% on
some pheasant farms (8,23,35). Recovering birds usually regain
muscle control in the eyelids first, then in neck and wings, and
finally in legs over a 3 to 5-day period if given ready access to feed
and water (9,35).
SAMPLE COLLECTION
Serum is the specimen of choice for demonstrating the presence of
neurotoxin in birds. The toxin may also be demonstrated in the
liver, spleen, crop, and gastrointestinal contents. Specimens should
be collected from live birds showing clinical signs, if possible,
because postmortem decomposition may result in toxin production
from C. botulinum in the intestines leading to a misdiagnosis. Feed,
larvae, carcasses, and environmental specimens may be collected
for toxin analysis to provide evidence of the source of intoxication
(8.13.35) . Specimens should be frozen and transported to a
laboratory as soon as possible after collection. Isolation of C.
48
botulinum from tissues of affected birds has generally not been
regarded as definitive evidence to support a diagnosis of botulism,
because the organisms have been isolated from apparently normal
birds (8,25). However, other investigators reported recovering the
organism from tissues of birds only if the flock had a history of
botulism (8).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Cold gelatin diluent (pH 6.2) containing 0.4 M phosphate buffer
and 0.2% gelatin may be used to extract specimens for toxin assays
and to dilute specimens prior to inoculation of media for isolation of
C. botulinum (15). Chopped meat-glucose-starch (CMGS) medium
may be used as an enrichment medium for isolation of the
organisms (25). McClung-Toabe egg yolk agar plates are used to
streak growth from the enrichment medium for isolated colonies
and to detect lipase-positive colonies (15).
AGENT IDENTIFICATION
The mouse bioassay for detection and typing of toxin in avian
serum samples has been commonly used to demonstrate the
presence of neurotoxin (15,25,44). However the mouse bioassay is
rapidly being replaced by in-vitro assays such as the amplified
enzyme-linked immunosorbent assay * (ELISA), antigen-capture
ELISA, and immuno-polymerase chain reaction assays. These
assays approach or are as sensitive as the mouse bioassay
(5,33,43,44).
Clinical and environmental specimens intended for isolation of C.
botulinum may be inoculated into CMGS medium for enrichment in
a ratio of 1 g of specimen to 10 ml of medium. Prior to inoculation,
tissues should be macerated in a small amount of gelatin diluent,
and fecal specimens should be diluted 1:4 in gelatin diluent and the
supernatant used as inoculum. Two tubes of CMGS medium should
be held in a 100 C water bath for 10 min. One tube is then placed in
cold water and the other in an 80 C water bath. After equilibration,
1 ml or approximately 1 g of specimen is inoculated into each tube.
After inoculation, the 80 C tube is held at that temperature an
additional 10 min, followed by cooling. Both tubes are incubated
anaerobically at 30 C for 4 days. Aliquots of the cultures are
centrifuged at 12,000 x g and the supernatants are recovered for
toxin assays. Positive enrichment cultures should be streaked onto
egg yolk agar plates, which are incubated anaerobically at 35 C for
48 hr. If growth is observed only on plates from unheated
enrichment cultures, ethanol treatment of enrichment cultures may
be necessary to recover less heat-stable spore forming organisms.
To confirm the identity of isolates, lipase-positive colonies may be
incubated anaerobically in CMGS medium for 4 days at 30 C
followed by biochemical testing and toxin typing by mouse
bioassay ELISA, PCR or other methods (15).
SEROLOGIC DETECTION IN THE HOST
Serologic testing of affected birds is of little value because the
intoxicating dose of neurotoxin is less than the dose required to
produce detectable levels of antitoxin. For this reason, recovering
birds do not develop protective immunity (8).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Clinically, botulism may be similar to Marek’s disease, Newcastle
disease, avian encephalomyelitis, chemical intoxications, and
musculoskeletal problems in poultry. In waterfowl, fowl cholera,
chemical intoxication, and lead poisoning should be considered.

Differential diagnosis is based on clinical signs and a lack of gross
and microscopic lesions. Definitive diagnosis is usually based on
demonstration of toxin in serum of affected birds, followed by
identification of the toxin type (8,25). The neurotoxin’s heat labile
ULCERATIVE ENTERITIS
INTRODUCTION
Ulcerative enteritis, originally referred to as quail disease, is
caused by Clostridium colinum. The disease has worldwide
distribution and has been reported in chickens, wild and domestic
turkeys, pigeons, pheasants, grouse, partridges, and robins, but quail
are the most susceptible species. Although the disease has been
reported in adult birds, it usually affects younger birds. Outbreaks in
chickens frequently occur after or during periods of stress or other
disease conditions, such as coccidiosis, aplastic anemia, and bursal
disease. Birds become infected by ingestion of the organism in feed,
water, or litter. Premises remain contaminated with spores for
prolonged periods after outbreaks. It has been suggested that
surviving birds become chronic carriers (2,25).
CLINICAL DISEASE
Birds may die in good physical condition without prior clinical
signs. Quail may have watery white feces. Birds may be listless
with eyes partially closed and have a humped appearance.
Emaciation with breast muscle atrophy may be seen in birds in
which the clinical course is 1 wk or more. Mortality may reach 10%
in chickens and 100% in quail. Because some surviving birds have
resisted subsequent experimental challenges, active immunity
appears to develop after outbreaks. However, survivors treated with
antibiotics may remain susceptible to infection (39). An unusual
enterotoxemic syndrome in 12 to 25-day-old broilers caused by C.
colinum has also been reported in Israel. Clostridium colinum was
the only organism consistently isolated from acutely infected birds
exhibiting severe duodenitis, nephrosis, and mortality up to 50%
(27). In another report a combination of Clostridim perfringens,
Capillaria sp., Eimeria sp., Histomonas sp., and E. coli were
reported in an epizootic that involved quail (29).
SAMPLE COLLECTION
Clostridium colinum may be isolated in pure culture from liver
specimens (24). The organism may also be recovered from spleen
and intestinal lesions (39,21). Swabs or tissues collected at
necropsy should be cultured as soon as possible, and should be
placed in anaerobic transport tubes (Starswab Anerobic Transport
System, VWR International) if transportation to a laboratory is
necessary.
PREFERRED CULTURE MEDIA AND SUBSTRATES
The medium of choice for isolation of C. colinum is tryptose
phosphate agar with 0.2% glucose and 0.5% yeast extract. Ihe pH
should be adjusted to 7.2, and the medium autoclaved, followed by
cooling to 56 C and addition of 8% horse plasma. The same
medium without agar (broth) may also be used (39).
49
Chapter 13 Clostridial Diseases
nature can be demonstrated by holding culture supernatant at 100 C
for 10 min, followed by mouse inoculation. Isolates of C. botulinum
can be differentiated from other Clostridia by biochemical testing
and toxin typing (15).
AGENT IDENTIFICATION
Characteristic gross lesions include multiple necrotic areas and
ulceration in the small intestine and ceca, areas of liver necrosis,
and an enlarged hemorrhagic spleen. In quail, marked hemorrhagic
enteritis is apparent in the duodenum. Ulcers in ceca may have
central depressions containing dark debris (25,39). Chickens may
have clearly circumscribed yellow ulcers 1-5 mm in diameter in the
mucosa that are detectable from the serosal side (21). Large Gram­
positive bacilli with subterminal spores can be demonstrated in
smears of necrotic liver tissue by Gram stain. Clostridium colinum
is fastidious and some laboratories have experienced difficulty in
isolating the organism from birds with characteristic gross lesions
(21,39). Specimens intended for isolation of C. colinum should be
inoculated into pre-reduced tryptose phosphate medium and
incubated anaerobically at 37 C for 2 days. Colonies are 1-2 mm in
diameter, round, semi translucent, convex, and have filamentous
margins. Growth in broth may occur within 12-16 hr after
inoculation and is characterized by gas production that subsides 6-8
hr after it begins (1,25). Biochemical characterization should be
used to confirm the identity of an isolate. The typical gas
chromatogram will indicate acetic and formic acid production
(1,21). A fluorescent antibody test for diagnosis of ulcerative
enteritis has correlated well with presumptive diagnoses based on
gross lesions. An agar gel diffusion test has been used to detect
soluble C. colinum antigens in intestinal contents, but cross
reactions with Clostridium perfringens types A and C are a problem
(39).
SEROLOGIC DETECTION IN THE HOST
A complement fixation test has been used to detect carrier birds
(39).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Clinically, ulcerative enteritis may be similar to coccidiosis,
histomoniasis, and necrotic enteritis. Because coccidiosis may occur
before or during ulcerative enteritis outbreaks, the etiologic agents
of both diseases may be present in specimens submitted to
diagnostic laboratories. Coccidia may be demonstrated in fecal or
impression smears. Histomoniasis may present cecal and liver
lesions similar to those of ulcerative enteritis (39). Histomonas may
be demonstrated in lesions by histopathologic examination.
Clostridium perfringens, the cause of necrotic enteritis, may be
distinguished from C. colinum by cultural and biochemical
methods. Clostridium difficile resembles C. colinum biochemically,
but differs in raffinose fermentation and gelatin hydrolysis (25,39).
Stephan G. Thayer and David A. Miller
NECROTIC ENTERITIS
INTRODUCTION
Necrotic enteritis is a sporadic disease of avian species
characterized by necrosis of the intestinal mucosa primarily in the
jejunum and ileum with the formation of pseudomembranes (25).
This disease has been reported from most areas of the world in
which poultry are produced. Recent restrictions on the use of
antibiotics and some anticoccidials has played a role in the increase
in the incidence of necrotic enteritis in some parts of the world (19).
The disease affects both broilers and layers and has also been
reported in wild and domestic ducks and geese, capercaillies, and
red lories (4,26,37,40). The etiologic agents are C. perfringens types
A and C. In earlier work the alpha toxin produced by type A and
type C organisms and the beta toxin produced by type C organisms
were thought to be responsible for the necrosis of intestinal mucosa
(40). However, more recent work has discounted the role of the
Alpha toxin requirement in the production of necrotic lesions in the
intestine (20). Plasmid encoded toxin genes appear to be stable
under normal transportation and culture conditions (17).
Toxinotyping of C. perfringens can be done by PCR and multiplex
PCR (16). Predisposing factors include high-energy-high-protein
diets, rations containing high levels of fish meal, wheat, rye, barley,
and oat groats, as well as damage to the intestinal mucosa induced
by high-fiber litter and coccidial infections (4,8,14,18,21,25,31).
Coccidiosis has been the most frequently diagnosed concurrent
intestinal disease (11). Genetic susceptibility may also be a factor
influencing occurrence in chickens, as evidenced by significantly
different mortality rates between different major histocompatibility
complex genotypes (34). Outbreaks of necrotic enteritis have
occurred most frequently in broilers 2-5 wk of age raised on litter,
but have also occurred in 3 to 6-mo-old layers raised in floor pens
and 12 to 16-wk-old caged layer replacements. In turkeys the
disease has occurred primarily in birds 6-11 wk of age. The
frequency of disease occurrence has been greater in male than in
female turkey flocks (11,40). Mortality rates up to 15% have been
reported in chickens (34). Not much is known about the role of
immunity in necrotic enteritis but it has been shown that protection
is associated with immunization or infection with virulent
C. perfringens but not with avirulent strains (22).
CLINICAL DISEASE
Clinical signs may be nonspecific. Birds exhibit depression,
inappetence, reluctance to move, diarrhea, and ruffled feathers. The
clinical course is frequently short and birds may be found dead
without premonitory signs (25,40). Turkeys may be well fleshed
and feathered but severely dehydrated (14). Gross lesions are
frequently confined to jejunum and ileum and include yellow or
green pseudomembranes adherent to the mucosa (25). Cecal lesions
have also been reported and may include small areas of mucosa
covered by a thick whitish brown pseudomembrane in turkeys
(14,40). Intestines may be friable with a thickened wall distended
by gas and contain bile-stained fluid or a granular core of
fibrinonecrotic debris and litter (18,40). Tylosin phosphate at 100
ppm can be used to reduce C. perfringens colonization and thus the
severity of necrotic lesions (6).
SAMPLE COLLECTION
Clostridium perfringens can be isolated from intestinal contents,
mucosal scrapings, hemorrhagic lymphoid nodules, and swabs of
pseudomembranous lesions. Specimens should be fresh and
processed as soon as possible to increase likelihood of recovery and
50
minimize overgrowth by other organisms. If transportation of
specimens to a laboratory is necessary, use of anaerobic transport
swabs (Starswab Anerobic Transport System, VWR International)
is recommended (25,40).
PREFERRED MEDIA AND SUBSTRATES
Anaerobic blood agar and PEA agar (Phenyethanol alcohol agar)
can be used to isolate C. perfringens from specimens collected at
necropsy. PEA agar is useful where contamination with facultative
enterics and swarming enteric anaerobes interfere. Classical double
zone hemolysis is useful in detection of C. perfringens colonies
though it may be observed as only a beta-hemolysis without the
double-zone characteristic. McClung-Toabe egg yolk agar can be
used to detect lecithinase and lipase production by isolates. For
determination of toxin types, isolates should be propagated in
cooked meat medium containing 1% glucose (16,40).
AGENT IDENTIFICATION
Diagnosis of necrotic enteritis is usually made on the basis of
gross and microscopic lesions and isolation of toxigenic Cl.
perfringens. Gram stains of impression smears from intestinal
mucosa may reveal large numbers of Gram-positive bacilli (14).
Clostridium perfringens can be isolated by inoculation of pre­
reduced blood agar and PEA plates incubated anaerobically at 37 C
overnight. Isolates are characterized by smooth, circular colonies 2-
4 mm in diameter surrounded by an inner β-hemolytic zone and an
outer zone of incomplete β-hemolysis. Though this double zone is
the classical appearance this characteristic is not always seen. Gram
stains typically reveal short, thick rods with blunt ends, usually
without spores. Classical biochemical methods can be used to
confirm identity of isolates. Typical gas chromatograms indicate
production of large amounts of acetic and butyric acids with smaller
amounts of propionic and formic acids. The presence of lecithinase
and absence of lipase can be observed on egg yolk agar. As an
alternative to classical biochemical methods which may take 48
more hours to complete, the use of a pre-formed enzyme
identification system (RapID ANA Π System, Remel, Inc., Lenexa,
KS) permits 4-6 hr identification. Toxin types can be identified by
inoculation of isolates into pre-reduced cooked meat-glucose
medium, which is incubated anaerobically at least 6 hr at 37 C.
Cultures should be centrifuged and supernatants tested for toxins.
To 1.2-ml aliquots of supernatants, 0.3 ml of C.perfringens types A
and C antitoxins are added, followed by neutralization at room
temperature for 30 min, and injection of 0.5 ml intravenously into
pairs of mice. A third group of mice receives supernatant mixed
with normal horse serum as a control. Mice should be observed for
24 hr. If the isolate is type A, mice inoculated with supernatants
neutralized by type A and type C antitoxins will survive. If the
isolate is type C, only mice receiving supernatants neutralized by
type C antitoxin will survive (25,40).
Toxin typing can also be accomplished using multiplex PCR to
determine the presence of genes coding for the different toxin types
in C. perfringens isolates or in C. perfringens in the test sample
(16).
SEROLOGIC DETECTION IN THE HOST
Serologic testing is not used in the diagnosis of necrotic enteritis.

DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Necrotic enteritis may resemble ulcerative enteritis and
coccidiosis. Because necrotic enteritis and coccidiosis may occur
simultaneously, the etiologic agents of both diseases may be
present in specimens submitted to diagnostic laboratories. Lesions
of necrotic enteritis can be found in the jejunum and ileum. These
appear as ulcers or light yellow spots on the mucosal surface.
Occasionally lesions may be seen in the liver thought to be affected
GANGRENOUS DERMATITIS
INTRODUCTION
Gangrenous dermatitis is a sporadic disease of chickens and
turkeys characterized by necrosis of the skin, subcutaneous tissue,
and possibly underlying musculature. The disease has been referred
to by a variety of other names, including necrotic dermatitis,
gangrenous cellulitis, gangrenous dermatomyositis, avian malignant
edema, gas edema disease, and wing rot. The etiology appears to be
complex and may include various species of aerobic and anaerobic
bacteria. Clostridium sordellii, C. novyi, C. sporogenes, C.
subterminale, Escherichia coli, Staphylococcus epidermidis, other
Staphylococcus and Streptococcus species, and Gallibacterium
anatis biovar haemolytica (formerly Pasteurella haemolytica) have
been isolated from comparable gross lesions (3,25,30). Clostridium
chauvoei has also been isolated from chickens exhibiting
inflammatory lesions on the skin of the head with necrosis of the
comb (28). However, C. septicum, C. perfringens type A, and
Staphylococcus aureus, either singly or in combination, have been
most frequently associated with gangrenous dermatitis.
Predisposing factors are other infectious agents that suppress
immunologic functions, such as infectious bursal disease virus,
chick anemia virus, and avian adenoviruses. Some evidence exists
of a genetic effect on susceptibility, because progeny from certain
breeder flocks have consistently developed die disease after
placement. Outbreaks have been reported in chickens and turkeys
17 days to 20 wk of age, but most commonly 4 to 8-wk-old broilers
have been affected. One report documented the annual recurrence of
gangrenous dermatitis caused by C. septicum (42). Outbreaks have
also been reported in 6 to 20-wk-old layers, 20-wk-old broiler
breeders, chickens following caponization, and turkey breeder hens.
Mortality rates have ranged from 1 to 60% (25,41).
CLINICAL DISEASE
Signs include depression, inappetence, incoordination, leg
weakness, and ataxia. The clinical course may be short, usually less
than 24 hr, and birds are often found dead without prior signs. Gross
lesions include dark, wet areas of skin devoid of feathers overlying
wings, breast, abdomen, or legs. Serosanguinous fluid, with or
without gas, may accumulate under affected skin and diffuse into
surrounding subcutaneous tissues under apparently normal skin.
The underlying musculature may appear gray or tan with fluid and
gas between muscle bundles (41). A cellulitis in turkeys
characterized by swelling and vesicular lesions on the tailheads with
gelatinous fluid accumulation over the breast has been reported (3).
Usually no involvement of internal organs is observed, but
occasionally birds may have discrete white foci of liver necrosis.
Significant atrophy of the bursa of Fabricius has been reported in
some outbreaks. On histopathologic examination, large basophilic
bacilli and small cocci may be seen in subcutaneous tissues (30,41).
51
Chapter 13 Clostridial Diseases
by ascending infection if the bile ducts (cholangiohepatitis). Also a
multifocal hepatitis with accompanying fibrinoid necroses may be
seen. Cecal involvement is usually minimal. Cultural and
biochemical methods can be used to distinguish C. perfringens
from C. colinum. Coccidia can be demonstrated by microscopic
examination of fecal smears, mucosal impression smears, or
intestinal sections (19,25,40).
SAMPLE COLLECTION
Specimens or swabs of exudates and affected tissues, including
skin and underlying muscle, should be processed for bacterial
isolation as soon as possible after collection. Isolation of
Clostridium species can be enhanced by use of anaerobic transport
swabs (Star-Swab Anerobic Transport System, VWR Scientific) if
transportation to a laboratory is necessary.
PREFERRED MEDIA AND SUBSTRATES
Media for isolation and identification of Staphylococcus species
and other facultative bacteria that may be associated with
gangrenous dermatitis have been described in previous chapters.
Isolation of C. perfringens has been described earlier in this chapter
and specimens for isolation of C. septicum should be inoculated
onto blood agar and PEA (Phenylethanol) agar plates to control
swarming. McClung-Toabe egg yolk agar can be used to detect
lecithinase and lipase production of isolates (25,41).
AGENT IDENTIFICATION
Gangrenous dermatitis is usually diagnosed on the basis of gross
and microscopic lesions and isolation of Clostridium and/or
Staphylococcus species. Clostridium septicum and other clostridial
species can be isolated on pre-reduced blood agar and PEA agar
plates incubated anaerobically at 37 C overnight. On blood agar, C.
septicum will swarm the entire plate overnight. C. sordellii can
partially cover a BA plate in the same time frame. Other species
such as C. perfringens will form defined colonies. PEA will control
swarming and permit selection of defined colonies for further
isolation as well as help control contamination and unwanted
growth. Isolated colonies can be easily seen and motile Clostridia
will have irregular margins. Once isolation is achieved use of a pre­
formed enzyme identification system (RapID ANA Π System,
Remel, Inc., Lenexa, KS) permits 4-6 hr identification. Fluorescent
antibody conjugates are available for presumptive identification of
several clostridial species in specimens and in culture. A more
classical approach would include growth on egg yolk agar
demonstrating a lack of lecithinase and lipase production. The
identity of isolates could then be confirmed biochemically. The
typical gas chromatogram will indicate production of large amounts
of acetic and butyric acids, usually with large amounts of formic
acid (25,41).
SEROLOGIC DETECTION IN THE HOST
Serologic testing is not used to diagnose gangrenous dermatitis.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Because viral infections may predispose birds to gangrenous
dermatitis, viral isolation and identification should be done (25). A
variety of other skin conditions may appear similar to this disease,
Stephan G. Thayer and David A. Miller
including mycotic dermatitis, ulcerative dermatitis of broilers,
plantar pododermatitis of turkeys, scabby hip lesions of broilers,
ulcerative squamous cell carcinoma, nutritional deficiencies, and
genetically related slow feathering of male chickens. Mycotic
dermatitis can be diagnosed by demonstration of fungal elements in
impression smears or isolation of the agents. Ulcerative dermatitis
and plantar pododermatitis are usually associated with wet or poor
litter conditions. Staphylococcus species and C. perfringens have
been recovered in pure culture from some birds with scabby hip
lesions and may be primary or secondary etiologic agents of that
condition (32). Squamous cell carcinoma can be diagnosed by
histopathologic examination.
REFERENCES
1. Berkhoff, H. A. Clostridium colinum sp. nov., nom. rev., the causative
agent of ulcerative enteritis (quail disease) in quail, chickens, and pheasants.
Int. J. Syst. Bacteriol. 35:155-159. 1985.
2. Brand, C. J., S. M. Schmitt, R. M . Duncan, and T. M. Cooley. An
outbreak of type E botulism among common loons (Gavia immer) in
Michigan’s upper peninsula. J. Wildl. Dis. 24:471-476. 1988.
3. Carr, D., D. Shaw, D. A. Halvorson, B. Rings, and D. Roepke. Excessive
mortality in market-age turkeys associated with cellulitis. Avian Dis.
40:736-741. 1996.
4. Chakrabarty, A K., B. R. Boro, A. Mukit, B. M Dutta, and Μ M.
Baruah. An epomitic of enteritis in brahminy ducks (Todoma ferruginea)
due to enterotoxigenic strains of Clostridium perfringens type C. J. Zoo.
Anim. Med. 14:24-27. 1983.
5. Chao, Η. Y., Y. C. Wang, S. S. Tang, and H. W. Liu. A highly sensitive
lmmuno-polymerase chain reaction assay for Clostridium botulinum
neurotoxin type A. Toxicon. 43:27-34. 2004.
6. Collier, C. T., J. D. van der Klis, B. Deplancke, and D. B. Anderson.
Effects of tylosin on bacterial mucolysis, Clostridium perfringens
colonization, and intestinal barrier function in a chick model of necrotic
enteritis. Antimicrob. Agents Chemother. 47:3311-3317. 2003.
7. Craven, S. E., Colonization of the Intestinal Tract by Clostridium
perfringens and Fecal Shedding in Diet-Stressed and Unstressed Broiler
Chickens. Poult. Sci. 79:843-849. 2000.
8. Dohms, J. E. Botulism In: Diseases of Poultry, 11th ed. Y.M. Saif, H. J.
Barnes, J. R. Glisson, A. M Fadly, L. R. McDougald, and D. E. Swayne,
eds. Iowa State Press, Ames, Iowa. pp. 785-791. 2003.
9. Dohms, J. E., P. H. Allen, and J. K. Rosenberger. Cases of type C
botulism in broiler chickens. Avian Dis. 26:204-210. 1982.
10. Dohms, J. E., P. H. Allen, and S. S. Cloud. The immunization of broiler
chickens against type C botulism Avian Dis. 26:340-345. 1982.
11. Droual, R., T. B. Farver, and A. A. Bickford. Relationship of sex, age,
and concurrent intestinal disease to necrotic enteritis in turkeys. Avian Dis.
39:599-605. 1995.
12. Fach, P., M Gibert, R. Griffais, and M. R. Popoff. Investigation of
animal botulism outbreaks by PCR and standard methods. FEMS Immunol.
Med. Microbiol. 13:279-285. 1996.
13. Foreyt, W. J., and F. R. Abinati. Maggot-associated type C botulism in
game farm pheasants. J. Am. Vet. Med. Assoc. 177:827-828. 1980.
14. Gadzinski, P., and R. J. Julian. Necrotic enteritis in turkeys. Avian Dis.
36:792-798. 1992.
15. Hatheway, C. L. Laboratory procedures for cases of suspected infant
botulism Rev. Infect. Dis. 1:647-651. 1979.
16 Heikinheimo, A., and H. Korkeala. Multiplex PCR assay for
toxmotyping Clostridium perfringens isolates obtained from Finnish broiler
chickens. Lett. Appl. Microbiol. 40:407-411. 2005.
17. Johansson, Anders. Clostridium perfringens the causal agent of necrotic
enteritis in poultry. Doctoral thesis. Swedish University of Agricultural
Sciences. Uppsala, Sweden. 2006.
18. Kaldhusdal, M., and M Hofshagen. Barley inclusion and avoparcin
supplementation in broiler diets: 2. Clinical, pathological, and
bacteriological findings of necrotic enteritis. Poult. Sci. 71:1145-1153.
1992.
19. Kaldhusdal, Magne, and Atle Lovland. Clostridial necrotic enteritis and
choiangiohepatitis. The Elanco Global Enteritis Symposium Abtract G-l-
14. Cambridge, July 9-11. 2002.
20. Keybum, Anthony L., Scott A. Sheedy, Mark E. Ford, Mark M
Williamson, Milena M. Awad, Julian I. Rood, and Robert J. Moore. Alpha­
Toran of Clostridium perfringens is not an essential virulence factor in
necrotic enteritis in chickens. Infect. Immun. 74:6496-6500. 2006.
52
21. Kondo, F. Ulcerative enteritis in broiler chickens caused by Clostridium
colinum and in vitro activity of 19 antimicrobial agents in tests on isolates.
Poult. Sci. 67:1424-1430. 1988.
22. Kulkami, R. R., V. R. Parreira, S. Sharif, and J. F. Prescott. Clostridium
perfringens antigens recognized by broiler chickens immune to necrotic
enteritis. Clin. Vacc. Immunol. 13:1358-1362. 2006.
23. Kurazono, Η., K. Shimozawa, and G. Sakaguchi. Botulism among
penned pheasants and protection by vaccination with Cl toxoid. Res. Vet.
Sci. 38:104-108. 1985.
24. Linares, J. A., R. L. Walker, A. A. Bickford, G. L. Cooper, and B. R.
Charlton. An outbreak of type C botulism in pheasants and subsequent
occurrence in chickens. J. Vet. Diagn. Invest. 6:272-273. 1994.
25. Miller, David A. Clostridial Diseases. In: Isolation and Identification of
Avian Pathogens, 4th ed. D. E. Swayne, J. R. Glisson, M. W. Jackwood, J.
E. Pearson, W. M. Reed (eds.). American Association of Avian Pathologists:
Kennett Square, PA, 61—68. 1998.
26. O’Toole, D., K. Mills, R. Ellis, R. Farr, and M Davis. Clostridial
enteritis in red lories (Eos bomea). J. Vet. Diagn. Invest. 5:111-113. 1993.
27. Perelman, B., S. Mints, M. Zjut, E. Kuttin, and S. Machny. An unusual
Clostridium colinum infection in broiler chickens. Avian Pathol. 20:475-
480. 1991.
28. Prukner-Radovcic, E., L. Milakovic-Novak, S. Ivesa-Petricevic, andN.
Grgic. Clostridium chauvoei in hens. Avian Pathol. 24:201-206. 1995.
29. Radi, Zaher Ahmed An Epizootic of Combined Clostridium
perfringens, Eimeria spp., and Capillaria spp. Enteritis and Histomonas spp.
Hepatitis with Escherichia coli septicemia in Bobwhite Quails (Colinus
virginianus). Int’l J. Poult. Sci. 3:438-441. 2004.
30. Reece, R. L., V. D. Beddome, and D. A. Ban. Diseases diagnosed in
broiler chicken flocks in Victoria, Australia, 1977 to 1984. Vet. Rec.
116:315-320. 1985.
31. Riddell, C., and X. M Kong. The influence of diet on necrotic enteritis
in broiler chickens. Avian Dis. 36:499-503. 1992.
32. Scanlan, C. M., and B. M Hargis. A bacteriologic study of scabby-hip
lesions from broiler chickens in Texas. J. Vet. Diagn. Invest. 1:170-173.
1989.
33. Sharma, S. K., J. L. Ferreira, B. S. Eblen, and R. C. Whiting. Detection
of type A, B, E, and F Clostridium botulinum toxins in foods by using and
amplified enzyme-linked immunosorbent assay with digoxigenin-labeled
antibodies. Appl. Environ. Microbiol. 72:1231-1238. 2006.
34. Siegel, P. B., A S. Larsen, C. T. Larsen, and E. A Dunnington.
Resistance of chickens to an outbreak of necrotic enteritis as influenced by
major histocompatibility genotype and background genome. Poult. Sci.
72:1189-1191. 1993.
35. Smart, J. L. Type C botulism in intensively farmed turkeys. Vet. Rec.
113:198-200. 1983.
36. Smith, G. R., and J. C. Oliphant. Diagnosis of botulism in water birds.
Vet. Rec. 112:457^158. 1983.
37. Stuve, G., M Hofshagen, and G. Holt. Necrotizing lesions in the
intestine, gizzard, and liver in captive capercaillies (Tetrao urogallus)
associated with Clostridium perfringens. J. Wildl. Dis. 28:598-602. 1992.
38. Thomas, R. J. Detection of Clostridium botulinum types C and D by
ELISA. Aust. Vet. J. 68:111-113. 1991.
39. Wages, D. P., Ulcerative Enteritis (Quail Disease). In: Diseases of
Poultry, 11th ed. Y.M Saif, H. J. Barnes, J. R. Glisson, A. M Fadly, L. R.
McDougald, and
D. E. Swayne, eds. Iowa State University Press, Ames, Iowa. pp. 776-781.
2003.
40. Wages, D. P., and K. Opengart. Necrotic Enteritis. In: Diseases of
Poultry, 11th ed. Y.M. Saif, H. J. Barnes, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, eds. Iowa State University Press, Ames,
Iowa. pp. 781-785. 2003.
41. Wages, D. P., and K. Opengart. Gangrenous Dermatitis. In: Diseases of
Poultry, 11th ed. Y.M. Saif, H. J. Barnes, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, eds. Iowa State Press, Ames, Iowa. pp. 791-
795. 2003.
42. Willoughby, D. H, A. A Bickford, G. L. Cooper, and B. R. Charlton.
Periodic Recurrence of Gangrenous Dermatitis associated with Clostridium
septicum in a Broiler Chicken Operation. J. Vet. Diag. Invest. 8:259-261.
1996.
43. Wu H.C., Y. L. Huang, S. C. Lai, Y. Y. Huang, and M. F. Shaio.
Detection of Clostridium botulinum neurotoxin A using immuno-PCR. Lett.
Appl. Microbiol. 32:321-325. 2001.
44. Yule, Adam M., Ian K. Barker, John W. Austin and Richard D. Moccia.
Toxicity of Clostridiium botulinum type E neurotoxin to Great Lakes fish:
Implications for avian botulism. J. Wildlife Dis. 42: 479-493. 2006.
 14
TUBERCULOSIS
Susan Sanchez and Richard M. Fulton

SUMMARY. Tuberculosis in commercial poultry occurs at a very low frequency. Tuberculosis is most common in small hobby poultry
flocks and pet birds; it is occasionally reported in captive bird collections and may occur in wild birds. The disease in birds is caused by
Mycobacterium avium subsp. avium. Mycobacteria are hardy organisms that can survive in the environment for several years. Avian
tuberculosis is a chronic disease leading to severe emaciation. The most common route of infection is fecal-oral.
Agent Identification. Multiple white nodular lesions on and/or in internal organs warrant the inclusion of avian tuberculosis in the
differential diagnosis. Finding acid fast bacilli in smears of the lesions and/or with histopathology allows confirmation of a diagnosis of
avian tuberculosis. Culture with identification of the organism and/or positive PCR further confirms the diagnosis.
Serologic Detection in the Host. Serologic tests are not readily available and do not appear to be as reliable as serologic tests of other
disease agents. Tuberculin testing may be a useful tool to detect infected chickens within a flock.

INTRODUCTION Tubercles may also be found on the serosal surfaces of intestines as

Tuberculosis in commercial poultry has a very low rate of
occurrence. It is most commonly found is small hobby poultry
flocks and pet birds. Occasionally, it is reported to occur in wild
birds and captive bird collections (14, 26). The disease in birds is
mostly caused by Mycobacterium avium subsp. avium serotypes 1,
2, or 3. Mycobacterium genavense has been isolated with
increasing frequency from pet and zoo collection birds (7, 18, 19,
20, 25, 26, 28, 33). Mycobacteriosis in poultry is a chronic disease
leading to emaciation and death (43). M avium belongs to the slow
growing non-tuberculous bacteria group and together with M.
intracellulare (serotypes 7, 12 to 20, and 22 to 28) form the
Mycobacterium avium Complex (MAC). There is evidence for a
third species in this group, generally referred to as MAC-X (45).
MAC organisms’ reservoir is in the environment; they have been
isolated from water, soil and plants. All members of the MAC have
been isolated from animals. M. avium may be further divided into
three subspecies namely M. avium sbsps. paratuberculosis isolated
from ruminants and free-ranging birds (2, 8), M. avium sbsps.
silvaticum isolated from a penguin and wood pigeons and M. avium
subsp. avium isolated from birds. In 2002 Mijs and his
collaborators suggested that M. avium sbsps. avium should be
further subdivided based on phenotypic and genotypic grounds in to
M. avium sbsps avium for isolates originating from birds and
Mycobacterium avium sbsps. hominissuis (serotypes 4, 6, 8 to 11,
and 21) for isolates recovered from humans and animals (1, 23).
Although disease in poultry is mostly attributed to one subspecies
in pet and wild birds, speciation of mycobacterium isolates is
warranted as they have been reported as being infected with several
subspecies of M. avium and species of Mycobacterium including M.
tuberculosis, M. bovis, M. fortuitum, and M. genavense (6, 7, 19).
CLINICAL DISEASE
Birds of all ages, and most likely all species, appear to be
susceptible to M. avium sbsps avium. Signs and lesions are most
common in older birds due to the slow progression of the illness.
Not all birds in an infected production flock will show signs of
illness even though they are infected. Some birds will go out of egg
production while others, although infected, will continue to lay
eggs. (16) Infected birds lose weight gradually, become unthrifty in
appearance, and eventually die. Birds may not show signs of illness
or gross lesions in the early stages of the disease.
Gross Lesions
Tubercles are the most prominent gross lesions of avian
tuberculosis; they appear as white to yellow to tan nodules of
various sizes (from pinpoint up to more than a centimeter).
Tubercules are found most commonly, in order of frequency, in the
parenchyma of spleen, liver, bone marrow, and thymus (10).
53
well as within the parenchyma of other internal organs, such as
lung, and are postulated to reflect route of exposure (27). On cut
surface tubercles may be solid and white or have central areas that
are yellow and easily crumbled, which suggests caseation. (10, 14,
16, 40).
A presumptive diagnosis of tuberculosis may be made at necropsy
based on emaciation and nodular lesions. Bone marrow nodules are
also supportive of that diagnosis, as they are not often seen in other
diseases. For definitive diagnosis, further testing such as acid-fast
stain of smears or lesions, culture with identification, and/or
polymerase chain reaction (PCR) is necessary.
Microscopic Lesions
Microscopic lesions of avian tuberculosis consist of granulomas.
They may be composed of aggregated epithelioid macrophages or
have centrally-located, granular debris, derived from local and/or
inflammatory cells, which is surrounded by epithelioid
macrophages with admixed multinucleated giant cells and a
peripheral zone of low numbers of lymphocytes and plasma cells.
Calcification and fibrosis are not features of avian tuberculosis as in
mammalian tuberculosis. In addition, multi-nucleated giant cells
are few in number in avian tuberculosis compared to that of
mammals. Acid-fast bacilli are usually found in large numbers in
epithelioid macrophages. (10,43)
SAMPLE COLLECTION
Smears and Sections
Acid-fast smears and histopathologic sections can be prepared
from tubercles. Smears may be made by placing small tubercles
between two glass slides, compressing the tubercle between the
slides followed by sliding one slide off of the other. Some tubercles
can have the surface scraped with a scalpel blade followed by
impression smears of the lesion. Slides are then air dried followed
by staining with an acid-fast stain or auramine-rhodamine or both at
the same time.
For histopathologic sections, select parenchymal or serosal
tubercles for fixation and processing. Experimentally inoculated
chickens routinely exhibit miliary lesions in spleen, and liver while
lesions are less frequently observed in bone marrow, lung, and
thymus (10, 32). Thus, in infection of short duration, tubercles may
be easily overlooked. In early stages of the disease, a tuberculin
positive chicken may have few or no visible lesions.
Histopathologic examination of liver, spleen, and bone marrow
from these birds may reveal granulomas not grossly visible.
Susan Sanchez and Richard M. Fulton
Isolation and Identification
For bacteriologic culture select spleen, liver, bone marrow, or
tubercles on the peritoneal surface, in that order of preference.
Femur marrow is useful from birds with postmortem autolysis.
Specimens must be removed with sterile instruments and ground to
a paste in sterile conditions with sufficient sterile water to form a
suspension thin enough to pipette. If the bird is freshly killed, the
tissue suspension can be transferred directly to slants of solid
media. Sample decontamination should only be attempted if the
sample is thought to be contaminated or culture is attempted from
feces. The decontamination process also destroys mycobacterial
cells and concentration of mycobacteria is recommended after this
process to enhance isolation. The most common decontaminant is
sodium hydroxide (see Appendix I for detail method).
In some instances isolation of the causative agent is not necessary
or not possible yet confirmation of mycobacteriosis is important. In
such situations detection of mycobacterial DNA using PCR is a fast
and very reliable option. Results can be obtained within the same
day of sample collection (34, 35).
PREFERRED CULTURE MEDIA AND SUBSTRATES
For primary cultures, only solid media are recommended.
M. avium sbsps. avium grows well on commercially available media
used for isolating Mycobacterium tuberculosis, such as
Lowenstein-Jensen (LJ) inspissated egg medium or Middlebrook
7H10 agar (Difco, Detroit, Mich.). The addition of sodium
pyruvate, 4.1 g per liter of 7H10 medium, is recommended for
isolating M, avium sbsps. avium from tissues (41). Suitable growth
will develop on blood agar, especially if the base agar has 2.0%
glycerol. If subcultures in liquid media are desired, Proskauer-
Beck liquid medium containing 5.0% serum or Middlebrook 7H9
liquid medium may be used (37). Pet birds can be infected with M.
genavense, which just like M. avium silvaticum, requires
mycobactin supplementation for growth. LJ slants supplemented
with mycobactin should be set up side by side with non­
supplemented LJ slants.
AGENT IDENTIFICATION
Smears and Section
Acid-Fast Stains. In domestic poultry, M. avium infection may be
diagnosed when acid-fast bacilli are demonstrable in smears of
typical lesions. The Kinyoun modification of the Ziehl-Neelsen
stain is recommended because the procedure is performed without
heat (37) (Table 14.2). Using new slides, make thin smears from
scrapings of cut surfaces of lesions; air-dry and fix by flaming for 1
sec. Cover the slide with a strip of filter paper and flood with
carbolfuchsin solution for 5 min. Wash with water and carefully
remove paper. Apply decolorizer until thick areas are clear and no
more stain flows off. Wash with water. Flood with counterstain for
1 min. Wash with water, drain, and blot with new paper or air-dry.
The acid-fast bacilli in lesions will be red coccoid or bacillary cells,
0.5-1.0 pm long, occurring singly or in large clumps.
Examining sections from acid-fast bacilli may be less fruitful than
examining smears because of the small amount of tissue seen per
field. For histopathology, a technique should be chosen that permits
study of the lesion and staining for acid-fast bacilli as described by
Feldman (13).
54
Fluorochrome Stain. An alternate method for a quick
identification is to use fluorescent microscopy; in this case, the
acid-fast stain is a mixture of auramine and rhodamine. Auramine-
rhodamine are non-specific fluorocromes that bind selectively to
mycolic acids, staining target organisms fluoresce orange-yellow
under UV light. Slides must be examined under ultraviolet light
with a microscope equipped with special filters (37). This stain is
more sensitive due to its minimal background allowing for the study
of the smear with lower magnification. It also has the advantage that
it can be used in conjunction with other stains.
Isolation and Identification
Any doubt about the diagnosis can be resolved only by isolating
the microorganism as described under sample collection above. For
epidemiologic studies, avian mycobacteria must be isolated in pure
culture for serotyping. Isolation and identification of M. avium may
require a minimum of 4 wk and negative samples can only be
discarded after 8 wk.
All initial growth must be stained for acid-fast bacilli to ensure
purity of culture. For optimal recovery, samples may be plated in
both liquid and solid media. Culture in liquid media is faster than on
solid media. Media can be selective (includes antibiotics) if
contamination is suspected or is elected to forgo the
decontamination process. The following media enhance the growth
of MAC organisms and may be used preferentially in a poultry
diagnostic laboratory (see appendix 1 for a more extensive list of
media): Lowenstein-Jensen medium or other suitable slants, tubes
of Proskauer-Beck liquid medium containing 5% serum or
Middlebrook which contains 2% glycerol. Isolated mycobacteria
can be used in subsequent tests for pathogenicity determination and
in in vitro differential tests (12). PCR has been used for rapid
identification of MAC organisms (34). Restriction fragment length
polymorphism (RFLP) typing, using the insertion sequence IS 1245
as probe, allows for the classification as a “bird type” isolate (23,
36). Isolates from the same serotype can belong to different
IS1245RFLP types (36); however, available probes do not provide
for differentiation of serovars (9).
Incubation
An atmosphere of 5-10% carbon dioxide (CO2) and a temperature
of 41 C are optimum for M. avium sbsps. avium, but 37 C is
satisfactory. Cultures can be transferred to an air incubator after 7
days of CO2 incubation. Commercial sachet CO2 generators are
acceptable alternatives in the absence of CO2 incubators. Cultures
should be examined twice a week for the first 4 wk (removing any
with contamination) and then once a week for 8 wk or longer if
there are positive smears or histopathology. This regime will also
allow for the isolation of other Mycobacterium spp. present in pet
birds.
Growth and Morphologic Characteristics
In lesions, M, avium sbsps. avium is a short (0.5-1.5-pm) acid-fast
rod. In cultures, M. avium sbsps avium may develop as acid-fast
branching filaments up to 10 cm in length. Growth can be seen as
soon as 14-21 days on solid medium incubated at 37 C
(temperature range 35 to 41 C). M. avium sbsps. hominissuis will
grow at 45 C while isolates of M. avium sbsps. avium will not grow
at this temperature; is the only way to presumptively distinguish
between the two subspecies without the aid of molecular
diagnostics (23). Colonies are flat, smooth, and glistening; rough,
with irregular edge and non-pigmented variants are common with in
the same culture. The color varies from colorless to light buff to
slightly yellowish, which becomes more prominent with age (3,12).
In liquid medium, the growth is turbid, with sediment, but no
pellicle.

Biochemical Characteristics
Mycobacterium avium does not produce niacin, does not hydrolyze
Tween 80, does not produce urease and does not reduce nitrate, but
does reduce tellurite (5). Acid-fast bacteria isolated from typical
tuberculosis lesions in poultry and having these features can be
assumed to be M. avium sbsps. avium.
Niacin Production. With rare exceptions of the slowly growing
mycobacteria, only M. tuberculosis yields a positive reaction for
niacin. A luxuriant 3-4-wk growth on Lowenstein-Jensen medium
or a 2-wk growth in Proskauer-Beck liquid medium is necessary to
test for niacin production. Add 1 ml of sterile water to the growth
on solid medium and allow to stand for 20 min on a horizontal
slant; add 1 ml of aniline solution (Table 14.3) and, after 5 min, add
1 ml of the cyanogen bromide solution (Table 14.3). A yellow
color will appear if niacin is present. This method is rarely
performed any more as impregnated paper strips are commercially
available. For the paper strip method, add water as described and
stand for 20 min for extraction, collected 0.5ml of the water and
placed in a sterile container with the paper strip, cap fast and let it
stand for 15min. A positive reaction will show as yellow color of
the liquid (not of the strip).
Urease Hydrolysis. M. avium and M. intracellulare do not
hydrolyze urea. This test is useful in distinguishing some pigmented
strain M. avium from M. scrofulaceum, and other slow growing
mycobacteria. The test media is prepared by mixing 1 part of urea
agar base concentrate with 9 parts of distilled water and dispensed
in 4ml volumes into tubes. A loopful of bacteria is emulsified in a
test tube containing this media and incubated at 37 C for 3 days. A
positive reaction is indicated by a pink or red color change.
Tween 80 Hydrolysis. Mycobacterium avium does not hydrolyze
Tween 80 in 10 days, whereas the similar-appearing
Mycobacterium terrae, Mycobacterium gas tri, and Mycobacterium
triviale will do so in less then 5 days (36). Inoculate substrate
(Table 14.4) with a 5-mm loopful of bacteria. Hydrolysis of the
Tween 80 is indicated when the solution becomes pink. Observe at
24hrs, 5 days, and 10 days and record color change. M. avium will
produce no change in color.
Nitrate Reduction. Mycobacterium avium does not reduce nitrate,
but some slow-growing mycobacteria, particularly M. triviale, may
reduce nitrate. Suspend a 5-mm loopful of 10-to-14-day-old
growing culture in 0.5 ml of sterile water and add 2 ml of buffered
sodium nitrate solution (Table 14.5); place in a water bath at 37 C
for 2 hr, and then add 1 drop of the HC1 solution, 2 drops of the
sulfanilamide solution, and 2 drops of the naphthylaminediamine-2
HC1 solution. Cultures of M. avium sbsps. avium reveal no color
change, indicating a negative test. If nitrate is reduced, a deep pink
color will occur.
Tellurite Reduction. Mycobacterium avium gives a positive test
for tellurite reduction, whereas the superficially similar M. terrae,
M. gas tri, and M. triviale do not. The medium used is
commercially available Middlebrook 7H9 liquid medium or
Proskauer-Beck medium without glycerol but with 5% serum. The
medium is dispensed in screw-capped tubes in 5.0-ml amounts.
Inoculate with a 10 to 14-day-old growing culture using a 5-mm
loop. Incubate for 7-10 days, then add 0.2 ml sterile 0.2%
potassium tellurite solution and reincubate for 3 days. A definite
black deposit on the bottom of the tube indicates reduction of the
potassium tellurite. Laboratories with only occasional need to
identify M. avium or other mycobacteria may send cultures to a
reference laboratory for supplemental tests.
Molecular identification
Mycobacterial culture is the gold standard for definitive diagnosis
of mycobacteriosis in birds after the microscopic examination of
tissues and/or exudates. However, these methods are slow and
cannot reliably determine the exact species or subspecies (34, 35).
Molecular probes, such those of the commercial assays AccuProbe
55
Chapter 14 Tuberculosis
(Gene-Probe, San Diego, CA, USA) System and the INNO-LiPA
Mycobacteria v2 (Innogenetics, Ghent, Belgium) are among the
most widely used. They allow for species identification after
bacterial culture (14). PCR has the advantage of being a very fast
and specific test allowing results to be obtained within hr of the
sample arriving at the laboratory without the need for culture. There
are many published validated assays that can be used if the
diagnostic laboratory has molecular diagnostic capability (4, 17, 22,
28, 29, 34, 35, 44). In the clinical veterinary laboratory is becoming
widely accepted that the future of mycobacteria identification lies in
the use of PCR due to its speed and accuracy.
Typing of Isolates
Serological typing of isolates using agglutination allows for the
recognition of a least 28 serovars of M. avium, and
Mycobacterium intracellulare and is based on their surface
glycopetidolipids. However, not all isolates can be reliably typed
using this method as some are non-typable. Isolates belonging to
serovars 1, 2 and 3 are ascribed to M. avium sbsps. avium, serovars
4 to 6, 8 to 11 and 21 to M avium sbsps. hominissui, and servars 7,
12 to 20 and 22 to 28 to M. intracellualre isolates (1). Serovar
prevalence in poultry varies among countries and host species (21).
Newer typing methods using the ELISA format detecting cell-wall-
specific targets and using monoclonal antibodies are currently
available for the major serovars as well as thin-layer
chromatography of lipids. Procedures for preparing the antisera and
for conducting the tests have been described in detail elsewhere
(31). Molecular typing of isolates, is also useful; pulse field gel
electrophoresis and large DNA restriction fragment length
polymorphism (RFLP) are very discriminatory. RFLP typing, using
the insertion sequence IS 1245 as probe, has recently been shown to
allow for the classification as a “bird type” isolate (23, 36). Isolates
from the same serotype can belong to different IS 1245 RFLP types
(36); however, available probes do not provide for differentiation of
serovars (8). Serotyping in combination with RFLP may be useful
in epidemiological studies.
Pathogenicity
Intracellular survival of M. avium is due to this bacterium’s ability
to inhibit macrophage phagosomal maturation. This has been
mainly attributed to the ability of the organism to inhibit
phagolysosome fusion in macrophages and the presence of an
electron-transparent extracellular capsule following the
accumulation of glycopeptidolipids in the cell envelope (30). These
glycopeptidolipids have been found to be relatively resistant to
macrophage degradation; therefore, they persist during infection
and may play a role in altering host response.
Intravenous injection of 0.01 mg of growing culture into chickens
or rabbits results in disseminated disease with enlargement of the
spleen and liver and death in 30-60 days. Subcutaneous or
intramuscular injections of this amount of inoculum cause disease
that progresses more slowly, but is still fatal. In guinea pigs, 0.01
mg given subcutaneously causes only a local abscess that eventually
may heal (13). M. avium can cause disease and tuberculin
hypersensitivity in many species of mammals, including humans
(42). Strains of M. avium serovar 1 have been isolated in patients
with acquired immune deficiency syndrome (15).
SEROLOGIC DETECTION IN THE HOST
Several serologic tests for diagnosis have been described, but their
practicality must await further studies (38). An enzyme-linked
immunosorbent assay has been developed (40).
The tuberculin test is a satisfactory means of detecting Μ avnat
infection in a flock of chickens. The M. avium purified protein
derivative tuberculin prepared by the U.S. Department of
Agriculture is used without dilution. Lyophilized purified protein
Susan Sanchez and Richard M. Fulton

derivative tuberculin must be reconstituted according to directions
of the manufacturer. With a 25-gauge needle, about 0.05 ml of
tuberculin is injected into the skin of one wattle to form a bleb or
blanched area. Each bird is examined in 48 hr. A positive test is
indicated by edema of the wattle, with swelling up to five times the
normal thickness, as compared with the other wattle (38). Chickens
with extensive tuberculous lesions may fail to react. In early stages
of the infection, the tuberculin test may be positive before any
grossly visible lesions are present. The tuberculin test may be
applied at 1 or 2-mo intervals for monitoring the occurrence of the
disease; but because each bird must be handled twice, tuberculin
testing may not be practical.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
In chickens and in other birds, any disease that causes granulomas
or produces nodules may mimic avian tuberculosis grossly. Thus,
differentiation from other causes require further analysis. Bacteria,
such as Escherichia coli, Staphylococcus sp., Enterococcus sp. and
Salmonella sp., and fungal agents such as Aspergillus sp. produce
granulomas that may be confused with avian tuberculosis.
Neoplasms whether caused by viruses, such as Marek’s disease
virus or avian leukosis virus, or spontaneously occurring may
mimic avian tuberculosis by forming solid masses within the
parenchyma or on the serosal surface of organs. None of these
diseases mimicking avian tuberculosis will contain acid-fast bacilli
Table 14.1. Reagents of Kinyoun stain for acid-fast bacilli.
and therefore would not have acid-fast bacilli in smears or in
examined sections of lesions. Thus, smears or histopathology are
diagnostic in these instances. In cases of persistent unexplained
death loss within a flock where birds die in the early stages of
infection without granuloma formation, many birds may have to be
examined over time to confirm the presence of Mycobacterium
avium subsp. avium.
APPENDIX I
Sodium Hydroxide decontamination method
Decontamination is necessary because any extraneous
microorganisms will contaminate and overgrow the culture of
slowly growing mycobacteria. Place 10-20 ml of tissue suspension
in the bottom of a 50-ml screw-capped centrifuge tube and add an
equal amount of decontaminant (Table 14.1).
Agitate for 5-10 sec on a vortex mixer. Allow to stand at room
temperature for 15 min; tissue with evidence of contamination can
stand for no more than 25 min. Neutralize with HC1 and then
centrifuge for 10 min at 1,000 x g. Do not use the centrifuge brake.
(If smears of the original material reveal one or more acid-fast
bacilli per field, concentration by centrifugation is not necessary.)
Remove the supernatant fluid aseptically and place in 5% phenol.
Transfer the sediment to slants of solid media with a swab or a 5-
mm loop.

Constituent Amount

Carbolfuchsin solutionA
Basic fuchsin 4.0 g
Phenol (melted) 8.0 ml
Ethyl alcohol (95%) 20.0 ml
Distilled water 68.0 ml

Decolorizer
HC1 (concentrate) 12.0 ml
Ethyl alcohol (95%) 388.0 ml

Counterstain
Methylene blue 4.0 g

Tap water 400.0 ml

A Allow mixture to stand for 24 hr, then filter through paper and store in a stoppered bottle.

Table 14.2. Aniline and cyanogen bromide solutions for the niacin test.

Constituent Amount

Aniline solution
Aniline 4.0 g
Alcohol (absolute) 96.0 ml

Cyanogen bromide solution

Cyanogen bromide 10.0 g
Distilled water 90.0 ml

Table 14.3. Substrate for Tween 80 hydrolysis test*1.

Constituent Amount

Phosphate buffer, 0.067 M, pH 7.0

100.0 ml
Tween 80
0.5 ml
Neutral red, 0.1% aqueous solution 2.0 ml

ADispense in 4.0-ml amounts in screw-capped tubes and autoclave for 10 min at 121 C. The solution should have an amber color.

56
 Chapter 14 Tuberculosis

Table 14.4. Reagents for the nitrate reduction test.

Constituent Amount

Buffered nitrate solution

NaNO3 0.085 g
KH2PO4 0.117 g
Na2HPO4.-12H2O 0.485 g
Distilled water 100.0 ml

Autoclave for 10 min at 121 C

HC1 (concentrate) 50.0 ml
Distilled water 50.0 ml
Sulfanilamide 0.2%
Naphthylaminediamine-2 HC1 0.1%

Table 14.5. Reagents used for decontamination of samples.

Constituent Amount

Decontaminant
NaOH (reagent-grade) 20.0 g
Sterile distilled water 1000.0 ml
Neutralizer
HC1 (concentrate) 82.5 ml
Sterile distilled water 917.5 ml
Bromcresol purple solution 4.5 ml

Bromcresol purple solution

Bromcresol purple 1-2 g
Alcohol (95%) 50.0 ml
Distilled water 50.0 ml

ACKNOWLEDGEMENT lymphoid systems in avian tuberculosis. Am. J. Path. 64:-97-122,1971.

The authors wish to thank Charles O. Thoen for previous contributions to
this chapter.
REFERENCES
1. Bartos, Μ, P. Hlozek, P. Svastova, L. Dvorska, T. Bull, L. Matlova, I.
Parmova, I. Kuhn, J. Subbs, M Moravkova, J. Kintr, V. Beran, I.
Melicharek, M Ocepek and I. Pavlik Identification of members of
Mycobacterium avium species by ACCU-Probes, serotyping, and single
IS900, IS907, IS7245 and IS907-flanking region PCR with internal
standards. J. Microbiol. Meth. 2005 Jul 29; [Epub ahead of print]
2. Beard, P. Μ, M J. Daniels, D. Henderson, A. Pirie, K. Rudge. D.
Buxton, S. Rhind, A. Creig, M R. Hutchings, I. McKendrik, K. Stevenson,
and J. M Sharp. Paratuberculosis infection of non-ruminant wildlife in
Scotland. J. Clin. Microbiol. 39:1517-1521. 2001.
3. Belisle, J. T., and P. J. Brennan. Molecular basis of colony morphology
in Mycobacterium avium. Res. Microbiol. 145(3):237-242. 1994.
4. Boian, Μ, T., E. Avaniss-Aghajani, R Walker, T. Aronson, T. Tran, N.
Glover, O. G. W. Berlin, L. Woods, C. Brunk, J. L. Li, S. Froman, and A.
Holtzman. Identification of Mycobacterium genavense in intestinal tissue
from a parakeet using two polymerase chain reaction methods: are pets are
reservoir of infection in AIDS patients? AIDS 111:255-256. 1997.
5. Boughton, E. Tuberculosis caused by Mycobacterium avium. Vet. Bull.
39:457^165. 1969.
6. Britt, J. Ο., E. B. Howard and W. J. Rosskopf. Psittacine tuberculosis.
Cornell Vet. 70:218-225,1980.
7. Buogo, C. H., L. Bacciarinini, N. Robert, T. Bodmer, and J. Nocolet.
Presence of Mycobacterium genavense in birds. Schweiz. Arch. Tierheilkd.
139:397-402. 1997.
8. Com J. L., E. J. B. Manning, S. Sreevatsan, and J. R. Fisher. Isolation of
Mycobacterium avium subsps. paratuberculosis from free-ranging birds and
mammals on livestock premises. Appl. Environ. Microbiol. 71: 6963-6967.
2005.
9. Crawford, J. T. Development of rapid techniques for identification of
Mycobacterium avium infection. Res. Microbiol. 145(3): 177-180. 1994.
10. Cheville, N. F. and W. D. Richards. The influence of thymic and bursal
11. Cromie, R. L., M J. Brown, N. A. Forbes, J. Morgan and J. L. Stanford.
Av. Pathology. 22:617-630,1993.
12. Engbaek, H. C., E. H. Runyon, and A. G. Karlson. Mycobacterium
avium Chester: designation of the neotype strain. Int. J. Syst. Bacteriol.
21:193-196. 1971.
13. Feldman, W. H. Avian tuberculosis infections. Williams & Wilkins
Co., Baltimore, Md. pp. 116-138. 1938.
14. Gerhold, R. W., and J. R. Fisher. Avian tuberculosis in a wild turkey.
Av. Diseases 49:164-166,2005
15. Good, R. C. Opportunistic pathogens in the genus Mycobacterium.
Annu. Rev. Microbiol. 39:347-369. 1985.
16. Gonzalez, M. A. Rodriguez-Bertos, I. Gimeno, J. M Flores and M
Pizarro. Outbreak of avian tuberculosis in 48-wk-old commercial layer hen
flock. Av. Diseases 46:1055-1061. 2002.
17. Gyimesi, Z. S., I. H. Stalis, J. M Miller, and C. O. Thoen. Detection of
Mycobacterium avium in formalin-fixed tissues of captive birds using
polymerase chain reaction. J. Zoo. Wildl. Med. 30:348-353. 1999.
18. Hoop, R. K., E. C. Bottger, P. Ossent, and M salfinger.
Mycobacteriosis due to Mycobacterium genavense in six pet birds. J. Clin.
Microbiol. 31:990-993. 1993.
19. Hoop, R. K., E. C. Bottger, and G. E. Pfyffer. Etiological agents of
mycobacteriosis in pet birds between 1986 and 1995. J. Clin. Microbiol.
34:991-992. 1996.
20. Kiehn, T. E., H. Hoefer, E. C. Bottger, R. Ross, M. Wong, F. Edwards,
N. Antinoff, and D. Armstrong. Mycobacterium genavense infections in pet
animals. J. Clin. Microbiol. 34:1840-1842. 1996.
21. Meissner, G., J. Viallier, and D. Coullioud. Identification serologique
de 1590 souches de Mycobacterium avium isolees en France et en
Allamagne Federate. Ann. Microbiol. (Inst. Pasteur) 129A: 131-137. 1978.
22. Mendenhall, Μ K., S. L. Ford, C. L. Emerson, R. A. Wells, L. G.
Gines, and I. S. Eriks. Detection and differentiation of Mycobacterium
avium and Mycobacterium genavense by polymerase chain reaction and
restriction enzyme digestion analysis. J. Vet. Diagn. Invest. 12 :57-60. 2000.
23. Mijs, W., P. de Haas, R. Rossau, T. Van Der Laan, L. Rigouts, F.
Portaels and D. van Soolingen. Molecular evidence to support a proposal to
reserve the designation Mycobacterium avium subsp. avium for bird-type
isolates and “M. avium subsps. hominissuis ” for the human/porcine type of
M. avium. Int. J. Syst. Evol. Microbiol. 52:1505-1518. 2002.

57
Susan Sanchez and Richard M Fulton
24. Montali, R. J., M Bush, C. O. Thoen, and E. Smith. Tuberculosis in
captive exotic birds. J. Am. Vet. Med. Assoc. 169:920-927. 1976.
25. Panigraphy B., F. D. Clark, and C. F. Hall. Mycobacteriosis in
psittacine birds. Avina Dis. 27:1166-1168. 1983.
26. Painter, K. S., Avian tuberculosis caused by Mycobacterium avium
serotype 3 in captive wildfowl. Vet. Record. 4557-458,1997.
27. Peavy, G. M., S. Silverman, E. B. Howard, R. S. Cooper, L. J. Rich and
G. N. Thomas. Pulmonary tuberculosis in a sulfur-crested cockatoo. J. Am.
Vet. Med. Assoc. 69:915-919,1976.
28. Portaels F., L. Realini, L. Bauwens, B. Hirschel, W. M Meyers, and W.
De Meurichy. Mycobacteriosis caused by Mycobacterium genavense in
birds kept in a zoo: 11-year survey. J. Clin. Microbiol. 34:319-323. 1996.
29. Ramis, A., L. Ferrer, A. Aranaz, E. Liebana, A. Mateos, L. Dominguez,
C. Pascual, J. Fdez-Garayazabal, and M D. Collins. Mycobacterium
genavense infection in canaries. Av. Diseases. 40:246-251. 1996.
30. Rastogi, N., and W. W. Barrow. Cell envelope constituents and the
multifaceted nature of Mycobacterium avium pathogenicity and drug
resistance. Res. Microbiol. 145:243-252. 1994.
31. Schaefer, W. B. Serologic identification and classification of the
atypical mycobacteria by their agglutination. Am. Rev. Respir. Dis.
92(2): 85-93. 1965.
32. Smith, I. M., S. T. Licence, and R. Hill. Effect of repeated injections of
iron dextran on the haematological, serological and pathological changes in
experimental avian tuberculosis. Res. Vet. Science. 25:284-289,1978.
33. Tell L. A., L. Woods, And R.I. Cromie. Mycobacteriosis in birds. Rev.
Sci. Tech. Off. Int. Epizoot. 20:180-203. 2001.
34. Tell L. A., C. M Leutenegger, R. S. Larsen, D. W. Agnew, L. Keener,
M L. Needham, and B. A. Rideout. Real-time polymerase chain reaction
testing for the detection of Mycobacterium genavense and Mycobacterium
avium Complex species in avian samples. Av. Diseases. 47:1406-1415.
2003a.
35. Tell L. A., A. L. Woods, and J. Foley. M L. Needham and R. L.
Walker. Diagnosis of mycobacteriosis: comparison of culture, acid-fast
stains, and polymerase chain reaction for the identification of
Mycobacterium avium in experimentally inoculated Japanese quail
(Coturnix japonica}. Av. Diseases. 47:444-452. 2003b.
58
36. Thegerstrom J., B. Marklund, S. Hoffner, D. Axelsson-Olsson, J.
Kauppinen, and B. Olsen. Mycobacterium avium with the bird type IS 1245
RFLP profile is commonly found in wild and domestic animals, but rarely in
humans. Scjnd. J. Infect. Dis. 37:15-20. 2005.
37. Thoen, C. O. Mycobacterium. In: Diagnostic procedures in veterinary
bacteriology and mycology, 5th ed. G. C. Carter and J. L. Cole, eds.
Academic Press, San Diego, Calif, pp. 287-298. 1990.
38. Thoen, C. O. Tuberculosis. In: Diseases of poultry. 10th ed. B. W.
Calnek, H. J. Bames, C. W. Beard, L. R. McDougald, and Y. M Saif, eds.
Iowa State University Press, Ames, Iowa. pp. 167-178. 1997.
39. Thoen, C. O., and R. Chiodini. Mycobacterium. In: Pathogenisis of
bacterial infections in animals C. L. Gyles and C. O. Thoen, eds. Iowa
State University Press, Ames, Iowa. pp. 44-56. 1993.
40. Thoen, C. O., W. G. Eacret, and E. M. Himes. An enzyme-labeled
antibody in chickens infected with Mycobacterium avium serotype 2. Avian
Dis. 22:162-165. 1978.
41. Thoen, C. Ο., E. M. Himes, and A. G. Karlson. Mycobacterium avium
complex. In: The mycobacteria: a sourcebook. G. P. Kubica and L. G.
Wayne, eds. Marcel Dekker Inc., New York. pp. 1251-1275. 1984.
42. Thoen, C. O., and D. E. Williams. Tuberculosis, tuberculoidoses and
other mycobacterial infections. In: Handbook of zoonoses, 2nd ed.. G. W.
Beran, ed. CRC Press, Boca Raton, Fla. pp. 41-60. 1994.
43. Thorel, M F., H. Huchzermeyer, R. Weiss, and J. J. Fontaine.
Mycobacterium avium infections in animals. Literature review. Vet. Res.
28: 439-447.
44. Thornton C. G., M R. Cranfield, K. M MacLellan, T. L. Brink, Jr., J. D.
Strandberg, E. A. Carlin, J. B. Torrelles, J. N. Maslow, J. L. B. Hasson, D.
M Heyl, S. J. Sarro, D. Chatteijee, and S. Passen. Processing postmortem
specimens with Cig-caboxypropylbetaine and analysis by PCR to develop
and antemortem test for Mycobacterium avium infections in ducks. J. Zoo
Wildl. Med. 30:11-24. 1999.
45. Wayne, L., R. Good, M Krichevsky, Z. Blacklock, H. David, D.
Dawson, W. Gross, J. Hawkins, V. Levy-Frebault, C. McManus, F. Portaels,
S. Rusch-Gerdes, K. Schroder, V. Silcox, M Tsukamura, L. Van den Breen
and M Yarkrus. Fourth report of the cooperative open-ended study of slowy
growing mycobacteria of die international Working Group on mycobacterial
Taxonomy. Int. J. Syst. Bacteriol. 41: 463-472. 1991.
 15
MYCOPLASMOSIS
Stanley H. Kleven

SUMMARY. The pathogenic avian mycoplasmas, Mycoplasma gallisepticum, Mycoplasma synoviae, Mycoplasma meleagridis, and
Mycoplasma iowae, are associated with respiratory disease, synovitis, poor performance, skeletal deformities, or embryo mortality in
chickens and turkeys. These mycoplasmas are egg transmitted, and (except for M. iowae) are covered by control programs administered
under the National Poultry Improvement Plan. The majority of broilers and turkeys in the United States are reared free of infection.
Mycoplasma gallisepticum and M. synoviae are frequently found in commercial layers; egg production losses due to M. gallisepticum are
generally controlled by vaccination.
Agent Identification. Serologic diagnosis is frequently verified by isolation and identification of the etiologic agent or by polymerase chain
reaction. All of the pathogenic avian mycoplasmas exhibit significant intraspecies variability in virulence, tissue tropism, and antigenic
makeup. DNA fingerprinting using random amplified polymorphic DNA or targeted gene sequencing may be utilized for epidemiologic
studies or for identifying specific strains, such as vaccine strains of M. gallisepticum.
Serologic Detection in the Host. Serum plate agglutination tests or enzyme-linked immunosorbent assays are used for screening and
preliminary diagnosis, and reactors are generally confirmed by hemagglutination inhibition. No serologic tests are available for M. iowae.

INTRODUCTION
Mycoplasmas are small prokaryotic organisms lacking a cell wall.
Numerous species of avian Mycoplasma have been described and
characterized. Table 15.1, adapted from Jordan (26) with
information from other sources (6, 7, 8, 17, 18, 34, 44, 45), lists
these species along with their biochemical reactions and usual host.
At least four species of Mycoplasma apparently are isolated from
ratites. Future additions to this list are likely as additional isolates
are characterized.
CLINICAL DISEASE
Four avian mycoplasmas are commonly recognized as poultry
pathogens: Mycoplasma gallisepticum, Mycoplasma synoviae,
Mycoplasma meleagridis, and Mycoplasma iowae.
M. gallisepticum is a cause of respiratory disease and egg
production drops in chickens, turkeys, and other avian species, and
M. gallisepticum is the most economically important of the avian
mycoplasmas (39). Severe airsacculitis, coughing, rales, and poor
growth may be observed in broilers or turkeys infected with
M. gallisepticum, with heavy condemnations from airsacculitis at
processing. Swollen sinuses are commonly seen in turkeys.
Mycoplasma gallisepticum infection is widespread in house finches
(Carpodacus mexicanus) in the eastern United States (40, 41), and
has been shown to be a cause of conjunctivitis. Mycoplasma
synoviae causes lesions of synovitis in chickens, turkeys, and other
species and is also involved in respiratory disease (31).
Mycoplasma meleagridis, found only in turkeys, causes respiratory
disease in young turkeys and is involved in stunting, poor
feathering, and leg problems (11). Mycoplasma iowae is a cause of
late embryo mortality and reduced hatchability in turkeys (9).
Mycoplasma gallisepticum, M. synoviae, M. meleagridis, and
M. iowae are egg-transmitted, and may be spread laterally by direct
or indirect contact. The mode of egg transmission of M. meleagridis
is venereal; infection of the phallus of the male results in
contaminated semen, which contaminates the oviduct of the female.
SAMPLE COLLECTION
During the acute stages of infection (up to 60-90 days
postinfection), the population of organisms in the upper respiratoiy
tract and the incidence of infection in the flock are high. In such
cases 5-10 cultures from the trachea or choanal cleft are often
sufficient. However, in chronic cases or when infection with
Mycoplasma strains of low pathogenicity is suspected, as many as
30-100 individuals should be cultured. When airsacculitis or
synovitis is present, lesions should be cultured. Organisms tend to
59
disappear from lesions after a few weeks, but they persist in the
upper respiratory tract. For culture of embryonating eggs for
M. gallisepticum, M. synoviae, or M. meleagridis, samples of yolk
that contain a portion of the yolk membrane should be included. For
M. iowae, culture of the esophagus of pipped embryos or 1-day-old
poults, or from cloaca, phallus or semen of breeding adult turkeys
should be obtained.
In the case of M. meleagridis, culture of the phallus or vagina of
breeding-age turkeys may be useful. In some cases, culture of other
tissues such as oviduct, cloaca, or brain may be desirable.
When specimens must be stored or shipped to a laboratoiy,
inoculate broth medium with the specimen on the farm and ship by
overnight carrier to the laboratory. Pre-wetting of the swabs in broth
medium or PBS may improve recovery rates. Inoculated broth
cultures are viable for several days at room temperature, although
they should be incubated as soon as possible. Swabs may be kept
moist at refrigerator temperature up to 24 hr if necessary.
Alternatively, tracheas, fluids, or tissues can be collected and frozen
on dry ice. Isolation of mycoplasmas is generally successful when
specimens are preserved on dry ice and arrive at the laboratory still
frozen. Shipment on wet ice may be necessary in some cases, but
specimens should be cultured within 24 hr, if possible.
No special procedures for serum collection are needed for
serologic testing. However, nonspecific agglutination may occur
with frozen sera, so fresh serum should be used for serum plate
agglutination tests. Either fresh or frozen serum is suitable for other
serologic tests.
PREFERRED CULTURE MEDIA AND SUBSTRATE
No single medium formulation has been universally accepted as
optimum for the growth of all avian Mycoplasma species.
Mycoplasmas are fastidious organisms that require a protein-based
medium enriched with 10%—15% serum or serum factors. Glucose
is fermented by M. gallisepticum, M. synoviae, M. iowae, and
several other species and is a common supplement. A yeast source
factor may be beneficial and is usually supplied by commercial
yeast autolysate or by fresh yeast extract. Mycoplasma synoviae
requires nicotinamide adenine dinucleotide (NAD), and cysteine
hydrochloride is added as a reducing agent for the NAD.
Mycoplasmas are resistant to penicillin (because they lack a cell
wall) and are relatively resistant to thallium; most media contain
these components to avoid bacterial and mycotic contamination. In
general, horse serum should be used in media for M. meleagridis,
swine serum for M. synoviae, and either horse or swine serum for
M. gallisepticum. Serum should be heat inactivated at 56 C for 30
min. Because of the variability in the ability of batches of serum to
support growth, each batch should be tested before use.
Stanley H. Kleven
Table 15.2 shows examples of commonly used formulations for
media that have been shown to support the growth of all avian
mycoplasmas and acholeplasmas. These are modifications of media
described by Frey et al. (19) and Bradbury (5).
Cotton swabs from trachea, air sac, or other tissue, or
approximately 0.1 ml of fluid from swollen sinuses or joints, are
inoculated into 3-5 ml of broth medium, and the swab is discarded.
Pieces of air sac, trachea, or other tissue may be inoculated directly
into broth medium; however, the inoculum should be small, because
tissue enzymes tend to break down glucose and cause a drop in pH,
or tissue inhibitors may be present. Therefore, too large an
inoculum may inhibit growth. Some laboratories make serial
dilutions of the inoculum in broth to avoid the inhibitory effects of a
large inoculum. Sometimes agar plates are inoculated
simultaneously with the broth, but broth cultures are generally more
sensitive. Incubation is at 37 C. Ordinarily, aerobic incubation is
sufficient, although some laboratories may prefer to incubate under
CO2. For M. synoviae, M. gallisepticum, and other glucose
fermenters, cultures are incubated until the phenol red indicator
changes in color from red to orange or yellow, and then plates and
fresh tubes of broth are inoculated. Do not allow broth cultures to
continue to incubate after the phenol red indicator changes to
yellow, because mycoplasmas (especially M synoviae) may be
sensitive to low pH. For nonfermenters, cultures are plated at about
5 days of incubation and again at 10-14 days. Agar plates can be
divided into sections so that six to eight cultures can be inoculated
on a single agar plate. Cotton swabs, microbiological loops, or
Pasteur pipettes can be used to inoculate agar plates. Plates are
incubated in a closed jar to prevent dehydration. For M. meleagridis
and M. iowae, primary isolation directly on agar plates may be more
successful than inoculating broth medium.
Agar plates are examined for Mycoplasma colonies under low
magnification (about 35 x) using an ordinary light microscope with
the light intensity reduced, or with a dissecting microscope. With
several of the nonpathogenic species, such as Acholeplasma
laidlawii, Mycoplasma gallinarum, or Mycoplasma gallinaceum,
colonies may be observed as early as 24 hr postinoculation.
However, with the pathogenic species (M. gallisepticum,
M. synoviae, and M. meleagridis), colonies are usually not observed
until 4—5 days of incubation at 37 C, but it some instances they may
be present after 3 days. Mixed cultures are common, especially in
multiage commercial layers, which may make recovery of the
pathogenic species more difficult. The most commonly encountered
nonpathogenic species are M. gallinarum and M. gallinaceum.
AGENT IDENTIFICATION
Tiny, smooth colonies 0.1-1 mm in diameter with dense, elevated
centers are suggestive of Mycoplasma species. Although
biochemical reactions (Table 15.1) may be useful at times,
identification of isolates is ordinarily by serologic methods, using
hyperimmune serum prepared in rabbits (46). For most tests, it is
important to ensure that the antiserum does not contain antibodies
against the serum present in the medium being used to propagate
the Mycoplasma isolate to be identified. This can be accomplished
by growing the antigen to be used for hyperimmunization in
medium containing serum from the animal to be immunized.
However, in most cases it is sufficient to grow antigen for preparing
hyperimmune serum in medium containing serum from a species
other than the serum being used in ordinary Mycoplasma medium.
For example, cultures to be used for immunizing rabbits are grown
in medium containing calf serum, and medium containing swine
serum is used for all other purposes.
60
A commonly used method for Mycoplasma identification is
growth inhibition (12). The surface of agar plates is evenly coated
with a moderate inoculum (usually a 1:10 to 1:1000 dilution of a
broth culture; too large an inoculum may give false negative
results), and filter paper discs impregnated with specific
hyperimmune serum are placed on the surface. After incubation at
37 C for several days, a zone of inhibition of colony formation
surrounding the disc indicates a positive test. The growth inhibition
procedure requires the use of pure cultures. Cultures may be cloned
by aspirating single colonies with a Pasteur pipette and inoculating
broth medium. After sufficient growth occurs in broth, the medium
should be filtered through a 0.45 pm filter to eliminate clumped
cells, and re-plated on agar. Cultures should be cloned up to three
times to ensure purity.
In many laboratories, direct immunofluorescence is the preferred
method of identifying isolates of avian mycoplasmas (47), although
many laboratories prefer an indirect procedure. Fluorescein is used
to conjugate high titered specific rabbit antiserum. Two to three
drops of diluted conjugate are placed on suspect colonies inside
a plastic cylinder on an agar plate, which is incubated at 37 C for 30
min. Washing is accomplished by filling the cylinder with
phosphate-buffered saline (PBS) and removing it by gentle suction.
The stained agar blocks that contain the colonies can then be placed
on a glass slide and examined with a fluorescent microscope at 35-
*.
100 Microscopes equipped with an ultraviolet (UV) light
source transmitted through a dry darkfield condenser are useful for
this purpose; for this procedure, agar blocks should be mounted face
down (toward the UV light source). This setup has the advantage of
making location of colonies using incandescent light easy; the light
source can then be switched to UV to examine the colonies for
fluorescence. Epifluorescence also works well; colonies should be
mounted face up. Immunofluorescence has the advantage of
accuracy and speed (an isolate can be examined within 1-2 hr), and
it can be effectively used with mixed cultures.
Molecular identification
Polymerase chain reaction (PCR) can be used to identify the
species of avian Mycoplasma isolates. The PCR product is cut with
one or more restriction enzymes, and the patterns can be used to
identify the species (15, 37). In addition, species-specific DNA
probes (29) or species specific PCR primers (3, 4, 20, 24, 27, 28,
35, 36, 38,42,43) can be used.
Mycoplasma gallisepticum strains differ in virulence and
antigenicity. Additional strain variation has been detected by
polyacrylamide gel electrophoresis of mycoplasmal proteins (30),
by restriction endonuclease analysis of DNA (32), and by Southern
blot hybridization using a DNA probe prepared from the ribosomal
RNA gene of Mycoplasma capricolum (48).
A rapid and accurate method for DNA fingerprinting utilizes
arbitrary primed PCR or random amplified polymorphic DNA. This
technique utilizes short, arbitrary PCR primers, which generate
reproducible patterns in agarose gels (10, 13, 14, 21). This method
is rapid and simple, and has proven to be very useful for rapid
identification of strains of M. gallisepticum, M. synoviae, M.
meleagridis, and M. iowae for epidemiologic studies. However,
there may be problems with reproducibility, so strains to be
compared must be run on the same gel. Also, interpretation of
banding patterns which appear to be similar can be difficult.
Gene targeted sequencing (GTS), using PCR primers for the mgc2,
gapA, pvpA, and MGA 0309 genes of M. gallisepticum can be used
to provide an accurate and reproducible method of typing of strains
which will allow rapid global comparisons between laboratories
(16). Preliminary strain identification with diagnostic PCR primers
for the mgc2 gene for M. gallisepticum or the vlhA gene for
M. synoviae by sequencing of die PCR product allows for
preliminary strain identification without the need for prior isolation
of the organism (24, 25). However, unrelated strains sometimes

have identical sequences using these primers, and further
characterization may be necessary.
Amplified Fragment Length Polymorphism (AFLP) is a powerful
and reproducible tool for identification of avian Mycoplasma
species (25) or for differentiating among strains of M. gallisepticum
(23), but the method is somewhat complex and requires DNA
sequencing equipment and expensive software.
SEROLOGIC DETECTION IN THE HOST
Serologic testing is the basis of voluntary control programs within
each state and as part of the National Poultry Improvement Plan (1).
Screening of poultry flocks for infection with the pathogenic
mycoplasmas is generally accomplished with the serum plate
agglutination (SPA) test (1). Generally, 10% of the flock (or a
minimum of 300 birds) is tested before the onset of egg production,
and approximately 30 birds per flock are tested every 60-90 days
thereafter. Serologic testing is also used as a laboratory diagnostic
aid.
The SPA test is quick, inexpensive, and highly sensitive. Infected
birds may test positive as early as 7-10 days after infection. The test
involves the use of specific stained antigens for M. gallisepticum,
M. synoviae, and M. meleagridis. Antigens are available
commercially (Intervet America, Millsboro, Del.; and Charles River
Laboratories, Wilmington, Mass.). Approximately 0.02 ml of serum
and 0.03 ml of antigen are mixed on a glass plate. The plate is
rotated for 2-3 min, and the tests are examined for visible
clumping. Antigens obtained from different sources may differ in
sensitivity and specificity (2), but variations also exist between
batches. Occasionally, agglutination tests are insensitive for the
detection of M. synoviae antibodies in turkeys.
The greatest disadvantage of the SPA test is low specificity (false
positive reactions). These have been related to medium components,
primarily serum, adhering to the surface of the Mycoplasma
organisms used to prepare the antigen, although false positive
reactions may often be unexplained (2). False positive reactions are
commonly seen after chickens or turkeys have been vaccinated with
inactivated oil emulsion vaccines against other infectious agents,
especially if there are remnants of serum in the vaccine (22). Such
false positive reactions may persist up to 4-8 wk or longer after
vaccination. In addition to false positive reactions related to
medium components, cross-reacting antigens shared among
Mycoplasma species or between mycoplasmas and bacteria may
occur. Several cross-reacting antigens between M. gallisepticum
and M. synoviae are known to occur.
Flocks with SPA reactors should be confirmed as positive or
negative with the hemagglutination-inhibition (HI) test or other
acceptable serologic test, or the agent can be detected by culture or
by PCR. Some laboratories prefer to use serum dilutions with the
SPA for confirming reactors. Serial twofold dilutions of the serum
are made in a buffer such as PBS, and the SPA test is conducted on
the diluted sera. Sera that react at 1:8 or 1:10 or greater are
considered positive. Overall, the SPA dilution system works well,
but weak but specific SPA reactors may be negative with the serum
dilution test, and strong false positive reactors may react at 1:8 or
greater.
Agglutination reactors are generally confirmed with the HI test.
Antigen is prepared by harvesting an actively growing culture by
centrifugation, suspending the packed cells in a small amount of
PBS, and mixing with an equal volume of glycerol. Aliquots are
preserved by freezing at -70 C. Hemagglutination antigen for M.
gallisepticum and M. synoviae are available commercially (Charles
River SPAFAS, Storrs, Conn.) The procedure for M. gallisepticum,
61
Chapter 15 Mycoplasmosis
M. synoviae, and M. meleagridis HI tests varies from other HI
procedures as follows (1): Mycoplasma HI tests are usually
conducted in microtiter plates, using 4 hemagglutinating units of
antigen per test using the β procedure (constant antigen-diluting
serum), although in practice the antigen concentration can be
reduced somewhat to improve sensitivity as long as negative control
sera still are solidly negative. The first serum dilution (1:10) is
made in buffer and is used as a serum control. All higher serum
dilutions are made directly in antigen. An alternative method is to
prepare serum dilutions in buffer and then add antigen. Some
batches of antigen tend to give occasional low-titered background
reactions up to 1:20 to 1:40 with negative sera. In such cases, the
antigen strength should be increased enough to suppress that effect,
even at the expense of sacrificing sensitivity. Also, reading positive
results only when hemagglutination is 100% inhibited helps to
eliminate nonspecific reactions. Generally, HI titers of 1:40 to 1:80
or greater are considered to be positive, but the interpretation of
results must be done on a flock basis. The HI test is considered to
be highly specific but less sensitive than the SPA test. Infected birds
may not test positive until 2-3 wk or longer after infection. In
addition, antigenic variation exists among M. gallisepticum strains
as measured by HI. Antigen prepared from one M. gallisepticum
strain may not adequately detect HI antibodies in chickens infected
with a different strain (33).
Enzyme-linked immunosorbent assays have also been developed
in several laboratories (16,28), and commercial test kits are
available (IDEXX, Westbrook, Maine, and Synbiotics, San Diego,
Cal.). Such systems are reliable for detecting antibodies against M.
gallisepticum or M. synoviae. The kits detect antibodies at about the
same time after infection as the HI test. Although the quality of the
commercial test kits is good, false positive results may sometimes
occur.
In many situations, serologic testing may not give a definitive
diagnosis, especially when positive agglutination reactions occur
that cannot be confirmed by HI testing. Retesting may be required
in such cases. When retesting is needed, isolation and identification
of the organism or PCR may result in a faster and more definitive
diagnosis than repeated serologic testing. No serologic tests exist
for avian mycoplasmas other than M. gallisepticum, M. synoviae,
and M. meleagridis.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Mycoplasma infections of poultry may be readily confused with
other respiratory diseases and may be obvious only when present in
conjunction with complicating respiratory infections such as
Newcastle disease or infectious bronchitis. Secondary bacterial
invasion associated with airsacculitis is often significant;
Escherichia coli is the bacterial species most frequently isolated.
Mycoplasma gallisepticum infection must be ruled out whenever
sinusitis or respiratory disease is present in turkeys, although M.
gallisepticum infection may be confused with avian influenza,
chlamydiosis, Newcastle disease, fowl cholera, or respiratory
cryptosporidiosis.
Mycoplasma synoviae infection should be considered whenever
synovitis lesions are present. Differentiation from infectious
tenosynovitis, infection with Staphylococcus aureus, or other
bacterial infection is essential. Mycoplasma meleagridis infection in
turkeys should be considered when air sac lesions are found in
young poults or when stunting and/or skeletal problems are present.
Mycoplasma iowae infection should be ruled out in cases of reduced
hatchability with late embryo mortality in turkeys.
Stanley H. Kleven

Table 15.1. Characteristics of avian mycoplasmas from various hosts

Mycoplasma species Usual host Glucose fermentation Arginine hydrolysis

Acholeplasma laidlawiiK Various +

M. anatis Duck +

M. anseris Goose +

M. buteonis Buteo hawk +

M. cloacale Turkey +

M. columbinasale Pigeon +

M. columbinum Pigeon +

M. columborale Pigeon +

M. corogypsi Black vulture +

M. falconis Saker falcon . +

M. gallinaceum Chicken +

M. gallinarum Chicken +

M. gallisepticum Chicken and Turkey +

M. gallopavonis Turkey +

M. glycophilum Chicken +

M. gypis Griffon vulture +

M. imitans Duck, goose, partridge +

M. iners Chicken +

M. iowae Turkey + +

M. lipofaciens Chicken + +

M. meleagridis Turkey +

M. pullorum Chicken +

M. sturni European starling +

M. synoviae Chicken and turkey +

Ureaplasma galloraleQ Chicken and turkey

62
 Chapter 15 Mycoplasmosis

Table 15.2. Formulations for two commonly used media for the isolation and propagation of avian mycoplasmas.
Medium Ingredient Amount
Frey’s medium BBL Mycoplasma broth base (Becton Dickinson, Sparks, Md) 22.5 g
Glucose 3g
Swine serum 120 ml
Yeast extract 35 ml
Cysteine hydrochloride® 0.1 g
Nicotinamide adenine dinucleotide (NAD)B 0.1 g
Phenol red (1%) 2.5 ml
Thallium acetate (10%)c 3ml
Penicillin G potassium9 106 units
Distilled water q.s. 1000 ml

Adjust pH to 7.8 with 20% NaOH and filter sterilize®4"

PPLO broth Difco PPLO broth without crystal violet (Becton Dickinson, Sparks, Md.) 21 g
Glucose 10g
Swine serum 150 ml
Yeast extractA 100 ml
Cysteine hydrochloride® 0.1 g
Nicotinamide adenine dinucleotide (NAD)® 0.1 g
Phenol red (1%) 2.5 ml
Thallium acetate (10%)c 3 ml
Penicillin G potassium9 106 units
Distilled water q.s. 1000 ml

Adjust pH to 7.8 with 20% NaOH and filter sterilize®4"

A Fresh yeast extract (also available commercially) is made by placing 250 g dry baker’s or brewer’s yeast in 1 liter distilled H2O and allowing to soak 1 hr. Heat to
boiling, allow to cool, and centrifuge at 3000 x g for 20 min. Decant the supemate and adjust the pH of the fluid to 8.0 with 0.1 M NaOH. Clarify by filtration
through coarse filter paper and sterilize by filtration. Dispense in aliquots and store at 20 C.
B Reduced NAD is required for M synoviae only. A 1% solution each of NAD and cysteine is mixed in equal parts, and 20 ml is added per liter of medium
c For potentially contaminated specimens, add an extra 20 ml of 1% thallium acetate per liter of medium to bring the total concentration to 1:2000. Add thallium
acetate to the distilled H2O before the other ingredients to prevent precipitation of protein.
D For potentially contaminated material, an extra 2 χ 106 units of penicillin may be added per liter of medium; 200 mg to 1 g of ampicillin per liter of medium will
substitute.
E Alternatively, all ingredients except cysteine/NAD, serum, penicillin, and yeast extract may be autoclaved at 121 C for 15 min, and the remaining ingredients are
added aseptically after sterilization by filtration.
F For agar medium, use 1% of a purified agar such as Difco purified agar. All components except cysteine/NAD, serum, and penicillin are sterilized by autoclaving
at 121 C for 15 min. Cool to 50 C and aseptically add the above components that have been sterilized by filtration and warmed to 50 C. Mix and pour plates to a
depth of approximately 5 mm

REFERENCES 6. Bradbury, J.M. and M Forrest. Mycoplasma cloacale, a new species

1. Anonymous, National Poultry Improvement Plan and Auxiliary
Provision. Vol. APHIS-91-55-063. Washington, DC. 2004.
2. Avakian, A.P., S.H. Kleven, and J.R. Glisson. Evaluation of the
specificity and sensitivity of two commercial enzyme-linked immunosorbent
assay kits, the serum plate agglutination test, and the hemagglutination­
inhibition test for antibodies formed in response to Mycoplasma
gallisepticum. Avian Dis. 32:262-272. 1988.
3. Bencina, D., M Drobnic-Valic, S. Horvat, M Narat, S.H. Kleven, and P.
Dove. Molecular basis of the length variation in the N-terminal part of
Mycoplasma synoviae hemagglutinin. FEMS Microbiol Lett. 203:115-23.
2001.
4. Boyle, J.S., R.T. Good, and C.J. Morrow. Detection of the turkey
pathogens Mycoplasma meleagridis and M iowae by amplification of genes
coding for ribosomal-RNA. J. Clin. Microbiol. 33:1335-1338. 1995.
5. Bradbury, J.M Rapid biochemical tests for characterization of the
Mycoplasmcfates. J. Clin. Microbiol. 5:531-534. 1977.
isolated from a turkey. Int. J. Syst. Bacteriol. 34:389-392. 1984.
7. Bradbury, J.M, M. Forrest, and A. Williams. Mycoplasma lipofaciens, a
new species of avian origin. Int. J. Syst. Bacteriol. 33:329-335. 1983.
8. Bradbury, J.M, F. Jordan, T. Shimizu, L. Stipkovits, and Z. Varga.
Mycoplasma anseris sp. nov found in geese. Int. J. Syst. Bacteriol. 38:74-76.
1988.
9. Bradbury, J.M and S.H. Kleven, Mycoplasma iowae infection. In:
Diseases of Poultry, 11th, ed Y.M Saif, et al., Editors. Iowa State
University Press: Ames, Iowa. p. 766-771. 2003.
10. Charlton, B.R., A.A. Bickford, R.L. Walker, and R. Yamamoto.
Complementary randomly amplified polymorphic DNA (RAPD) analysis
patterns and primer sets to differentiate Mycoplasma gallisepticum strains. J.
Vet. Diag. Invest. 11:158-61. 1999.
11. Chin, R.P., G. Y. Ghazikhanian, and I. Kempf. Mycoplasma meleagridis
infection. In: Diseases of Poultry, 11th. ed Y.M. Saif, et al., Editors. Iowa
State University Press: Ames, Iowa. p. 744-756. 2003.

63
Stanley H. Kleven
12. Clyde, W.A. Mycoplasma species identification based upon growth
inhibition by specific antisera. J. Immunol. 92:958-965. 1964.
13. Fan, H.H., S.H. Kleven, and MW. Jackwood. Application of
polymerase chain reaction with arbitrary primers to strain identification of
Mycoplasma gallisepticum. Avian Dis. 39:729-735. 1995.
14. Fan, H.H., S.H. Kleven, and MW. Jackwood. Studies of intraspecies
heterogeneity of Mycoplasma synoviae, M meleagridis, and M iowae with
arbitrarily primed polymerase chain reaction. Avian Dis. 39:766-777. 1995.
15. Farmer, K.L., G.E. Hill, and S.R. Roberts. Susceptibility of a naive
population of house finches to Mycoplasma gallisepticum. J. Wildl. Dis.
38:282-286. 2002.
16. Ferguson, N.M, D. Hepp, S. Sun, N. Ikuta, S. Levisohn, S.H. Kleven,
and M Garcia. Use of molecular diversity of Mycoplasma gallisepticum by
gene-targeted sequencing (GTS) and random amplified polymorphic DNA
(RAPD) analysis for epidemiological studies. Microbiol. 151:1883-1893.
2005.
17. Forrest, M. and J.M Bradbury. Mycoplasma glycophilum, a new
species of avian origin. J. Gen. Microbiol.?597-603. 1984.
18. Forsyth, MH., J.G. Tully, T.S. Gorton, L. Hinckley, S. Frasca Jr., H.J.
Van Kruiningen, and S.J. Geary. Mycoplasma stumi sp. nov., from the
conjunctiva of a European starling (Stumus vulgaris). Int. J. Syst. Bacteriol.
46:716-719. 1996.
19. Frey, ML., R.P. Hanson, and D.P. Anderson. A medium for the
isolation of avian Mycoplasmas. Am. J. Vet. Res. 29:2163-2171. 1968.
20. Garcia, Μ, N. Ikuta, S. Levisohn, and S.H. Kleven. Evaluation and
Comparison of Various PCR Methods for Detection of Mycoplasma
gallisepticum Infection in Chickens. Avian Dis. 48:125-132. 2005.
21. Geary, S.J., MH. Forsyth, S.A. Saoud, G. Wang, D.E. Berg, and C.M
Berg. Mycoplasma gallisepticum strain differentiation by arbitrary primer
PCR (RAPD) fingerprinting. Molec. Cell. Probes. 8:311-316. 1994.
22. Glisson, J.R., J.F. Dawe, and S.H. Kleven. The effect of oil emulsion
vaccines on the occurrence of nonspecific plate agglutination reactions for
Mycoplasma gallisepticum and Mycoplasma synoviae. Avian Dis. 28:397-
405. 1984.
23. Hong, Y, M. Garcia, S. Levisohn, P. Savelkoul, V. Leiting, I.
Lysnyansky, D.H. Ley, and S.H. Kleven. Differentiation of Mycoplasma
gallisepticum strains using amplified fragment length polymorphism and
other DNA-Based Typing Methods. Avian Dis. 49:43-49. 2005.
24. Hong, Y., M Garcia, L. Leiting, D. Bencina, L. Dufour-Zavala, G.
Zavala, and S.H. Kleven. Specific Detection and Typing of Mycoplasma
synoviae Strains in Poultry with PCR and DNA Sequence Analysis
Targeting the Hemagglutinin Encoding Gene vlhA. Avian Dis. 48:606-616.
2004.
25. Hong, Y., M Garcia, S. Levisohn, I. Lysnyansky, V. Leiting, P.H.M.
Savelkoul, and S.H. Kleven. Evaluation of Amplified Fragment Length
Polymorphism for Differentiation of Avian Mycoplasma Species. J. Clin.
Microbiol. 43:909-912. 2005.
26. Jordan, F.T.W., Recovery and identification of avian mycoplasmas, in
Methods in Mycoplasmology. Volume Π, Diagnostic Mycoplasmology. J.G.
Tully and S. Razin, Editors. Academic Press: New York. p. 69-79. 1983.
27. Kempf, I. DNA amplification methods for diagnosis and
epidemiological investigations of avian Mycoplasmosis. Acta Vet. Hung.
45:373-386. 1997.
28. Kempf, I., A. Blanchard, F. Gesbert, M Guittet, and G. Bennejean.
Comparison of antigenic and pathogenic properties of Mycoplasma iowae
strains and development of a PCR-based detection assay. Res. Vet. Sci.
56:179-185. 1994.
29. Khan, MI., B.C. Kirkpatrick, and R. Yamamoto. A Mycoplasma
gallisepticum strain-specific DNA probe. Avian Dis. 31:907-909. 1987.
30. Khan, MI., K.M Lam, and R. Yamamoto. Mycoplasma gallisepticum
strain variations detected by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis. Avian Dis. 31:315-20. 1987.
64
31. Kleven, S.H., Mycoplasma synoviae infection. In: Diseases of Poultry,
11th. ed. Y.M Saif, et al., Editors. Iowa State University Press: Ames, Iowa,
p. 756-766. 2003.
32. Kleven, S.H., G.F. Browning, D.M Bulach, E. Ghiocas, C.J. Morrow,
and K.G. Whithear. Examination of Mycoplasma gallisepticum strains using
restriction endonuclease DNA analysis and DNA-DNA hybridisation. Avian
Pathol. 17:559-570. 1988.
33. Kleven, S.H., C.J. Morrow, and K.G. Whithear. Comparison of
Mycoplasma gallisepticum strains by hemagglutination-inhibition and
restriction endonuclease analysis. Avian Dis. 32:731-741. 1988.
34. Koshimizu, K., R. Harasawa, I.J. Pan, H. Kotani, M Ogata, E.B.
Stephens, and MF. Barile. Ureaplasma gallorale sp. nov. from the
oropharynx of chickens. Int. J. Syst. Bacteriol. 37:333-338. 1987.
35. Laigret, F., J. Deaville, J.M Bove, and J. Bradbury. Specific detection
of Mycoplasma iowae using polymerase chain reaction. Molec. Cell. Probes.
10:23-29. 1996.
36. Lauerman, L.H., Mycoplasma PCR Assays, in Nucleic Amplification
Assays for Diagnosis of Animal Diseases, ed. L.H. Lauerman,
Editor.American Association of Veterinary Laboratory Diagnosticians:
Auburn, AL. p. 41-52. 1998.
37. Lauerman, L.H., A.R. Chilina, J.A. Closser, and D. Johansen. Avian
Mycoplasma identification using polymerase chain reaction amplicon and
restriction fragment length polymorphism analysis. Avian Dis. 39:804-811.
1995.
38. Lauerman, L.H., F.J. Hoerr, A.R. Sharpton, S.M Shah, and V.L. van
Santen. Development and application of a polymerase chain reaction assay
for Mycoplasma synoviae. Avian Dis. 37:829-834. 1993.
39. Ley, D.H., Mycoplasma gallisepticum infection. In: Diseases of Poultry,
11th. ei Y.M Saif, et al., Editors. Iowa State University Press: Ames, Iowa,
p. 722-744. 2003.
40. Ley, D.H., J.E. Berkhoff, and J.M McLaren. Mycoplasma gallisepticum
isolated from house finches (Carpodacus mexicanus) with conjunctivitis.
Avian Dis. 40:480-483. 1996.
41. Luttrell, M.P., J.R. Fischer, D.E. Stallknecht, and S.H. Kleven. Field
investigation of Mycoplasma gallisepticum infections in house finches
(Carpodacus mexicanus) from Maryland and Georgia. Avian Dis. 40:335-
341. 1996.
42. Moalic, P.M, F. Gesbert, F. Laigret, and I. Kempf. Evaluation of
polymerase chain reaction for detection of Mycoplasma meleagridis in
turkeys. Proc. World Vet. Poultry Assoc. 11:73. 1997.
43. Morina, R., D. Bencina, and P. Dove. Polymorphisms in the 5' - vlhA
gene enable differentiation of Mycoplasma synoviae strains, in International
Organization for Mycoplasmology. 2002. Vienna.
44. Panangala, V.S., J.S. Stringfellow, K. Dybvig, A. Woodard, F.-. Sun,
D.L. Rose, and MM Gresham. Mycoplasma corogypsi sp. nov., a new
species from the footpad abscess of a black vulture, Coragyps atratus. Int. J.
Syst. Bacteriol. 43:585-590. 1993.
45. Poveda, J.B., J. Giebel, J. Flossdorf, J. Meier, and H. Kirchhoff.
Mycoplasma buteonis sp. nov., Mycoplasma falconis sp. nov., and
Mycoplasma gypis sp. nov., 3 species from birds of prey. Int. J. Syst.
Bacteriol. 44:94-98. 1994.
46. Senterfit, L.B., Preparation of antigens and antisera. Vol. 1,
Mycoplasma Characterization. In: Methods in Mycoplasmology. S. Razin
and J.G. Tully, Editors. Academic Press: New York, N.Y. p. 401-404. 1983.
47. Talkington, F.D. and S.H. Kleven. A classification of laboratory strains
of avian Mycoplasma serotypes by direct immunofluorescence. Avian Dis.
27:422-429. 1983.
48. Yogev, D., D. Halachmi, G.E. Kenny, and S. Razin. Distinction of
species and strains of Mycoplasmas (Mollicutes) by genomic DNA
fingerprints with an rRNA gene probe. J. Clin. Microbiol. 26:1198-1201.
1988.
 16
CHLAMYDIOSIS
Arthur A. Andersen and Daisy Vanrompay

SUMMARY. Avian chlamydiosis is caused by avian strains of Chlamydophila psittaci. Currently six serovars (serovars A through F) of C.
psittaci are known from birds. The serovars appear to be related to the host species, with serovar A predominately found in psittacine birds
and serovar B in pigeons. Some uncertainty still exists about the natural hosts of the other serovars; however, serovar D is the serovar seen in
turkeys during outbreaks with high mortality and high risks to humans. Natural infections of C. psittaci have been reported to occur in most
species of birds. Chlamydiosis is an Office International des Epizooties (OIE) list B disease, having public health importance and being
significant in international trade. Most states require the treatment of known infected birds prior to slaughter.
Agent Identification. Diagnosis of avian chlamydiosis preferably is made by isolation and identification of the agent. PCR and other
molecular tests are replacing isolation in a number of laboratories because of improved sensitivity of recently developed tests and to increase
laboratory safety. Other diagnostic methods such as enzyme-linked immunosorbent assay for detection of the antigen, and direct visualization
of the organism by Giemsa staining or by indirect fluorescent antibody tests, are satisfactory when signs of the disease are present. In
necropsied birds the use of immunohistochemistry is continuing to increase in importance for confirmation of chlamydiosis.
Serological Detection in the Host. A number of serological tests are available. The complement fixation (CF) test is considered the standard
in most countries. A high CF titer in a majority of individuals in a flock with clinical signs is presumptive evidence of an active infection. A
fourfold increase in titer in an individual bird is considered to be diagnostic for a current infection.

INTRODUCTION infections result in fever, anorexia, lethargy, diarrhea, and

Avian chlamydiosis (psittacosis, ornithosis, parrot fever) is caused
by Chlamydophila psittaci. The family Chlamydiaceae was
recently reclassified into two genera and nine species (15). The
new genera Chlamydia and Chlamydophila correlate with the
former species Chlamydia trachomatis and Chlamydia psittaci. The
genus Chlamydia includes C. trachomatis (human), C. suis (swine),
and C. muridarum (mouse, hamster). The genus Chlamydophila
includes C. psittaci (avian), C. felis (cats), C. abortus (sheep, goats,
cattle), C. caviae (guinea pigs), and the former species C.
pneumoniae (human) and C. pecorum (ruminants). All known avian
strains belong to the species Chlamydophila psittaci, which includes
six avian strains (serovars A through F) (2,4), and two mammalian
isolates (WC and M56). WC and M56 are isolates from epizootics
in cattle and muskrats, respectively. The avian serovars are
relatively host-specific. Serovars A and B are usually associated
with psittacine birds and pigeons, respectively. The natural hosts of
the other serovars are more uncertain. Serovar C has primarily been
isolated from ducks and geese, and serovar D has been isolated
from turkeys. Serovar F is a single isolate from a psittacine bird.
The host range of serovar E is the most diverse of the strains: it is
isolated from about 20% of pigeons, from many cases of fatal
chlamydiosis in ratites, from outbreaks in ducks and turkeys, and
occasionally from humans.
The term "virulent” when used with serovar D is a misnomer, as
virulence is highly dependent on the strain of chlamydia and the
species of bird infected. However, in the literature, ’’virulent"
primarily refers to infections in turkeys, with serovar D being the
most virulent serovar in this species. Serovar D is the serovar most
likely to be transmitted to humans following exposure in turkey
processing plants.
United States Department of Agriculture (USDA) regulations
prohibit the movement of poultry, carcasses, or offal from any
premises where avian chlamydiosis has been proven by isolation of
the chlamydial agent. State regulatory agencies may also impose
quarantines on intrastate movement of diseased flocks and may
require antibiotic treatment of infected birds. Interstate movement
of birds, but not eggs, from infected flocks is prohibited by the
Animal and Plant Health Inspection Service of the USDA and by
the U.S. Department of Health and Human Services.
CLINICAL DISEASE
Depending on the chlamydial serovar and the avian host,
chlamydiae cause pericarditis, air sacculitis, pneumonia, lateral
nasal adenitis, peritonitis, hepatitis, and splenitis. Generalized
65
occasionally shock and death.
Turkeys most commonly are infected by serovar D, with mortality
rates of 5^W% unless early antibiotic treatment is instituted (6,45).
Vasculitis, pericarditis, splenitis, and lateral nasal adenitis are
typical postmortem findings. Experimentally, virulent turkey
strains cause little, if any, disease in chickens, pigeons, and
sparrows; however, cockatiels and parakeets succumb rapidly to
infection by these agents.
Turkey outbreaks with low mortality and little or no human
involvement usually are caused by the pigeon serovar. Mortality
usually is less than 5%. Necropsy findings include pneumonitis, air
sacculitis, and hepatosplenomegaly.
Chlamydiosis is a very common chronic infection of psittacine
birds (42). The disease is of public health significance because of
the popularity of psittacine birds as pets and the increased
placement of these birds in child-care facilities and in homes for the
aged. Infections cause conjunctivitis, enteritis, air sacculitis,
pneumonitis, and hepatosplenomegaly. Droppings are often green to
yellow-green. Many of the birds become chronically infected but
show no clinical signs until stressed. These birds often shed
chlamydiae intermittently and serve as a source of infection for
humans and other birds.
Chlamydiosis is a common chronic infection of pigeons. Clinical
signs include conjunctivitis, blepharitis, and rhinitis (6). Survivors
become asymptomatic carriers. In recent years, chlamydiosis due to
serovar E has been reported in a number of ratites.
Chlamydiosis in ducks is rare in the United States, but is a serious
economic and occupational health problem in Europe (6).
Trembling, conjunctivitis, rhinitis, and diarrhea are seen in infected
ducks. Mortality can range up to 30%.
SAMPLE COLLECTION
The laboratory diagnosis of avian chlamydiosis usually includes
the isolation and identification of the organism from the host.
Because C. psittaci requires living cells to multiply, isolation
requires inoculation of either laboratory animals or cell cultures.
Specimens should be collected aseptically, as contaminant bacteria
may interfere with isolation of the chlamydiae.
Proper handling of clinical samples is necessary to prevent loss of
infectivity. If specimens are used to inoculate animals or cell
cultures immediately, most diluents will be adequate; however, if
the specimen is to be shipped or stored, a special diluent should be
used. A diluent consisting of sucrose-phosphate-glutamate (SPG)
was developed for rickettsiae and has proven satisfactory for
transport of chlamydial field samples (10,43). The recommended
Arthur A. Andersen and Daisy Vanrompay
medium for chlamydiae consists of SPG buffer (sucrose, 74.6
g/liter; KH2PO4, 0.512 g/liter; K2HPO4, 1.237 g/liter; and L-
glutamic acid, 0.721 g/liter), which can be sterilized by autoclaving.
To this is added fetal calf serum (10%), vancomycin and
streptomycin (100 pg/ml), and nystatin and gentamicin (50 pg/ml).
The antibiotics reduce the effect of contamination even when
samples are shipped at ambient temperatures. This medium also
serves as a laboratory diluent and a medium for freezing of
chlamydiae.
For isolation and identification of C. psittaci from acute and
subclinical cases of chlamydiosis, the following samples should be
collected: pharyngeal/choanal slit swabs (3), lung tissue, thickened
exudate-coated air sacs and free exudate, thickened pericardial
tissues and exudate, sections of enlarged spleen and liver, intestinal
mucosa at sites of hyperemia, colon contents, and conjunctival and
nasal discharges. In the live bird, pharyngeal/choanal slit swabs,
fecal samples, and cloacal swabs are the preferred specimens (3).
All three specimens should be collected, as no one sample will
provide an isolation in all cases. Other specimens that can be
collected, depending on the disease signs present, include whole
blood, conjunctival scrapings or exudate, and peritoneal exudate.
When companion birds are being tested for subclinical infection
before placement in facilities, repeated sampling is necessary.
The same tissues can be collected for PCR and other molecular
tests. If the DNA extraction will not be done immediately, it may be
beneficial to collect the specimen in a DNA stabilization buffer
(13).
Hazards to Humans in Handling Specimens
Potentially infected birds and specimens must be handled with
caution, as the avian strains can cause serious or fatal disease in
humans. Humans can also become infected through aerosol
exposure or contact with dried excrement. Precautions must be
taken to prevent creation of infectious aerosols during necropsies or
by mechanical manipulation of suspensions of organisms in
syringes, centrifuges, tissue grinders, pipettes, or other laboratory
equipment, and to prevent the contamination of skin with infectious
exudate or material. The use of biological safety hoods and gloves
is recommended during the handling of any potentially infectious
material.
Storage of Specimens
The stability of chlamydiae during storage depends upon the
material in which it is contained. Chlamydiae in tissue specimens or
yolk-sac suspension can be preserved indefinitely by storage at -70
C (5,6). Note that chlamydiae harvested from cell culture require
special media during freezing. A satisfactory method for freezing
them is to replace the cell culture medium with SPG buffer before
freezing, as the organism is highly susceptible to the presence of
sodium ions in the medium (43). The transport medium described
earlier will provide adequate stability during freezing. At 4 C, the
organism can survive with gradual loss of infectivity for 30 days or
longer when in heavily infected tissues or in SPG transport medium
(43).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Chlamydiae are obligate intracellular parasites that multiply in the
cytoplasm of animal cells. The preferred method of isolation of
avian strains in most laboratories is inoculation of cell cultures.
Modifications of standard cell culture techniques are used to
enhance the growth of the organism and are discussed under agent
identification below.
Until recently, the standard method for the isolation of chlamydiae
has been inoculation of chicken embryos. Chicken embryos will
support the growth of all known strains of chlamydiae infecting
66
birds. Mice and guinea pigs can also be used when chlamydiae-free
animal colonies are available.
AGENT IDENTIFICATION
Microscopic Examination of Specimens
Histochemical Staining. Chlamydiae can be detected in smears of
exudates and feces and in impression smears of liver and spleen by
a variety of techniques. Gimesa and Gimenez stains are commonly
used. The modified Gimenez technique (Table 16.1; B.D. Van Do-
Kamp, pers. comm.) is routinely used by several laboratories for
detection of chlamydial inclusions in smears and paraffin-embedded
tissue sections.
Procedure for smears:
1) Fix in methanol for 5 min.
2) Stain in solution 3 for 10 min.
3) Rinse in tap water.
4) Counterstain in solution 6 for 2 min.
5) Rinse in tap water.
6) Air dry.
Procedure for paraffin sections:
1) Deparaffmize and hydrate in distilled H2O.
2) Stain in solution 3 for 10 min.
3) Rinse in tap water.
4) Dip in solution 4 until no more red runs out of the section.
5) Rinse in tap water.
6) Counterstain in solution 6 for 20 dips.
7) Dip in two changes of 95% alcohol, for five dips each.
8) Dehydrate, clear, and mount.
9) Chlamydiae will appear red against a green background.
Immunohistochemical Staining.
Immunohistochemistry is another method for detection of
chlamydiae in cytologic and histologic preparations (35,45). The
use of immunohistochemical staining on formalin-fixed sections is
gaining in popularity because a number of laboratories are using
automatic staining equipment. The technique also allows
laboratories to take routine samples for histopathology and then
retrospectively examine them for chlamydiae if necessary. The
technique is more sensitive than histochemical staining, but
experience is required to interpret findings. Cross-reactions with
some bacteria, fungi, and epithelial intercellular material dictate that
morphology must be considered in making a positive diagnosis.
Chlamydial antigen is most often found in macrophages in areas of
inflammation. Antigen can be found in the lateral nasal gland up to
50 days post infection. Inflamed air sacs and pericardium also
consistently contain antigen. However, care must be taken to avoid
misinterpreting hemosiderin as antigen. Antigen-positive tissue and
hematoxylin-and-eosin-stained sections are used as controls.
For immunohistochemical staining of paraffin sections, a genus­
specific monoclonal or polyclonal antibody is used as the primary
antibody. The antibodies should be produced to formalin-
inactivated chlamydiae and selected for reaction with formalin-
inactivated chlamydiae. The specific procedure used for staining the
paraffin sections will depend on the equipment available, as most
techniques will give satisfactory results.
Isolation of the Organism
Preparation of Inoculum. Tissue specimens, fecal samples, and
swabs are routinely used as samples for the isolation of chlamydiae.
The processing of the samples is similar for inoculation of cell
cultures, embryonated eggs, or laboratory animals. Diluents such as
beef heart infusion broth, phosphate-buffered saline (PBS; pH 7.2),
and cell culture media often are used to prepare a 20%-40%
suspension of the homogenized sample. These diluents, with
antibiotics, are satisfactory when the samples are to be inoculated
within 24 h and will not be frozen. For routine use, a number of

laboratories are using SPG buffers, such as the transport medium
described earlier or Bovamick's buffer (10,43). These buffers have
the added advantage of stabilizing the agent during refrigeration or
freezing of the samples.
Before the inoculation of animals or cell cultures, contaminated
samples must be treated by one of three basic methods: treatment
with antibiotics (8), treatment with antibiotics plus low-speed
centrifugation (6), or treatment with antibiotics plus filtration (8). A
number of antibiotics that do not inhibit chlamydiae are available. A
standard procedure is to homogenize the sample in diluent
containing 500-1000 pg/ml each of streptomycin, vancomycin, and
kanamycin. Amphotericin B will control yeast and fungal growth.
Other antibiotic solutions are often used, but penicillin, tetracycline,
and chloroamphenicol should be avoided, as they will inhibit the
growth of chlamydiae.
If the sample is lightly contaminated, adequate treatment for
inoculation into chicken embryos, guinea pigs, mice, or cell culture
consists of homogenization of the sample in an antibiotic solution.
The sample is often left in the antibiotic solution for 24 hr before
the inoculation of cell cultures or animals. If the sample is heavily
contaminated, such as a fecal sample, it should be homogenized in
antibiotics and centrifuged at 1000-2000 x g for 30 min. The
surface layer and the bottom layer should be discarded; the
supernatant fluid is collected and recentrifuged, and the final
supernatant fluid is inoculated into the experimental host or cell
culture. If contamination persists, the sample may also be passed
through a filter of 0.45-0.8 pm pore size.
Cell Cultures. Cell cultures are the most common and convenient
method for the isolation of C. psittaci. The most commonly used
cell lines are BGM, McCoy, HeLa, Vero, and L-929, although a
number of other cell cultures can be used. A recent study showed
BGM to be the most sensitive, with Vero and L-929 listed as
satisfactory (49). Standard cell culture medium is used, containing
5%-10% fetal calf serum and antibiotics that do not inhibit the
growth of chlamydiae. In our laboratory, 10 pg/ml of gentamicin
and 2 pg/ml of amphotericin B are standard for use.
The laboratory equipment and supplies available will determine
the type of vessel used to grow the cell culture monolayer for
incubation with the homogenated samples. The equipment,
however, must be suitable for the following procedures:
identification by direct fluorescent antibody (FA) or another
appropriate technique of staining of the infected monolayer;
centrifugation of the inoculum into the monolayer to enhance
infectivity; possible blind passage at 3-6 days to increase sensitivity
of isolation; examination of the sample two to three times during a
passage; and protection of humans against possible infection. Small
flat-bottomed vials (I-dram shell vials) or bottles, with 12-mm
diameter glass coverslips, will meet these requirements and are
often used (8,9) because the cell culture monolayer can be grown
directly on the coverslip. Several vials (often four to six) are
inoculated with each sample to permit fixing and staining at various
times and to permit repassaging of negative samples after 4-6 days
of inoculation. Multiwell disposable cell culture dishes in sets of
four are used in our laboratory. These work well when processing
large numbers of samples; however, cross contamination between
wells can be a problem. The infected monolayers are fixed and
stained directly in 96 multiwell dishes. Inclusions are visualized by
inverting the plate under a FA microscope.
Chlamydiae can be isolated from cells that are replicating
normally. Most diagnosticians, however, prefer to use
nonreplicating cells for two reasons: to provide increased nutrients
for the replication of chlamydiae, and because nonreplicating cells
can be maintained for longer periods for observation. Host-cell
replication can be suppressed either by irradiation or by cytotoxic
chemicals; the use of chemicals is becoming more common.
Cytotoxic chemicals include 5—iodo—2-deoxyiodine, cytocholasin
B, cycloheximide, and emetine hydrochloride (36). Cycloheximide
67
Chapter 16 Chlamydiosis
is most commonly used; it can be added to the medium at the rate of
0.5-2.0 pg/ml at the time of inoculation of the monolayer. The
concentration needed will depend on the cell line used. Emetine
must be removed after treatment and replaced with medium (836);
this is considered by some to be an argument for its use. The
monolayer is treated for 5 min with a concentration of 0.5 μg/ml of
emetine. After removal of the emetine and its replacement with
medium, the monolayer is ready for use. The effect of these drugs
on the replication of the chlamydiae is strain dependent: growth of
most, but not all, strains is enhanced by treatment of the monolayer
with one of these drugs.
Chlamydiae are known to have a low infection rate in cell cultures,
and methods to enhance the infection rate are often used. A
common method to increase attachment of the chlamydiae to the
cells is to centrifuge the inoculum onto the monolayer at 1000-3000
x g for 30-90 min. Adsorption is enhanced by temperatures near 37
C. The inoculum is often removed and replaced with cell culture
medium containing an antimetabolite. Incubation is usually at 37-
39 C. Cultures must be examined at regular intervals by an
appropriate staining method for the identification of chlamydiae.
Staining is usually done at days 2-3 and days 5-6. Cultures that are
negative at day 6 are harvested and repassed. Disruption of the
monolayer by freeze-thawing should not be done, as it will destroy
the chlamydiae.
Staining of coverslips. The preferred method for fixing of the
monolayer is to remove the medium, wash once with PBS, and fix
with acetone for 2-10 min. If the cell culture vessel is plastic, the
monolayer can be fixed with a mixture of 50% acetone and 50%
methyl alcohol. The preferred method for staining is the direct FA
method (5,6,8), but a number of other methods can be used. With
the FA method, the fluorescein-conjugated antichlamydia serum is
applied to the coverslip and incubated 30 min at 37 C. The
coverslips are then washed three times with PBS, air-dried, and
mounted in an inverted position on a glass slide. The chlamydial
inclusions will fluoresce a light green color under ultraviolet
microscopy. Commercially prepared conjugates using monoclonal
antibodies are available and are highly specific. Conjugates also can
be prepared from polyclonal sera from rabbits, guinea pigs, sheep,
or goats. The main problem is obtaining a specific, high-titer
antiserum. The fluorescein conjugate is prepared using standard
techniques (5,6,8).
Other techniques to demonstrate chlamydial inclusions are the
indirect immunofluorescent technique, the immunoperoxidase
technique (35), and direct staining techniques, such as Pierce-Van
Der Kamp (PVK), Gimenez, Giemsa, or Macchiavello's stains. The
immunoperoxidase, Macchiavello, PVK, and Gimenez staining
techniques allow the use of standard light microscopes.
Chicken Embryos. A number of laboratories still use chicken
embryos for primary isolation of chlamydiae. The standard
procedure is to inject up to 0.5 ml of inoculum into the yolk sacs of
6 to 7 day-old embryos (6). Incubation is at 39 C, as multiplication
of chlamydiae is greatly increased in comparison with incubation at
37 C. Replication of the chlamydiae usually will cause the death of
the embryo within 5-12 days after inoculation. If no deaths occur,
two additional blind passages are usually made before calling the
sample negative. Chlamydial infection typically causes vascular
congestion of the yolk-sac membranes, which are harvested and
homogenized as a 20% yolk-sac suspension. This suspension can be
frozen to preserve the strain or inoculated into other eggs or into
cell culture monolayers.
Identification of the organism requires preparation of an antigen
from the infected yolk sac and testing for the chlamydial group
antigen by the complement fixation (CF) test or other appropriate
serologic test. Laboratories now often inoculate cell culture
monolayers with the yolk-sac suspension and stain for chlamydial
inclusions at 48-72 hr by the direct FA test described above. The
typical chlamydial inclusion is a round or hat-shaped body in the
Arthur A. Andersen and Daisy Vanromp ay
cytoplasm. In some virulent strains the inclusions break up rapidly
and the chlamydial antigen is found dispersed throughout the
cytoplasm.
Enzyme-Linked Immunosorbent Assays. A number of
manufacturers are producing enzyme-linked immunosorbent assay
(ELISA) kits for detection of Chlamydia trachomatis in humans.
These test kits will detect C. psittaci as they react to the
lipopolysaccharide (LPS) or group antigen. The advantages of
ELISA are that it is rapid, does not require a high level of expertise,
and is safe for the technician because the sample can be inactivated.
A number of the test kits have been evaluated for use in avian
samples (50), although none of the kits are licensed for use in
veterinary medicine. One of the problems of some of these tests is
that the chlamydiae LPSs share some epitopes with the LPSs in
other gram-negative bacteria, which can lead to a high number of
false positives. This problem has been reduced or eliminated in the
more recently developed kits by the use of monoclonal antibodies.
However, these kits still lack sensitivity: a few hundred organisms
are needed for a positive reaction. The general rule with these tests
is that a diagnosis of chlamydiosis can be made when a strong
positive reaction is seen along with clinical signs of chlamydiosis.
Because of the number of false positives, a positive test without
signs cannot be considered significant.
Polymerase chain reaction
The possibilities of diagnostic detection of Chlamydophila psittaci
are considerably improved with the introduction of molecular
methods, particularly the polymerase chain reaction (PCR), which
permits direct identification from clinical specimens and accelerates
diagnosis from several days to a single working day. Tests
published in the literature utilize two different genomic target
regions for amplification, namely the ribosomal RNA gene region
(33,16,32) and the gene encoding the MOMP antigen designated
ompl or ompA (25,27,56).
The sensitivity of the PCR largely depends on the amount and
quality of the extracted DNA. Optimal extraction of nucleic acids
from a wide range of clinical samples is one of the most under
appreciated, but nevertheless challenging and important steps.
Proper extraction must efficiently release nucleic acids from
samples, remove PCR inhibitors, avert the degradation of nucleic
acids, and ensure adequate concentration of the nucleic acids after
extraction. This is relatively easily achievable for viral and
mammalian amplification targets, but much more difficult and
inconsistent for nucleic acid targets of bacteria, as these pathogens
frequently possess highly resistant outer membranes, and specific
methods for disruption of these membranes are necessary for
quantitative recovery of nucleic acids from these organisms. In
some cases, concentration of target organisms by physical means
increases assays’ sensitivity, but it is important to ascertain the
enrichment effect (13). Such methods include immunomagnetic,
centrifugal, or filter concentration (31,1,37). Several in-house-made
and commercial DNA extraction methods have been described
(54,38; Harkinezhad et al., 2005, unpublished results). The
following are used in a number of laboratories and are designed for
specific sample types.
Materials for the simplest methods for chlamydial DNA extraction
from various specimens:
1. Water. Deionized water must be used for all buffers and
dilutions.
2. Lysis buffer I: 100 mM Tris-HCl, pH 8.5, 0.05% (v/v) Tween®
20.
3. Lysis buffer Π: 0.01 M Tris-HCl, 0.05 M KC1, 0.0025 M
MgC12.6H2O, 0.5% (v/v) Tween® 20, pH 8.3
4. Proteinase K solution I: 10 mg/ml in water.
5. Proteinase K solution Π: 20 mg/ml in water
68
6. Phosphate-buffered saline (PBS): 10 mM Na2HPO4, 10 mM
NaH2PO4, 145 mM NaCl, pH 7.0. Adjust pH by adding NaH2PO4.
7. Tris-EDTA (TE) buffer: 10 mM Tris-HCl, pH 8.0, 1 mM EDTA,
pH 8.0 (ethylene diamine tetra-acetic acid).
8. Sodium dodecyl sulfate (SDS) solution: 10 mg/ml in TE.
9. Phenol: saturated solution in TE buffer. If two separate phases
are visible, use the lower phase only.
10. Chloroform-isoamyl alcohol: 24:1 (v/v).
11. Isopropanol, analytical or molecular biology grade
Procedure for DNA extraction from nasal, pharyngeal, conjunctival
swabs or faecal swabs:
1. Pipet 500 μΐ of lysis buffer I into a 2-ml microfuge tube
containing the swab.
2. Vortex mix thoroughly for 1 min.
3. Centrifuge at 12,000 x g for 30 s.
4. Put the swab into a 1-ml pipet tip whose lower half was cut off
and place it all into a fresh microfuge tube.
5. Centrifuge at 12,000 x g for 1 min to press the remaining liquid
out of the swab.
6. Add the liquid to that in the first microfuge tube. If you sampled
your swabs into GIT buffer, please
7. Centrifuge the liquid at 12,000 x g for 15 min.
8. Discard the supernatant and resuspend the pellet in 50 μΐ lysis
buffer I.
9. Add 20 μΐ proteinase K solution I and incubate at 60 C for 2 h.
10. Inactivate the proteinase K by heating at 95 C for 15 min.
11. Centrifuge at 12,000 x g for 5 min to remove debris.
12. Use 5 μΐ of the supernatant for PCR.
13. For faecal swabs an additional purification of DNA by phenol
extraction and ethanol or isopropanol precipitation is recommended.
14. When the swabs are taken in guanidinium isothiocyanate
buffer, step 1 should be vortex mix thoroughly for 1 min followed
by centrifugation at 12,000 x g for 30 s and afterwards removing all
the buffer except 50 μΐ. Resuspend the pellet in the buffer and add
the proteinase K solution as in step 9.
Procedure for DNA extraction from organ tissues:
1. Boil 100 mg of homogenized tissues in 200 μΐ of water in a
plastic tube for 10 min. Subsequently, allow the tube to cool to
room temperature.
2. Optionally, proteinase digestion can be carried out to increase
the final yield of DNA: add 200 μΐ SDS solution and 20 μΐ of
proteinase K solution I to the tube and incubate at 55 C for 1 h.
3. Add 200 μΐ of phenol.
4. Vortex mix vigorously for 1 min.
5. Centrifuge at 12,000 x g for 5 min.
6. Transfer the upper aqueous phase into a fresh microfuge tube.
7. Add 200 μΐ of chloroform-isoamyl alcohol and vortex mix at the
highest intensity for 1 min.
8. Transfer the upper aqueous phase into a fresh microfuge tube.
9. Precipitate DNA by adding 120 μΐ of isopropanol. Thoroughly
mix the reagents and incubate at room temperature for 10 min.
10. Collect DNA by centrifugation at 12,000 x g for 10 min.
Discard supernatant.
11. Allow DNA pellet to air-dry for 30 min.
12. Dissolve pellet in 20 μΐ of water. Use 1 μΐ for the PCR.
Procedure for DNA extraction from faeces:
1. Add 200 μΐ of water to 100 mg of faeces and vortex mix
vigorously for 1 min.
2. Boil the suspension for 10 min.
3. Add 300 μΐ pf phenol to each tube for DNA extraction and
vigorously vortex mix for 1 min.
4. Centrifuge at 14,000 x g for 5 min.
5. Transfer the (upper) aqueous phase into fresh microfuge tubes.
6. Add 300 μΐ of chloroform-isoamyl alcohol to each tube.

7. Vortex mix at the highest intensity.
8. Centrifuge at 14,000 x g for 5 min.
9. Transfer the (upper) aqueous phase into fresh microfuge tubes.
10. Add 200 μΐ of isopropanol for DNA precipitation. Thoroughly
mix the reagents and incubate at room temperature for 10 min.
11. Centrifuge at 14,000 x g for 10 min. Discard the supernatant.
12. Allow DNA pellet to air-dry for 30 min.
13. Dissolve pellet in 20 μΐ of water. Use 1 μΐ for the PCR.
Alternatively, commercial DNA extraction kits can be used for
the extraction of chlamydial DNA. In our hands the QIAamp®
DNA Mini Kit performed the best for pharyngeal swabs while the
High Pure PCR Template Preparation Kit performed best for
cloacal swabs and faeces. The use of commercial kits can be
recommended especially when dealing with PCR inhibitors. They
contain a special buffer reagent for lysis of the bacterial and
eukaryotic host cells mostly based on a guanidine-detergent lysing
solution first described by Chomczynski and Sacchi (12).
Simultaneous disruption of cells and inactivation of nucleases is
achieved by lysis in strong denaturing reagents, for instance 4M
guanidinium isothiocyanate (GIT) or 4M guanidinium
hydrochloride. Guanidinium isothiocyanate (GIT) is 2.5 times more
effective on a molar basis than guanidine HC1. Both anion and
cation act as denaturants in the GIT buffer but only the guanidine
cation in GIT-HCL buffer. An optimal RNase digestion is intended
to remove cellular RNA. The lysate is then centrifuged through a
mini-column, where the released DNA is effectively bound to a
solid phase: modified silica, hydroxyl apatite, or a special filter
membrane. After washing, the DNA can be eluted with an elution
buffer or water. DNA prepared in this manner is usually of high
purity and free of PCR inhibitors.
Tissue sample homogenization in cell culture medium, PBS, or
TBS and/or freeze-thaw cycles of samples lead to rapid loss of
chlamydial target DNA. Specimens that contain low target numbers
before freezing often become negative after cryostorage. The
preservation of DNA from degradation is critically important. De
Graves et al., (13) advise to collect all specimens for PCR analysis
in a DNA stabilization reagent. Such reagents are commercially
available; for instance the RNA/DNA Stabilization Reagent for
Blood/Bone Marrow® from Roche Applied Science. This
stabilization reagent is based on the denaturation of proteins in a
concentrated solution of guanidinium isothiocyanate and a reducing
agent, as introduced by Chirgwin et al., (11) for the inactivation of
ribonuclease during RNA isolations. However, it also works
perfectly well to stabilize DNA as demonstrated by De Graves et
al., (13) extracting chlamydial DNA from 10% (w/v) tissue
suspensions of lungs from mice and by Harkinezhad et al., (2005,
unpublished results) extracting chlamydial DNA from avian
pharyngeal and cloacal swabs stored in this reagent as well as
faeces.
The choice of a PCR test depends on the skill of the personnel in
the laboratory and the equipment available. Nested procedures are
more sensitive than traditional PCR and in most cases are also more
sensitive than real-time PCR. Recently, two highly sensitive nested
PCR assays have been developed to detect Chlamydophila psittaci
in avian samples (38,48). The nested PCR of Sachse and Hotzel
(38) is based on a first amplification generating a genus-specific
ompA product (576-597 bp) followed by a second amplification
using one species-specific and one genus-specific primer generating
a Chlamydophila psittaci-specific amplicon (389-404 bp). PCR
results are visualized by agarose gel electrophoresis using ethidium
bromide containing gels. The sensitivity of the nested PCR-EIA was
established at 1 to 0.1 infection forming unit (IFU). Van Loock et
al. (48) developed a nested PCR-enzyme immuno assay (PCR-EIA).
The fluorescein-biotin labelled PCR products were immobilized on
streptavidin-coated microtiter plates and detected with anti­
fluorescein peroxidase conjugate and a colorimetric substrate,
69
Chapter 16 Chlamydiosis
although detection by use of a fluorimeter is also possible by using
this method. The sensitivity of the nested PCR-EIA was established
at 0.1 infection-forming units (IFU). Specificity was 100%. An
internal inhibition control was included to rule out the presence of
inhibitors of DNA amplification.
Nested PCR-EIA procedure
The nested ompA PCR-EIA was developed using external and
internal primers generating a biotin-fluorescein dual labelled
internal PCR product of 472 bp (Table 16.2).
Both inner and outer sense primers are located within the first
conserved domain (CD1) of ompA, whereas the inner anti-sense
primer is located in CD3 and the outer anti-sense primers overlap
CD4 and variable domain 4 (Fig 16.2) First round PCR occurred in
50 mM KC1, 20 mM Tris-HCl (pH 8.3), 2 mM MgCl2, 0.1%
Tween20, 200 μΜ each dNTP, 1.25 μΜ each external primer
(Table 16.2) and 0.1 U SuperTaq polymerase (5 U/μΙ). After an
initial denaturation at 95 C for 5 min, 20 cycles of one min at 95 C,
two min at 59 C and three min at 72 C, with a final extension at 72
C for 5 min were performed. Second round amplification was
performed under similar conditions, using labelled internal primers
(each 10 μΜ; Table 16.2), adapted annealing temperature (47 C)
and adapted number of cycles (25). Subsequently, nested PCR
generated a fluorescein/biotin dual-labelled product of 472 bp.
To allow colorimetric detection of the ompA PCR products, 50 μΐ
of the PCR product diluted 1:10 in PBS supplemented with 3%
BSA was transferred in duplicate to streptavidin-coated microtiter
plates (2 pg/well for 3 hr at 37 C) and incubated at 37 C for one
hour. Non-specific binding places .were blocked overnight (4 C)
with 5% BSA in PBS. Subsequently, the plates were washed twice
with PBS and incubated (1 hour, 37 C) with a horseradish
peroxidase labelled anti-fluorescein antibody (Invitrogen), diluted
1/1000 in PBS supplemented with 3% BSA. Following incubating
and washing with PBS, the ABTS substrate solution (2,2' azino-di-
3-ethylbenzothiazoline sulphonate, KPL) was added to the wells.
Absorbencies were read at 450 nm after incubating for 30 min at 37
C (TiterTek MultiskanR Plus, MKH, TechGen International). Three
positive controls consisting of serial 10-fold dilutions of PCR
products generated from 5 IFU of C. psittaci and five negative
controls (water) were included in each assay. Results were positive
if the absorbance exceeded the cut off value of the mean of negative
controls plus three times the standard deviation.
Note: rules to remember
1. Work in separate rooms (three levels) for DNA extraction (level
1), preparation of the PCR
reaction mix and PCR (level 2) and visualization of the result (level
3). Use a biosafety cabinet for DNA extraction and preparation of
the PCR reaction mix.
2. Use separate sets of supplies and pipets in these levels.
3. Avoid bringing amplified DNA to level 1 and 2.
4. Take supplies from storage cabinets and not from the room
where the PCR analyses are being performed.
5. Store all reagents (including water) as aliquots and record the
lots.
6. The use of positive displacement pipets or filter tips in
recommended.
7. Change gloves frequently.
8. Uncap the tubes carefully to prevent aerosols.
9. Minimize sample handling.
10. Add non-sample components to the reaction mixture before
addition of DNA and cap each tube after adding the sample DNA
before proceeding to the next sample.
11. Use a positive control that amplifies weakly but consistently, as
one of the major mistakes is using a strongly positive control and
thus augmenting the risk of post-PCR carry-over from the amplified
positive control.
Arthur A. Andersen and Daisy Vanromp ay
12. Use pre- and post-amplification methods for the inactivation of
possible contaminating nucleic acids.
Real-time PCRA number of real-time PCR tests have been
developed. At least two of these tests have been used successfully
with avian samples. One uses the TaqMan system and the other uses
the LightCycler system. The technologies are similar and either test
with minor modifications can readily be adapted to other systems.
The real-time PCR systems have the advantage that their sensitivity
approaches that of the nested PCR systems, and they require no
additional pipetting or handling of the PCR product following the
initial set-up of the PCR mix. This reduces both the time needed for
the test and the incidence of contamination.
The TaqMan test amplifies a 132bp segment of the 23S rDNA
(15). In our laboratory we have found its sensitivity to be
comparable to isolation using samples from experimentally infected
animals (Andersen, unpublished data).
Recently a SYBRGreen-based real-time PCR was developed
targeting the rDNA ribosomal spacer of Chlamydophila psittaci
(19). The test could detect 10 rDNA copies/μΐ DNA extract and
could detect all known Chlamydophila psittaci genotypes (20).
Real-time PCR was performed with the LightCycler 2.0 Instrument
(Roche, Applied Science, Penzberg, Germany) using the
LightCycler FastStart DNA MasterPLUS SYBR Green I kit and
LightCycler Capillaries. The reaction mixture (20 μΐ) was prepared
according to the manufacturer’s protocol: 11 μΐ PCR grade water,
2 μΐ of primer mixture (300 nM forward primer and reverse primer),
2 μΐ lOx Master Mix, 5 μΐ of DNA template. Cycling conditions
were as follows: 50 cycles of 95 C for 10 s, 63 C for 10 s and 72 C
for 8 s. All default program settings were used. Standard graphs of
the Cycle threshold (Ct) values, obtained by testing tenfold serial
dilutions (108 to 101) of the purified species-specific inhibition
control plasmid, were used for quantification. Ct-values were
automatically converted into initial template quantities (No) using
the LightCycler Software 4.0. DNA from clinical samples was
always tested in the presence of control plasmid (50 copies/μΐ) to
check for PCR inhibitors.
AGENT IDENTIFICATION
Previously the standard procedure for the identification of
chlamydiae was to confirm the presence of chlamydiae by preparing
an antigen from the egg harvest and testing it in the CF test with
known antisera. Currently the determination is made at the time of
isolation by using fluorescein-labeled antichlamydial antibodies
following inoculation of cell culture monolayers as described
above. Distinguishing between C. psittaci and the other species of
chlamydia is not of major importance, as all avian isolates have
been in the species C. psittaci. Knowing the particular strain can be
important in identifying the source of infection and in
epidemiologic studies. Monoclonal antibodies have been developed
that can readily serotype the six known serovars seen in birds and a
number of serotypes from other animals (2,4). PCR restriction
fragment length polymorphism procedures are available that can
distinguish the different chlamydial species and avian strains
(14,41). Isolates can also be readily identified by sequence analysis
of the major outer membrane protein gene (ompA) (20). Sequence
analysis has the advantages that it can characterize new strains and
that in epidemiological studies it can track strains with minor DNA
changes.
Genotype-specific real-time PCR
Recently a genotype-specific real-time PCR was developed
detecting all known ompA genotypes (19). The genotype-specific
real-time PCR could easily distinguish genotypes C, D and F by use
of TaqMan probes. Genotypes A, B and E could not be
distinguished from each other by simply using TaqMan probes. For
this purpose non-fluorescent competitor oligonucleotides had to be
70
used next to the TaqMan probes. Genotype E/B could only be
detected by use of a minor groove binder (MGB) probe. Genotype­
specific probes (Applied Biosystems) listed in Table 16.3 were 5’
and 3’ labelled with the reporter dye 6-carboxyfluorescein (FAM)
and the quencher dye carboxytetramethylrhodamine (TAMRA),
respectively. Genotype-specific reactions were performed with the
LightCycler 2.0 instrument in LightCycler Capillaries, using the
LightCycler FastStart DNA MasterPLUS Hybridization Probes kit,
in a total reaction volume of 20 μΐ (9 μΐ PCR grade water, 2 μΐ of
primer (300 nM) / probe (300 nM) I competitor (50 nM or 150 nM)
mixture, 4 μΐ 5 x Master Mix, 5 μΐ of DNA template). Cycling
conditions were as follows: 95 C for 10 min and subsequently 50
cycles of 95 C for 10 s followed by 63 C (genotype B) or 60 C (all
other genotypes), for 20 s. Genotypes A, B and E could only be
distinguished by using competitor oligonucleotides enhancing the
TaqMan probe specificity. The detection of genotype E/B was made
possible by use of a minor groove binder (MGB) probe (Applied
Biosystems) (29). Standard Ct-value graphs obtained from testing
serial dilutions of purified control plasmids (108 to 101) were used
for quantification. Clinical samples from case studies were tested in
the presence of genotype-specific control plasmids (50 ompA
copies/μΐ) to check for PCR inhibitors. Ct-values for clinical
samples were plotted against standard graphs and C. psittaci
genotypes present in clinical samples (No) were quantified using the
LightCycler 4.0 software. The sensitivity of the assay was found to
be 10 ompA copies/μΐ DNA extract.
DNA microarray-based detection andddentification
Microarrays can be coupled with PCR where they serve as a set of
parallel dot-blots to enhance product detection and identification of
bacterial isolates. Recently, Sachse et al. (39) developed a DNA
microarray-based detection and identification method for
Chlamydia and Chlamydophila spp. The test was developed using
the ArrayTube platform (CLONDIAG®chip technologies). Unique
species-specific hybridization patterns were obtained for all nine
species of the family Chlamydiaceae on both microarray types. The
present assay proved suitable for unambiguous species
identification of chlamydial cell cultures and showed a potential for
direct detection of these bacteria from clinical tissue.
SEROLOGICAL DETECTION IN THE HOST
Serology
Despite the introduction of very sensitive and specific tests like
PCR, the idea of serological diagnosis still lingers in the minds of
several veterinary clinicians. However, serology alone is not
particularly useful in diagnosing a current chlamydial infection in
birds because of the high prevalence of this infection in birds and
the long-term, up to several months, persistence of anti-chlamydial
antibodies. In most bird species, there is a high background rate of
anti-chlamydial antibodies, and until we have more information on
the disease pattern in certain bird species in relation to direct
identification of the bacteria and serology, we are unable to
comment on the real significance of antibody titers obtained. Thus,
to determine if a single bird is infected, serology should always be
used in conjunction with antigen or gene detection or paired sera
should be examined. However, obligatory examination of paired
sera removes serology from immediate clinical relevance. A
positive test is evidence that the bird was infected by the bacterium
but does not necessarily indicate an active infection. False negative
results can occur in birds with acute infections that are sampled
before sero-conversion. Treatment with antibiotics may also delay
and/or diminish the antibody response. The main serological
methods that are been used for detecting chlamydial antibodies are:
1) various methods of elementary body agglutination (EBA), 2) the
complement fixation test (CF), 3) an indirect (micro)
immunofluorescence (ΜΠ7) test and 4) several commercial ELISAs.
 Chapter 16 Chlamydiosis

The EBA detect primarily IgM antibodies and thus can detect early
infections (22,23,24). Titers > 1:10 in budgerigars, cockatiels and
lovebirds; and titers > 1:20 in larger birds are frequently seen in
cases of recent infection. A negative result does not guarantee that a
bird is free of infection as the sensitivity of the test is rather low.
The direct complement fixation (DCF) test detects avian IgG but
not IgM. An advantage is that there is a readily available
microprocedure. Disadvantages are: 1) test antigen commercially
unavailable, 2) the test cannot be used for testing sera from avian
species whose immunoglobulins do not fix complement, such as
small psittacine birds, 3) it is only relatively sensitive, 4) it cannot
be used to differentiate between IgG and IgM antibodies, making it
necessary to test paired sera, and 5) the technique is fairly laborious
when there is a large number of samples to be tested. The modified
DCF test is more sensitive but has the same disadvantages as the
DCF test (5,21,23,47). The indirect IF test detects all
immunoglobulin isotypes and is, as is the MIF test, widely used to
detect Chlamydia trachomatis, Chlamydophila pneumoniae and
Chlamydophila psittaci antibodies in human sera using selected
strains of these bacteria (40,55,17). The MIF test appears to be more
sensitive than the complement fixation tests. Some years ago a large
number of commercially available ELISAs were evaluated for
demonstrating Chlamydophila psittaci antibodies in birds. All of
these ELISAs were highly sensitive but showed low specificity, as
they were mainly based on the use of whole chlamydial organisms,
LPS, or chlamydial outer membrane fractions of LPS and
lipoglycoprotein nature (44,7,18,30,47). When using these sources
and antigen, false-positives due to the presence of antibodies cross-
reactive to the chlamydial LPS or hsp60 cannot be ruled out. More
recently, peptide-based ELISA systems, or ELISAs using
recombinant LPS, have become commercially available for the
specific detection of Chlamydia trachomatis, Chlamydophila
pneumoniae and Chlamydophila abortus antibodies (Medac,
Savyon, Labsystems), (28,34,26,46. These tests performed as well
as the MIF assay, but are less time-consuming, less expensive, and
easier to perform. In the future this principle might also be useful in
the serodiagnosis of Chlamydophila psittaci infections. At present,
an ELISA using recombinant MOMP of Chlamydophila psittaci has
already been described (52; Verminnen et al., 2005, unpublished
results) for testing avian sera. The test is not species-specific as the
recombinant MOMP, produced by transiently tranfected COS7 cells
(51), comprises all four variable domains as well as conserved
domains and thus detects antibodies against all members of the
genus Chlamydophila and Chlamydia (53). However, this is not a
problem when testing avian sera as birds can only become infected
by Chlamydophila psittaci. Unfortunately, Chlamydophila psittaci-
specific ELISAs are not yet available.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The gross lesions caused by chlamydiae may resemble those
caused by Pasteurella, mycoplasmas, and coliforms when a
systemic infection occurs. Pasteurella- and coliform-caused
diseases can readily be eliminated from consideration, as the
fibrinous exudate from uncomplicated chlamydial infection will be
free of bacteria that can be cultured on standard bacteriologic
media. Confirmation of chlamydial infections can be obtained by
isolation and identification of viable chlamydiae from infected
tissues or by demonstration of chlamydiae by specific
immunohistochemical techniques.

Table 16.1. Modified Giminez technique or Pierce-Van Der Kamp (PVK) stain.

Constituent Amount

Distilled H2O 450.0 ml

Solution 1:
Phenol 5.0 ml

Basic fuchsin 2-5 g

Add to:
95% Ethanol 50.0 ml

Incubate (tightly capped) at 37 C for 48 hr. Filter and store at room temperature.
Na2HPO4 11.65 g
Solution 2: NaH.POAO 2.47 g
Distilled H2O (pH 7.5) Sufficient quantity 1 liter
Solution 1 20.0 ml
Solution 3:
Solution 2 25.0 ml
Let stand 10 min, filter, and use.
Solution 4: 0.5% Citric acid (aqueous)
Fast green 0.2 g
Solution 5: Distilled H2O 100.0 ml
Glacial acetic acid 0.2 ml
Solution 5 20.0 ml
Solution 6:
Distilled H2O 50.0 ml

71
 Arthur A. Andersen and Daisy Vanrompay

Table 16.2 Primer sequences for the nested PCR/EIA

Oligonucleotide bp Sequence (5’- 3’)

Forward outer 21 CCT GTA GGG AAC CCA GCT GAA

Reverse outer 22 GGT TGA GCA ATG CGG ATA GTA T

Fluorescein—forward inner 17 GCA GGA TAC TAC GGA GA

Biotin—reverse inner 18 GGA ACT CAG CTC CTA AAG

Table 16.3. Genotype specific primers and probes and competitors

Oligonucleotide Sequence (5’-3’) Positiona Specificity
CpPsSSfor TTATTAAGAGCTATTGGTGGATGCC 1 822 Cp. psittaci

CpPsSSrev AACGTATAATGGTAGATGATTAATCTACCG 1 972

CpPsGASfor GGTTTTCAGCTGCAAGCTCAA 488 Genotype A
CpPsGASprobe CTACCGATCTTCCAACGCAACTTCCTAACG 512
CpPsGAScompetitorB CTACCGATCTTCCAATGCAACTTCCTAACGb 512
CpPsGASrev CCACAACACCTTGGGTAATGC 565 .
CpPsGBSfor AATAGGGTTTTCAGCTACCAACTCAA 483 Genotype B
CpPsGBSprobe TCTACCGATCTTCCAATGCAACTTCCTAACGTA 511
CpPsGBScompetitorA TCTACCGATCTTCCAACGCAACTTCCTAACGTA 511
CpPsGBScompetitotE+E/B TCTACCGAGCTTCCAATGCAACTTCCTAACGTA 511
CpPsGBSrev CCACAACACCTTGGGTAATGC 565
CpPsGCSfor GCATCGCTCAACCTAAATTGG 929 Genotype C
CpPsGCSprobe TCTGCTGTTATGAACTTGACCACATGGAACC 952
CpPsGCSrev ATTGTGGCTTCCCCTAAAAGG 1 009
CpPsGDSfor AACCACTTGGAACCCAACACTTT 969 Genotype D
CpPsGDSprobe AGGAAAGGCCACAACTGTCGACGG 993
CpPsGDSrev CGAAGCAAGTTGTAAGAAGTCAGAGTAA 1 062
CpPsGESfor CCAAGCCTTCTAGGATCAAGGA 982 Genotype E
CpPsGESprobe TACTTTGCCCAATAATGGTGGTAAGGATGTTCTATC 1 005
CpPsGEScompetitorA+B TGCTTTGCCCAATAATAGTGGTAAGGATGTTCTATC 1005
CpPsGEScompetitorE/B TGCTTTGCCCAATAATGCTGGTAAGGATGTTCTATC 1 005
CpPsGESrev CGAAGCAATTTGCAAGACATCA 1 062
CpPsGFSfor GCAACTTTTGATGCTGACTCTATCC 904 Genotype F
CpPsGFSprobe CATCGCTCAACCTAAATTAGCCGCTGC 930
CpPsGFSrev GTTCCATGTGGTCAAGTTCAAAAC 981
CpPsGE/BSfor CCAAGCCTTCTAGGATCAACCA 982 Genotype E/B
CpPsGE/BSprobe TGCTTTGCCCAATAATGCTGc 1 005
CpPsGE/BScompetitorA+B TGCTTTGCCCAATAATAGTG 1 005
CpPsGE/BScompetitorE TACTTTGCCCAATAATGGTG 1 005
CpPsGE/BSrev TGCAAGACATCAGATAGAACATCCTT 1 052

72

ML-INF02-F
472 bp
872 bp
< >
70 90 184 200 ompA
CD1 VD1 CD2 VD2
◄-- 1068 bp
Figure 16.1: Location of the outer and inner primers in the ompA gene. Numbering according to ompA sequences in Genbank
REFERENCES
1. Al-Soud, W.A, P.--G. Lantz, A. Backman, P. Olcen, and P. Rydstrom. A
sample preparation method which facilitates detection of bacteria in blood
cultures by the polymerase chain reaction. J. Microbiol. Meth. 32:217-224.
1998.
2. Andersen, A. A. Serotyping of Chlamydia psittaci isolates using serovar—
specific monoclonal antibodies with the microimmunofluorescence test. J.
Clin. Microbiol. 29:707-711. 1991.
3. Andersen, A.A. Comparison of pharyngeal, fecal, and cloacal samples
for the isolation of Chlamydia psittaci from experimentally infected
cockatiels and turkeys. J. Vet. Diagn. Invest. 8:448-450. 1996.
4. Andersen, A. A. Two new serovars of Chlamydia psittaci from North
American birds. J. Vet. Diagn. Invest. 8:159-164. 1997.
5. Andersen, A.A. Avian chlamydiosis. In: OIE Manual of standards for
diagnostic tests and vaccines for terrestrial animals (mammals, birds and
bees), 5th ed. Office International des Epizooties (OIE), Paris, France, pp.
856-867. 2004.
6. Andersen, A.A., and D. Vanrompay. Avian chlamydiosis (psittacosis,
ornithosis). In: Diseases of poultry, 11th ed. Y.M. Saif, ed. Iowa State
University Press, Ames, Iowa. pp. 863-879. 2003.
7. Bendheim U., I. Wodowski, M. Ordonez, and A. Naveh. Development of
an ELISA—Kit for antibody detection in psittacine birds. IV DVG Tagung
uber Vogelkrankheiten. Munchen. pp. 193-201. 1993.
8. Bevan, B.J., and C.D. Bracewell. Chlamydiosis in birds in Great Britain.
2. Isolations of Chlamydia psittaci from birds sampled between 1976 and
1984. J. Hyg. 96:453-458. 1986.
9. Bevan, B.J., G.A. Cullen, and W.MF. Read. Isolation of Chlamydia
psittaci from avian sources using growth in cell culture. Avian Pathol.
7:203-211. 1978.
10. Bovamick, M.R., J.C. Miller, and J.C. Snyder. The influence of certain
salts, amino acids, sugars, and proteins on the stability of rickettsiae. J.
Bacteriol. 59:509-522. 1950.
11. Chirgwin, J.M., A.E. Przybyla, RJ. MacDonald, and W.J. Rutter.
Isolation of biologically active ribonucleic acid from sources enriched in
ribonuclease. Biochemistry, 18:5294-5299. 1979.
12. Chomczynski, P, and N. Sacchi. Single-step method of RNA isolation
by acid guanidinium thiocyanate—phenol—chloroform extraction. Anal.
Biochem 162(1): 156—9. 1987.
13. DeGraves, F.J., D. Gao, and B. Kaltenboeck. High-sensitivity
quantitative PCR platform. Biotechniques 34(1): 106-10, 112-5. 2003.
14. Everett, K.D.E., and A. A. Andersen. 1999. Identification of nine species
of the Chlamydiaceae using PCR-RFLP. Inti. J. Systematic Bacteriol.
49:803-813.
73
Chapter 16 Chlamydiosis
ML-INR03-B
<=?
>
638 655 920 941
CD3 VD3 CD4 VD4 CD5
—►
15. Everett, K.D.E., RM. Bush, and A.A. Andersen. Emended description
of the order Chlamydiales, proposal of Parachlamydiaceae fam nov. and
Simkaniaceae fam. nov., each containing one monotypic genus, revised
taxonomy of the family Chlamydiaceae, including a new genus and five new
species, and standards for the identification of organisms. Inti. J. Systematic
Bacteriol. 49:415-440. 1999.
16. Everett, K.D.E., L.J. Hornung, and A.A. Andersen. Rapid detection of
the Chlamydiaceae and other families in the Order Chlamydiales'. Three
PCR Tests. J. Clin. Microbiol. 37(3):575-580. 1999.
17. Fernandez, F., J. Gutierrez, J. Mendoza, J. Linares, and M.J. Soto. A
new microimmunofluorescence test for the detection of Chlamydia
pneumoniae specific antibodies. J. Basic Microbiol. 44(4):275-9. 2004.
18. Fudge, A.M. Blocking antibody ELISA testing of pet birds:
Implications for chronic infections. Semen. Avian Exotic Pet Med. 2:167—
170. 1993.
19. Geens, T., A. Dewitte, N. Boon, and D. Vanrompay. Development of a
Chlamydophila psittaci species—specific and genotype—specific real-time
PCR. Vet. Res. 2005, in press.
20. Geens, T., A. Desplanques, M. Van Loock, B.M. Bonner, E.F. Kaleta,
S. Magnino, A.A Andersen, K.D. Everett, and D. Vanrompay. Sequencing
of the Chlamydophila psittaci ompA gene reveals a new genotype, E/B, and
the need for a rapid discriminatory genotyping method. J. Clin. Microbiol.
43(5):2456—61. 2005.
21. Grimes, J.E., D.N. Phalen, and F. Arizmendi. Chlamydia latex
agglutination antigen and protocol improvement and psittacine bird anti-
chlamydial immunoglobulin reactivity. Avian Dis. 37(3):817-24. 1993.
22. Grimes, J.E., and F. Arizmendi. Usefulness and limitations of three
serologic methods for diagnosing or excluding chlamydiosis in birds. J.
Am. Vet. Med. Assoc. 209:747-750. 1996.
23. Grimes, J.E., T.N. Tully, Jr., F. Arizmendi, and D.N. Phalen.
Elementary body agglutination for rapidly demonstrating chlamydial
agglutinins in avian serum with emphasis on testing cockatiels. Avian Dis.
38:822-831. 1994.
24. Grimes, J.E. Evaluation and interpretation of serological responses in
psittacine bird chlamydiosis and suggested complementary diagnostic
procedures. J. Avian Med. Surg. 10:75—83. 1996.
25 Hewinson, R.G., P.C. Griffiths, B.J. Bevan, S.E. Kirwan, M.E. Field,
M.J. Woodward, and M. Dawson. Detection of Chlamydia psittaci DNA in
avian clinical samples by polymerase chain reaction. Vet. Microbiol.
54(2): 155-66. 1997.
26. Hoymans, V.Y., J.M. Bosmans, L. Van Renterghem, R. Mak, D. Ursi,
F. Wuyts, C.J. Vrints, and M. Ieven. Importance of methodology in
determination of Chlamydia pneumoniae seropositivity in healthy subjects
and in patients with coronary atherosclerosis. J. Clin. Microbiol. 41(9)4049-
-53. 2003.
27. Kaltenbock, Β., N. Schmeer, and R. Schneider. Evidence for numerous
ompl alleles of porcine Chlamydia trachomatis and novel chlamydial
species obtained by PCR. J. Clin. Microbiol. 35(7): 1835-41. 1997.
Arthur A. Andersen and Daisy Vanrompay
28. Kaltenboeck, B., D. Heard, F.J. DeGraves, and N. Schmeer. Use of
synthetic antigens improves detection by enzyme—linked immunosorbent
assay of antibodies against abortigenic Chlamydia psittaci in ruminants. J.
Clin. Microbiol. 35(9):2293-8. 1997b.
29. Kutyavin, I.V., I.A. Afonina, A. Mills, V.V. Gom, E.A. Lukhtanov, E.S.
Belousov, MJ. Singer, D.K. Walburger, S.G. Lokhov, A.A. Gall, R.
Dempcy, MW. Reed, R.B. Meyer, and J. Hedgpeth. 3'-minor groove
binder-DNA probes increase sequence specificity at PCR extension
temperatures. Nucleic Acids Res. 28:655-661. 2000.
30. Ley, D.H., K. Flammer, and P. Cowen. Performance characteristics of
diagnostic tests for avian chlamydiosis. J. Assoc. Avian Vet. 7:203-207.
1993.
31. Lindqvist, R., B. Norling, and S.T. Lambertz. A rapid sample
preparation method for PCR detection of food pathogens based on buoyant
density centrifugation. Lett. Appl. Microbiol. 24:306—310. 1997.
32. Madico, G., T.C. Quinn, J. Boman, and C. A. Gaydos. Touchdown
enzyme time release—PCR for detection and identification of Chlamydia
trachomatis, C. pneumoniae, and C. psittaci using the 16S and 16S—23 S
spacer rRNA genes. J. Clin. Microbiol. 38(3): 1085-93. 2000.
33. Messmer, T. O., S. K. Skelton, J. F. Moroney, H. Daugharty, and B. S.
Fields. Application of a nested, multiplex PCR to psittacosis outbreaks. J.
Clin. Microbiol. 1997; 35:2043-2046.
34. Morre, S.A., C. Munk, K. Persson, S. Kruger-Kjaer, R. van Dijk, C.J.
Meijer, and A. J. van Den Brule. Comparison of three commercially
available peptide-based immunoglobulin G (IgG) and IgA assays to
microimmunofluorescence assay for detection of Chlamydia trachomatis
antibodies. J. Clin. Microbiol. 40(2):584-7. 2002.
35. Moore, F.M, and ML. Petrak. Chlamydia immunoreactivity in birds
with psittacosis: Localization of chlamydiae by the peroxidase­
antiperoxidase method. Avian Dis. 29:1036-1042. 1985.
36. Paul, I.D. The growth of Chlamydia in McCoy cells treated with
emetine. Med. Lab. Sci. 39:15-32. 1982.
37. Ridstrom, P., R. Knutsson, P. Wolffs, M Dahlenborg, and C. Lofstrom.
Pre—PCR processing of samples. In: PCR detection of microbial pathogens.
K. Sachse, and J. Frey, eds. Humana Press, Totowa, NJ. pp. 31-50. 2003.
38. Sachse, K. and H. Hotzel. Detection and differentiation of Chlamydiae
by nested PCR. In: PCR detection of microbial pathogens. K. Sachse and J.
Frey, eds. Humana Press, Totowa, NJ. pp. 123-136. 2003.
39. Sachse, K, H. Hotzel, P. Slickers, T. Ellinger, and R. Ehricht. DNA
microarray-based detection and identification of Chlamydia and
Chlamydophila spp. Mol. Cell Probes 19(1):41—50. 2005. (Epub 2004 Nov
Π)
40. Salinas, J., MR. Caro, and F. Cuello. Comparison of different
serological methods for the determination of antibodies to Chlamydia
psittaci in pigeon sera. Zentralbl. Veterinarmed. B. 40(4):239—44. 1993.
41. Sayada, C., A.A. Andersen, C. Storey, A. Milon, F. Eb, N. Hashimoto,
K. Hirai, J. Elion, and E. Denamur. Usefulness of ompl restriction mapping
for avian Chlamydia psittaci isolate differentiation. Res. Microbiol.
146:155-165. 1995.
42. Smith, K.A., K.K. Bradley, MG. Stobierski, and L.A. Tengelsen.
Compendium of measures to control Chlamydophila psittaci (formerly
Chlamydia psittaci) infection among humans (psittacosis) and pet birds,
2005. J. Am. Vet. Med. Assoc. 226(4):532-39. 2005.
43. Spencer, W.N., and F.W.A. Johnson. Simple transport medium for the
isolation of Chlamydia psittaci from clinical material. Vet. Rec. 113:535—
536. 1983.
44. Sting, R., and H.M. Hafez. Purification of Chlamydia psittaci antigen by
chromatografie on polymyxin B agarose for use in die enzyme-linked
immunosorbent assay (ELISA). Zentralbl. Bakteriol. 277: 436—445. 1992.
45. Tappe, J.P., A.A. Andersen, and N.F. Cheville. Respiratory and
pericardial lesions in turkeys infected with avian or mammalian strains of
Chlamydia psittaci. Vet. Pathol. 26:386-395. 1989.
46. Tiran, A., K. Tiesenhausen, E. Karpf, J. Orfila, G. Koch, H.J. Gruber,
O. Tsybrovskyy, and B. Tiran. Association of antibodies to chlamydial
lipopolysaccharide with the endovascular presence of Chlamydophila
pneumoniae in carotid artery disease. Atherosclerosis. 173(1):47—54. 2004.
47. Tully, T.N.,Jr., S.M. Shane, J.E. Grimes, R.P. Poston, and MT.
Kearney. Comparison of procedures to detect Chlamydia psittaci antibodies
in cockatiels (Nymphicus hollandicus). Avian Dis. 40(2): 266—71. 1996.
48. Van Loock, Μ, K. Verminnen, T.O. Messmer, G. Volckaert, B.M
Goddeeris and D. Vanrompay. Use of a nested PCR-enzyme immunoassay
with an internal control to detect Chlamydophila psittaci in turkeys. 2005,
BMC Infect. Dis. 5:76, 2005.
49. Vanrompay, D., R. Ducatelle, and F. Haesebrouck. Diagnosis of avian
chlamydiosis: Specificity of the modified Gimenez staining on smears and
comparison of the sensitivity of isolation in eggs and three different cell
cultures. J. Vet. Med. Ser. B 39:105-112. 1992.
50. Vanrompay, D., A. Van Nerom, R. Ducatelle, and F. Haesebrouck.
Evaluation of five immunoassays for detection of Chlamydia psittaci in
cloacal and conjunctival specimens from turkeys. J. Clin. Microbiol.
32:1470-1474. 1994.
51. Vanrompay, D., E. Cox, J. Mast, B. Goddeeris, and G. Volckaert. High-
level expression of Chlamydia psittaci major outer membrane protein in
COS cells and in skeletal muscles of turkeys. Infect. Immun. 66(11): 5494-
500. 1998.
52. Vanrompay, D., E. Cox, P. Kaiser, S. Lawson, M Van Loock, G.
Volckaert, and B. Goddeeris. Protection of turkeys against Chlamydophila
psittaci challenge by parenteral and mucosal inoculations and the effect of
turkey interferon-gamma on genetic immunization. Immunology.
103(1): 106-12. 2001.
53. Vanrompay, D., T. Geens, A. Desplanques, T.Q. Hoang, L. De Vos, M
Van Loock, E. Huyck, C. Mirry, and E. Cox. Immunoblotting, ELISA and
culture evidence for Chlamydiaceae in sows on 258 Belgian farms. Vet.
Microbiol. 99(1):59—66. 2004.
54. Wilson, P.A., J. Phipps, D. Samuel, andN.A. Saunders. Development of
a simplified polymerase chain reaction—enzyme immunoassay for the
detection of Chlamydia pneumoniae. J. Applied Bacteriol. 80:431—438.
1996.
55. Wong, K.H, Skelton S.K., and H. Daugharty. Utility of complement
fixation and microimmunofluorescence assays for detecting serologic
responses in patients with clinically diagnosed psittacosis. J. Clin.
Microbiol. 32(10):2417-21. 1994.
56. Yoshida, Η., Y. Kishi, S. Shiga, and T. Hagiwara. Differentiation of
Chlamydia species by combined use of polymerase chain reaction and
restriction endonuclease analysis. Microbiol. Immunol. 42(5):411—4. 1998.
 17
ORNITHOBACTERIOSIS
Richard P. Chin and Bruce R. Charlton

SUMMARY. Omithobacteriosis is a respiratory disease of avian species caused by the bacterium Ornithobacterium rhinotracheale. Gross
lesions in infected birds include a fibrinoheterophilc pneumonia, airsacculitis, and pericarditis. Ornithobacterium rhinotracheale is a
pleomorphic gram-negative rod-shaped bacterium that grows on blood agar. Seventeen serotypes (A through Q) are currently recognized,
though serotype A is the major one isolated. The bacterium has been isolated from numerous avian species, primarily infecting chickens and
turkeys.
Agent Identification. Isolation and identification of the bacterium are required to make a diagnosis.
Serologic Detection in the Host. Enzyme-linked immunosorbent assays and serum plate agglutination tests have been developed to detect
antibodies.

INTRODUCTION airsacculitis, pericarditis, peritonitis, and a mild tracheitis could

Ornithobacterium rhinotracheale is associated with respiratory
disease in avian species, primarily turkeys and chickens, but the
bacterium also has been isolated from chukars, rooks, and a
partridge, pheasant, and pigeon (2,4,10). The first reported isolation
of O. rhinotracheale was made from turkeys in Germany in 1981
(6). The bacterium has since been isolated from birds throughout
the world.
Prior to being named in 1994, O. rhinotracheale had been
identified as Pasteurella-\&Q organism, Kingella-tiks bacterium,
Taxon 28, and pleomorphic gram-negative rod bacterium.
Identification of O. rhinotracheale by biochemical test kits can be
challenging. Current commercially available identification systems
do not have O. rhinotracheale listed in their database and may
misidentify it as Gallibacterium anatis biovar haemolytica
(formerly Pasteurella haemolytica), Weeksella spp., or
Flavobacterium meningosepticum, depending on the test system and
variable reactions of this bacterium.
CLINICAL DISEASE
Whether or not O. rhinotracheale is a primary pathogen is still
uncertain. In many cases, in both chickens and turkeys, infection
with O. rhinotracheale is secondary to other respiratory disease
agents (9).
In chickens, infections have been reported in 3-to-6-wk-old birds,
and in layers 20-50 wk of age (5,6,8,9,12). Mild respiratory signs
occur from about 3 to 4 wk of age, mortality mildly increases, and
airsacculitis condemnation rates at the slaughter plant are higher. In
broiler breeders, the disease primarily occurs between 20 and 50 wk
of age, during peak egg production (5). Mortality is slightly
increased, feed intake is decreased, and mild respiratory signs
occur. There may be egg production decrease, eggshell may be of
poor quality, and egg size may decrease.
In turkeys, infections have been detected as early as 2 wk of age,
but severe lesions are seen in older birds (>14wk of age) and
breeders (3,5,11). Infection with O. rhinotracheale at 2 wk of age
causes respiratory signs and nasal discharge, followed by facial
edema and swelling of the infraorbital sinuses (9). Birds will
appear depressed with ruffled feathers, and display a decrease in
feed and water intake. Subsequently, mortality increases. In older
birds, a sudden increase in mortality may be the only sign. Slight
depression and gasping, marked dyspnea, and expectoration of
blood-stained mucus can be seen just prior to death. In breeder
flocks, egg production can decrease slightly (2-5%) (3). Mortality
rates usually range between 2% and 11% in chickens and turkeys.
Clinical cases reveal unilateral and bilateral lung consolidation
with fibrinous exudate on the pleura in both chickens and turkeys
(3,11). These lesions are similar to those seen in fowl cholera in
turkeys, but are less severe. In addition, a fibrinoheterophilic
75
occur.
SAMPLE COLLECTION
The primary site for isolating O. rhinotracheale is the respiratory
tract. Taking tracheal cultures from live birds should be done using
a sterile swab. Care must be taken to prevent contamination as
large numbers of other bacteria can easily overgrow the pinpoint
colonies of O. rhinotracheale. Samples can be taken at necropsy
using sterile swabs (cotton or dacron) from the trachea, infraorbital
sinuses, lungs, and air sacs. Reports have been made of isolation of
O. rhinotracheale from joints, heart, brain, and fiver, and in chronic
disease, from the thoracic vertebrae and tendon sheaths. Isolates
can be stored at -70 C.
PREFERRED CULTURE MEDIA AND SUBSTRATES
For primary isolation, O. rhinotracheale gjtows readily on 5%
sheep blood agar. It grows aerobically, microaerobically, and
anaerobically. The best growth occurs in air enriched with 7.5%-
10% CO2 at 37 C, although growth occurs from 30 to 42 C.
Ornithobacterium rhinotracheale does not grow on MacConkey
agar.
About 90% of the isolates appear to be resistant to gentamicin and
polymyxin B (11). Hence, 5pg/ml each of gentamicin and
polymyxin B can be added to blood agar media for selective
isolation of O. rhinotracheale. However, blood agar plates without
antibiotics should always be used in tandem to prevent missing the
10% antibiotic-susceptible isolates.
AGENT IDENTIFICATION
Colony and Cell Morphology
On blood agar, pinpoint colonies, less than 1 mm, can be detected
at 24 hr of incubation. At 48 hr, colonies will be approximately 1-2
mm in diameter, gray, circular, and convex with an entire edge.
Some isolates from chickens have a reddish glow. Plates should be
held for 48 h to look for the small colonies typical of
O. rhinotracheale as they can easily be overgrown by other bacteria
such as Escherchia coli. Ornithobacterium rhinotracheale cultures
can have a distinct smell similar to butyric acid.
Ornithobacterium rhinotracheale is a gram-negative, highly
pleomorphic, nonmotile, nonsporulating bacterium. It appears
primarily as short, plump rods 0.2-0.9 pm x 1-3 pm, and less
frequently as long filamentous rods or club-shaped rods (10).
Biochemical Characteristics
Biochemical tests for O. rhinotracheale are inconsistent. Listed in
Table 17.1 are some of the more consistent reactions.
Richard P. Chin and Bruce R. Charlton
Table 17.1. Some phenotypic characteristics of Ornithobacterium
rhinotracheale.
Test Reaction
Blood agar Growth
MacConkey agar No growth
Gram stain Pleomorphic gram-neg. rod
Catalase Negative
Oxidase Positive
Triple sugar iron agar No change
β-Galactosidase (ONPG) Positive
Indole Negative
The API-20NE identification strip (bioMerieux-Vitek, Hazelwood,
Mo.) is routinely used, although O. rhinotracheale is not included
in their database, and there are various biocodes. The most common
biocodes are 0220004 (61%) and 0020004 (38.5%) (11). If the
isolate is positive for arginine dihydrolase (0.5%) biocodes of
0320004 and 0120004 are produced. The API ZYM system
(bioMerieux-Vitek, Hazelwood, Mo.) is useful for determining
enzymatic activities. In this system O. rhinotracheale consistently
produces five negative reactions (lipase, β-glucuronidase, β-
glucosidase, α-mannosidase, and α-fucosidase). Another rapid test
system, the RapID NF Plus, (Remel/Atlanta, Norcross, Ga.) also
appears to be suitable for identification of O. rhinotracheale (7).
Field isolates generated 5 unique biocodes: 472264 (41.8%),
476264 (31.8%), 676264 (18.2%), 672264 (7.3%) and 472044
(0.9%). Carbohydrate fermentation is extremely variable.
Analysis of cellular fatty acids can aid in identifying
O. rhinotracheale. Predominant fatty acids detected using the
Microbial Identification System (Microbial ID, Newark, Del.) are
15:0 iso, 16:0, 15:0 iso 3OH, 17:0 iso, 16:0 3OH, 17:0 iso 3OH, and
unknown peaks with equivalent chain lengths of 13.566 and 16.580
(2).
Seventeen serotypes of O. rhinotracheale are reported, serotype A
through Q. These have been differentiated using the agar gel
immunodiffusion test (8), (P. van Empel, pers. comm.). Some
geographical differences exist in serotypes found throughout the
world. Most isolates found in Europe and the United States are
serotype A. After serotype A, types B, D, and E are the predominate
serotypes found in Europe. Ninety-five percent of the strains
isolated from chickens are serotype A.
SEROLOGIC DETECTION IN THE HOST
Enzyme-linked immunosorbent assays (ELISAs) have been
developed and appear adequate for detecting antibodies to most
serotypes of O. rhinotracheale (5,8,11). Commercial ELISA kits are
available in Europe and appear to detect antibodies for serotypes A
through M. A serum plate agglutination test has also been
developed to detect antibodies to O. rhinotracheale (1).
76
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Ornithobacterium rhinotracheale infection should be
differentiated from other diseases with pneumonia and airsacculitis,
such as fowl cholera, colibacillosis, mycoplasmosis, and
chlamydophylosis. This is dependent upon isolation and
identification of O. rhinotracheale from infected tissues.
REFERENCES
1. Back, A, D. Halvorson, G. Rajashekara, K. V. Nagaraja. Development of
a serum plate agglutination test to detect antibodies to Ornithobacterium
rhinotracheale. J. Vet. Diagn. Invest. 10:84-86. 1998
2. Charlton, B. R., S. E. Channing-Santiago, A. A. Bickford, C. J. Cardona,
R. P. Chin, G. L. Cooper, R Droual, J. S. Jeffrey, C. U. Meteyer, H. L.
Shivaprasad, and R. L. Walker. Preliminary characterization of a
pleomorphic gram-negative rod associated with avian respiratory disease. J.
Vet. Diagn. Invest. 5:47-51. 1993.
3. Chin, R. P., P. C. M van Empel, and Η. M Hafez. Ornithobacterium
rhinotracheale infection. In: Diseases of poultry, 11th ed. Y. M Saif, H. J.
Bames, J. R. Glisson, A. M Fadly, L. R. McDougald, and D. E. Swayne,
eds. Iowa State University Press, Ames, Iowa. pp. 683-690. 2003.
4. De Rosa, M., R. Droual, R. P. Chin, H. L. Shivaprasad, and R. L.
Walker. Ornithobacterium rhinotracheale infection in turkey breeders.
Avian Dis. 40:865-874. 1996.
5. Hafez, Η. M Current status on the role of Ornithobacterium
rhinotracheale (ORT) in respiratory disease complexes in poultry. Arch.
Geflugelk. 60:208-211. 1996.
6. Hinz, K.-H., and Η. M Hafez. The early history of Ornithobacterium
rhinotracheale (ORT). Arch. Geflugelk 61:95-96. 1997.
7. Post, K. W., S. C. Murphy, J. B. Boyette, and P. M Resseguie.
Evaluation of a commercial system for the identification of
Ornithobacterium rhinotracheale. J. Vet. Diagn. Invest. 11:97-99. 1999.
8. Travers, A. F. Concomitant Ornithobacterium rhinotracheale and
Newcastle disease infection in broilers in South Africa. Avian Dis. 40:488-
490. 1996.
9. van Beek, P.N.G.M, P. C. M van Empel, G. Van Den Bosch, P. K.
Storm, J. H. Bongers, and J. H. du Preez. Ademhalingsproblemen,
groeivertraging en gewrichtsontsteking bij kalkoenen en vleeskuikens door
een Pasteurella-achtige bacterie: Ornithobacterium rhinotracheale or “Taxon
28.” Tijdschr. Diergeneeskd 110:99-101. 1994.
10. Vandamme P., P. Segers, M. Vancanneyt, K. van Hove, R. Mutters, J.
Hommez, F. Dewhirst, B. Paster, K. Kersters, E. Falsen, L. A Devriese, M
Bisgaard, K.-H. Hinz, and W. Mannheim. Ornithobacterium rhinotracheale
gen. nov., sp. nov., isolated from the avian respiratory tract. Int. J. Syst.
Bacteriol. 44:24-37. 1994.
11. van Empel, P. C. M, and Η. M Hafez. Ornithobacterium
rhinotracheale: a review. Avian Pathol. 28: 217-227. 1999.
12. van Empel, P., H. van den Bosch, D. Goovaarts, and P. Storm.
Experimental infection in turkeys and chickens with Ornithobacterium
rhinotracheale. Avian Dis. 40:858-864.1996.
 18
MYCOSES AND MYCOTOXICOSES
R. D. Wyatt

SUMMARY. Mold-related disease in avian species can be divided into two broad categories, namely mycoses and mycotoxicoses. Mycoses
are typically defined as infection of tissue by a particular mold species. In general terms, Aspergillus, Dactylaria, and Microsporum are those
mold species most apt to be responsible for mycoses in avian species. Additionally, Candida, a genus of polymorphic yeasts (exhibiting yeast
cells, hyphae and pseudohyphae) can also infect the upper gastrointestinal tract. All of these agents should be considered economically
important to domestic poultry, however, Aspergillus is by far the most common.
Mycotoxins are a broad and diverse group of toxic metabolites produced by toxigenic molds when these molds are permitted to grow on
certain feedstuffs. Consumption of such moldy feedstuffs by avian species may result in clinical signs of disease, dependent upon the specific
mycotoxin that is contaminating the ingested feedstuff. The three most important mold genera that are known to have species that posses the
capability to produce mycotoxins are Fusarium, Aspergillus, and Penicillium. Trichothecenes, a rather large group of mycotoxins with
similar chemical structures, are produced primarily by species of Fusarium. Aflatoxin, perhaps the most toxic of all mycotoxins, is the most
important mycotoxin produced by Aspergillus. Ochratoxin is also an economically important mycotoxin and is produced by species of
Penicillium and Aspergillus.
Isolation and identification of molds responsible for mycoses can be accomplished in infected tissues by employing basic microbiological
techniques. Additionally, histological examination of infected tissue and examination of the etiological agent and tissue response can also
confirm the identity of die pathological agent.
Isolation and identification of specific mycotoxins requires extraction of the contaminated feedstuff followed by chemical analysis of the
extract. Additionally, flock history, management practices and a working knowledge of specific clinical signs of various mycotoxicoses is
essential to identify the specific mycotoxin involved in a disease outbreak.

ASPERGILLOSIS

INTRODUCTION

The term “fungus” is a general term used to describe any member
of a very broad taxonomic classification of eukaryotic
microorganisms (protists) including lichens, mushrooms, yeasts,
rusts, smuts, molds, and numerous other organisms. These
organisms have no chlorophyll, are aerobic, and have a very rigid
cell wall containing chitin. Molds are a subset of fungi that degrade
organic material in the environment. They are ubiquitous,
saprophytic, parasitic, and their spores are resistant to many
environmental conditions, especially desiccation. When growing in
culture, most molds will first produce single filaments known as
hyphae and as the culture matures it will appear filamentous and
assume a "wooly” appearance. Mature cultures are frequently
pigmented due to the production of pigments by the mycelium or
pigments associated with spores. Pathogenic molds typically
reproduce by formation of spores or conidia; whereas, Candida
albicans reproduces by budding. A relatively small percentage of
molds in die environment are causative of disease of poultry.
Nevertheless, based upon routine exposure of poultry to molds, the
probability for disease outbreaks to occur in commercial poultry is
significant. Infections of the upper respiratory tract by Aspergillus
fumigatus and other Aspergilli and infections of the upper
gastrointestinal tract of poultry by Candida albicans are well-
documented (7,40).
Other mold species are merely environmental inhabitants with soil
being their natural ecological niche. These molds are typically
associated with degradation of living or dead organic material.
Those degrading living organic material are often plant pathogens;
whereas, those degrading dead organic material are best known for
their capability to produce secondary metabolites such as antibiotics
(e.g. Penicillium chrysogenum). Some molds possess the genetic
capability to produce highly toxic secondary metabolites during
their growth on organic material. These toxic metabolites are
referred to as mycotoxins. Ingestion of mycotoxins by poultry in
grain or finished feed will result in disease referred to as
mycotoxicosis. Mycotoxicoses in poultry are quite diverse with
each being caused by a specific mycotoxin and each toxicosis
characterized by a primary target organ system, target organ, or
target tissue. The toxicity of various mycotoxins to poultry differ
dramatically. Consequently, the signs of mycotoxicoses will vary
depending on the specific mycotoxin(s) involved in the disease.
Signs of disease are also influenced by various interacting factors
such as the presence of other diseases, nutritional status of affected
birds, environmental conditions, and husbandry practices (11, 13,
17, 34, 35, 37, 39). Hence, a rapid and accurate diagnosis of specific
mycotoxicoses is often very difficult.
CLINICAL DISEASE
Aspergillosis can be caused by any member of the genus
Aspergillus, however, Aspergillus fumigatus is the most common
etiologic agent for this disease in poultry (7, 18, 22). The lungs
and air sacs are the typical tissues involved, however, infection of
the eye, sinuses, and meninges can occur. When responsible for
mycoses, Aspergilli are generally considered opportunistic
pathogens. Immunosuppression, respiratory tract irritation,
antibiotic therapy and die presence of other infective agents can
predispose birds to aspergillosis (2).
In young broilers, poults, and quail, and a variety of wild birds (7,
12, 22) high morbidity and mortality are commonly observed.
Improperly fumigated hatching eggs and improperly disinfected
incubators and hatchers can result in high exposure rates to the
spores of Aspergilli resulting in infection of chicks with the disease
progressing rapidly. Consequently, the term “brooder pneumonia”
is often used to describe acute aspergillosis in young birds.
Impairment of respiratory function followed by lethargy and
anorexia can lead to death in young birds within 24-72 hr. Adult
turkeys are also susceptible to aspergillosis. Although the signs of
the disease are similar to those of young turkeys, chickens and
quail, the disease is generally of a longer duration. Coughing,
sneezing, and general labored breathing are commonly observed.
Upon necropsy, the internal lesions can be described as focal
caseous nodules on the air sacs, imbedded within the lungs and on
the mucosal surface of the trachea. Occasionally, greenish mold
growth can be visualized on the air sacs. This is typically associated
with the chronic form of the disease. When this occurs, the lesions
associated with other internal organs may appear yellowish in color.

77
R. D. Wyatt
SAMPLE COLLECTION
Upon necropsy, areas of suspected infected tissue should be
carefully identified, aseptically excised from surrounding tissue and
immediately transferred to a sterile vessel. Retrieval of suspect
tissue from both the periphery and center of a lesion is
recommended. Retrieved tissue should be subjected to both direct
microscopic examination and microbiological culturing. Care
should be taken in maintaining aseptic conditions since Aspergilli
are common in the laboratoiy microflora. When samples are being
prepared for microscopic examination, immediate fixing of the
specimen is imperative. Also, culturing procedures should be
initiated without delay following removal of the infected tissue.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Place a small subsample of the suspected infected tissue in a sterile
container with a sufficient volume of sterile saline to facilitate
disruption of tissue. Disruption of tissue can be accomplished with a
sterile glass rod or sterile spatula. Alternatively, infected tissue can
be transferred directly to culture medium in a Petri dish or
thoroughly homogenized in a tissue grinder or microblendor prior to
transfer. In any case, following aseptic transfer of the specimen to
the surface of the Petri dish, streaking or spreading of the specimen
over the surface of the Petri dish should be accomplished with a
sterile inoculating loop.
Several types of microbiological media can be used for culturing
Aspergilli. Sabouraud’s dextrose agar, malt agar, and potato
dextrose agar have proven ideal for the growth of numerous species
of Aspergillus (2). Regardless of the choice of medium, fortification
of the medium with 40-50 micrograms of chloramphenicol/ml of
medium should be employed to inhibit any bacteria that may be in
the specimen. This is essential since bacteria, if present, will grow
more rapidly than molds present in the specimen. The rapid growth
of bacteria will impede or even prevent the development of the
slower growing molds. Incubation of the Petri dish cultures should
be done at 30 C or up to 10 days.
During incubation of the inoculated cultures, Aspergillus growth
will typically be evident within 2-3 days of incubation and will first
appear white in color and filamentous in texture. If the mold
sporulates, it may turn light green to gray in color by day 5-10. The
reverse of the Petri dish culture will typically be white to tan in
color. Not all Aspergilli display a greenish coloration during spore
formation, but A. fumigatus and many other species do.
CANDIDIASIS
CLINICAL DISEASE
Avian candidiasis, also known as crop mycosis, is an infection of
the upper gastrointestinal tract. Turkeys are more susceptible to
candidiasis than chickens (40). The primary etiologic agent for this
disease is Candida albicans, however, C. tropicalis, C. labrata, C.
parapsilosis, C. krusei, and C. lusitaniae have also been isolated
from outbreaks of candidiasis (2,40). C. albicans is common in
small numbers in the gastrointestinal tract of birds, however this
opportunistic pathogen tends to colonize the bird during early age,
following long-term use of antibiotics, during stages of
immunodeficiency, and during times of generalized stressful
situations, such as pre-existing infection, poor sanitation,
overcrowding, poor nutrition, and environmental extremes.
During infection, the crop wall will become thickened and opaque
and during advanced cases, focal areas of white yeast growth can be
visualized. During advanced cases, the mucosal surface will present
a “Turkish towel” appearance. The esophagus may be characterized
by having a thick exudate covering the mucosal lining. Affected
birds may appear clinically normal or may exhibit poor growth,
78
AGENT IDENTIFICATION
Presumptive identification of Aspergillus is based upon
microscopic morphology and growth on various microbiological
media. Aspergilli typically exhibit hyaline (glassy appearance),
septate, and branched hyphae. The color of the conidiophore can be
colorless, brown or green depending upon the species (7). The
conidiophore with be rather long (> 300 microns) in the case of
A. niger, and short (<300 microns) in length in the case of A.
fumigatus (9). The round or spherical conidia supported by the
coniophore are usually arranged in either a radiate or columnar
fashion. Aspergillus fumigatus is typically in a columnar
configuration; whereas, A. niger is typically in a radiate
configuration.
Direct Microscopic Examination
Specimens of infected tissue can be mixed with 10% KOH on a
sterile microscope side and then stabilized by covering with a cover
slip. With large pieces of tissue, the KOH concentration can be
increased to 20% and allowed to incubate to permit sufficient
clarification of the tissue to permit visualization of the mold.
Infecting mold can be visualized and detected by the presence of
branching septate hyphae or mycelium. If mold is detected in the
tissue it is advisable to prepare another specimen for histological
examination.
Histological Examination of Infected Tissue
Suspect tissue should first be fixed in 10% neutral buffered
formalin, embedded in paraffin and sections prepared for staining.
Several stains are available for detection and identification of mold
in tissue. Examples are Girdley’s fungus, periodic acid-Schiff
(PAS), hematoxylin and eosin (H&E) and Gomori methenamine
silver (GMS) (5). Of these, GMS is usually preferred (5). However,
routinely stained specimens with H&E will stain most species of
Aspergilli, but is not acceptable for most other mold genera. Stained
sections infected with mold will have structures similar to those
described above. Hyaline, septate, and branched hyphae with a
consistent diameter can be detected. In some cases of aspergillosis,
the conidial head and even conidia may be present.
poor feathering, lethargy, and C. albicans septicemia in rare cases
(40).
SAMPLE COLLECTION
In intact birds, the upper gastrointestinal tract (mouth, esophagus,
and crop) can be swabbed with a dry sterile cotton swab by gently
rubbing the swab on these internal surfaces. At this point, the swab
can be used to inoculate the surface of a Petri dish containing an
appropriate medium and subsequently incubated. On the other hand,
after swabbing, the end of the swab can be separated from the swab
stick with sterile scissors while the used portion of the swab is
allowed to drop into a sterile container containing a small volume of
neutral buffered saline. Following gentle agitation to release and
suspend any yeast cells into the saline, a measured volume of the
saline can be transferred directly to the surface of a Petri dish
containing an appropriate medium, streaked and subsequently
incubated. Alternatively, the suspension can be serially diluted and
pour-plate technique used to enumerate the recovered organisms
(2).

During necropsy, the mouth can be swabbed as described above.
The crop can be opened with sterile scissors, rinsed with water and
then swabbed with a sterile cotton swab and plated as described.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Collected specimens should be streaked onto Petri dish cultures
containing Pagano Levin Base (Difco Laboratories, Detroit, MI)
fortified with 100 micrograms of 2, 3, 5-triphenylterazolium
chloride (TTC) and 500 micrograms of neomycin per ml of medium
and prepared in strict adherence to manufacturer’s
recommendations. Under some situations, the presence of
neomycin-resistant bacteria in the sample will tend to impede the
growth, enumeration, or visualization of Candida species. If this
occurs, gentamicin (50 micrograms per ml of medium) can be
added to the medium in addition to the neomycin. Petri dish cultures
of Candida species should be incubated at 30 C for 72 hr. Candida
species will appear as rather large round colonies with a regular
border, dull or glistening luster. Depending upon the Candida
species growing on the surface of the medium, the color of
individual colonies will be cream to pink to light red in color.
Furthermore, the colonial characteristic is described as having a
raised center (similar to a fried egg). Candida albicans will
typically be cream to light pink in color with the raised center being
CLINICAL DISEASE
Dactylariosis is term used to refer to the fungal encephalitis caused
by the thermophilic mold Ochroconis (Dactylaria) gallopavum
(gallopava) (27). For taxonomic purposes, D. gallopava is the now
obsolete synonym for Ochroconis gallopavum. However, based
upon general usage of D. gallopava by most in the poultry industry,
this synonym will be used herein. Daciy/arza-caused encephalitis
is known to affect turkey poults, young chicks, quail, and wildbirds
(3, 21, 25, 26). The target tissue of affected birds is the brain,
specifically the cerebrum. Infected tissue will be characterized by
multiple granuloma and localized necrosis. Affected birds may
exhibit ataxia, loss of motor control, and torticollis. Although this
disease is relatively rare, a high percentage of birds within an
affected flock may exhibit mortality rates from 5-20%.
Thermophilic fungi, including Dactylaria, have been found in
several materials (24, 29, 36), some of which can be used in the
poultry industry and may be the source of introduction of the
pathogen to susceptible birds. In numerous cases, the utilization of
aged pine and hardwood shavings as litter has been linked to the
introduction of Dactylaria in a flock.
SAMPLE COLLECTION
During necropsy, a sample of the granuloma should be collected for
microbiological culture and histopathology assessment. The
RINGWORM (FAVUS)
CLINICAL DISEASE
Favus is a dermatophytosis that affects the comb, wattles, and
feather follicles of chickens and turkeys. The most common
etiological agent is Microsporum gallinae (previously Trichophyton
gallinae). This disease is highly transmissible by bird-to-bird
contact or contact with a contaminated environment. The disease
presents as white, wrinkled or crusty lesions primarily on the comb
and wattles. Infection of feather shafts and follicles are also
79
Chapter 18 Mycoses and Mycotodcoaes
somewhat more intense in color and with an overall dull luster to
the colony surface.
AGENT IDENTIFICATION
Confirmation of Candida albicans can be accomplished based
upon chlamydospore formation. Cornmeal agar is typically used for
chlamydospore formation. The cornmeal agar is inoculated with the
suspect yeast, incubated at 25 C for 2-3 days and examined
microscopically for the presence of large chlamydospores typically
along the border of pseudomycelium or at the pseudomycelium
terminus (2).
Another confirmation of Candida albicans is based upon germ
tube formation. A 0.5 ml volume of sterile serum is placed in a
sterile test tube and inoculated with actively growing yeast cells
(confirmed by microscopic examination) and incubated at 37 C for
3 hr. Following incubation, remove of a small volume of serum and
examine microscopically. The presence of germ tubes originating
from parent yeast cells is consistent with of C. albicans (2).
Fermentation of specific carbohydrates, carbohydrate assimilation
tests, and nitrogen utilization tests are extremely useful in
identification of yeasts, particularly when identifying less frequently
encountered yeasts, variants, and atypical isolates. These tests are
essential in taxonomic studies, but offer little additional information
in identifying most avian yeast pathogens (16).
technique for tissue collection is the same as previously described
for aspergillosis.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Homogenized portions of affected brain tissue characterized by
granuloma or necrosis are plated and streaked on Sabouraud’s
dextrose agar containing 50 micrograms of chloramphenicol/ml of
medium. Incubation should be done at 37 C for 5 days.
AGENT IDENTIFICATION
Colonies of Dactylaria will appear as typical mold colonies,
grayish brown in color, with the underside of the colony being deep
purple-red or intensely wine-colored. This pigment, typically
produced by Dactylaria will diffuse into the medium and will create
a pigmented border surrounding each mold colony or may pigment
the entire culture plate if numerous colonies are present (10). When
mycelial growth is teased from a colony and placed in a small
volume of mounting fluid, Dactylaria has distinct morphology.
Individual hyphae are septate, the conidiophore is erect and
unbranched, conidia are two-celled, oval to tear-drop in
morphology. Very young conidia may be more round than oval and
may be single celled.
prevalent resulting in marked feather loss. Affected birds will
appear lethargic and may show anorexia and generalized loss of
condition. This disease is uncommon in commercial poultry flocks
are occurs in low frequency in backyard flocks and exotic species.
Strict environmental sanitation, isolation, and culling of affected
birds are recommended.
R. D. Wyatt
SAMPLE COLLECTION
Suspect areas of infection can be removed from the bird by gently
scraping affected areas of epidermal tissue. Scrapings can be
cleared with 10% KOH for direct microscopic examination or
transferred to microbiological medium for growth of the mold,
isolation, and identification.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Microsporum gallinae grow abundantly on Sabouraud’s dextrose
agar supplemented with 50 micrograms of chloramphenicol/ml of
medium. Incubation of Petri dish cultures should be done at 27-30
C for 7-14 days.
AGENT IDENTIFICATION
Colonies of M. gallinae will appear as white to cream colored and
will have a suede-like texture. Pigment formation (pink or peach in
color) can be observed along the periphery of developing and aging
cultures. The underside of Petri dish colors will have a similar color
to that observed on the periphery of the top side of the culture,
MYCOTOXICOSES
INTRODUCTION
Mycotoxins are defined as highly toxic secondary metabolites
produced by certain molds during the growth of these molds on a
suitable substrate. Mycotoxins can either be associated with the
mold mycelium, extruded into the microenvironment surrounding
the mold or both. Several key points are important in understanding
the relationship of mycotoxins to disease in poultry. First, a
relatively small percentage of molds in the environment have the
genetic capacity for mycotoxin production. Secondly, mold growth
must occur before mycotoxins can be produced in an environment.
The most important factor promoting mold growth in nature is the
availability of moisture. Molds do not grow and mycotoxins are not
produced in very dry environments, however, the mold spores can
remain viable for years in environments with almost no water.
Resistance to desiccation is common in molds. Lastly, molds must
have a suitable substrate (with sufficient moisture) in order to grow.
Dead or living organic material is an ideal substrate for mold
growth. Most feed grains, grain products and finished poultry feed
are ideal substrates for mold growth.
Mycotoxins as a broad class of chemicals are produced by a very
diverse population of molds. Additionally, the chemical structures
of mycotoxins differ greatly. Hence, as would be expected, the
biological activity and pathological manifestations of mycotoxin
intoxication will also differ greatly. In fact, some mycotoxins are
extremely toxic to poultry; whereas, others are literally non-toxic to
all classes of poultry.
Ingestion of a mycotoxin at a concentration sufficient to cause an
alteration of structure or disruption of function of poultry will result
in disease. This disease is classified as a toxicity, specifically a
mycotoxicosis. Mycotoxicoses are usually of an acute nature. This
is due to the sporadic occurrence of mycotoxins in feedstuffs and
the management techniques used in the feeding of poultry flocks.
Three genera of molds, Fusarium, Aspergillus, and Penicillium, are
typically associated with most mycotoxin formation in poultry
feedstuffs. For example, various species of Fusarium produce
numerous mycotoxins that share similar chemical structures. This
class of mycotoxins, known as trichothecenes, are responsible for
numerous disease outbreaks in poultry. Aspergillus parasiticus and
A. flavus are the two producers of aflatoxin, perhaps the most toxic
of all mycotoxins to poultry. Penicillium viridicatum and
80
however the color will generally be more intense and diffusion into
the medium can be observed. Direct microscopic and histological
examination of recovered mycelial growth will reveal both micro-
and macroconidia. Microconidia are usually the more abundant and
will have a pear-shaped morphology. Macroconidia are
multicellular (4-6 cells), have a thick wall and are pear to club
shaped. Frequently, the branched hyphae will break into chains of
arthroconidia. The same structures can be visualized in scrapings
with direct microscopic examination after clearing with 10% KOH
or in histological sections stained with GMS or Periodic Acid Schiff
(2,4, 5).
Aspergillus ochraceus are the primary producers of ochratoxin. All
of these mycotoxins are known to adversely affect poultry health
and productivity. On the contrary, Fusarium roseum and other
Fusarium spp. are known to produce zearalenone. This mycotoxin
is highly toxic to swine and cattle, but has literally no impact on
poultry health. Vomitoxin is another mycotoxin produced by
Fusarium and has relatively low toxicity to poultry compared to
many other mycotoxins (38). On the other hand, the prevalence of
vomitoxin as a common contaminant of com, the primary cereal
grain for poultry and other animals, leads to the conclusion that this
mycotoxin may be an insidious toxicant in animal agriculture (33).
Mycotoxicoses are known to interact with various conditions and
circumstances associated with poultry production. For example,
aflatoxin tends to exhibit a more pronounced effect on poultry
health when birds are exposed to a low environmental temperature,
compared to the response of birds exposed to a high environmental
temperature (17). Young chicks are much more susceptible to
aflatoxin than are older birds. A low nutritional plane tends to
accentuate the response of poultry to most mycotoxins (34).
Immunosuppression is caused by several mycotoxins (23,30).
During these mycotoxicoses, secondary viral, bacterial and mold
infections can occur in birds that are experiencing mycotoxicoses.
Consequently, a rapid and accurate diagnosis of mycotoxicosis or
the specific mycotoxicosis is often difficult. Diagnosis is typically
achieved by evaluation of clinical signs, and under certain
circumstances even hematological evaluation (38). Furthermore,
collection of suspect feed or grain followed by chemical analysis of
the sample for specific mycotoxin contamination is most helpful in
achieving a diagnosis.
The following is a brief summary of the major clinical signs of
specific mycotoxicoses in poultry. The specific mycotoxicoses
discussed herein are generally considered to be the most prevalent
in poultry. However, due to the number of mycotoxins known to
contaminate poultry feedstuffs, not all potential mycotoxicoses are
mentioned.
Aflatoxicosis
The major four naturally occurring forms of aflatoxin apt to be
found in feedstuffs are designated as aflatoxin Bb B2, Gb and G2.
Of these, aflatoxin Bj is the most toxic to poultry and is usually
produced in the highest concentration. Aspergillus flavus and

A. parasiticus are recognized as the molds responsible for the
production of aflatoxin in nature. In most feedstuffs, Aspergillus
flavus tends to produce primarily aflatoxin Bj; whereas, A.
parasiticus tends to produce a mixture of both aflatoxin B] and Gb
A mycotoxicosis will occur in poultry when birds are fed a ration
containing a toxic concentration of the mycotoxin for a period of
time sufficient for the mycotoxin to impact the function or structure
of susceptible tissues. When poultry are fed a ration containing
aflatoxins affected birds will appear listless, have rough feathers,
display marked depigmentation of the skin and shanks and may die
from acute toxicosis or from the toxicosis complicated with an
infection of viral, bacterial or fungal etiology due to
immunosuppression associated with aflatoxicosis (6). The basic
mechanism of action of aflatoxin at the cellular level is to bind
covalently with DNA with a subsequent inhibition of protein
synthesis or disruption of normal regulatory processes. Failure of
affected birds to produce digestive enzymes is noted during
aflatoxicosis (19). This results in incomplete digestion of feed,
passage of undigested feed in the feces, and poor growth and
performance. Birds being processed for meat may show reddening
of the wing tips, reddening of the skin covering the thigh, legs, and
breast, and petechial hemorrhages of the leg, thigh and breast
muscle. This response is attributable to capillary fragility resulting
from induction of lysosomal enzymes by aflatoxin (32). The gall
bladder will typically be enlarged and elongated and filled with bile
with a pale green color (28).
The liver is the organ that will respond first and to the greatest
degree. Upon necropsy, the liver can be described as enlarged,
edematous, fatty, and will tend to have a yellowish discoloration
due to the accumulation of lipoidal components (28). Occasionally,
the liver will show focal hemorrhages with necrotic foci. The spleen
will typically be enlarged and may exhibit a mottled appearance.
Mild kidney enlargement and thymus gland atrophy are also
typically observed during aflatoxicosis. Histological examination of
liver tissue will reveal severe fatty infiltration, edema, bile ductule
hyperplasia, necrosis, hemorrhage, necrosis, and fibrosis (20).
Susceptibility of poultry to aflatoxicosis is dependent upon the
presence of interacting factors, age of the birds, and species. For
example, breed, strain, and gender of poultry will influence their
susceptibility of aflatoxin poisoning (41). Additionally, the
environmental temperature and the nutritional status of birds are
also known to influence the susceptibility of poultry to
aflatoxicosis. Young broilers are more susceptible to aflatoxin than
older broilers. In broiler breeder hens exposed to aflatoxin, the hen
does not respond to aflatoxin in a significant manner, however the
transfer of minute concentrations of aflatoxin residues to hatching
eggs will result in high embryonic mortality (31). Ducklings,
turkeys, and chickens respond in similar fashion to aflatoxicosis,
however, ducklings are the most susceptible, followed by turkey
poults, and finally chickens (1).
Caution should be exercised when attempting to relate dietary
concentrations of aflatoxin and other mycotoxins to various
physiological and pathological responses. Laboratory
experimentation is designed to establish a cause-and-effect
relationship between dietary aflatoxin and specific responses in
poultry. In general terms, the dietary concentration required to elicit
a specific response in laboratory studies is much higher than the
dietary concentration required elicit the same response under
conditions of commercial poultry production. The underlying
rationale for this is the presence of various interacting factors and
circumstances in the “field situation” that are usually absent in the
“laboratory environment” (11).
Trichothecene Toxicosis
The trichothecene mycotoxins are a group similar chemical
compounds, also referred to as the 12, 13, epoxytrichothecenes. The
trichothecenes are produced in nature by primarily members of the
81
Chapter 18 Mycoses and Mycotoxi coses
genus Fusarium. Although their chemical structures are similar,
their biological activities are slightly different. In general terms,
their mechanisms of action involve an impact on dermal tissue and
systemic effects that target lymphatic tissue (33).
Much of the research with trichothecenes has been conducted with
T-2 toxin, one of the 12, 13, epoxytrichothecenes. This was done
based upon the ease of bioproduction of T-2 toxin in the laboratory
for use in experimentation. It is now recognized that T-2 toxin may
not be the primary trichothecene produced in nature or the most
common trichothecene contaminant of poultry feeds.
Diacetoxyscirpenol (DAS) and deoxynivalenol (DON) are most
likely more probable as poultry feed contaminants. The primary
clinical manifestation of trichothecene toxicosis is oral necrosis
presumably resulting by direct contact of contaminated feed with
the mucous membranes of the oral cavity and esophagus (42). This
oral necrosis will clinically manifest itself as small white to cream­
colored necrotic areas on the inside of the upper and lower
mandible and the borders of the tongue. With some trichothecenes,
these necrotic areas may involve the esophagus as well. Associated
with oral necrosis is a marked decrease in feed intake. Decreased
feed intake leads to poor growth in broilers and extremely poor
feathering. In commercial layers, decreased feed intake and thin egg
shells is commonly observed (38). Necrosis of dermal tissue has
been observed in broiler grown on litter contaminated with
trichothecenes and manifests as dermatitis of skin and shanks.
Inhibition of protein synthesis at the ribosomal level has been
associated with trichothecene toxicosis resulting in
immunosuppression (33). Among the.systemic effects of T-2 toxin
in broiler chickens is an impact on neurological tissue. Hysteroid
seizures, impaired righting reflex, and an abnormal wing posture
following handling of affected birds is observed in birds
experiencing moderate to severe T-2 toxicosis (38).
Upon necropsy, oral lesions ranging from a few small areas of
necrosis to numerous areas of larger areas of necrosis will be
observed. The higher number of lesions of increased severity in the
oral cavity is usually associated with higher dietary concentrations
of the trichothecene or exposure to contaminated feed for an
extended period of time.
Ochratoxicosis
Ochratoxin is a term typically used to refer to either ochratoxin A
or B, or a mixture of the two. Ochratoxin A is the more toxic to
poultry. Aspergillus ochraceus and Penicillium viridicatum are
considered as the primary producers of ochratoxin in nature. The
target organs for ochratoxin are primarily the kidney and to a lesser
extent the Ever. The primary clinical manifestations of ochratoxin
are extreme morbidity, increased mortality, poor growth rate,
impaired feed efficiency, pasty vents, and diarrhea (8, 15).
At necropsy, severely enlarged and pale kidneys are the most
notable signs with the liver being of normal size but tan-colored.
The kidney tubules will be filled with urates but visceral or articular
gout is usually not present. Histological examination of renal tissue
typically shows enlarged and necrotic proximal tubular epithelium
(8). Histological examination of the liver will reveal liver
congestion, focal necrosis, and an unusually high glycogen content
(14). High glycogen concentrations in liver is a specific response
and is of diagnostic value for ochratoxicosis.
Analysis for Mycotoxins
Tissue analysis for mycotoxins is most always futile. The
underlying reason for this is due to the fact that mycotoxin
concentrations at the time the tissue sample is obtained will be
extremely low or non-existent. Once most mycotoxins are
consumed, the mycotoxin or its metabolites and adducts are rapidly
excreted from the bird and no residues will persist.
The most promising approach to identify a mycotoxin responsible
for the disease outbreak is a chemical analysis of the feed being
R D. Wyatt
consumed by affected birds. This, however, is not without
difficulties. In many situations, the feed responsible for the disease
outbreak may have been consumed and a new feed delivered made
to the affected flock. Analysis of the feed in this situation will most
likely reveal no detectable mycotoxin contamination. Since
mycotoxin formation does not occur uniformly within a container of
feed or grain, sampling is a major problem in attempting to obtain a
sample indicative of the true field situation. On the other hand, if a
feed sample can be obtained (from the farm or as a “retained”
sample) that was fed to the birds, it is important to stabilize the feed
to prevent additional mycotoxin production and to halt all microbial
activity so the contaminating mycotoxin will not be degraded. The
goal of any sample is that it accurately reflects the whole from
whence it was obtained. Feed samples should be stored in a paper
container, frozen, and then analyzed as soon as possible.
The decision of which mycotoxin to analyze for in a feed sample
should be based upon the production traits, clinical signs, and
histological examination of birds from the affected flock. Since
several mycotoxins could be involved in an outbreak of a toxicosis,
and since the analysis for each mycotoxin will have inherent
specifics, it is imperative that all information surrounding the
affected flock be furnished to the laboratory in order to narrow the
list of mycotoxin possibilities.
The specific method of analysis could involve chemical
absorbency, thin layer chromatography (TLC), high pressure liquid
chromatography (HPLC), or gas chromatography-mass spectral
(GC-MS) methodology. Specific techniques and methods are will
recognized that will permit an analysis for numerous mycotoxins.
However, these methodologies are time-consuming, costly, and
often require specialized equipment and training of laboratory
personnel. These techniques are most appropriate for research
laboratories rather than diagnostic facilities.
Exploitation of enzyme-linked immunosorbent assay (ELISA)
technology has resulted in the development of testing procedures
for mycotoxins in a variety of commodities. These tests can yield
mycotoxin concentrations with ppb accuracy or can be modified to
give a less expensive qualitative result. These tests have proven to
be not only highly accurate and specific but also free from most
interfering influences. Among the sources for various testing
supplies are Charm Sciences, Inc. Lawrence, MA; EnviroLogix,
Inc. Portland, ME; Neogen, Corp., Lansing, MI; Romer Labs, Inc.
Union, MO; Strategic Diagnostics Inc. Newark, DE; VICAM,
Watertown, MA; and R-Biopharm Rhone, Ltd. Glasgow, Scotland.
REFERENCES
1. Asplin, F. D. and R B. A. Camaghan. The toxicity of certain groundnut
meals for poultry with special reference to their effect on ducklings and
chickens. Vet. Rec. 73:1215-1219. 1961.
2. Benke, E. S. and A. L. Rogers. Medical mycology manual with human
mycoses monograph, 4th ed Burgess Publishing Company, Minneapolis,
MN. 1980.
3. Blalock, H. G., L. K. Georg, and W. T. Derieux. Encephalitis in turkey
poults due to Dactylaria (Diplohinotrichum) gallopava-a. case report and its
experimental reproduction. Avian Dis. 17:197-204. 1973.
4. Chandler, F. W., W. Kaplan, and L. Ajello. Color Atlas and Text of the
Histopathology of Mycotic Diseases. Year Book Medical Publishers,
Chicago, 1980.
5. Chandler, F. W. and J. C. Watts. Histologic and immunohistologic
diagnosis of mycotic diseases. International Academy of Pathology, Short
Course No. 12, Atlanta, GA. 1983.
6. Chang, C. F. and P. B. Hamilton. Impaired phagocytosis by heterophils
from chickens during aflatoxicosis. Toxicol. Appl. Pharmacol. 48:459-462.
1979.
7. Converse, K. A. Aspergillosis. In: Infectious Diseases of Wildbirds. N. J.
Thomas, R. Hunter, and C. T. Atkinson, eds. Blackwell Publishing, Oxford,
UK. pp. 360-374. 2007.
8. Dwiedi, P and R. B. Bums. The natural occurrence of ochratoxin A and
its effect in poultry. A review. Part 1. Epidemiology and toxicity. World’s
Poultry Science Journal. 42:32-47. 1986.
82
9. Dixon, D. M and A. Polak-Wyss. The medically important dematiaceous
fungi and their identification. Mycoses. 34:1-18. 1991.
10. Georg, L. K., B. W. Biere, and W. B. Cooke. Encephalitis in turkey
poults due to a new fungus species. Sabouraudia 3:239-244. 1964.
11. Hamilton, P. B. Determining safe levels of mycotoxins. J. Food Protect.
47:570-575. 1984.
12. Hubbard, G. B., R. E. Schmidt, D. L. Eisenbrandt, W. M. Witt, and K.
C. Fletcher. Fungal infection of ventriculi in captive birds. J. Wildlife Dis.
21:25-28. 1985.
13. Huff, W.E. and J.A. Doerr. Synergism between aflatoxin and ochratoxin
in broiler chickens. Poultry Sci. 60:550-555. 1981.
14. Huff, W. E., J. A. Doerr, and P. B. Hamilton. Decreased glycogen
mobilization during ochratoxicosis in broiler chickens. Appl. Microbiol.
37:122-124. 1979.
15. Huff, W. E., R. D. Wyatt, T. L. Tucker, and P. B. Hamilton.
Ochratoxicosis in the broiler chicken. Poult. Sci. 53:1585-1590. 1974.
16. Lodder, J. The Yeasts, 2nd ed. North-Holland Publishing Co.
Amsterdam, The Netherlands. 1970.
17. Manning, R. O. and R. D. Wyatt. Effect of cold acclimation on the
broiler chick’s resistance to acute aflatoxicosis. Poultry Sci. 69:388-396.
1990.
18. Okoye, J. O. A., C. N. Okeke, and F. K. O. Ezeobele. Effect of
infectious bursal disease virus infection on the severity of Aspergillus flavus
aspergillosis of chickens. Avian Pathol. 20: 167-171. 1991.
19. Osborne, D. J. and P. B. Hamilton. Decreased pancreatic digestive
enzymes during aflatoxicosis. Poultry Sci. 60:1818-1820. 1981.
20. Quist, C. F., T. Cornish, and R. D. Wyatt. Mycotoxicosis. In: Infectious
Diseases of Wildbirds. N. J. Thomas, R. Hunter, and C. T. Atkinson, eds.
Blackwell Publishing, Oxford, UK. pp. 417-430. 2007.
21. Ranck. F.M, L.K. Georg, and D. H. Wallace. Dactylariosis, a newly
recognized fungus disease of chickens. Avian Qis. 18:4-20. 1974.
22. Redig, P. T. Aspergillosis in avians, an update. In: Proceedings of the
19th annual conference on avian medicine and surgery. Mid-Atlantic States
Association of Avian Veterinarians. Lancaster, PA. pp 172-177. 1998.
23. Richard, J. L., S. J. Cysewski, A. C. Pier, and G. D. Booth. Comparison
of effects of dietary T-2 toxin on growth, immunogenic organs, antibody
formation and pathologic changes in turkeys and chickens. Am. J. Vet. Res.
39:1674-1679. 1978.
24. Rippon, J. W., R. Gerhold, and M Heath. Thermophilic and
thermotolerant fungi isolated from the thermal effluent of nuclear power
generating reactors: dispersal of human opportunistic and veterinary
pathogenic fungi. Mycopathologia 70:169-179. 1980.
25. Salkin, I. F., D. M Dixon, Μ E. Kemna, P. J. Danneman, and J. W.
Grifith. Fatal encephalitis caused by Dactylaria constricta var. gallopava in
a snowy owl chick (Nyctea scandiaca). 28:2845-2847. 1990.
26. Shane, S. M, J. Markovits, T. G. Snider ΠΙ, and K. S. Harrington.
Encephalitis attributed to dactylariosis in Japanese quail chicks (Coturnix
coturnix japonica). Avian Dis. 29:822-828. 1985.
27. Singh, K., J. Hood, R D. Welsh, J. H. Wyckoff ΠΙ, T. A Snider and D.
A. Sutton. Fatal systemic Phaeohyphomycosis caused by Ochroconis
gallopavum in a dog (Canis familaris}. Vet. Pathol. 43:988-992. 2006.
28. Smith, J. W. and P. B. Hamilton Aflatoxicosis in the broiler chicken.
Poultry Sci. 49:207-215. 1970.
29. Tansey, M R. and T. D. Brock. Dactylaria gallopava, a cause of avian
encephalitis, in hot spring effluents, thermal soils and self-heated coal waste
piles. Nature 242:202-203. 1979.
30. Thaxton, J. P., Η. T. Tung, and P. B. Hamilton. Immunosuppression in
chickens by aflatoxin. Poultry Sci. 53:721-723. 1974.
31. Trucksess, N. W., L. Stoloff, K. Young, R D. Wyatt, and B.L. Miller.
Aflatoxicol and aflatoxins B] and Mi in eggs and tissues of laying hens
consuming aflatoxin-contaminated feed. Poult. Sci. 62:2176-2180. 1983.
32. Tung, Η. T., J. W. Smith, and P. B. Hamilton Aflatoxin and bruising in
the chicken. Poult. Sci. 50:795-798. 1971.
33. Ueno, Y. Trichothecene mycotoxins: mycology, chemistry and
toxicology. Advances in Nutrition Research 3:301-305. 1980.
34. Veltmann, J. R, R. D. Wyatt and Μ N. Voigt. The effect of varying the
total sulfur amino acid content in the diets of chicks with aflatoxicosis.
Poultry Sci. 60:1748.
35. Voigt, Μ N., R. D. Wyatt, J. C. Ayres, and P. E. Koehler. Abnormal
concentrations of B vitamins and amino acids in plasma, bile and liver of
chicks with aflatoxicosis. Appl. Environ. Microbiol. 40:870-874. 1980.
36. Waldrip, D. W., A A. Padhye, L. Ajello and M Ajello. Isolation of
Dactylaria gallopava from broiler-house litter. Avian Dis. 18:445-451.
1974.

37. Wyatt, R.D. Mycotoxin Interactions. In: The Mycotoxin Blue Book. D.
Diaz, ed. Nottingham University Press. Nottingham, UK. pp 269-278. 2005.
38. Wyatt, R.D. Poultry. In: Mycotoxins and Animal Foods. J. E. Smith and
R. S. Henderson, eds. CRC Press, Boca Raton, FL. pp. 553-605.
39. Wyatt, R. D., J. A. Doerr, P. B Hamilton, and H. R. Burmeister. Egg
production, shell thickness and other physiological parameters of laying
hens affected by T-2 toxin. Appl. Microbiol. 29:641-645. 1975.
83
Chapter 18 Mycoses and Mycotoxicoses
40. Wyatt, R. D., and P. B. Hamilton. Candida species and crop mycosis in
broiler chickens. Poult. Sci. 54:1663-1666. 1975.
41. Wyatt, R. D., H. L. Marks, and R. O. Manning. Selection for resistance
to aflatoxin in chickens. Poultry Sci. 66:1901-1904. 1987.
42. Wyatt, R. D., B. A. Weeks, P. B. Hamilton, and H. R. Burmeister.
Severe oral lesions in chickens caused by ingestion of dietary fusariotoxin
T-2. Appl. Microbiol. 24:251-254. 1972.
 19
ADENOVIRUSES
Brian M. Adair and J. Brian McFerran

SUMMARY. Avian adenoviruses are divided into three groups, which correspond to general to the Adenovirus family. Group 1, or
conventional adenoviruses (Genus Aviadenovirus), all share a common group antigen, distinct from the mammalian group antigen. The
group 1 viruses are subdivided into 5 species (A to E) on the basis of molecular criteria and at least 12 serotypes. The group 2 adenoviruses
(Genus Siadenovirus) are dealt with in Chapter 20. The third group (Genus Atadenovirus) is represented by a duck virus that partially shares
an antigen with the group 1 viruses and causes egg drop syndrome (EDS) in chickens.
Group 1 adenoviruses are spread both vertically and horizontally, mainly by the fecal-oral route, and are ubiquitous in avian species. The
group 2 (EDS) virus replicates in the uterus of hens and is transmitted either in or on the egg and also in droppings contaminated by
secretions from the oviduct. Chickens can also be infected by direct or indirect contact with contaminated feces from waterfowl.
Because so many healthy birds are infected with group 1 adenoviruses, it is difficult to determine their adenoviruses as pathogens, however
strong evidence exists that some strains can cause inclusion body hepatitis (IBH) and pancreatitis in birds. Others are associated with
hydropericardium syndrome (HPS) or Angarra disease. Infection of laying hens with the group 3 (EDS) virus results in a severe decrease in
egg production, mainly through the production of soft-shelled and shell-less eggs.
Agent identification. Virus isolation is the first stage in adenovirus characterization and subtyping and is best carried out in epithelial cell
cultures such as embryo liver cells. Detection of virus in cell cultures or tissues from diseased birds is normally carried out using
immunostaining (immunofluorescence or immunoperoxidase) techniques, or by molecular methods. Because of the well defined and easily
recognized structure of the adenovirus particle, negative stain and thin section electron microscopy is useful and widely used to confirm
presence of the virus. Subtyping is achieved by molecular methods or by cross neutralization tests with prototype strains.
Serologic Detection in the Host. Serologic tests are of little value except to monitor specific-pathogen-free flocks, where a sensitive test
such as the enzyme-linked immunosorbent assay should be used. The hemagglutination inhibition test is recommended for EDS virus
serology. Latently infected chicks only develop antibody to EDS virus after they produce affected eggs.

INTRODUCTION chickens have generally resulted in mild respiratory signs or none at

Avian adenoviruses can be divided into three subgroups, which are
now separated into 3 distinct Genera of the Adenovirus Family (6).
The first group (Genus Aviadenovirus) includes the conventional
avian adenoviruses, which are often referred to in the literature as
group 1 adenoviruses. The second group (Genus Siadenovirus),
consists of the viruses of hemorrhagic enteritis of turkeys and
marble spleen disease of pheasants, along with the virus causing
avian adenovirus splenomegaly (AAS) of chickens. This group is
often referred to in the literature as group 2 avian adenoviruses,
and they are dealt with in Chapter 20. The third group (Genus
Atadenovirus), contains the viruses isolated from ducks and
chickens, which cause Egg Drop Syndrome (EDS), and are referred
to as group 3 avian adenoviruses. The EDS adenovirus has not been
identified in chickens in the United States, and if evidence of
infection is detected, animal health officials must be notified.
CLINICAL DISEASE
Group 1 Adenoviruses
The group 1 adenoviruses are widely distributed in avian species
as indicated by serological surveys and virological studies, and have
been isolated from both sick and healthy birds. In addition to
chickens and turkeys, they have been isolated from geese, ducks,
pigeons, and budgerigars, and there is reported evidence of
infection in other species, including gulls, owls, and hawks (13).
They have been isolated from birds with signs of respiratory
disease, depressed egg production, arthritis/ tenosynovitis, uneven
growth, and enteritis, but, in most cases, causal relationships have
been difficult to demonstrate. Infection of healthy birds is common,
and most adults have been infected by many serotypes. They have
also been isolated from commercial poultry flocks even when
exceptionally high levels of production and fertility are in evidence.
Apart from quail bronchitis virus (QBV), caused by an FAdV-1
strain (Table 19-1), the association with respiratory disease has not
been proven, although adenoviruses have frequently been isolated
from the respiratory tract, often in association with severe
respiratory disease. Despite this association, attempts to reproduce
respiratory disease by experimental inoculation of isolates into
84
all.
Several serotypes of group 1 adenoviruses have been directly
associated with inclusion body hepatitis (IBH) in chickens, turkeys,
parrots, kestrels, merlins, and pigeons. In chickens, the disease is
usually seen in meat producing birds, between 3 and 7 wk of age
but has also been recorded in birds as young as 7 days and as old as
20 wk. The disease has a sudden onset of mortality, peaking after 3-
4 days but may continue for 2-3 wk. Mortality normally ranges
from 5-10%, but can reach 30%; pale swollen livers with
hemorrhages are observed and there are also numerous eosinophilic
inclusion bodies present in hepatocytes. Electron microscopy shows
the presence of large numbers of adenovirus particles in the
inclusion bodies. Many different serotypes of adenovirus have been
associated with IBH. Several outbreaks of disease in Australia, with
mortality up to 30%, were associated with 3 serotypes all belonging
to FAdV species E (Table 19-1), although FAdV8 was the most
common isolate (9).
FAdV4 viruses have been implicated in outbreaks of
hydropericardium syndrome (HPS), also known as Angarra disease,
which has caused severe economic losses to the poultry industry in
Pakistan. HPS has also been recorded in India, Kuwait, Iraq, Japan,
and parts of Eastern Europe, as well as South and Central America.
The disease is characterized by accumulation of fluid in the
pericardium with lesions in heart, kidneys and lungs, and presence
of basophilic intra-nuclear inclusion bodies in hepatocytes, along
with multiple areas of focal necrosis and mononuclear cell
infiltration (14,16).
Group 3 (EDS) viruses
The viruses associated with EDS are widespread in waterfowl and
in domestic ducks and geese. Three forms of EDS have been
recognized. The first, or classical, form infects breeding stock and is
vertically transmitted. The virus remains latent until birds come into
lay, when it becomes activated, causing classical EDS. The second,
or endemic, form arises from the classic form. Virus spreads into
commercial egg layers and is often spread by eggs through common
packing stations. The third form is the sporadic form, which infects
flocks via drinking water contaminated by wild or domestic
waterfowl. This form can give rise to the classical form (if great
grandparents or grandparents were infected) or to the endemic form.

SAMPLE COLLECTION
Group 1 Adenoviruses
The main sites of replication of group 1 adenoviruses are the
digestive tract and the upper respiratory system. Samples for virus
isolation should therefore include feces or large intestine with feces,
and also an aliquot from the affected organ(s), e.g. liver in cases of
IBH. Virus is also often present in the pharynx and kidney. Ten per
cent suspensions of tissue or feces in cell culture medium,
homogenized or shaken with glass beads, then frozen and thawed,
provides a convenient method for preparing inocula. Details are
given in Chapter 43 (Cell culture Methods). Following
centrifugation, the supemates may be stored at -80 C until required
for inoculation of cell cultures.
Group 3 (EDS) viruses
The main site of EDS virus replication is the pouch shell gland
area of the uterus, although selection of an infected bird can be
difficult because of the lack of clinical signs and the short duration
that virus is present. Consequently, the usual method of detecting an
infected flock is by serology. Isolation of the virus can be facilitated
by collecting thin shelled and soft shelled eggs from affected birds,
homogenizing and using this as oral inoculum by feeding to normal
laying hens, which have no EDS virus antibodies. At the first signs
of abnormal eggs being produced by the hens (i.e. loss of shell
color, thin shells, or no shells), the hens are sacrificed and the pouch
shell gland removed for either immunohistochemical staining or
virus isolation. A 10% suspension of the shell gland is prepared as
above. If the birds are kept in cages, spread can be slow. Birds or
eggs for virus isolation should be selected from cages where
affected eggs are being laid and from adjoining cages where normal
eggs are present. Blood samples for serology should be taken from
the first birds to show signs of EDS i.e laying abnormal eggs.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Isolation of adenovirus in cell culture is an essential prerequisite
for full characterization and typing, and for further studies on
disease association. In general, cell systems from the homologous
species should be used. Therefore, although fowl adenoviruses have
been isolated from turkeys using chicken cells, isolation of turkey
adenovirus strains seem to require turkey cell cultures. Embryonic
fiver or kidney cells, and kidney cells from 1-4 wk old birds are the
cultures of choice. If chick embryo cells are used, they should have
a predominance of epithelial cells for optimal sensitivity. Chick
embryo fibroblasts or tracheal organ cultures are less sensitive for
aviadenovirus primary isolation.
Because of the problem of latency, the cell cultures must be
prepared from embryos or chicks derived from a flock known to be
free of adenovirus. Uninoculated control cultures should be
included, and these should be incubated for approximately 7 days,
disrupted by freezing and thawing, or by sonication, and the
supernatants passed onto fresh cell cultures. Two passes in this
manner should be sufficient to exclude the possibility of latent
adenovirus being present in the uninoculated cells.
The group 3 (EDS) viruses are best isolated in duck cell cultures,
although chick embryonic liver cells or, to a lesser degree, chicken
kidney cells, can be used instead. Isolation in chick cultures may
require up to five passages before CPE becomes apparent.
Supernatants of all cultures should be checked for
hemagglutination, using chick erythrocytes. Although the virus can
be difficult to isolate, cross-contamination with EDS viruses occurs
readily. Therefore, controls must be passaged in parallel with the
specimens.
Embryonated eggs are not normally a sensitive medium for
primary isolation of group 1 adenoviruses, although all the
prototype fowl adenoviruses have been propagated in eggs by yolk
85
Chapter 19 Adenovirus
sac inoculation (13). However, the FAdV-1 and FAdV-5 viruses,
and in particular the FadV-4 strains, associated with HPS (Angara
Disease), appear to grow well in embryonated eggs. FadV-4 strains
from HPS cases have been isolated in eggs and cause high levels of
embryo mortality with severe lesions (14).
The group 3 (EDS) viruses produce high titers of hemagglutinin
when inoculated into the allantoic cavity of embryonated duck or
geese eggs, but do not produce hemagglutinin or cause embryo
death in embryonated chicken eggs.
AGENT IDENTIFICATION
On recognition of cytopathic effect, several alternatives are
available to confirm presence of adenovirus.
Antigen detection
Confirmation of adenovirus presence in cell culture can be made by
fluorescent antibody staining of infected cells using adenovirus­
specific antisera (1,3). This is best done on cell cultures grown for
this purpose on sterile glass coverslips (e.g. 13 mm diameter) in
Petri dishes, or in 24-well cell culture plates or rectangular
coverslips in tubes. Chick embryo liver cells or chick kidney cells
are allowed to monolayer on the coverslips, and the supemate is
removed and replaced with the specimen containing virus.
Coverslips are removed with sterile forceps at 24 and 48 hr post
Table 19.1 Classification of Group 1 avian adenoviruses
*
Group 1 avian adenoviruses (Genus Aviadenovirus)
Group 1 Recognized serotypes within each species and examples
aviadenovirus species of prototype strains
Fowl adenovirus A Fowl adenovirus 1 (FAdV-1) (CELO, 112, QBV, Ote,
Hl)
Fowl adenovirus B Fowl adenovirus 5 (FAdV-5) (340,TR-22, Tipton, M2)
Fowl adenovirus C Fowl adenovirus 4 (FAdV-4) (506, J2, KR5, H2, K31,
61)
Fowl adenovirus 10 (FAdV-10) (C-2B, Mil, CFA20,
SA2)
Fowl adenovirus D Fowl adenovirus 2 (FAdV-2) (GAL-1, 685, SR-48, H3,
P7)
Fowl adenovirus 3 (FAdV-3) (SR-49, 75, H5)
Fowl adenovirus 9 (FAdV-9) (A2, 90, CFA19)
Fowl adenovirus 11 (FAdV-11) (380, UF71)
Fowl adenovirus E Fowl adenovirus 6 (FAdV-6) (CR119,168)
Fowl adenovirus 7 (FAdV-7) (YR36, X-l 1,122)
Fowl adenovirus 8a (FAdV-8a) (58, TR-59, T-8,
CFA40)
Fowl adenovirus 8b (FAdV-8b) (764, B3, VRI-33)
*Based on Benko et al, (6)
inoculation, fixed by immersion in acetone (5 min), air dried, then
stained by addition of adenovirus antiserum using either direct or
Brian M. Adair and J. Brian McFerran
indirect immunofluorescence techniques. In direct
immunofluorescence, infected coverslip cultures are covered by the
conjugated antiserum (conjugated normally with fluorescein
isothiocyanate, FITC) known to contain adenovirus group-specific
antibodies at a pre-determined dilution. After incubation at 37 C for
30 min, the coverslips are washed in several changes of PBS,
blotted dry, mounted in buffered glycerol, and examined for
presence of fluorescent intranuclear inclusions using a fluorescent
microscope (1,3). In indirect immunofluorescence, the first serum
used for staining is unconjugated and this first phase is followed by
secondary staining using an anti-species FITC conjugate (e.g. anti­
chicken FITC). Following incubation and washing, the coverslips
are mounted and viewed as above (3,4).
An antigen detecting ELISA has also been used for demonstration
of adenovirus antigen in tissues from diseased birds (18). In this
test, a rabbit antiserum against an FAdV8 strain of group I
adenovirus was used to capture virus present in tissues or in cell
cultures. Ninety six-well ELISA plates are coated with the capture
antibody, washed, and the test samples (10% tissue suspension, see
above) are added. After incubation for 90 min at 37 C and washing,
a chicken antiserum to group 1 adenovirus is added and following
incubation and washing, an anti-chicken serum conjugated with
horseradish peroxidase is added. The test was shown to be capable
of detecting less than 100 TCID50 of virus per gram of tissue and
was capable of detecting any of the 12 recognized adenovirus
serotypes (i.e. it was group specific).
Gel diffusion is relatively insensitive but may be useful to confirm
that an isolate made in cell culture is an adenovirus, if no other
methods are available. Once an isolate has been made in cell
culture, a large batch of antigen must be prepared e.g. 12 x 75 cm2
flasks of chick embryo liver or kidney. Following development of
>80% CPE, the cells are disrupted by freezing and thawing, the cell
debris removed by centrifugation, and the supemates, containing
virus antigens, concentrated by precipitation with ammonium
sulphate overnight or by extraction with arcton. A control
adenovirus antiserum and antigen is required and common lines of
precipitation in agar, between the control and test antigen confirms
presence of adenovirus.
Growth of group 3 (EDS) virus in cell culture is accompanied by
production of a hemagglutinin which agglutinates avian
erythrocytes but not mammalian erythrocytes. Therefore, while
fluorescence or other antigen detecting techniques can be applied to
detection of EDS virus, hemagglutination presents an easier
alternative. This is carried out by removing some supernatant from
the EDS virus-infected culture, following development of CPE, and
addition of an equal volume of chicken or duck erythrocytes (0.8%
suspension in PBS). Presence of EDS hemagglutinin results in
hemagglutination of the erythrocytes. Hemagglutination-inhibition
(HI) (see below) using EDS virus-specific antiserum confirms the
isolate as EDS virus. If immunofluorescence is to be used for
detection of EDS virus antigen in infected cultures or tissues,
antisera with specificity for group I adenoviruses cannot be used,
because of lack of cross reactivity. Specific EDS antisera are
required for this purpose. EDS specific antisera have been used for
direct immunostaining of tissue sections to detect EDS antigens.
Using the avidin-biotin-peroxidase technique, EDS antigen was
detected in tissue sections of infundibulum for 3-5 days post
infection and in large amounts in the pouch shell gland from about 8
days post inoculation, until as long as affected eggs were produced
(19).
86
Nucleic acid detection
Presence of adenovirus in tissues or lesions from diseased birds is
often first suspected by demonstration of intranuclear inclusion
bodies in histopathology studies, although adenoviruses are not the
only agents which give rise to intranuclear inclusions following
infection. Other viruses e.g. herpesviruses, circoviruses or polyoma
viruses may give rise to similar inclusions.
In situ hybridization (ISH) has been used for detection of
adenovirus DNA in tissues in these circumstances and can be useful
in species other than turkeys or chickens where cell cultures are not
available for virus isolation, or where formalin-fixed tissues are the
only specimen submitted to the laboratory for diagnosis.
Adenovirus ISH probes (36-40 bases) based on a highly conserved
region of the penton of FAdVIO have been described and used in
ISH (12). This region was chosen since it is highly conserved and
therefore provides maximum cross reactivity between adenovirus
species. The procedure requires the sections to be de-paraffinized
by treatment with xylene, rehydrated by passage through graded
alcohols, digested with pepsin, before hybridization to the
digoxigen labeled probe. An anti-digoxygenin antibody conjugated
to alkaline phosphatase was then applied, and the chromogen,
nitroblue tetrazolium (NBT) added. Foci of dye reduction to blue­
black formazan pigment indicated presence of adenovirus nucleic
acid, which duplicated the pattern of intranuclear inclusions seen in
parallel H&E stained sections. ISH was successfully used to
demonstrate hepatic, renal and intestinal adenovirus infection in
parrots and to exclude herpesvirus and circovirus from the
diagnosis. The same probes were used ‘in an investigation of
inclusion body hepatitis and pancreatitis in broiler chickens, and
positive adenovirus ISH results were confirmed by thin section
electron microscopy and virus isolation (10).
Morphology
On development of CPE, negative stain electron microscopy is
used to confirm presence of adenovirus. Simple techniques for
diagnostic use of the electron microscope are described in Chapter
34 on enteric viruses. Examination of negatively stained material by
electron microscopy is fast and also allows both positive
identification of the virus and recognition of other unsuspected
viruses or bacteria. Adenoviruses are normally easily recognized by
their morphology. They are seen as isosahedral particles (i.e.
particles with 12 vertices and 20 triangular faces) measuring 65-75
nm in diameter. Degenerating particles, however, can develop a
circular appearance. Adeno-associated parvoviruses are frequently
seen, along with the adenoviruses. These are spherical particles
measuring approximately 22 + 3 nm in diameter. If desired,
sensitivity can be improved by use of immunoelectron microscopy,
in which adenovirus antiserum or convalescent serum is mixed with
the specimen at an appropriate dilution to facilitate clumping of
particles, making viewing easier.
Thin-section electron microscopy has also proved useful for
demonstration of adenoviruses in cell cultures or to confirm
presence of adenovirus in tissues or organs from birds in which
intranuclear inclusions are seen with high frequency in
histopathology studies. Cell cultures showing CPE are scraped from
the plastic surface, fixed for 2 hr at 4 C in glutaraldehyde, post fixed
in osmium tetroxide for 2 hr at room temperature, then dehydrated
in alcohol and embedded in Araldite. Ultrathin sections of infected
cells stained with uranyl acetate and lead citrate show large
numbers of characteristic particles, 65-75 nm in diameter, often in
crystalline arrays, along with associated inclusion material in the
nucleus (5). Small pieces of tissue shown by histopathology to
contain large numbers of inclusions can also be treated in this way,
and often show similar large concentrations of virus particles. This
can be useful in investigations in species other than chicken and
turkey where virus isolation in cell culture is more difficult, or not

an option, but is not indicative of a causal relationship to the
condition.
Subtyping of Isolates
The hexon protein of the group 1 avian adenoviruses contains a
highly conserved region which gives rise to antibodies which are
‘group specific’ i.e. the antibodies produced following infection
with one group 1 adenovirus also react with other group 1 viruses in
tests such as gel diffusion and immunofluorescence. Other
antibodies are produced following infection, which react only with
the infecting virus and closely related viruses. These type specific
antibodies neutralize virus infectivity and are used to separate group
1 viruses into serotypes, using the serum neutralization test (see
below).
In most cases, establishment an isolate as an adenovirus may be
sufficient for diagnosis. Further characterization, to establish
relatedness to standard strains, requires more detailed laboratory
testing. The group 1 adenoviruses are subdivided into 5 species (A
to E; Table 19.1), based largely on molecular criteria, in particular
restriction endonuclease analysis (REA) and sequencing data.
Viruses within each species are further subdivided into serotypes
largely on the result of cross-neutralization tests, although this can
also be done by PCR. REA of fowl adenovirus serotypes into 5
distinct groups was first described by Zsak and Kisary, (21) and has
proved effective in clarifying relationships between serotypes and in
some cases between strains showing differences in virulence e.g.
strains associated with IBH (9). Polymerase chain reaction (PCR)
primers, based on conserved regions of the hexon gene, are
available which will amplify group 1 adenoviruses belonging to all
12 reference serotypes (15). Treatment of the PCR product with 4
endonucleases produces restriction patterns which are specific for
each reference strain. Therefore, the combined use of PCR with
REA can be used for detection and typing of all group 1
adenoviruses (15,11). Details of the primers and methodology are
given by Meulemans et al., (15), and Hess (11). PCR’s are also
available for specific detection of EDS virus (17) and for
amplification of DNA from all 3 groups of avian adenoviruses (21).
Subdivision into serotypes can also be done by serum
neutralization test, which requires substantial cell culture expertise
and access to reference antisera prepared against each prototype
strain. Prototype antisera (usually prepared in rabbits) are titrated
against 100 mean tissue culture infective doses (TdD50) of virus
and then diluted to contain 20 neutralizing units (e.g., a serum with
a neutralizing antibody titer of 1:2048 is diluted to 1:100). The
strains are described in Table 19-1. For typing of isolates by serum
neutralization, the virus isolate is diluted to 1/10 and 1/1000 in cell
culture medium, mixed with 1 volume of each prototype antiserum
containing 20 neutralizing units, and incubated for 2 hr at 37 C.
Duplicate monolayers of chick embryo liver or kidney cells,
growing in 96-well, flat bottomed microtitre plates or in 24 well cell
culture plates, are inoculated with each virus-serum mixture and the
plates are incubated at 37 C and observed for CPE over a period of
6 days. Controls, consisting of virus alone, and antiserum alone are
also inoculated. Neutralization of virus CPE indicates the serotype
of the isolate. Chick embryo liver cells are preferable to chick
kidney cells because the endpoints are more distinct. If desired,
pools of antisera can be used instead of individual antiserum.
Physicochemical properties
The more important physical and chemical properties may be
useful if an isolate is recovered, which cannot be neutralized using
the prototype antisera. Tests for determining the presence of
essential lipid, nucleic acid type, and thermal stability may be useful
and are described in Chapter 45 on virus identification and
classification. Other characterization criteria may include
morphology, site of replication, resistance to pH 3, and stability in
the presence of divalent cations. To test for resistance to pH 3, the
87
Chapter 19 Adenovirus
virus stock is mixed with buffer at pH 3 and pH 7. After incubating
for 1 hour at 37 C, the virus suspensions are immediately titrated.
Adenoviruses should be stable to pH 3 treatment, and show no
substantial reduction in infectivity. Adenoviruses in cell-culture
medium, without serum, are generally inactivated by heating for 30
min at 60 C. At 50 C for 1 hr, 1 M MgCl2 enhances the thermal
inactivation, and this is the basis of the test for stability in the
presence of divalent cations.
SEROLOGIC DETECTION IN THE HOST
Group specific antibodies
Because antibodies to avian adenoviruses are widespread in
poultry flocks, serological methods are of little significance in
diagnosis, except for the screening of SPF flocks. For this purpose,
ELISA is probably the test of choice. Indirect ELISAs have been
described and have been shown to be broadly group specific,
detecting antibodies to all group 1 avian adenoviruses (7). Antigen
for ELISA was grown by infecting monolayers of chicken kidney
cells with each avian adenovirus serotype. After 4 days, the cells
were scraped from the plastic, disrupted by sonication in distilled
water and extracted with fluorocarbon. The antigen preparation was
added to ELISA cuvettes at a predetermined dilution and allowed to
absorb overnight. After washing, test antisera were added, the
cuvettes were again washed and an anti-chicken serum conjugated
with horseradish peroxidase was added. Following incubation and
washing positive reactions were identified by addition of the
enzyme substrate, at a previously standardized concentration (7).
A similar indirect ELISA for detection of group 3 (EDS) virus
antibodies has also been described (5). In this test the EDS antigen
was grown in chick embryo liver cells, and an anti-chicken serum
conjugated with peroxidase was used with ortho phenylene diamine
as the substrate. The test was shown to be equal in sensitivity to an
EDS serum neutralization test and an indirect fluorescent antibody
test which used EDS virus infected chick embryo liver cells, fixed
on 12-well multispot slides.
A group specific, microtitre based immunofluorescence test
capable of screening large numbers of sera for group 1 adenovirus
antibodies, has also been described (4). In this test, chick embryo
liver cells, grown as monolayers in the wells of 96-well, flat
bottomed microtitre plates for 48 hr, were infected with FAdVl
virus, for 24 hr, and the plates were fixed by addition of a diluted
hypochlorite solution. After washing in PBS, test sera were applied
and the plates were incubated at 37 C for 30 min then washed and
an anti-chicken serum conjugated with FITC added. After
incubation and washing, the wells were examined for fluorescent
nuclei using an inverted fluorescence microscope.
Double-immunodiffusion or gel diffusion has been commonly
used for detecting avian adenovirus group specific antibodies. It is
fast, cheap, and simple to use but lacks sensitivity, so birds
undergoing a primary infection by natural routes may not respond
with detectable precipitating antibodies. However, if three antigens
are pooled (e.g. FAdVl, FAdV5 and FAdV9) sensitivity can be
markedly improved (8). Antigen for gel diffusion test may be
prepared by inoculating embryonating chicken eggs by the allantoic
route with 0.1 ml of an egg-adapted strain of group 1 adenovirus,
such as FAdVl. After 72 hr incubation at 37 C, the eggs are
chilled, and the chorioallantoic membranes harvested. One ml PBS
is added for each membrane and the membranes are homogenized
then centrifuged at 1500 x g for 20 min to remove the debris. The
pooled supemate is stored in small volumes at -80 C as gel diffusion
antigen.
Type specific (neutralizing) antibodies
Neutralizing antibodies to group 1 adenoviruses may occur in
chickens, turkeys, quail, pigeons, and other avian species. The
neutralization test is similar to that described above for typing of
Brian M. Adair and J. Brian McFerran
isolates. Two-fold dilutions of the test sera (e.g. 1/16 to 1/2048) are
added (50ul volumes) to duplicate wells of flat-bottomed microtitre
plates. Two hundred TCID50 ,of the appropriate adenovirus serotype
in a 50 μΐ volume, are then added to each well. Following
incubation for 1 hour at 37 C, to allow neutralization to take place,
50μ1 of chick embryo liver or kidney cell suspension is added to
each well. Virus controls containing 100, 10, 1.0, and 0.1 TCID50 of
virus are also included, and the plates are incubated and examined
for development of viral CPE. Neutralizing endpoints are read when
the virus controls indicate that 100 TCID5o of virus is present in the
test.
The same test can be used for EDS virus to confirm results of HI
tests. In this case the endpoints can be read on the basis of CPE or
by removing the supemate from each well to a parallel microtitre
plate, adding 50μ1 of chicken erythrocytes and observing for
presence of hemagglutination, as described above.
HI test for group 3 (EDS) virus antibodies
EDS virus growth in cell cultures or eggs is accompanied by
production of a hemagglutinating antigen, which agglutinates
chicken and duck erythrocytes. Antibody to the virus inhibits the
hemagglutination reaction and this is used as the basis of the HI test
for EDS. The test can be used for detecting infection with EDS
virus and is not applicable to any other avian adenovirus. Birds do
not usually develop antibody until after they have had EDS. Flocks
that develop EDS through reactivation of latent virus usually do so
before they are 35 wk old. Birds of all ages are susceptible to the
virus, and if the EDS virus is introduced (e.g., through drinking
contaminated water), infection can occur at any age. For screening
purposes, 1/10 dilutions of test sera in PBS are added to duplicate
wells of V-well microtitre plates. An equal volume of EDS antigen,
diluted to contain 4 hemagglutinating (HA) units, is added to one
well, and 1 volume PBS to the duplicate (control) well. A titration
of a positive serum (2-fold dilutions in PBS) should also be
included. The plates are shaken and left at room temperature for 15
min, 1 volume of an 0.8% suspension of chicken erythrocytes is
added to each well. The plates are again shaken and left at room
temperature until the erythrocytes have settled (about 45 min), and
then viewed by holding at an angle of 45 degrees and allowing the
settled erythrocytes to stream. No hemagglutination should occur in
the serum control well, no inhibition should occur with negative
serum, and the positive serum should be at its correct titer. Finally,
a back-titration carried out on the diluted antigen used in the test
should indicate that 4 HA units are present. Antigen for HI tests
may be prepared by inoculating 10-day-old embryonated duck eggs
allantoically with 0.2 ml of a 1/100 dilution of EDS virus. The
allantoic fluid is harvested 4-5 days after inoculation, clarified by
low-speed centrifugation, and stored at -80 C in small volumes.
Alternatively chick embryo liver or chick embryo kidney
monolayers may be inoculated with 1000 TCID50 of EDS virus, and
incubated until EDS virus CPE is seen in 10% of the cells. The
flasks of cells are then frozen at -80 C and thawed 3 times and the
cell debris removed by centrifugation. The supernatant containing
the hemagglutinin is distributed in small volumes and stored frozen
at -80 C. If inactivation of the antigen is required, this is done by
heating for 1 hr at 65 C in a water bath. This is preferred to formalin
treatment.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differentiation of Isolates. Isolation attempts in cell cultures will
often result in the isolation of other agents, particularly reoviruses.
In addition to the different CPE in cells, these viruses produce intra-
cytoplasmic inclusions. Mycoplasma may also be recovered from
specimens in cell culture and may be suspected due to their
reovirus-like CPE and sensitivity to chloroform. To eliminate the
possibility of contamination with other agents, limit dilution
88
titration in cell culture should be performed with new isolates. Ten­
fold dilutions of the virus isolate are prepared and inoculated into
duplicate chick embryo liver or kidney cell cultures. The highest
dilution showing CPE is harvested by freezing at -80 C and
thawing; the process is repeated a total of 3 times. Electron
microscope examination should be used to confirm presence of only
one agent. While the procedure is not foolproof, it gives some
confidence that most other agents have been removed. Adeno-
associated parvoviruses have been found in adenovirus stock pools
and have also been isolated from healthy birds. They require
presence of adenovirus for their replication, and there is no
evidence to suggest an involvement in disease. Molecular tests
(PCR) are available for their diagnosis.
REFERENCES
1. Adair, B.M Studies on the development of avian adenoviruses in cell
cultures. Avian Pathol. 7:541-550. 1978
2. Adair, B.M, Curran, W.L. and McFerran, J.B. Ultrastructural studies of
the replication of fowl adenoviruses in primary cell cultures. Avian Pathol.
8:133-144. 1979.
3. Adair, B.M, McFerran, J.B., Connor, T.J., McNulty, MS. and McKillop,
E.R. Biological and physical properties of a virus (strain 127) associated
with the egg drop syndrome 1976. Avian Pathol. 8: 249-264. 1979.
4. Adair, B.M, McFerran, J.B. and Calvert, V.M Development of a
microtitre fluorescent antibody test for serological detection of adenovirus
infection in birds. Avian Pathol. 9: 291-300. 1980.
5. Adair, B.M., Todd, D., McFerran, J.B. and McKillop, E.R. Comparative
serological studies with egg drop syndrome virps. Avian Pathol. 15: 677-
685. 1986.
6. Benko, M, B.Harrach, and W.C. Russell. 2000. Family Adenoviridae. In:
Virus Taxonomy. Seventh Report of the International Committee on
Taxonomy of Viruses. MH.V. van Regenmortel, C.M Fauquet, D.H.L.
Bishop, E.B. Carstens, MK. Estes, S.M Lemon, J. Maniloff, MA. Mayo,
D.J. McGeoch, C.R. Pringle, R.B. Wickner (eds), Academic Press, New
York, San Diego. Pp. 227-238. 2000.
7. Calnek, B.W., Shek, W.R., Menendez, N.A. and Stiube, P. Serological
cross-reactivity of avian adenovirus serotypes in an enzyme-linked
immunosorbent assay. Avian Dis. 26: 897-906 1982.
8. Cowen, B. S. A triple antigen for the detection of type 1 avian adenovirus
precipitin. Avian Dis. 31:351-354. 1987.
9. Emy, K. M, D. A Barr, and K. J. Fahey. Molecular characterization of
highly virulent fowl adenoviruses associated with outbreaks of inclusion
body hepatitis. Avian Pathol. 20:597-606. 1991.
10. Goodwin, MA, Latimer, K.S., Resurreccion, R.S., Miller, P.G. and
Campagnoli, R.P. DNA in situ hybridization for the rapid diagnosis of
massive necrotizing avian adenovirus hepatitis and pancreatitis in chicks.
Avian Dis. 40:828-831. 1996.
11. Hess, M Detection and differentiation of avian adenoviruses: a review.
Avian Pathol. 29: 195-206. 2000.
12. Latimer, K.S., Niagro, F.D., Williams, O.C., Ramis, A., Goodwin,
MA, Ritchie, B.W. and Campagnoli, R.P. Avian Dis. 41: 773-782. 1997
13. McFerran, J.B. and Smyth, J.A Avian Adenoviruses. Rev. Sci. Off. Int.
Epiz., 19: 589-601. 2000.
14. Mazaheri, A, Prusas, C., Voss, M and Hess, M Some strains of
serotype 4 fowl adenoviruses cause inclusion body hepatitis and
hydropericardium syndrome in chickens. Avian Pathol. 27: 269-276. 1998.
15. Meulemans, G., Boschmans, M., van den Berg, T.P. and Decaesstecker,
M Polymerase chain reaction combined with restriction enzyme analysis for
detection and differentiation of fowl adenoviruses. Avian Pathol. 30: 655-
660. 2001.
16. Nakamura, K., Mase, M, Yamaguchi, S., Shibahara, T. and Yuasa, N.
Pathologic study of specific pathogen free chicks and hens inoculated with
adenovirus isolated from hydropericardium syndrome. Avian Dis. 43: 414-
423. 1999.
17. Raue, R. and Hess, M Hexon based PCR’s combined with restriction
enzyme analysis for rapid detection and differentiation of fowl adenoviruses
and egg drop syndrome virus. J. Virol. Meth. 73: 211-217.
18. Saifuddin, M and Wilks, C.R. Development of an enzyme linked
immunosorbent assay to detect and quantify adenovirus in chicken tissues.
Avian Dis. 34: 239-245. 1990.
 Chapter 19 Adenovirus

19. Smyth, J. A., M A. Platten, and J. B. McFerran. A study of the
pathogenesis of egg drop syndrome in laying hens. Avian Pathol. 17:653—
666. 1988.
20. Xie, Z., Fadi, A.A., Girshick, T. and Khan, MI. Detection of avun
adenovirus by polymerase chain reaction. Avian Dis. 43: 98-105. 1999.
21. Zsak, L. and Kisary, J. Grouping of fowl adenoviruses based upon the
restriction patterns of DNA generated by Bam Hl and Hind HI. InterviroL
22: 110-114.

89
 20
HEMORRHAGIC ENTERITIS OF TURKEYS
MARBLE SPLEEN DISEASE OF PHEASANTS
F. William Pierson and Scott D. Fitzgerald

SUMMARY. Hemorrhagic enteritis of turkeys and marble spleen disease of pheasants are caused by viruses of the family Adenoviridae,
genus Siadenovirus. They are serologically distinct from other avian adenoviruses but are indistinguishable from one another as determined
by agar gel immunodiffusion (AGID) test. Slight differences appear at the DNA level and clinical manifestations of disease vary with the
strain of virus and the host infected. Most gallinaceous birds are susceptible to infection, but disease is of primary importance in turkeys and
pheasants.
Agent Identification. Diagnosis can usually be made on the basis of clinical signs, lesions, histopathology, and the demonstration of viral
antigen or DNA in splenic tissue by AGID and PCR respectively.
Serologic Detection in the Host. Analysis of acute and convalescent sera by AGED or enzyme linked immunosorbent assay may also be of
diagnostic value.

INTRODUCTION Gross Lesions

Hemorrhagic enteritis (HE) is an acute viral disease of turkeys, 4
wk of age and older caused by a virus of the family Adenoviridae,
genus Siadenovirus, i.e., Turkey Hemorrhagic Enteritis Virus
(THEV) (8) In its most severe form the disease is characterized by
depression, bloody droppings, and death. Survivors as well as those
with milder forms of the disease, often develop secondary coliform
infections as a result of transient immunosuppression. This is
believed to be the result of viral replication within IgM bearing B-
lymphocytes and macrophages as well as cytokine mediated
apoptosis of bystander cells (40). Gastrointestinal lesion formation
is likewise considered to be immune mediated (40). Prevention of
the gastrointestinal form of the disease may be accomplished
through the use of avirulent live-virus vaccines (14,18).
Marble spleen disease (MSD) is a condition affecting captive-
reared pheasants between 3-8 mo of age and is caused by a virus
serologically indistinguishable from THEV (11,28). However,
MSD virus (MSDV) primarily causes pulmonary edema and death
by asphyxiation in affected pheasants. Mottled enlarged spleens are
also characteristic (20). Like HE, fulminate MSD is thought to be
an immune mediated disease and may be prevented by vaccination
(15).
Both THEV and MSD have been reviewed extensively in the
literature (20,37).
CLINICAL DISEASE
Signs
The clinical signs of the gastrointestinal form of HE usually
appear 3-4 days after exposure to the virus and include depression,
pallor, bloody diarrhea, prostration, and death. Dark red to black
gastrointestinal contents may be expressed from the cloaca of dead
or moribund birds following application of moderate pressure to
the abdomen. Clinically affected birds usually die within 24 hr or
recover completely. The disease spreads quickly through
susceptible flocks and usually subsides within 6-10 days of onset.
The morbidity typically approaches 100% but mortality may range
from less than 1 % to as high as 60% depending on the viral
pathotype (13,24). Due to the immunosuppressive nature of the
virus a second rise in mortality commonly occurs approximately 2
wk after the first due to secondary infections with E. coli,
Staphylococcus sp. or other agents (36, 42, 49).
The progression of clinical signs associated with MSD in
pheasants is also rapid and includes depression, weakness, nasal
discharge, dyspnea, and death. Gastrointestinal involvement is not
apparent. Mortality usually ranges between 2 and 3% but may
reach as high as 20% over the course of approximately 10 days
(5,15,33).
90
Turkeys that have died from HE are pale due to loss of blood but
are otherwise in good flesh and often have feed in the crop. The
anterior small intestine is congested and the lumen is often filled
with blood. The intestinal mucosa especially at the level of the
duodenum has hemorrhage with progression from ecchymoses to
petechiae, proximal to distal. In such cases the spleen may appear
small and pale but in moribund birds killed prior to extensive blood
loss, splenic enlargement with mottling is typically observed
(22,36,39).
In pheasants, splenic enlargement with mottling, lung congestion
and edema are the hallmark lesions. Gastrointestinal lesions are
absent (5).
Histopathology
In cases of HE or MSD splenic tissue that has been fixed in 10%
neutral buffered formalin and stained with hematoxylin and eosin
reveals numerous distinct microscopic lesions. These include
lymphoid follicular depletion due to virus-induced apoptosis and
necrosis as well as prominent hyperplasia of large lymphoreticular
cells within the white pulp, many of which contain eosinophilic
intranuclear inclusions (23,29,41,40).
Intestinal samples may be of confirmative value if preserved in
Zenker's fixative within a few minutes of death and stained with
hematoxylin and eosin. Characteristic histopathologic changes
include severe congestion of the mucosa, degeneration and
detachment of the villus epithelium, and hemorrhage within the
lamina propria (41).
Occasional intranuclear inclusions may be seen in lymphocytes
and macrophages of the lamina propria, in mononuclear cells
located within the fiver, bone marrow, peripheral blood, lung,
pancreas, brain, and renal tubular epithelium (26,29,41,45).
Microscopically the splenic lesions seen with MSD are identical
to those of HE. Lung lesions in pheasants that succumb to MSD are
consistent with the congestion and edema observed grossly (21).
Intranuclear inclusions are occasionally found in mononuclear cells
in the lung, liver, proventriculus, bursa of Fabricius, and bone
marrow (21).
SAMPLE COLLECTION
THEV can be recovered from the intestinal contents or spleens of
dead or moribund turkeys. However for both THEV and MSDV
mottled enlarged spleens are by far the best source (12). To obtain
useful quantities of virus the capsule of the spleen should be
removed and the parenchyma pressed through a syringe to disrupt
the reticular architecture. This material should be diluted with an
equal volume of 10 mM phosphate buffered saline (pH 7.4), mixed,
frozen and thawed 2-3 times, and centrifuged. The resulting
supernatant may be used as a test antigen in immunoprecipitation
reactions or for further propagation in susceptible birds and cell
 Chapter 20
culture. The virus is extremely stable and can be maintained for
extended periods by freezing or lyophilization. Infectivity is
destroyed by drying or application of disinfectants containing
phenol or sodium hypochlorite (9,10).
PREFERRED CULTURE MEDIA AND SUBSTRATES.
THEV and MSDV can be propagated in susceptible turkeys that
are 4 wk-of-age or older. However 5-6 wk of age is generally the
best time for infection due to the natural decline of maternal
antibody (17). Birds may be inoculated intravenously or orally with
about 0.25 ml of a IO’2 dilution of supernatant prepared as
previously described. Removal of spleens should be performed 3-4
days after intravenous inoculation or 5-6 days after oral inoculation
(12). At these times the spleens will be grossly mottled and
enlarged. Successful in vitro propagation of THEV and MSDV can
be accomplished using MDTC RP19 cells (American Type Culture
Collection, Rockville, MD), a turkey lymphoblastoid cell line
derived from a Marek’s disease virus-induced tumor (34) or in
leukocytes isolated from the peripheral blood of THEV negative
turkeys (46).
AGENT IDENTIFICATION
Morphology and Physicochemical Properties
THEV and MSDV are DNA viruses (27,31). They produce thin
bands in sucrose or cesium chloride gradients at a density of 1.32-
1.34 g/ml (4,27). They are non-enveloped icosahedrons having 252
capsomeres of which 240 are non-vertex capsomeres (hexons). The
12 vertex capsomeres (pentons) possess a single fiber (43).
Complete virions range in diameter from 70 to 90 nm (27,44).
Biological Properties
The viruses causing HE and MSD are believed to be pathotypic
variants of the same virus. THEV will cause splenic enlargement
and mottling in pheasants without producing significant pulmonary
lesions (15). Similarly MSDV infection in turkeys is characterized
by splenic enlargement and mottling without gastrointestinal
involvement (14). The observed variations in clinical disease are
probably as much the result of differences in the host immune
response i.e., target shock organ (37,40) as they are differences
between viral strains. Other variants exist that produce graded
intermediate clinical responses in infected birds (14).
Mottling and enlargement of the spleen have also been observed
in chickens infected with a virus serologically indistinguishable
from THEV and MSDV (16). The disease has been referred to as
avian adenovirus group Π splenomegaly (AAS) of chickens but
probably only represents the expression of THEV/MSDV in a
different gallinaceous host. Except for occasional condemnation
due to suspicion of Marek’s disease or lymphoid leukosis, AAS
appears to be of little economic significance (16).
Antigen Detection
Agar Gel Immunodiffusion (AGID) Test for Antigen. Isolates
of THEV and MSDV are serologically indistinguishable from one
another. However an AGID may be used to differentiate HEV and
MSDV from other pathogens (12,13).
Viral antigen may be obtained from the spleens of suspect cases
as described in the section on sample collection. Positive control
antigen may be prepared as described in the section on preferred
culture media and substrates. Positive control antiserum may be
obtained 4 wk post-inoculation.
Immunodiffusion gels may be prepared in the following manner.
Thirty-two (32.0) grams sodium chloride, 0.8 g sodium azide, and
3.2 g agarose are added to 400 ml distilled water in a 1000-ml
Erlenmeyer flask. The mixture is then stirred on a hot plate until
boiling, at which time it should clarify. The liquefied gel can then
91
Hemorrhagic Enteritis of Turkeys Marble Spleen Disease of Pheasants
be divided into smaller aliquots, refrigerated, and re-liquefied by
heating in a microwave or boiling water prior to the pouring of test
plates. Disposable immunodiffusion plates that hold approximately
15 ml of gel or comparable products are commonly used. Wells
should be 5 mm in diameter and hold approximately 50 ml.
Unknown test material and known positive control antigen should
be placed in alternating wells around a central well containing
positive control antiserum. Plates should be incubated in a
humidified chamber at room temperature and read at 24 and 48 hr.
Bands of precipitation showing lines of identity with known
positive antigen are indicative of THEV or MSDV infection.
Quantification of THEV/MSDV antigen. An antigen capture
ELISA for HEV has been described in the literature (47). This
technique enables more precise quantitation of viral antigen in
tissue extracts than does AGID. Competitive PCR may also be
used for quantification in tissue based on the DNA copy number
(2).
Immunohistochemistry. As an adjunct to routine histopathology,
immunofluorescent and immunoperoxidase staining techniques
have been described that allow accurate identification of THEV or
MSDV intranuclear inclusions in fixed tissues (19,21,41).
Molecular Identification
The THEV/MSDV genome is small in comparison to other
members of the family Adenoviridae i.e., 26.3 kb in length (38).
This in addition to the presence of unique open reading frames and
relatively high A+T content, formally establishes THEV and
MSDV as being members of the genus Siadenovirus (7,8,38).
Techniques for determining the presence of viral DNA in tissues
using both in situ DNA hybridization and polymerase chain
reactions (PCR) have been described (2,3,25,43). Due to its
enhanced sensitivity PCR may be useful in cases in which the
suspicion of HEV infection is high but presence of viral antigen
cannot be confirmed by AGID or antigen capture ELISA. A
suitable technique involves the amplification of a 273 bp region of
the hexon gene. Primers (NHEVF-5’-gtggttcagcagaaagttctt-3’;
NHEVR-5’-cagtagactcataagcaactat-3’) are added to the mastermix
which contains thermostable Taq DNA polymerase, MgCl2 and
dNTPs (Platinum Taq Readymix®, Invitrogen, Grand Island, NY)
to a final concentration of 0.2 mM of each primer. Sample DNA
extracted from splenic tissue (InstaGene™ Matrix, Bio-Rad
Laboratories, Hercules, CA) is then added and the PCR reaction is
run (thermocycler program: initial denaturation at 95 C for 2 min;
then 35 cycles of 95 C for 15 sec, 58 C for 15 sec, 72 C for 30 sec;
and final extension at 72 C for 10 min). PCR products are
visualized after agar gel electrophoresis (0.8% TBE-agarose gel,
100V for 1 hour) by staining with ethidium bromide and UV trans­
illumination. Intense bands corresponding with the predicted 273
bp product are considered positive.
SEROLOGICAL DETECTION IN THE HOST
Agar Gel Immunodiffusion Test for Antibody
Anti-HEV or anti-MSDV antibodies can be detected in sera as
early as 2-3 wk post-infection by AGID (12,13,30). The assay is
identical to that described in the section on agent identification
with the exception that unknown test sera should be alternated with
known positive control sera and placed in opposition to positive
control (splenic) antigen. Testing of both acute and convalescent
sera should be performed.
Enzyme-Linked Immunosorbent Assay (ELISA)
Enzyme-linked immunosorbent assays have been developed for
the detection of THEV/MSDV antibody (6,35,47) and are available
commercially (Synbiotics Corporation, San Diego, CA). These
tests are more sensitive than AGID and may be useful in the
quantitation of low levels of antibody such as that found in young
F. William Pierson and Scott D. Fitzgerald
birds prior to and shortly after vaccination. In older birds with high
levels of antibody e.g., breeders or market age turkeys, additional
dilution of sera may be required to bring optical densities within
readable limits. In most cases multiplication of the sample to
positive ratio by the appropriate dilution factor prior to the
calculation of the log titer will enable comparison with younger
birds.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
In turkeys the presence of mottled enlarged spleens in the absence
of detectable HEV antigen or intestinal bleeding should arouse
suspicion of other diseases such as reticuloendotheliosis (see
Chapter 35) or lymphoproliferative disease (1). Splenic
enlargement may also be indicative of a generalized septicemia or
other acute conditions (37, see Chapters 3, 4, and 9). Congestion
and hemorrhage in the proximal small intestine should also prompt
consideration of coccidiosis (Eimeria meleagrimidis) (32). In
pheasants mortality associated with asphyxia, dyspnea, pulmonary
edema, and mottled enlarged spleens may be considered
pathognomonic for MSD.
ACKNOWLEGEMENT
The authors are greatly indebted to Drs. C. H. Domermuth and W. B. Gross
for their contributions to earlier editions of this chapter.
REFERENCES
1. Biggs, P. M Lymphoproliferative disease of turkeys. In: Diseases of
poultry, 10th ed B. W Calnek. H. J. Barnes, C. W. Beard, L R. McDougald,
Y. M Saif, eds. Iowa State University Press, Ames, Iowa. pp. 485-488.
1997.
2. Beach, N., C. Cardona, R.B. Duncan, Jr., D. Wise, and F. W. Pierson.
Competitive PCR for the quantification of hemorrhagic enteritis virus. In:
Proceedings of the 73rd Northeastern Conference on Avian Diseases,
College Park, Maryland 2001.
3. Beach, N., C. Cardona, D. Wise, R. Duncan, and F. W. Pierson. Latency
of hemorrhagic enteritis virus as determined by nested PCR. In:
Proceedings of the 74th Northeastern Conference on Avian Diseases,
Mystic, Connecticut. 2002.
4. Carlson, H. C., F. AI-Sheikhly, J R. Pettit, and G. L. Seawright. Virus
particles in spleens and intestines of turkeys with hemorrhagic enteritis.
Avian Dis. 18:67-73. 1974.
5. Carlson, H. C., J. R. Pettit, R. V. Hemsley, and W. R. Mitchell. Marble
spleen disease of pheasants in Ontario. Can. J. Comp. Med. 37:281-286.
1973.
6. Davidson, I., A. Aronovici, Y. Weisman, and M Malkinson. Enzyme
immunoassay studies on the serological response of turkeys to hemorrhagic
enteritis virus. Avian Dis. 29:43-52. 1985.
7. Davison, A J., and B. Harrach. Siadenovirus. In: The springer index of
viruses. C.A. Tidona and G. Darai, eds.: Springer-Verlag, New York, New
York, pp.29-33. 2002.
8. Davison, A.J., M Benko, and B. Harrach. Genetic Content and Evolution
of Adenoviruses. J. Gen. Virol. 84:2895-2908. 2003.
9. Domermuth, C. H., and W. B. Gross. Effect of disinfectants and drying
on the virus of hemorrhagic enteritis of turkeys. Avian Dis. 15:94-97. 1971.
10. Domermuth, C. H., and W. B. Gross. Effect of chlorine on the virus of
hemorrhagic enteritis of turkeys. Avian Dis. 16:952-953. 1972.
11. Domermuth, C. H., and W. B. Gross. Hemorrhagic enteritis of turkeys:
antiserum efficacy, preparation and use. Avian Dis. 19:657-665. 1975.
12. Domermuth, C. H., W. B. Gross, R. T. DuBose, C. S. Douglass, and C.
B. Reubush, Jr. Agar gel diffusion precipitin test for hemorrhagic enteritis
of turkeys. Avian Dis. 16:852-857. 1972.
13. Domermuth, C. H., W. B. Gross, and R. T. DuBose.
Microimmunodiffusion test for hemorrhagic enteritis of turkeys. Avian Dis.
17:439-444. 1973.
14. Domermuth, C. H., W. B. Gross, C. S. Douglass, R. T. DuBose, J. R.
Harris, and R. B. Davis. Vaccination for hemorrhagic enteritis of turkeys.
Avian Dis. 21:557-565. 1977.
15. Domermuth, C. H., W. B. Gross, L. D. Schwartz, E. T. Mallinson, and
R. Britt. Vaccination of ring-necked pheasant for marble spleen disease.
Avian Dis. 23:30-38. 1979.
92
16. Domermuth, C. H., J. R. Harris, W. B. Gross, and R. T. DuBose. A
naturally occurring infection of chickens with a hemorrhagic
enteritis/marble spleen disease type of virus. Avian Dis. 23:479-484.1979.
17. Fadly, A. M, and K. Nazerian. Hemorrhagic enteritis of turkeys:
influence of maternal antibody and age at exposure. Avian Dis. 33:778-86.
1989.
18. Fadly, A Μ, K. Nazerian, K. Nagaraja, and G. Below. Field
vaccination against hemorrhagic enteritis of turkeys by a cell-culture live-
virus vaccine. Avian Dis. 29:768-777. 1985.
19. Fasina, S. O., and J. Fabricant. In vitro studies of hemorrhagic enteritis
virus with immunofluorescent antibody technique. Avian Dis. 26:150-
157.1982.
20. Fitzgerald, S. D., and W. M. Reed. A review of marble spleen disease
of ring-necked pheasants. J. Wildl. Dis. 25:455-461. 1989.
21. Fitzgerald, S. D., W. M Reed, and T. Bumstein. Detection of type Π
avian adenoviral antigen in tissue sections using immunohistochemical
staining. Avian Dis. 36:341-347. 1992.
22. Gross, W. B. Lesions of hemorrhagic enteritis. Avian Dis. 11:684-693.
1967.
23. Gross, W. B., and C. H. Domermuth. Spleen lesions of hemorrhagic
enteritis of turkeys. Avian Dis. 20:455-466. 1976.
24. Gross, W. B., and W. E. C. Moore. Hemorrhagic enteritis of turkeys.
Avian Dis. 11:296-307. 1967.
25. Hess, M, R. Raue, and Η. M Hafez. PCR for specific detection of
haemorrhagic enteritis virus of turkeys, an avian adenovirus. J. Virol.
Methods 81:199-203. 1999.
26. Hussain, I., C. U. Choi, B. S. Rings, D. P. Shaw, and K. V. Nagaraja.
Pathogenesis of hemorrhagic enteritis virus infection in turkeys. Zentralbl.
Veterinarmed. 40:715-726.1993.
27. litis, J. P., and S. B. Daniels. Adenovirus of ringnecked pheasants:
purification and partial characterization of marble spleen disease virus.
Infect. Immun. 16:701-705. 1977.
28. litis, J. P., R. M Jakowski, and D. S. Wyand. Transmission of marble
spleen disease in turkeys and pheasants. Am J. Vet. Res. 36:97-101. 1975.
29. Itakura, C., and H. C. Carlson. Pathology of spontaneous hemorrhagic
enteritis of turkeys. Can. J. Comp. Med. 39:310-315.1975.
30. Jakowski, R. M, and D. S. Wyand. Marble spleen disease in ring­
necked pheasants: demonstration of agar gel precipitin antibody in
pheasants from an infected flock. J. Wildl. Dis. 8:261-263. 1972.
31. Jucker, M T„ J. R. McQuiston, J. V. van den Hurk, S. M, Boyle, and
F. W. Pierson. Characterization of the haemorrhagic enteritis virus genome
and the sequence of the putative penton base and core protein genes. J. Gen.
Virol. 77:469-479. 1996.
32. MacDougald, L. R. Coccidiosis. In: Diseases of poultry, 11th ed. Y.M
Saif., H.J. Barnes, J.R. Glisson, A.M Fadly. L.R. McDougald, and D.E.
Swayne, eds. Iowa State University Press, Ames, Iowa. pp. 988. 2003.
33. Mayeda, B., G. B. West, A A. Bickford, and B. R. Cho. Marble spleen
disease in pen-raised pheasants in California. Proc. Amer. Assoc. Vet. Lab.
Diagn. 25:261-270. 1982.
34. Nazerian, K., and A. Fadly. Propagation of virulent and avirulent
turkey hemorrhagic enteritis virus in cell culture. Avian Dis. 26:816-
827.1982.
35. Nazerian, K., and A M Fadly. Further studies on in vitro and in vivo
assays of hemorrhagic enteritis virus (HEV). Avian Dis. 31:234-240. 1987.
36. Pierson, F. W., V. D. Barta, D. Boyd, and W. S. Thompson. Exposure
to multiple infectious agents and the development of colibacillosis in
turkeys. J. Appl. Poult. Res. 5:347-357.1996.
37. Pierson, F. W., and S. D. Fitzgerald. Hemorrhagic enteritis and related
infections. In: Diseases of poultry, 11th ed. Y.M Saif, H.J. Barnes, J.R.
Glisson, A.M. Fadly, L.R. McDougald, and D.E. Swayne, eds. Iowa State
University Press, Ames, Iowa. pp. 237-247. 2003.
38. Pitcovski, J., M Mualem, Z. Rei-Koren, S. Krispel, E. Shmueli, Y.
Peretz, B. Gutter, G.E. Gallili, A. Michael, and D. Goldberg. The complete
DNA sequence on genome organization of the avian adenovirus,
hemorrhagic enteritis virus. Virol 249:307-315. 1998.
39 Pomeroy, B. S., and R. Fenstermacher. Hemorrhagic enteritis in
turkeys. Poult. Sci. 16:378-382. 1937.
40. Rautenschlien, S., and J. M Sharma. Immunopathogenesis of
haemorrhagic enteritis virus (HEV) in turkeys. Devel. Comp. Immuno.
24:237-246. 2000.
41. Saunders, G. K., F. W. Pierson, and J. V. van den Hurk. Haemorrhagic
enteritis virus infection in turkeys: a comparison of virulent and avirulent
virus infections and a proposed pathogenesis. Avian Pathol. 22:47-58.
1993.
 Chapter 20
42. Sponenberg, D. P., C. H. Domermuth, and C. T. Larsen. Field
outbreaks of colibacillosis of turkeys associated with hemorrhagic enteritis
virus. Avian Dis. 29:838-842. 1985.
43. Suresh, M., and J. M Sharma. Pathogenesis of type II avian adenovirus
infection in turkeys: in vivo immune cell tropism and tissue distribution of
the virus. J. Virol. 70:30-36. 1996.
44. Tolin, S. A., and C. H. Domermuth. Hemorrhagic enteritis of turkeys.
Electron microscopy of the causal virus. Avian Dis. 19:118-125. 1975.
45. Trampel, D. W., C. U. Meteyer, and A. A Bickford. Hemorrhagic
enteritis virus inclusions in turkey renal tubular epithelium. Avian Dis.
36:1086-1091. 1992.
93
Hemorrhagic Enteritis of Turkeys Marble Spleen Disease of Pheasants
46. van den Hurk, J. V. Propagation of hemorrhagic enteritis virus in
normal (non-tumor derived) cell culture. J. Am. Vet. Med. Assoc. 187:307.
1985.
47. van den Hurk, J. V. Quantitation of hemorrhagic enteritis virus antigen
and antibody using enzyme-linked immunosorbent assays. Avian Dis.
30:662-671. 1986.
48. van den Hurk, J. V. Characterization of the structural proteins of
hemorrhagic enteritis virus. Arch. Virol. 126:195-213. 1992.
49. van den Hurk, J. V., B. J. Allan, C. Riddell, T. Watts, and A. A Potter.
Effect of infection with hemorrhagic enteritis virus on susceptibility of
turkeys to Escherichia coli. Avian Dis. 38:708-716. 1994.
 21
INFECTIOUS LARYNGOTRACHEITIS
Deoki N. Tripathy and Maricarmen Garcia

SUMMARY. Infectious laryngotracheitis (ILT) is either an acute, highly contagious herpesvirus infection of chickens, characterized by
severe dyspnea, coughing, and rales; or a subacute disease with lacrimation, tracheitis, conjunctivitis, and mild rales. ILT has been reported
from most of the intensive poultry-rearing areas of the United States and many other countries. Mortality varies and may reach 50% in adult
birds, usually due to occlusion of the trachea by hemorrhage or exudate. Following recovery, some birds remain carriers for variable periods
and become a source of infection for susceptible birds. Diagnosis during the acute stage of infection is usually made by clinical signs and
demonstration of intranuclear inclusion bodies in the infected tracheal epithelium.
Agent Identification. Infectious laryngotracheitis is routinely diagnosed by histopathologic examination of tracheal lesions characterized by
the presence of intranuclear inclusion bodies. In addition, viral particles exhibiting typical herpesvirus morphology can be detected by
negative staining of lesion suspensions or by direct examination of ultrathin sections of affected tissues using transmission electron
microscopy. The virus is isolated by inoculation of chorioallantoic membrane (CAM) of 9 to 12-day-old developing chicken embryos.
Lesions develop on the CAM 5 to 7 days post-infection. Etiology is confirmed by histopathologic examination of the CAM for intranuclear
inclusion bodies or electron microscopy for herpesvirus morphology. Isolated viruses can be evaluated for pathogenicity in susceptible hosts,
for example, chickens (development of clinical signs and tracheal lesions), or for growth and pathogenicity of avian cell culture (cytopathic
effect and plaque formation).
Genomic characterization of virus isolates can be based on restriction fragment length polymorphism (RFLP), in which the DNA profiles
are compared after restriction enzyme digestion and subsequent agarose gel electrophoresis. Although cloned genomic fragments have been
used as diagnostic probes, the use of polymerase chain reaction (PCR) for the amplification of a specific portion of the genome have been
used more frequently as a rapid diagnostic method for detection of viral nucleic acid in experimentally and naturally infected birds. Although
PCR has not been used as a routine diagnostic tool, PCR-RFLP procedures has been widely utilized as an epidemiological tool to
differentiate among viral isolates. Other rapid diagnostic methods utilized are the immunoperoxidase staining, indirect fluorescent antibody,
and the agar-gel immunodiffusion (AGID) test, all utilized to detect the viral antigen in affected tissues.
Serologic Detection in the Host. Serologic detection of infection may be important in experimental studies and in measuring immune
response following vaccination. Antibody response can be measured by AGID tests, the immunoperoxidase (IP) test, and the enzyme-linked
immunosorbent assays (ELISA). The immunoperoxidase/indirect fluorescent antibody and AGID tests can also be used to detect the antigen
in affected tissues. Antigenic differences among isolates can be determined by host pathogenicity and virus neutralization.
Vaccination with modified live strains of low virulence is practiced in endemic areas and on farms where a specific diagnosis has been
made. Vaccination in the face of an outbreak shortens the course of the disease.

may be detectable in some cases. In the milder forms of the disease,

INTRODUCTION only a few birds in a flock show classical respiratory signs, and
mortality is low. In such cases, the clinical signs are characterized
Infectious laryngotracheitis (ILT) is an acute respiratory disease of by mild tracheatis, swollen sinus and mild conjunctivitis (32, 37).
chickens caused by an alphaherpesvirus. ILT has been recognized in Turkeys and pheasants have a low degree of susceptibility to ILTV
many countries and is an economically important disease of (18).
chickens (18). In areas with large concentrations of poultry, ILT is
responsible for losses due to lowered egg production and mortality. SAMPLE COLLECTION
As a member of the alpha-herpesvirus family the ILT virus (ILTV)
has the ability to establish latency and to persist in recovered Tracheal exudates, tracheal scrapings and lung should be collected
chickens for variable periods after recovery from the disease. Thus,
for virus isolation in the early acute phase of the disease. A 10%
the carrier state is of considerable epizootiological significance, as suspension is made of the tissue in sterile normal saline, Hanks
carrier birds may shed the reactivated virus and may be responsible
balanced salt solution, or broth by grinding the tissue either with
for new outbreaks of the disease.
sterile fine sand or 60-mesh aluminum oxide with a sterile mortar
and pestle or in a glass grinder. Alternatively tracheal scrapings can
CLINICAL DISEASE
be collected with a sterile scalpel and resuspended in any suitable
sterile transport media. The suspension is centrifuged at 700 x g for
Infection with ILTV is characterized by anorexia, depression, and
10 min, and antibiotics (1000 IU/ml penicillin and 1 g/ml of
severe respiratory distress, with coughing, sneezing, gurgling,
dihydrostreptomycin) are added. The supernatant fluid is held at
gasping, and rales. The neck is often extended during inspiratory
room temperature for 30-50 min before inoculation into the culture
efforts, because the trachea is often partially occluded, and bloody,
substrate.
mucous exudate may be expelled during violent expectorating Tracheal tissue from early acute cases may be collected in Bouin’s
efforts. Conjunctivitis has been characteristic of more recent
or Zenker’s fixatives for demonstration of intranuclear inclusion
outbreaks Although ILTV causes a highly localized infection
bodies by histopathologic examination. Serum samples may be
involving mainly the trachea and the conjunctiva, extratracheal
collected to measure antibody responses by virus-neutralization
spread of the virus to the lung, trigeminal ganglion and brain has (VN), agar-gel immunodiffusion (AGID), enzyme-linked
also been reported.
immunosorbent assay (ELISA), or fluorescent antibody (FA) tests
In severe forms of the disease, mortality is as high as 50% or
to detect specific antibodies.
more, with significant lesions consisting of hemorrhages in the
trachea and larynx. The tracheal lumen is often filled with blood
clots, mucus, caseous yellowish exudate, or a tracheal plug, which
may cause death from asphyxia. Intranuclear inclusion bodies are
detectable in the early stage of the disease on histopathologic
examination of the infected trachea. Air sacculitis and pneumonitis
94

PREFERRED CULTURE MEDIA AND SUBSTRATES
Routinely ILTV can be isolated from tracheal exudates, tracheal
scrapings or lung tissue suspensions by inoculation of developing
embryonated eggs, the trachea and infraorbital sinuses of
susceptible chickens, or inoculation of chick embryo liver (CEL)
and chicken embryo kidney (CEK) monolayer cultures and virus
isolation from tracheas of latently infected birds has been possible
using the tracheal organ culture system (18).
Embryo Inoculation
Chicken embryos, 9 to 12 day-old, from specific-pathogen-free
flocks are inoculated on the chorioallantoic membrane (CAM) with
a 0.1 to 0.2-ml suspension of tracheal exudate or tracheal and lung
tissues. Inoculated embiyos are incubated at 37 C. As early as 3
days post-inoculation (PI), plaques can be observed on the CAM
that have opaque edges and depressed central areas of necrosis. The
plaques result from proliferation and necrosis of the affected cells
and may vary from a few scattered foci to large numbers. Some
embryos die between 2 to 8 days PI, and the size of surviving
embryos is often reduced.
Chicken Inoculation
Susceptible chickens can be inoculated by tracheal, infraorbital
sinus, or aerosol methods with a suspension of the specimen. Under
experimental conditions the severity of respiratory signs and
mortality depends on virulence of the viral strain, susceptibility and
age of the birds, and the route of inoculation. The virus multiplies
primarily in the trachea and can be isolated 2 to 7 days after
intratracheal inoculation. Virus titer is at a maximum 3 to 4 days PI.
Chickens infected with virulent strains usually develop signs of
respiratory tract infection by day 3 PI. Most chickens show typical
signs of the disease by days 4 and 5. Mild respiratory disease with
mild, focal, non-suppurative pneumonitis and air sacculitis may be
observed in some birds.
Gross changes in birds infected experimentally with virulent ILTV
by the aerosol method consist of severe hemorrhagic laryngitis and
tracheitis by day 3 PI, with extension to the syrinx and bronchi by
day 4. A yellowish, diphtheritic membrane lining the trachea and
larynx is observed at about day 6 PI and may be found as a plug in
the laiynx and upper trachea by day 8. The tracheal exudate is
expelled by day 10. Gross lesions of the lungs and air sacs are
observed in some experimental chickens between days 3 and 7 PI
and occasionally for longer periods.
During the incubation stage in experimentally infected, susceptible
birds, isolated areas of epithelial hyperplasia appearing as giant cell
syncytia occur in the trachea and laiynx by 48 hr PI. Intranuclear
inclusion bodies are detectable in the syncytia. Necrotizing
tracheitis with sloughing of the epithelium in cell groups with
intranuclear inclusion bodies is seen by day 3 PI. Inclusions are
usually observed from 4 to 6 days PI. At 5 to 7 days PI, the lesion
progresses to extensive necrosis of the epithelium, and inclusions
are visible less often. In recovered birds, the epithelium regenerates
to normal appearance by day 12 (34). Pneumonitis and airsacculitis
are often present during the acute stage, and giant cell syncytia
containing intranuclear inclusion bodies are observed in the air sac
walls and lungs.
Cell Culture
Chick embryo liver (CEL) and chicken embryo kidney (CEK)
cells are suitable for isolation of ILTV (23). A chicken liver tumor
cell line, LMH, has also been used for propagation of ILTV (39).
Early cytopathic changes in the CEK cells after inoculation with
ILTV consist of the development of numerous multinucleate giant
cells that grow, coalesce, and finally undergo degeneration with
continued incubation. Large, basophilic (methanol-fixed and stained
by the May-Griinwald-Giemsa method), DNA-positive (fixed in
95
Chapter 21 Infectious Laryngotracheitis
Camoys solution and stained either by the Feulgen method or with
acridine orange) inclusion bodies in a few multinucleate giant cell
nuclei are observed 12 hr after infection. Degenerate and detached
cells are seen from 36 to 72 hr, and degeneration may be complete
by 72 hr PI. Adult chicken kidney culture, CEK cells, and the LMH
cell line have been used as a plaque system for quantitative assay of
ILTV. Plaques of 1 to 2 mm in diameter develop by 4 to 5 days PI
(35, 39).
AGENT IDENTIFICATION
Infectious laryngotracheitis (ILT) is routinely diagnosed by
histopathologic examination of tracheal lesions for the presence of
intranuclear inclusion bodies. In addition, viral particles exhibiting
typical herpesvirus morphology can be detected by negative
staining of suspensions from affected tissues or by direct
examination of ultrathin sections with electron microscopy. On
inoculated CAM the etiology is confirmed by histopathologic or
ultrastructural examination of the CAM lesions for intranuclear
inclusion bodies or viral particles with herpesvirus morphology.
Isolated viruses can be evaluated for pathogenicity in susceptible
hosts, for example, in chickens (development of clinical signs and
tracheal lesions), or for susceptibility of avian cell culture
(cytopathic effect and plaque formation).
A slide-smear technique for diagnosis of ILT has been described
(7). Smears from scrapings of laryngeal mucosa (or conjunctiva in
the case of conjunctivitis) are fixed for 3-5 min in absolute methyl
alcohol and stained with Giemsa (1 drop of stock per ml of distilled
water) for 2 hr at 37 C or overnight at room temperature. Stained
smears are washed in tap water and differentiated in absolute
methyl alcohol, using three to five quick dipping motions, until the
smear has a magenta cast. The smear is washed in tap water, air­
dried, and examined. Intranuclear inclusion bodies of ILTV are
detectable in the early acute stages of disease. Tracheal impression
smears stained by Giemsa in early stages of the disease also reveal
intranuclear inclusion bodies. The inclusions appear purple with a
pinkish cast and are surrounded by a halo. Inclusions can be
observed in conjunctival smears in cases with conjunctivitis.
Sevoian (38) described a quick method for diagnosis of ILT. This
method uses simultaneous fixation and dehydration and
demonstrates intranuclear inclusion bodies in less than 3 hr. In
another histologic diagnostic method tracheas and affected tissues
are embedded in wax medium for sectioning and satisfactory slides
are prepared in 3 hr (33).
Direct electron microscopy can be used to identify virions of
typical herpesvirus morphology in lysed cells from tracheal
scrapings of infected birds. Various serologic tests (e.g., FA,
immunoperoxidase [IP], and AGID), described later in the chapter,
can be used to detect the ILTV antigen in the specimen.
Fluorescent Antibody (FA)
The viral antigen can be detected by direct and indirect FA in
tracheal smears or frozen tracheal sections during the early acute
phase of the disease (2 to 8 days after exposure) 22). The FA test is
a useful rapid assay. Direct FA on smears of tracheal scrapings has
been evaluated on experimentally and naturally infected birds. On
naturally infected birds, viral antigens were detected from 2 to 14
days PI, while characteristic ILTV lesions were detected by
histopathological examination were detected from day 3 to 10 PI
(43). In naturally infected birds, FA and histopathological
examination were equally satisfactory in the detection of infected
birds (15).
Immunoperoxidase (IP)
An indirect IP method with monoclonal antibody has been used
for detection of ILTV antigen in frozen tracheal sections (17). In a
recent experimental study (2), IP was more sensitive than other
Deoki N. Tripathy and Maricarmen Garcia
diagnostic tests when histopathology, FA, IP, PCR, and
hybridization were compared.
Molecular Identification
Procedures for detection of ILTV DNA using dot-blot
hybridization assays with cloned ILTV DNA fragments labeled
with p32 or digoxigenin have been described (12, 26, 29). These
procedures demonstrated to be highly sensitive for detection of
ILTV in acutely affected and convalescent chickens when detection
was no longer possible by virus isolation. With the advent of
polymerase chain reaction (PCR) several viral nucleic acid
amplification procedures have been described (1, 4, 24, 40, 41, 44,
45). Some PCR have included the use of non-isotopically labeled
probes on membrane hybridization (1, 4), or an ELISA format, to
enzymatically detect the amplification products (40). Otherwise
amplification products are visualized by gel electrophoresis. Nested
PCR amplifications, with two sets of primers, have been utilized to
increase the sensitivity of detection of ILTV DNA (24).
Different samples have been evaluated for the detection of ILTV
DNA by PCR. For example, viral DNA has been successfully
amplified from ILTV infected cell culture supernatants (40),
tracheal scrapings (41, 45), tracheal swabs (44), conjunctival swabs
(4), turbinates, trigeminal ganglia (44), and from formalin-fixed,
paraffin embedded tracheal tissues (24).
The ability of PCR to detect ILTV infected birds has been
compared to other diagnostic assays in samples from experimentally
(2, 4) and naturally infected birds (45). In tracheas from
experimentally infected birds PCR was more effective than virus
isolation in the detection of ILTV, particularly during late stages of
infection when birds have recovered from clinical signs. In naturally
infected birds PCR detected viral DNA from tracheal samples that
contained bacteria and other viruses that prevented the isolation of
ILTV in cell culture (45). Molecular methods for differentiating
ILTV strains have been described. These include restriction
fragment length polymorphism (RFLP) analysis of the viral genome
(6, 16, 19, 27, 28), reciprocal DNA : DNA hybridization using
cloned DNA fragments (31, 42), and RFLP of PCR amplified
products (9, 10, 13, 14, 20). RFLP analysis of the viral genome
requires large amounts of purified viral DNA, reciprocal
hybridization protocols call for in-vitro radiolabelling of viral DNA.
Although these procedures are useful in epidemiological studies
they are cumbersome not practical for larger epidemiological
studies, and not feasible for the daily diagnostic routine. The use of
PCR based methods has greatly facilitated the molecular
differentiation of ILTV because pure viral DNA is not required, and
a large number of isolates from a single outbreak, or from different
geographical regions can be analyzed in a timely fashion.
Strain Variability
Naturally occurring strains of ILTV of variable pathogenicity have
been isolated from field outbreaks. However, not enough
information is available on their characterization. The DNA of
virulent and avirulent strains shows high homology by reciprocal
DNA-DNA hybridization (30, 42). However, some minor
differences can be detected by restriction endonuclease analysis
(27) and by PCR RFLP analysis (9, 11, 14, 42). A PCR-RFLP assay
developed by Clavijo and Nagy (9) allowed the differentiation of a
virulent LT isolate from a low less virulent Canadian isolate.
Australian vaccine and a pathogenic field strain were differentiated
by the identification of a 467 base pair insertion/deletion in the
ICP4 gene non-coding region (42). The 467 bp pair deletion present
in the Australian pathogenic field isolate was not detected in other
pathogenic field isolates from Taiwan (11). However, Taiwanese
isolates as well as isolates from England, Scotland, and the
Republic of Ireland were differentiated from vaccine strains by
PCR-RFLP analysis of the coding and non-coding ICP4 gene
96
sequences (10, 14). In these reports outbreak related isolates
collected before the use of vaccination were easily differentiated
from vaccines strains. However, outbreak related isolates obtained
after the implementation of vaccination were identical to the
currently utilized vaccines. A PCR-RFLP analysis of the viral
glycoprotein E (gE) gene demonstrated that different viral
subpopulations are present in the chicken embryo origin (CEO)
ILTV vaccine preparations. This assay permitted the identification
of vaccine related isolates in as the cause of outbreaks in the US
(13). Korean field isolates were differentiated from vaccine strains
by PCR-RFLP analysis of the glycoprotein G and thymidine kinase
(tk) genes (20). Although vaccine strains and field isolates from
different countries were differentiated successfully using different
PCR-RFLP none of the reported ILTV DNA differences between
vaccine and field isolates has been related to differences in strains
pathogenicity at this moment.
SEROLOGIC DETECTION IN THE HOST
Agar-Gel Immunodiffusion
Infectious laryngotracheitis virus antigen is prepared from infected
CAMs of embryonated eggs by homogenizing membranes that have
confluent lesions. Large tissue particles are removed by
centrifugation at 1600 x g, and the supernatant is used as an antigen.
Tracheal antigen is prepared from a bird that either died of ILT or
was euthanized within 1 wk of the onset of clinical signs. The
antigen consists of exudate collected from the lumen and walls of
the larynx, trachea, and extrapulmonary bronchi. If the exudate is
too dry, it is diluted with normal saline. Antigen prepared from
either the ILTV-infected CAM or the tracheal exudate is reacted
with specific antibody in plates prepared with 1.5% Noble agar and
8% sodium chloride in veronal buffer (pH 7.2). Sodium azide in 1%
concentration of thimerosal in 0.01% concentration is added as a
preservative. A line or lines of precipitation will develop between
the antigen and antibody wells after 24 to 48 hr of incubation at
room temperature if the concentration of antigen is adequate in the
tracheal exudate. Because the amount of precipitating antigen in the
tracheal exudate and the amount of live virus will vary with the
period of infection and from bird to bird, AGID should be
performed in combination with egg or cell culture inoculation (and
tests such as IP, FA, or PCR). A small amount of five virus present
in tracheal exudate will infect the CAM of embryonated eggs or cell
culture, whereas an inadequate concentration of precipitating
antigen will not form a line of precipitation with the antibody.
AGID also can be used to detect the antibody responses of
recovered birds by reacting the sera with known antigen prepared
from ILTV-infected cell cultures or CAM (25). A positive response
may occur in 25%-50% of the birds, and occasionally in over 80%.
The test is less sensitive than IP, ELISA, FA, and VN. However, it
still may be a useful test for detecting antibodies on a flock basis
(3).
Virus Neutralization
Infectious laryngotracheitis virus or ILTV antibody can be
identified by the VN test. Undiluted serum mixed with 10-fold virus
dilutions or serially diluted serum mixed with a single concentration
of virus is held at room temperature for 1^4 hr before inoculation of
9-to-12-day-old embryonated chicken eggs or CEK cell cultures.
Neutralizing antibody is detectable by 1 wk PI (21). A microassay
and neutralization test with CEK (35) and CEL cells (5) in
microcell culture trays can be used satisfactorily.
Enzyme-Linked Immunosorbent Assay
An ELISA tests has been developed to detect serum antibodies
against ILTV and is available commercially in United States and
Europe. Current ELISA tests utilize antigen prepared from either
infected CAM or infected cell cultures. Using antigen prepared

from either infected CAM or infected cell cultures can detect
antibodies in the sera of infected birds as early as 7 days PI (3). The
ELISA was shown to be more sensitive than VN in the detection of
ILTV serum antibodies (8). ELISA is an ideal test for survey
purposes particularly when it has been utilized to evaluate the
antibody response of vaccinated flocks (31, 36). Antigen capture
ELISA using ILTV polyclonal or monoclonal antibodies and then
detecting the capture antigen by enzyme-labeled antibodies has also
been utilized as a rapid diagnostic test to detect infected flocks (46).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Although acute signs of ILT, characterized by coughing, expulsion
of blood, and high mortality, can be suggestive of ILT, many signs
are similar to those of other respiratory diseases. The diphtheritic
form of fowlpox with lesions in the trachea may simulate signs of
ILT. Respiratory signs caused by mildly virulent strains of ILTV
may be indistinguishable from other respiratory infections, such as
mycoplasmosis and infectious bronchitis. Therefore tests such as
PCR, FA, IP become relevant confirmatory tests in the diagnosis of
ILTV.
REFERENCES
1. Abbas, F., J. R. Andreasen, Jr., and M W. Jackwood. Development of a
polymerase chain reaction and a nonradioactive DNA probe for infectious
laryngotracheitis virus. Avian Dis. 40:56-62. 1996.
2. Abbas, F., and J. R. Andreasen, Jr. Comparison of diagnostic tests for
infectious laryngotracheitis. Avian Dis. 40:290-295. 1996.
3. Adair, B. M, D. Todd, E. R. McKillop, and K. Bums. Comparison of
serological tests for detection of antibodies to infectious laryngotracheitis
virus. Avian Pathol. 14:461-469. 1985.
4. Alexander, H. S., and E. Nagy. Polymerase chain reaction to detect
infectious laryngotracheitis virus in conjunctival swabs from experimentally
infected chickens. Avian Dis. 41:646-653. 1997.
5. Andreasen J. R, J. Brown, J. R. Glisson and P. Villegas. Reprodicibility
of a virus-neutralization test for infectious laryngotracheitis virus. Avian
Dis. 34:185-192. 1989.
6. Andreasen, J. R., J. Glisson, Jr., and P. Villegas. Differentiation of
vaccine strains and Georgia field isolates of Laryngotracheitis virus by theis
restriction endonuclease. Avian Dis. 34:646-656. 1990.
7. Armstrong, W. H. A slide smear technique for the diagnosis of
laryngotracheitis. Avian Dis. 3:80-84. 1959.
8. Bauer, B.,J. E.Lohr and E. F. Kaleta. Comparison of commercial ELISA
test kits from Australia and the USA with the serum neutralization test in
cell cultures for the detection of antibodies to the infectious laryngotracheitis
virus of chickens. Avian Pathology. 28:65-72. 1999.
9. Clavijo, A., and E. Nagy. Differentiation of laryngotracheitis virus strains
by polymerase chain reaction. Avian Dis. 41:241-246. 1997.
10. Chang, P. C., Y. L. Lee, J. H. Shien, and Η. K. Shien. Rapid
differentiation of vaccine strains and field isolates of infectious
laryngotracheitis virus by restriction fragment length polymorphism of PCR
products. J. Virol. Methods. 66:179-186. 1997.
11. Chang, P. C.,H. K.Shieh, J. H. Shien, and S. W. Kang. A homopolymer
stretch composed of variable numbers of cytidine residues in the terminal
repeats of infectious laryngotracheitis virus. Avian Dis. 44:125-131.2000.
12. Fatunmbi, Ο. O., W. M Reed, D. L. Schwartz, and D. N. Tripathy. Dual
infection of chickens with pox and infectious laryngotracheitis (ILT)
confirmed with specific pox and ILT DNA dot-blot hybridization assays.
Avian Dis. 39:925-930. 1995.
13. Garcia, M, and S. M Riblet. Characterization of Infectious
laryngotracheitis virus (ILTV) vaccine strains and field isolates:
demonstration of viral sub-populations within vaccine preparations. Avian
Dis. 45:558-566. 2001.
14. Graham, D. A., I. E. Mclaren, V. Calvert, D. Torrens, and B. M
Meeham. RFLP analysis of recent Northern Ireland isolates of infectious
laryngotracheitis: comparison with vaccine virus and field isolates from
England, Scotland and Republic of Ireland. Avian Pathol. 29:57-62. 2000.
15. Goodwin, M. A, M A. Smeltzer, J. Brown, R. S. Resurreccion, and T.
G. Dickson. Comparison of histopathology to the direct immunofluorescent
antibody test for the diagnosis of infectious laryngotracheitis in chickens.
Avian Dis. 35:389-391. 1991.
97
Chapter 21 Infectious Laryngotracheitis
16. Guy, J. S., H. J. Bames, L. L. Munger, and L. Rose. Restriction
endonuclease analysis of infectious laryngotracheitis viruses: Comparison of
modified-live vaccine viruses and North Carolina field isolates. Avian Dis.
33:316-323.1989.
17. Guy, J. S., H. J. Bames, and L. G. Smith. Rapid diagnosis of infectious
laryngotracheitis using a monoclonal antibody-based immunoperoxidase
procedure. Avian Path. 21:77-86. 1992.
18. Guy, J. S. and T. J. Bagust. Laryngotracheitis. In: Diseases of Poultry,
11th ed. Y. M Saif, ed. Iowa State University Press, Ames, Iowa. pp. 121-
134.2003.
19. Han, M G. and S. J. Kim. Comparison of virulence and restriction
endonuclease cleavage patterns of infectious laryngotracheitis virus isolated
in Korea. Avian Pathol. 30: 337 -344. 2001a.
20. Han, M G., and S. J. Kim. Analysis of Korean strains of infectious
larymgotracheitis virus by nucleotide sequences and restriction fragment
length polymorphism. Veterinary Microbiol. 83:321 - 331. 2001b.
21. Hitchner, S. B., C. A. Shea, and P. G. White. Studies on a serum
neutralization test for the diagnosis of laryngotracheitis in chickens. Avian
Dis. 2:258-269. 1958.
22. Hitchner, S. B., J. Fabricant, and T. J. Bagust. A fluorescent-antibody
study of the pathogenesis of infectious laryngotracheitis. Avian Dis. 21:185—
194. 1977.
23. Hughes, C. S., and R. C. Jones. Comparison of cultural methods for
primary isolation of infectious laryngotracheitis virus from field material.
Avian Pathol. 17:295-303. 1988.
24. Humberd, J., Riblet, S., Resurreccion, R.S., Brown, T.P., and Garcia, M.
Detection of infectious laryngotracheitis in formalin-fixed, paraffin
embedded tissues by nested-PCR Avian Dis. 46: 64-74. 2002.
25. Jordan, F. T. W., and R. C. Chubb. The agar gel diffusion technique in
the diagnosis of infectious laryngotracheitis (ILT) and its differentiation
from fowlpox. Res. Vet. Sci. 3:245-255. 1962.
26. Keam L, York JJ, Sheppard M, Fahey KJ.Detection of infectious
laryngotracheitis virus in chickens using a non-radioactive DNA probe.
Avian Dis.35:257-262. 1991.
27. Keeler, C. L., Jr., J. W. Hazel, J. E. Hastings, and J. K. Rosenberger.
Restriction endonuclease analysis of Delmarva field isolates of infectious
laryngotracheitis virus. Avian Dis. 37:418-426. 1993.
28. Keller, L. H., C. E. Benson, S. Davison, andR. J. Eckroade. Differences
among restriction endonuclease DNA fingerprints of Pennsylvania field
isolates, vaccine strains, and challenge strains of Infectious laryngotracheitis
virus. Avian Dis. 36:575-581. 1992.
29. Key, D. W., C. B. Gough, J. B. Derbyshire, and E. Nagy. Development
and evaluation of a non-isotopically labeled DNA probe for the diagnosis of
infectious laryngotracheitis. Avian Dis. 38:467-474. 1994.
30. Kotiw M, Sheppard M, May JT, Wilks CR. Differentiation between
virulent and avirulent strains of infectious laryngotracheitis virus by
DNA: DNA hybridization using a cloned DNA marker. Vet Microbiol.
11(4):319-30. 1986
31. Leong, V.Y., J. R. Glisson, R. S. Resurreccion, and I-H. N. Cheng.
Infectious laryngotracheitis virus in commercial hens: A serological study
based on enzyme - linked immunosorbent assay. Avian Dis.38:304 - 307.
1994.
32. Linares, J. A., A. A. Bickford, G. L. Cooper, B. R. Charlton, and P. R.
Woolcock. An of infectious laryngotracheitis virus in California broilers.
Avian Dis. 38:188-192. 1994.
33. Pirozok, R. P., C. F. Helmboldt, and E. L. Juhgherr. A rapid histological
technique for the diagnosis of infectious avian laryngotracheitis. J. Am. Vet.
Med. Assoc. 130:406-407. 1957.
34. Purcell, D. A. Histopathology of infectious laryngotracheitis in fowl
infected by an aerosol. J. Comp. Pathol. 81:421^131. 1971.
35. Robertson, G. M, and J. R. Egerton. Micro-assay systems for infectious
laryngotracheitis virus. Avian Dis. 21:133-135. 1977.
36. Sander, J. E. and S. G. Thayer. Evaluation of ELISA titers to infectious
laryngotracheitis. Avian Dis. 41:429-432.1997.
37. Sellers, H. S., M Garcia, J. R. Glisson, T. P. Brown, J. S. Sander, and J.
S. Guy. Mild infectious laryngotracheitis in broilers in the Southeast. Avian
Dis. 48:430-436.2004.
38. Sevoian, M A. A quick method for the diagnosis of avian pox and
infectious laryngotracheitis. Avian Dis. 4:474-476. 1960.
39. Schnitzlein, W. M, J. Radzevicius, and D. N. Tripathy. Propagation of
infectious laryngotracheitis virus in avian liver cell line. Avian Dis. 38:211—
217. 1994.
40. Shirley MW, Kemp DJ, Sheppard M, Fahey KJ. Detection of DNA
from infectious laryngotracheitis virus by colourimetric analyses of
polymerase chain reactions. J Virol Methods. 30(3):251 -9. 1990.
Deoki N. Tnpathy and Maricarmen Garcia
41. Sholz E., Porter RE. & Guo P. 1994. Differential diagnosis of
infectious laryngotracheitis from other avian respiratory disease by a
simplified PCR procedure. J. Virol. Meth. 50:313-322. 1994
42. Trist, Η. M, S. G. Tyack, M A. Johnson, C. T. Prideaux, and M
Sheppard. Comparison of the genomic short regions of a vaccine strain (SA-
2) and a virulent strain (CSW-1) of infectious laryngotracheitis virus (Gallid
Herpesvirus 1). Avian Dis. 40:130-139.1996.
43. Wilks, C. R. and Kogan, V. G. An immunofluorescence diagnostic test
for avian infectious laryngotracheitis. Aus. Vet. Journal. 55:385 - 388. 1979.
98
44. Williams, R A, M Bennett, J. M. Bradbury, R. M Gaskell, R C.
Jones, and F. T.W. Jordan. Demonstration of sites of latency of infectious
laryngotracheitis virus using the polymerase chain reaction. J. Gen Virol.
73:2415-2420.1992.
45. Williams, R. A., C. E. Savage, and R. C. Jones. A comparison of direct
electron microscopy, virus isolataion and a DNA amplification method for the
detection of avian infectious laryngotracheitis virus in fiels material. Avian
Pathol. 23:709-720. 1994.
46. York, J. J., and K. J. Fahey. Diagnosis of infectious laryngotracheitis
using a monocloal antibody ELISA. Avian Pathol. 17:173-182. 1988.
 22
MAREK’S DISEASE
Patricia S. Wakenell and Jagdev M. Sharma

SUMMARY. Marek’s Disease (MD) is a herpesvirus-induced neoplastic disease of chickens. Because MD virus (MDV) is ubiquitous and
chickens acquire environmental infection early in life, they must be protected by vaccination in the hatchery. Diagnosis of infection versus
diagnosis of disease is critical as most birds are infected without developing clinical disease. The molecular structure of MDV has been
extensively examined. The virus has three serotypes, serotypes 1, 2, and 3. Among these, only viruses of serotype 1 have pathogenic
potential. MDV isolates can be categorized by serotype-specific monoclonal antibodies. Exposure to MDV results in persistent infection that
lasts for the life of the bird. Infected birds develop viremia as well as antibodies against the virus. Although initially the virus causes a lytic
infection in lymphoid cells, the virus persists in the birds by establishing a long-term latent infection of lymphocytes. Latently infected cells
minimally express viral antigens. Some latently infected cells may undergo transformation and induce tumors. Thus, MD outbreaks are
characterized by development of lymphoid tumors in viscera, skin, and nervous system. MD outbreaks may be associated with mortality,
immunosuppression, or excessive condemnation of carcasses during processing. Commercial chicken flocks can experience MD outbreaks at
any age. A number of vaccines are available to control MD in the field. These vaccines consist of serotype 1 (attenuated), 2, or 3 viruses
administered singly or in combination. Herpes virus of turkeys (HVT), a serotype 3 virus once used as a monovalent vaccine against MD, is
now usually mixed with serotype 1 and 2 viruses. Most commercial broiler chickens in the US receive MD vaccines by in ovo technology, in
which the vaccine is mechanically injected into eggs at embryonation day 18.
Agent Identification. Because most commercial chickens with or without MD have circulating MDV, mere virus isolation or detection of
antibody is not helpful in establishing a firm diagnosis. History of the flock, vaccination protocols, the nature of lesions, viral load,
expression of viral antigens, and the identity of the cells constituting tumors must be carefully considered.
A number of virus isolation strategies are available. Virus isolation in cell cultures is preferred. Because MDV is highly cell-associated,
viable cells removed from the tissues or tumors of infected chickens are generally co-cultivated with susceptible monolayer cells to isolate
the virus. Upon co-cultivation, the latently infected cells transmit the infection to permissive cells and induce herpesvirus-type cytopathology.
The specificity of the cytopathic effect can be confirmed by staining the cell culture monolayers by the immunofluorescence test using anti-
MDV antibodies. A number of molecular techniques have been used to identify viral genome in tissues. These include polymerase chain
reaction, dot-blot hybridization, and in situ hybridization. Assessment of MD viral load in tumors by quantitative PCR and expression of meq
on tumor cell surfaces are promising techniques for confirmation of MDV as the causative agent.
Serologic Detection in the Host. The serologic tests that can identify anti-MDV antibodies include immunofluorescence,
immunohistochemistry, enzyme-linked immunosorbent assay, the agar gel preciptin test, and virus neutralization test.

INTRODUCTION
Marek’s disease (MD) is important primarily in chickens, to a
much lesser degree in quail, and has been rarely observed in
turkeys, pheasants and jungle fowl. Turkeys and other species have
limited susceptibility. Attempts to infect mammals with MD virus
(MDV) have uniformly failed. The disease is caused by a
widespread, highly contagious, cell-associated, oncogenic
herpesvirus. In susceptible chickens, exposure to pathogenic MDV
may result in a progressive, debilitating disease that may result in
high mortality, reduced egg production, and immunosuppression.
The disease most commonly occurs in young, sexually immature
chickens 2-7 mo old, but can occur at virtually any age beyond 3
wk. Most commercial flocks are routinely vaccinated against MD.
Monovalent or multivalent vaccines are used. Although extensive
use of vaccines has greatly reduced the incidence of disease
outbreaks compared to the pre-vaccination era, MD occasionally
occurs in the presence of vaccine use. Many outbreaks in recent
years have been caused by highly virulent strains of the virus that
emerged from less virulent predecessors. MDV vaccines protect
against the disease but not against infection with the virus. Upon
exposure to MDV, vaccinated or unvaccinated chickens become
carriers of the virus and persistently shed MDV into the
environment, thus making eradication difficult. MDV is not
transmitted vertically. The disease occurs throughout the world and
virtually all flocks are exposed to the causative virus.
CLINICAL DISEASE
Clinical signs occur in chickens affected with MD but are of little
help in establishing a diagnosis. The disease is characterized by
proliferation of lymphoid cells in various tissues and organs,
including peripheral nerves. Birds with visceral tumors are
depressed and often cachectic prior to death. Birds with lymphoid
infiltration of peripheral nerves may demonstrate asymmetric partial
99
paralysis and/or dilation of the crop due to vagus nerve paralysis.
Affected nerves appear edematous, grayish and devoid of cross
striations. Blindness is associated with lymphoid infiltration of the
iris. Microscopically, MD lesions are composed of an infiltration by
a heterogenous population of mononuclear cells.
SAMPLE COLLECTION
Since MDV is ubiquitous among chickens, mere demonstration of
the virus or antibody cannot be considered pathognomonic for the
cause of death or of an eportnic. The disease itself is not ubiquitous
and differentiation from other agents causing lymphoid tumors can
be problematic (19, 46, 51). For a positive diagnosis of MD in a
flock, one must consider the history of the flock and the presence of
characteristic gross and microscopic lesions in clinically sick and
dead chickens (52).
If virus isolation is attempted from commercial chickens raised
under field conditions, several MDV types may be isolated.
Chickens acquire infection with these viruses through live vaccines
or through environmental exposure. The isolated viruses may
include herpesvirus of turkeys (HVT, designated serotype 3 MDV)
or serotype 1 or 2 MDV. Optimum sources are the same for
isolation of HVT as for isolation of MDV. Most suitable for virus
isolation are blood and cellular suspensions of spleen or tumor
tissue.
Isolation from Blood
Blood is preferred for virus isolations when euthanasia of the bird
is not permitted. In susceptible chickens inoculated experimentally
at 1 day of age, viremia peaks at about 4 wk, and most chickens
remain persistently viremic for life (52). Infectivity in the blood is
associated with the leukocyte (lymphocyte) fraction. The test
sample consists of 0.2 ml of whole blood or 2 x 106 buffy-coat cells
suspended in cell-culture medium. The buffy-coat cells are the
preferred sample.
Patricia S. Wakenell and Jagdev M Sharma
Isolation from Tumors
Solid tumor, spleen, kidney, or other tissues are removed
aseptically, minced with scissors, washed several times with
phosphate-buffered saline (PBS) until reasonably clear of
erythrocytes, and then trypsinized once or twice to obtain single-cell
suspensions. The cells are pelleted by centrifugation, resuspended in
either PBS or cell-culture medium, and adjusted to give 2 x 106
cells per 0.2 ml.
For best results, the cellular preparations should be used
immediately after they are processed. If storage is required, the
following method is recommended: leukocytes or tissue cells
suspended at 2 x 107 cells/ml in cell-culture medium containing ΙΟ­
Ι 5% dimethyl sulfoxide (DMSO) and 15-25% bovine fetal serum
are dispensed in 1 ml amounts in glass or plastic cryovials. The
ampules are heavily insulated with paper towels and/or placed in a
Styrofoam container and stored overnight at -70 C. Ampules are
then rapidly, to avoid any thawing, transferred to storage in liquid
nitrogen. Cellular suspensions prepared as above can be held at
-196 C indefinitely without loss of viability. At the time of use, the
ampules are removed from the liquid nitrogen and quickly (< 2 min)
thawed in tepid water. The ampules are placed on wet ice and used
immediately. For shipping, ampules must be transferred to either
liquid nitrogen dewers (preferred) or dry ice without any thawing at
any stage of shipment or packaging.
Isolation of Cell-Free Virus
This procedure is not routine. However, for special purposes (e.g.,
the serum-neutralization test or cloning the virus by plaque
purification in cell cultures), cell-free MDV can be extracted from
feather tips or skin of infected chickens. For skin preparations,
feathers are clipped off at the surface of major feather tracts, skin
strips are removed, minced with scissors, and suspended in sucrose-
phosphate-glutamine albumin (SGPA) buffer containing sodium
ethylenediamintetraacetate (EDTA).
A 1:5 or 1:10 (w/v) suspension of skin strips in SGPA-EDTA
buffer is homogenized for 3-5 min and then sonicated for 2 min
(four bursts of 30 sec each) with an ultrasonic oscillator with the
needle probe set at an intensity of 70 on the meter. The resulting
suspension is centrifuged at 650 x g, and the supernatant is saved as
a source of cell-free virus (9). This preparation can be filtered
through a 0.45 mm filter pretreated with bovine fetal serum.
Cell-free virus can also be isolated from feather tips. Feathers are
pulled from all major feather tracts, and 3-5 mm parts of the tips are
cut with scissors, diluted 1:5 (w/v) with SPGA-EDTA buffer, and
sonicated for 2-3 min. The suspension is cleared by centrifugation
and tested for cell-free virus either with or without filtration through
a 0.45 mm filter.
Cell-free virus preparations should be stored at -70 C in glass or
plastic cryovials. For shipment, ampules should be packed in dry
ice.
Table 22.1: Sucrose-phosphate-glutamine-albumin buffer containing
sodium ethylene diaminetetraacetic acid (EDTA) for extraction and titration
of cell-free Marek’s disease virus. The buffer is sterilized by filtration and
has a pH of about 6.5
Reagents Concentration Weight
Sucrose 0.2180 M 7.462 g
Monopotassium phosphate 0.0038 M 0.052 g
Dipotassium phosphate 0.0072M 0.125 g
L-Monosodium glutamate 0.0049 M 0.083 g
Bovine albumin powder 1.0% 1.000 g
EDTA 0.2% 0.200 g
Distilled H20 qs adA 100 ml
A qs ad = sufficient quantity to make
100
Samples for Antibody
Either serum or plasma can be used. Samples are stored and
shipped at -20 C. Sera can be shipped at room temperature if a
preservative (e.g. merthiolate, benzalkonium chloride or
chloroform) is added to prevent bacterial growth.
PREFERRED CULTURE MEDIA AND SUBSTRATES
The best and most widely used substrate for virus isolation is
permissive cell cultures. In cell cultures, MDV produces cytopathic
effects (CPEs) typical of herpesviruses. Although serotypes 1, 2,
and 3 produce herpesvirus-type CPEs, it is possible to differentiate
between serotypes by staining CPE-bearing cell cultures with
serotype-specific monoclonal antibodies using an indirect
immunofluorescence test (26). An experienced eye may also be able
to differentiate the morphogenic characteristics of the plaques
induced by each serotype. Serial passages of individual isolated
plaques picked from an agar-overlaid culture containing a mixture
of viruses may be used to prepare stocks of single serotypes. Virus
can be isolated by inoculating test materials into embryonating
chicken eggs. Isolation of virus by inoculation of susceptible
chickens is cumbersome and not commonly done, although the
identity of virus isolated in cell cultures or embryos can be
confirmed by reproducing typical disease in chickens.
Cell Culture
Cell-Associated Virus. Although cell-associated MDV propagates
in most avian cell cultures tested, chicken kidney (CK) cells,
chicken embryo fibroblasts (CEFs) and duck embryo fibroblasts
(DEFs) are the most commonly used. Most classical isolates of
serotype 1 MDV replicate poorly or become inconsistent in biologic
characteristics when cultivated in CEFs (35). Thus CEFs are
generally considered unsuitable for primary virus isolation or
propagation for challenge of these viruses. Serotype 2 and 3 viruses
grow readily in CEF. Serotype 1 viruses, passed first in susceptible
cells, also adapt to grow in CEF. A cellular suspension (0.2 ml
containing 2 x 106 cells) is inoculated onto each monolayer culture
of 24-hr primary CK cells or secondary CEF or DEF, grown in 15 x
60 mm plastic tissue culture plates. CEF and DEF cultures can be
maintained in flasks or roller bottles as well. However, CK
maintenance for 5-6 days in flasks or roller bottles is difficult. The
cultures are incubated at 37-38 C in a humidified atmosphere
containing 3-5% CO2. The culture medium is first renewed 24 hr
post-inoculation (PI) and then on alternate days. For serotype 1, foci
of CPEs, usually termed plaques, are counted under a light
microscope 4-8 days PI in CK cells and 10-14 days PI in DEFs.
Direct culture of kidney cells from infected chickens can be done
(53). However, kidney cells from older birds may not culture well
due to cellular age. Kidney cells from older birds can be used to
infect CK monolayers as described.
Cell-Free Virus. Cell-free serotype 1 MDV propagates best in
primary CK cell cultures. DEF and CEF are less susceptible than
are CK cells.
Virus is diluted in SPGA-EDTA buffer (Table 1). The SPGA-
EDTA buffer enhances the virus titer several fold over that with a
standard diluent such as PBS.
Primary CK cultures, 24-48 hr old, are drained and inoculated with
the virus dilutions, two cultures per dilution using 0.2 ml of
inoculum per culture. After 30 min of adsorption at 37 C, the
medium is added to the cultures. Thereafter, the medium is changed
at 48 hr intervals. Because the virus suspension contains EDTA, a
chelating agent, the inoculated cells tend to detach from the dish
during adsorption. Upon addition of fresh medium, however, the
cells resettle and estabfish monolayers. Plaques are counted under
the light microscope 6-8 days PI, and the number of plaque-forming
units (PFU) per milliliter of virus is calculated.

Chicken Embryo Inoculation
Cell-Associated Virus. Primary virus isolation can be done also by
inoculating test material into the yolk sac of 4-day-old
embiyonating chicken eggs (45) or intravenously in 10 to 11-day-
old embryos. This procedure is rarely used. Virus isolation in cell
cultures is preferred. Inoculated and uninoculated control eggs are
incubated at 37 C and candled daily. Embryos dying within 24 hr of
inoculation are discarded, and those dying thereafter are examined
for pocks on the chorioallantoic membrane (CAM). When the
embryos are 18 days old, the test is ended by chilling the eggs
overnight at 4 C. Positive isolations are characterized by the
appearance of pocks on the CAM. One disadvantage of primary
virus isolation in embryos is that lymphoid cells present in virus-
free inocula may also occasionally produce pocks on the CAM (5).
Futhermore, adaptation of MDV to cell cultures by serial passages
reduces the pock response by embryos (38).
Cell-Free Virus. Inoculum is deposited in the CAM of 9 to 12-
day-old embryonating eggs, and the CAM is examined for pocks 7
days PI. Cell-free virus can be inoculated intravenously into 10 to
11-day-old embryos (0.1 ml per embryo), and the CAM is examined
for pocks 5 days later.
Chicken Inoculation
A 0.2 ml test inoculum containing cell-associated or cell-free virus
is injected intra-abdominally in 1 to 5-day-old chicks of a
susceptible genetic line lacking maternal antibodies to MDV or
HVT. The chickens are raised in an isolation environment until they
are 6-8 wk old (50, 53). Because MDV is ubiquitous and highly
contagious, strict isolation must be maintained to prevent exposure
to extraneous virus. Chickens that die before the end of the study
should be necropsied, and if gross lesions are absent, sections of
nerves (vagus nerves and brachial and sciatic plexuses and nerves),
gonads, spleen, kidney, liver and heart should be fixed in 10%
neutral buffered formalin and hematoxylin and eosin stained
sections examined for histologic changes (30). At the end of the
study, survivors are bled for serum and examined for gross and
microscopic pathology. Polymerase chain reaction (PCR) can also
be performed on tumor and spleen (2,3,4,21,40,55). Antibody can
be tested by the agar-gel precipitin (AGP) test, immunofluorescent
(IF) test, or ELISA. Groups of chickens infected with the virus
develop lesions or antibody or both. Certain highly virulent strains
may cause a high incidence of mortality within the first week of
infection (49,50). This early mortality is associated with extreme
lymphoid cell depletion.
AGENT IDENTIFICATION
Physiochemical and Molecular Characteristics of MDV. MDV
is ether-sensitive, contains DNA, and belongs to the herpesvirus
group (52). The nuclear capsid is 90-100 nm in diameter and
contains 162 capsomeres arranged in an icosahedral symmetry. The
DNA of MDV is similar for all 3 serotypes and is a buoyant density
of 1.705 g/ml. The guanine plus cytosine content is different
amongst the 3 serotypes ranging from 43.9-53.6% for serotypes 1
and 2 and 47.6% for serotype 3.MDV remains highly cell-
associated in vitro, and transfer of infection from one culture to
another depends on the use of viable infected cells. Destruction of
cell viability generally results in the loss of infectivity. However,
small amounts of cell-free virus can be extracted from cell cultures
by SPGA buffer (9).
Cell-free MDV obtained from extracts of skin or feather pulp
retains its titer for several months at -60 C but not at -20 C. Virus is
inactivated in 2 wk at 4 C, in 4 days at 22-25 C, in 18 hrs at 37 C, in
30 min at 56 C, and in 10 min at 60 C. The virus can withstand at
least four freeze-thaw cycles and 10 min of ultrasonic vibration. A
pH of lower than 4 or higher than 10 readily inactivates the virus.
101
Chapter 22 Marek’s Disease
The molecular structure of MDV has been examined extensively.
The viral DNA for molecular analysis can be obtained by extraction
total cell DNA from cell cultures exhibiting extensive viral CPEi,
feather tips, feather follicle epithelium (FFE), lymphoid tissues aid
brain. Separating virus-specific from cellular DNA can be difficult
because the densities of viral and cellular DNA are similar. Many
methods are used but pulse field electrophoresis is recommended
(48). Cloning of MDV in bacterial artificial chromosomes (BAC)
can generate larger amounts of MDV DNA (36). It has been
suggested that viral DNA is integrated in the host DNA at multiple
sites in chromosomes and the integration pattern varies in different
cell lines derived from in vivo MDV-induced tumors (16,24). The
complete sequence has been obtained for the 3 serotypes
(1,23,41,44). The genome consists of long and short unique regions
flanked by terminal repeats (52). Endonuclease digestion patterns
differ substantially between the three serotypes (41). Cross
hybridization of DNA among the three serotypes under less
stringent conditions has shown that these viruses have a collinear
relationship. The three types of viruses share significant homology
at the DNA level and the structure of some of die dominant genes
such as gB, gC, gD, and gH is quite similar within all serotypes
(1,23,41,44). There are few structural differences between serotype
1 pathotypes (41).
All three serotypes of MDV can cause latent infection in cells but
only unattenuated serotype 1 MDV has oncogenic potential.
Latently infected cells have limited or no production of virus and
have fewer than 5 copies of the viral genome per cell. This number
may increase to 15 copies when the cell undergoes neoplastic
transformation (20). Viral DNA of transformed cells is highly
methylated. Although the molecular basis of oncogenic
transformation by MDV is not clear, the gene meq, containing a
basic leucine zipper resembling the jun/fos oncogene family, is a
strong candidate (25). Some of the transformed cells express meq
which can assist in the diagnosis of MDV-induced lymphomas
(19,24). The region containing 132 base pair tandem repeats flanks
the unique long portion of the virus genome. This region is
important because the number of copies of 132 base pair repeats
increases following cell culture attenuation of serotype 1 viruses,
and thus can be used as a marker for reduced oncogenicity (40).
Identification by Inoculation in Cell Cultures, Chickens, or
Embryonating Eggs. MDV may be identified by inoculating the
test sample in avian cultures (preferably CK cells or DEFs), 1-day-
old susceptible chicks, or 9 to 12 day-old embryonating chicken
eggs. Positive samples will induce herpesvirus-type CPE in cell
cultures, MD in chickens, and pocks on the CAM of eggs.
Nonpathogenic isolates of MDV, such as serotypes 2 or attenuated
serotype 1, will not induce clinical MD in chickens, although the
chickens will develop specific antibodies.
In cell cultures, MDV produces CPE characteristic of
herpesviruses. The CPEs are sensitive to inhibitors of DNA
synthesis such as 5’-iodo-2’-deoxyuridine (IDU). Within 3-5 days
of inoculation of monolayer cell cultures with MDV, plaques of
CPE appear. These consist of collections of rounded refractile cells.
With continued incubation, each plaque grows by including
additional refractile cells at its periphery. In Giemsa stained
preparations, the refractile cells appear as small or large
polykaryocytes. Intranuclear inclusions (Cowdry type A) are readily
seen in the areas of CPEs. MDV adapted to grow in cell cultures by
serial passage produces large plaques that often develop clear areas
(holes) in the center.
The morphology of CPE may also vary with the type of cell
culture. For instance, in DEF cultures, a focus of CPEs consist of
round as well as fusiform cells. In CK cell cultures, fusiform cells
are rare. The serotype of the CPE inducing virus can be confirmed
by staining infected cultures by the IF test using serotype specific
monoclonal antibodies.
Patricia S. Wakenell and Jagdev M. Sharma
Samples containing oncogenic serotype 1 MDV and HVT may not
induce MD in chickens because of the protective effect of HVT. To
identify MDV in such samples, inoculated chickens should be
maintained in direct contact with uninoculated hatchmates. If
oncogenic serotype 1 MDV is present, the contact exposed chickens
will not be protected against MD by this virus. If the test samples
contain serotype 1 and serotype 2 MDV, neither the inoculated
chickens nor the contact exposed chickens will develop MD,
although both groups of chickens will develop anti-MDV antibody
and persistent viremia with both serotypes.
Several pathotypes of serotype 1 MDV have been isolated from
chicken flocks. Periodically, highly virulent isolates of serotype 1
virus have emerged that have increasingly resisted protection by
conventional vaccines. Thus, serotype 1 MDV isolates recovered
from field flocks may vary greatly in virulence. The isolates may be
mildly virulent (mMDV), virulent (vMDV), very virulent
(wMDV), or very very virulent (w+MDV) (49). These pathotypes
can be differentiated by chick inoculation (50,51) although the
process is very tedious and should be attempted only by well
equipped laboratories proficient in tissue culture techniques and
having good animal isolation facilities. Briefly, the virus is first
isolated from the test sample in cell cultures. The isolated virus is
cloned into a population that contains pure serotype 1 virus without
detectable contamination with other serotypes of MDV or other
common viruses that may have been present in the test sample. It is
imperative that the test sample is free of extraneous viruses that
might influence the behavior of the test sample (50,51). The
pathotype of the isolated virus is determined by inoculation in
chickens that are either unvaccinated or have been immunized with
monovalent HVT, bivalent HVT + SB-1 (serotype 2 MDV) or
Rispens (attenuated serotype 1) vaccines. All pathotypes cause
clinical MD in unvaccinated chickens with the exception of certain
highly inbred resistant lines. mMDV is protected by HVT, w
MDV is protected by HVT/SB-1 and w+MDV is fairly well
protected by Rispens.
Direct Demonstration of Viral Antigens in Tissues. Viral
antigens can be detected only in tissues that are productively
infected with MDV. The FA test using monoclonal or polyclonal
ant-MDV antibodies may be used. Fresh tissues are frozen at -70 C
or -196 C and cut at 6-8gm thickness in a freezing microtome. At
the time of staining, tissue sections are thawed, mounted on glass
microscope slides, and stained by the direct or indirect FA test.
Viral antigen in the feather follicles may also be detected by
reacting feather pulp with anti-MDV polyclonal antibody in an
AGP test.
The immunohistochemistry (IHC) test using an avidin-biotin-
peroxidase complex (Vecta-stain ABC kit, Vector Laboratories,
Burlingame, CA) has been done to detect meq, CD30, MATSA,
p53, pp38 and methyl-3-cytosine in tumors (19). Expression of meq
was considered specific for MD lymphomas. Briefly, the IHC
staining of meq and CD30 were amplified with the tyramide signal
reaction using the TSA Biotin System Kit (PerkinElmer Life
Science, Boston, MA). The monoclonal antibody (mAb) for meq
(27) was used at a dilution of 1:1000, mAb for pp38 (Hl9.47, 14)
was used at a 1:3200 dilution, mAb for AV37, specific for chicken
CD30 (7) was used at a dilution of 1:25, the mAb for MATSA
(14B367 Lee, unpublished data) was used at 1:2000, the mAb for
methyl-3-cytosine (WWR International Oncogene Research
Product, San Diego, CA) was used at 1:25 and the mAb for p53 is
specific for mouse p53 but cross reacts with chicken p53 (Pab 240,
18) was used at a dilution of 1:25.
Molecular procedures can be used to detect the presence of viral
DNA in tissues or cells in which viral antigens are not expressed.
Dot-blot and in situ hybridization have been used to detect viral
antigen in feather tip extracts and to localize viral antigens in
tissues, respectively (15,17,22).
102
Virus Detection by Molecular Techniques. These procedures are
not routinely used for diagnosis of MD but have recently become
popular research tools. Polymerase chain reaction (PCR) technology
can be used to identify viral nucleic acid in productively and
latently infected cells as well as in cells from lymphomas. The most
commonly used primers amplify the 132 base pair repeat sequences
(4,21,40,55), although primers to amplify other regions of the
genome may also be used (4,19,21). The 132 base pair repeat
primers can detect virulent or attenuated serotype 1 MDV.
Quantitative PCR has been used to detect MDV in latently infected
birds (6,33). Real-time PCR has been used to quantify MDV in
tumors (19). Briefly, DNA was extracted from tumors using a
Puragene DNA Isolation kit (Gentra System, Minneapolis, MN).
Samples were amplified using primers for glycoprotein B (gB) and
glyceraldehydes-3-phosphate dehydrogenase (GAPDH). The
GeneAmp 5700 (Applied Biosystems, Foster City, CA) was used to
amplify the samples in a 25 μΐ PCR reaction containing 50 ng DNA,
0.2pm of each primer and SYBR green master mix (Applied
Biosystem, Warrington, UK). The reaction was cycled 40 times.
The threshold cycle was determined for each PCR reaction by
establishing a fixed threshold. The relative number of copies of gB
was compared to that of GAPDH, the reference control (19). High
loads of MDV DNA in tumors were considered diagnostic of MDV
as the causative agent.
Strain Variability
Numerous isolates of MDV have been described. Serologically,
MDV isolates can be differentiated into sefbtypes 1 and 2. Serotype
1 contains pathogenic isolates and their attenuated forms, and
serotype 2 contains apathogenic isolates. Serotype 1 isolates have
been differentiated primarily on the basis of pathogenicity for
chickens. Thus, they fall into one of four general categories:
mMDV, vMDV, wMDV, or w+MDV. Although isolates of
serotypes 1 and 2 cross-react, isolates within each serotype have
stronger serologic cross-reactions than the isolates between the two
serotypes. Highly virulent isolates of MDV (wMDV or w+MDV)
are of interest because HVT is not an effective vaccine against these
isolates, and bivalent vaccines containing HVT and serotype 2
MDV, certain attenuated serotype 1 vaccines or trivalent vaccines
containing HVT along with serotypes 1 and 2 MDV must be used to
protect flocks. Diagnosis of infection with wMDV in a flock is a
complicated process that has been detailed previously (50). Using
real-time reverse transcriptase PCR (54) and/or quantitative PCR to
determine viral load (19) show promise for differentiation of
pathotypes. Although expansions of the 132 base pair repeat have
indicted attenuation, these are not related to virulence (42).
Mutations in genes such as meq (10) and the terminal and internal
repeat long regions of MDV may also contribute to differences in
virulence (43).
Characteristics of Vaccine Strains
Although HVT was once the most commonly used vaccine against
MD, many flocks now receive bivalent or trivalent vaccines.
Bivalent vaccines contain HVT and a serotype 2 MDV (e.g., SB-1),
whereas trivalent vaccines may contain HVT, attenuated serotype 1
MDV (e.g., CV1988), and serotype 2 MDV (e.g., SB-1). In some
parts of the world, serotype 1 MDV is used alone as an effective
vaccine against MD.
Recombinant MD vaccines have been developed that are quite
similar to HVT/SB-1 in protecting chickens against virulent MDV.
The recombinants have been constructed by inserting immunogenic
genes of MDV, particularly gB, in fowlpox virus or HVT (28,34).
Recombinant vaccines containing immunogenic genes from
multiple disease agents such as MDV and Newcastle disease virus
have also been developed (32).
Upon vaccination, chickens remain asymptomatic, although they
develop persistent viremia with all viruses present in the vaccine.

Vaccinated chickens become resistant to tumor formation by
virulent MDV but not to infection with MDV. Thus, the vaccinated
chickens become persistently viremic with the vaccine virus(es) as
well as field MDV and can shed virulent MDV, although at a
reduced rate. The best way to ascertain that the flock has been
properly vaccinated against MD is to isolate the vaccine virus(es)
from vaccinated chickens, HVT replicates readily in avian cell
cultures (8), although CPEs are slightly different from that of MDV.
In contrast to MDV plaques, which develop slowly and consist of
rounded clusters rarely extending more than 0.5-1 mm in diameter,
the plaques produced by HVT in CK cells appear early (in 2-3 days)
and consist of large syncytia surrounding a clear central area. HVT
plaques grow rapidly, reaching a diameter of 1.5-3 mm in about 10
days. HVT and MDV plaques can be distinguished in several avian
cells cultures, but most clearly in CK cell cultures. The identity of
the plaques induced by the two viruses may be confirmed by
staining CPE-monoclonal antibodies in an FA test. Serotypes 1 and
2 antibody will react only with MDV plaques and serotype 3
antibody reacts with HVT plaques.
Most MD vaccines consist of a suspension of viable, virus-infected
CEF (wet vaccine), although lyophilized, monovalent cell-free HVT
vaccine (diy vaccine) is also available. Serotypes 1 or 2 MDV are
not available in the lyophilized form. Wet vaccine is supplied in
frozen, sealed glass ampules. The accompanying handling
instructions should be followed carefully. The vaccine should be
thawed just before used and immediately diluted to the proper dose
level. Concentrations of DMSO used to protect cells during freezing
are highly toxic to cells at room temperature (25-30 C).
SEROLOGIC DETECTION IN THE HOST
Chickens infected with MDV develop antibody that persists for
life. Several serologic tests may be used to quantify serum antibody,
however, usefulness in commercial flocks is limited since all flocks
have been vaccinated or exposed. Serologic assays are useful for
evaluating chickens with no known prior exposure to MDV vaccine
or field strains (backyard flocks, international flocks).
Agar-Gel Precipitin Test
In the AGP test, serum is reacted with MD antigens in an agar
medium. Commercial reagents are available. The antigen for this
test is prepared by propagating MDV (of low cell-culture-passage
level) in CK cell or CEF cultures (12). When CPEs are confluent,
the cells are detached from the culture vessel either by scraping the
vessel with a rubber policeman or trypsinizing and the cells are
suspended in PBS or culture medium without tryptose phosphate
broth (tryptose phosphate broth in the antigen may produce
nonspecific precipitin bands) at a concentration of about 1 x 107
cells/ml. This suspension is then freeze-thawed three times and used
as antigen. Feather pulp extracted by squeezing the tips of feathers
plucked from major feather tracts of infected chickens also has been
used as antigen. For optimum precipitation, a 1% suspension of
Noble agar is made in NaK phosphate buffer (pH 7.4) containing
8% NaCl. About 3 ml of suspension is poured onto a glass
microscope slide pretreated with a film of 1:5 dilution of agar
suspension. When the agar solidifies, one central and six peripheral
equidistant wells, each 3 mm in diameter and about 3.5 mm apart
are cut with a template or other suitable borer. The central well is
filled with antigen, and the peripheral wells are filled with serum.
To detect nonspecific precipitin bands and enhance weak reactions
each well containing test serum should be adjacent to one
containing known MD-specific serum. Reagents should be diffused
for 72 hr in a moist chamber at either 37 C or at room temperature.
Positive test serum should form a line of identity with the line
produced by MD-specific serum. Certain sera may produce up to
six precipitin lines. The most prominent line, referred to as the A (or
gC) line, is produced by the antigen released from infected cells into
103
Chapter 22 Marek’s
the medium, whereas the other lines are minor, produced by
antigens intimately associated with infected cells.
Fluorescent Antibody Test
The FA test can be used to detect antibodies if known antigen is
available (indirect FA) or - the reverse - to detect antigen if know®
antibody is available (direct FA). Techniques for both direct and
indirect FA tests for the avian system have been reviewed (31). Far
the direct test, globulin extracted from serum of chickens exposed
to MDV is labeled with fluorescein isothiocyanate. For the indirect
test, labeled anti-chicken gamma globulin is available from several
commercial sources. Mouse monoclonal anti-MDV antibodies have
been developed that may be used in the indirect FA test (26).
The antigen is prepared in monolayer cultures of CK cells grown
on glass coverslips. Confluent monolayers are inoculated with
enough MDV to give numerous separated plaques. When the
earliest distinct plaques appear (before CPE become confluent), the
coverslips are washed once with PBS and then fixed for 5 min in
acetone at 4 C. Fixed coverslips can be stored at -20 C and used
within several weeks.
Enzyme-Linked Immunosorbent Assay
In this test, wells of a 96-well microtiter plate are coated with
MDV-infected CEFs or DEFs (11). Monolayer cells cultured in
100-mm plates are infected with a massive dose of cell-associated
MDV. When more than 75% cells show CPEs, the infected cells are
trypsinized and suspended in PBS and used to coat the wells of the
microtiter plate. Alternatively, the cells may be suspended in tissue­
culture medium containing 10% calf serum and 10% DMSO and
stored in liquid nitrogen for later use. At the time of use, the frozen
cells are thawed and washed twice with PBS to remove the DMSO
before coating the wells. Each microtiter well receives 5 x 104
infected cells (containing about 1.7 x 103 PFU) in 0.1 ml PBS. After
the plates are low-speed centrifuged (1000 rpm) for 10 min, the
supernatant is discarded and the cells are allowed to dry at room
temperature. Antigen-coated plates may be stored at 4 C or -20 C
for at least 3 mo without loss of reactivity. The stored plates should
be washed three times with PBS containing 0.1% Tween 80 before
use.
Duplicate samples of 0.1 ml of test sera and known MD antibody­
positive and -negative sera diluted in 3% bovine serum albumin are
placed in the wells of the microtiter plates. After 1 hr at 37 C, the
wells are washed with PBS and 0.1 ml of a 1:3200 dilution of
affinity-purified goat anti-chicken immunoglobulin G (IgG)-
peroxidase conjugate (Synbiotics, San Diego, CA) is added to each
well. After 1 hr at 37 C, the wells are washed four times and to each
well is added 0.1 ml of substrate containing one volume of 0.05%
H2O2 and nine volumes of purified 5-aminosalicylic acid (1 mg per
ml in 0.02 M phosphate buffer [pH6.0]). After 30 min at room
temperature, absorbance is read at 490 nm wavelength using any
commercially available ELISA reader. Sera showing an absorbance
reading of at least three times that of known antibody-negative sera
are considered positive. Cheng et al. (11) considered a serum
positive if the absorbance at a 1:400 dilution was 0.20 units or
higher. The titer of antibody was the reciprocal of the serum
dilution with an absorbance of 0.20 units.
Virus Neutralization Test
This test is used to detect neutralizing antibody in the serum or
plasma of infected chickens. Because the cell-free preparations of
MDV prepared from skin or feather-follicle extracts of MDV-
infected chickens are generally low in titer, the kinetics of
neutralization have not been adequately studied. The test should be
conducted with cell-free virus suspension in SPGA-EDTA buffer
with a titer of about 103 PFU/ml. One part of twofold or 10-fold
serum or plasma dilution and four parts of virus suspension are
mixed and incubated for 30 min at 37 C or at room temperature.
Patricia S. Wakenell and Jagdev M Sharma
Known positive and negative serum controls should be included in
the test. Each of duplicate cultures of 24-hr-old primary CK cells is
then inoculated with 0.2 ml of the serum-virus mixture and
absorbed for 30 min at 37 C and fresh medium is then added to the
cultures. Thereafter, medium is changed on alternate days. Plaques
are counted 6-8 days after inoculation. The titer of the serum is the
reciprocal of the serum dilution that causes at least 50% reduction
in virus titer (obtained with negative serum control).
Vaccine Delivery. Within the last decade, a dramatic change has
occurred in the method of MD vaccine delivery in commercial
chicken flocks. Previously, MD vaccines were administered
subcutaneously in newly hatched chickens in the hatchery. Most of
the major hatcheries in the U.S.A. now use in ovo technology to
vaccinate chickens against MD (37,39). In this technology, the
vaccines are injected in eggs at 17-18 days of embryonation using
multiple-head injection machines. Site of vaccine delivery is critical
for MDV vaccine efficacy (47). This method has substantially
reduced the labor cost associated with posthatch vaccination.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Clinical MD is often confused with lymphoid leukosis. The main
source of confusion is the similarity of the gross visceral tumors
produced by the two diseases. Detection of cellular antigens with
monoclonal antibodies may be used to distinguish tumor cells of
MD and lymphoid leukosis (13,19,29,51). Because
reticuloendotheliosis virus may cause nerve enlargement or
lymphomas under experimental conditions, it also may be confused
with MD. Firm diagnosis depends on flock history, distribution and
histologic appearance of lesions, identity of cells constituting
tumors, identification of viral antigens in tumor cells, and isolation
of the etiologic agent (see Chapter 35 on oncornaviruses). Viral
antigens may be identified by microscopy techniques using
immunofluorescence or immunohistochemhical staining or by
molecular assays such as PCR to detect viral nucleic acid.
Another common avian herpesvirus that should differentiate from
MDV is infectious laryngotracheitis virus (ILTV). Clinically, ILTV
causes a respiratory disease in chickens, and the lesions are more or
less restricted to the upper respiratory tract, without involvement of
the nervous system. ILTV produces pocks that are indistinguishable
from those produced by MDV on the CAM of embryonated eggs. In
avian cell cultures, ILTV becomes cell-free and grows much faster
than MDV. The CPE of ILTV becomes detectable 8-10 hr after
inoculation and consists of rapidly progressing syncytia formation.
Plaques induced by ILTV and MDV may be differentiated by
staining with virus-specific antibodies.
REFERENCES
1. Afonso, C. L., E. R. Tulman, Z. Liu, L. Zsak, D. L. Rock, and G. F.
Kutish. The genome of turkey herpesvirus. J. Virol. 75:971-978. 2001.
2. Baigent, S., V. Nair, and R. Currie. Real-time quantitative PCR for
Marek’s disease vaccine virus in feather samples: applications and
opportunities. Dev. Biol. (Basel). 126:271-81. 2006.
3. Baigent, S. J., L. J. Pelherbridge, K. Howes, L. P. Smith, R. J. Currie, and
V. K. Nair. Absolute quantification of Marek’s disease virus genome copy
number in chicken feather and lymphocyte samples using real-time PCR. J.
Virol. Methods 123(l):53-64. 2005.
4. Becker, Y., Y. Asher, E. Tabor, I. Davidson, M Malkinson, and Y.
Weisman. Polymerase chain reaction for differentiation between pathogenic
and nonpathogenic serotype 1 Marek’s disease virus (MDV) and vaccine
viruses of MDV serotypes 2 and 3. J. Virol. Methods 40:307-322. 1992.
5. Biggs, P. M, and B. S. Milne. Use of the embryonating egg in studies on
Marek’s disease. Am. J. Vet. Res. 32:1795-1809. 1971.
6. Bumstead, N. J., Silliboume, M. Rennie, N. Ross, and F. Davison.
Quantification of Marek’s disease virus in chicken lymphocytes using the
polymerase chain reaction with fluorescence detection. J. Virol. Methods
65:75-81. 1997.
104
7. Burgess, S. C., P. Kaiser, and T. F. Davison. A monoclonal antibody that
recognizes the chicken homologue of CD30, a tumor antigen in Marek’s
disease. In: K. A. Schat (Ed). Current Progress in Avian Immunology. Am.
Assoc. Avian Path. Kennett Square, PA. pp. 232-232. 2001.
8. Calnek, B. W., C. Garrido, W. Okazaki, and I. V. Patrascu. In vitro
methods for assay of turkey herpesvirus. Avian Dis. 16:52-56. 1972.
9. Calnek, B. W., S. B. Hitchner, and Η. K. Adldinger. Lyophilization of
cell-free Marek’s disease herpesvirus and a herpesvirus of turkeys. Appl.
Microbiol. 20:723-726. 1970.
10. Chang, K. S., K. Ohashi, and M Onuma. Diversity (polymorphism) of
the meq gene in the attenuated Marek’s disease virus (MDV) serotype 1 and
MDV-transformed cell lines. J. Vet. Med. Sci. 64:1097-1101. 2002.
11. Cheng, Y. Q., L. F. Lee, E. Smith, and R. L. Witter. An enzyme-linked
immunosorbent assay for the detection of antibodies to Marek’s disease
virus. Avian Dis. 28:900-911. 1984.
12. Chubb, R. C., and A E. Churchill. Precipitating antibodies associated
with Marek’s disease. Vet. Rec. 83:4-7. 1968.
13. Crespo, R., P. R. Woolcock, A. M Fadly, C. Hall, and H. L.
Shivaprasad. Characterization of T-cell lymphomas associated with an
outbreak of reticuloendotheliosis in turkeys. Avian Pathology 31:355-361.
2002.
14. Cui, Z. Z., D. Yan, and L. F. Lee. Marek’s disease virus gene clones
encoding virus-specific phosphorylated polypeptides and serological
characterization of fusion proteins. Virus Genes 3:309-322. 1990.
15. Davidson, I., M Malkinson, C. Strenger, and Y. Becker. An improved
ELISA method using a streptavidin-biotin complex, for detecting Marek’s
disease virus in feather tips of infected chickens. J. Virol. Methods 14:237-
241. 1992.
16. Delecluse, H.-J., and W. Hammerschmidt. Status of Marek’s disease
virus in established lymphoma cell lines: herpesvirus integration is
common. J. Virol. 67:82-92. 1993.
17. Endoh, D., Y. Kon, M Hayashi, T. Morimura, K. O. Cho, T. Iwasaki,
and F. Sato. Detection of transcripts of Marek's disease virus serotype 1
ICP4 homologue (MDV ICP4) by in situ hybridization. J. of Vet. Mei Sci.
58:969-975. 1996.
18. Gannon, J. V., R. Greaves, R. Iggo, and D. P. Lane. Activating
mutations in p53 produce a common conformational effect. A monoclonal
antibody specific for the mutant form. Euro. Mol. Biol. Org. J. 9:1595-1602.
1990.
19. Gimeno, I. M, R. L. Witter, A. M Fadly, and R. F. Silva. Novel criteria
for the diagnosis of Marek’s disease virus-induced lymphomas. Avian
Pathology 34(4):332-340. 2005.
20. Gimeno, I. M, R. L. Witter, and A. Miles. Marek’s disease (CDRom)
Slide set. Am. Assoc. Avian Path. Athens, GA. 2004.
21. Handenberg, K. J., O. L. Nielsen, and P. H. Jorgensen. The use of
serotype 1- and serotype 3-specific polymerase chain reaction for the
detection of Marek’s disease virus in chickens. Avian Pathology 30:243-
249. 2001.
22. Holland, M S., C. D. Mackenzie, R. W. Bull, and R. F. Silva. A
comparative study of histological conditions suitable for both
immunofluorescence and in situ hybridization in the detection of herpesvirus
and its antigens in chicken tissues. J. Histochem. Cytochem. 44:259-265.
1996.
23. Izumiya, Y, Η. K. Jang, M Ono, and T. Mikami. A complete genomic
DNA sequence of Marek’s disease virus type 2, strain HPRS24. In: K. Hirai
(Ed.). Current Topics in Microbiology and Immunology. Springer-Verlag,
Berlin. 255:191-222. 2001.
24. Jarosinski, K. W., B. K. Tischer, S. Trapp, andN. Osterrieder. Marek’s
disease virus: Lytic replication, oncogenesis and control. Expert. Rev.
Vaccines 5(6):761-772. 2006.
25. Kung, H. J., L. Xia, P. Brunovskis, D. Li, J. L. Liu, and L. F. Lee. Meq:
An MDV-specific bZIP transactivator with transforming properties. In: K.
Hirai (Ed.). Current Topics in Microbiology and Immunology. Springer-
Verlag, Berlin. 255:245-260. 2001.
26. Lee, L. F., X. Liu, and R. L. Witter. Monoclonal antibodies with
specificity for three different serotypes of Marek’s disease viruses in
chickens. J. Immunol. 130:1003-1006. 1983.
27. Liu, J. L., L. F. Lee, and H. J. Kung. Biological properties of the
Marek’s disease latent protein MEQ: Subcellular localization and
transforming potential. In: R. F. Silva, Η. H. Cheng, P. M Coussens, L. F.
Lee, and L. F. Velicer (Eds.). Current Research on Marek’s Disease. Am.
Assoc. Avian Path. Kennett Square, PA pp. 271-277. 1996.
28. Nazerian, K., L. F. Lee, N. Yanagida, and R. Ogawa. Protection against
Marek’s disease by fowlpox virus recombinant expressing the glycoprotein
B of Marek’s disease virus. J. Virol. 66:1409-1413. 1992.

29. Neumann, U., and R. L. Witter. Differential diagnosis of lymphoid
leukosis and Marek’s disease by tumor associated criteria. I. Studies on
experimentally infected chickens. Avian Dis. 23:417-425. 1979.
30. Payne, L. N., and P. M Biggs. Studies on Marek’s disease. Π.
Pathogenesis. J. Natl. Cancer Inst. 39:281-302. 1967.
31. Purchase, H. G. Fluorescent-antibody techniques in avian research.
Avian Dis. 17:213-226. 1973.
32. Reddy, S. K., J. M Sharma, J. Ahmad, D. N. Reddy, J. K. McMillen, S.
M Cook, M A. Wild, and R. D. Schwartz. Protective efficacy of
recombinant herpesvirus of turkeys as an in ovo vaccine against Newcastle
and Marek’s disease in specific-pathogen-free chickens. Vaccine 14:469-
477. 1996.
33. Reddy, S. M, R. L. Witter, and I. M Gimeno. Development of a
quantitative-competitive polymerase chain reaction assay for serotype 1
Marek’s disease virus. Avian Dis. 44:770-775. 2000.
34. Ross, L. J. N., Μ M Binns, P. Tyers, J. Pastorek, V. Zelnik, and S.
Scott. Construction and properties of turkey herpesvirus recombinant
expressing the Marek’s disease virus homolog of glycoprotein B of herpes
simplex virus. J. Gen. Virol. 74:371-377. 1993.
35. Schat, K. A. Isolation of Marek’s disease virus: Revisited. Avian
Pathology 34(2):91-95. 2005.
36. Schumacher, D. Β., Β. K. Tischer, W. Fuchs, and N. Osterrieder.
Reconstruction of Marek’s disease virus serotype I (MDV-1) from DNA
cloned as a bacterial artificial chromosome and characterization of a
glycoprotein B negative MDV-1 mutant. J. Virol. 74:11088-11098. 2000.
37. Sharma, J. M., and B. R. Burmester. Resistance to Marek’s disease virus
at hatching in chickens vaccinated as embryos with the turkey herpesvirus.
Avian Dis. 26:134-'49. 1982.
38. Sharma, J. Μ, B. D. Coulson, and E. Young. Effect of in vitro
adaptation of Marek’s disease virus on pock induction on the chorioallantoic
membrane of embryonated chicken eggs. Infect. Immun 13:292-295. 1976.
39. Sharma, J. M, and R. L. Witter. Embryo vaccination against Marek’s
disease with serotypes 1, 2, and 3 vaccines administered singly or in
combination. Avian Dis. 27:453-463. 1983.
40. Silva, R. F. Differentiation of pathogenic and nonpathogenic serotype 1
Marek’s disease viruses (MDVs) by the polymerase chain reaction
amplification of the tandem direct repeats within the MDV genome. Avian
Dis. 36:521-528. 1992.
41. Silva, R. F., L. F. Lee, and G. F. Kutish. The genomic structure of
Marek’s disease virus. In: K. Hirai (Ed.). Current Topics in Microbiology
and Immunology. Springer-Verlag, Berlin. 255:143-158. 2001.
105
Chapter 22 Marek’s Disease
42. Silva, R. F., S. M Reddy, and B. Lupiani. Expansion of a unique region
in the Marek’s disease virus genome occurs concomitantly with attenuation
but is not sufficient to cause attenuation. J. Virol. 78:733-740. 2004.
43. Spatz, S. J., and R. F. Silva. Polymorphisms in the repeat long regions
of oncogenic and attenuated pathotypes of Marek’s disease virus 1. Virus
Genes. Sep. 9. 2006.
44. Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, D. L. Rock, and G. F.
Kutish. The genome of a very virulent Marek’s disease virus. J. Virol.
74:7980-7988. 2000.
45. Von Bulow, V. Diagnosis and certain biological properties of the virus
of Marek’s disease. Am. J. Vet. Res. 32:1275-1288. 1971.
46. Wakenell, P. S. An overview of problems in diagnosis of neoplastic
diseases of poultry. In: Proceedings of the American Association of Avian
Pathologists Tumor Virus Symposium. Pp 1-7. 1997.
47. Wakenell, P. S., T. Bryan, J. Schaeffer, A. Avakian, C. Williams, and C.
Whitfill. Effect of in ovo vaccine delivery route on herpesvirus of
turkeys/SB-1 efficacy and viremia. Avian Dis. 46:274-280. 2001.
48. Wilson, M R., and P. M Coussens. Purification and characterization of
infectious Marek’s disease virus genomes using pulsed field electrophoresis.
Virology 185:673-680. 1991.
49. Witter, R. L. Increased virulence of Marek’s disease virus field isolates.
Avian Dis. 41:149-163. 1997.
50. Witter, R. L., B. W. Calnek, C. Buscaglia, I. M Gimeno, and K. A
Schat. Classification of Marek’s disease viruses according to pathotype:
Philosophy and methodology. Avian Pathology 34(2): 75-90. 2005.
51. Witter, R. L., I. M Gimeno and A. M Fadly. Differential diagnosis of
lymphoid and myeloid tumors in chickens (CD-ROM), set 27. Am. Assoc.
Avian Pathologists, Athens, GA. 2005.
52. Witter, R. L., and K. A. Schat. Marek’s disease. In: Diseases of Poultry,
11th ed. Y. M Saif, H. J. Bames, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne (Eds.). Iowa State University Press, Ames,
LA. Pp. 407-465. 2003.
53. Witter, R. L., J. J. Solomon, and G. H. Burgoyne. Cell culture
techniques for primary isolation of Marek’s disease associated herpes
viruses. Avian Dis. 13:101-118. 1969.
54. Yunis, R., K. W. Jarosinski, and K. A. Schat. Association between rate
of viral genome replication and virulence of Marek’s disease herpesvirus
strains. Virology 328:142-150. 2004.
55. Zhu, G. S., T. Ojima, T. Hironaka, T. Ihara, N. Mizukoshi, A. Kato, S.
Ueda, and K. Hirai. Differentiation of oncogenic and nononcogenic strains
of Marek’s disease virus type 1 by using polymerase chain reaction DNA
amplification. Avian Dis. 36:637-645. 1992.
 23
DUCK VIRUS ENTERITIS
Peter R. Woolcock
SUMMARY. Duck virus enteritis (DVE) is caused by a herpesvirus of the subfamily Alphaherpesvirinae of the family Herpesviridae. No
evidence exists of antigenic variation. Infections have only been reported in ducks, geese, and swans. Birds of all ages are susceptible to
infection and mortality may be high, but the severity of clinical signs varies with the species, sex, and age of the infected birds. Lesions seen
at necropsy are typical of vascular damage.
Agent Identification. Diagnosis of DVE is confirmed by isolation and identification of the virus. Polymerase chain reactions (PCR) have
been developed to detect viral DNA in infected tissues.
Serologic Detection in the Host. Serologic detection of infection is only of importance in non-commercial waterfowl, and may be used to
determine prior exposure of migratory and non-migratory birds to DVE virus.
INTRODUCTION
Duck virus enteritis (DVE) is an acute, sometimes chronic,
contagious viral infection occurring naturally only in ducks, geese,
and swans, all of which are members of the family Anatidae of the
order Anseriformes. DVE may also be referred to as duck plague,
anatid herpes, eendenpest, entenpest, and peste du canard. The
disease has been reported in Asia, Europe, and North America. The
etiologic agent, a herpesvirus, is a member of the subfamily
Alphaherpesvirinae of the family Herpesviridae (16, 17). The
infection has not been reported in other avian species, mammals, or
humans.
CLINICAL DISEASE
In domestic ducks and ducklings, DVE has been reported in birds
ranging from 7 days of age to mature breeders. In susceptible
flocks, wild or domestic, the first signs are often sudden, high, and
persistent mortality, and a significant drop in egg production. In
chronically infected, partially immune flocks, only occasional
deaths occur. Latent infections are established in recovered birds
and these carriers may shed the virus in feces or on the surface of
eggs over a period of years (16,18).
Clinical signs and gross lesions associated with a DVE outbreak
vary not only with the virulence of the strain of virus, but also with
the species, age, and sex of the affected waterfowl (1, 17). In
breeder ducks, the signs may include photophobia, polydypsia, loss
of appetite, ataxia, watery diarrhea, and nasal discharge. Affected
birds often have ruffled feathers and soiled vents. Sick birds may
maintain an upright stance by using their wings for support, but
their overall appearance is one of weakness and depression. In
ducklings 2-7 wk of age, mortality may be lower than in older birds
and the signs associated with DVE infection include dehydration,
loss of weight, a blue coloration of the beaks, and blood-stained
vents.
At necropsy, little evidence exists of emaciation in adult ducks.
Prolapse of the phallus may occur in mature males. The gross
lesions are characterized by vascular damage, with tissue
hemorrhages and free blood in the body cavities, eruptions or
annular hemorrhages (seen as dark red bands around the intestine),
and ulcers with diphtheritic plaques on the mucosal surfaces of the
digestive tract. Lesions occur in all the lymphoid organs and
degenerative changes are apparent in the parenchymatous organs.
Collectively, these lesions are pathognomonic for DVE. The
pathology and histopathology of DVE in white Pekin ducks (Anas
platyrhynchos) has been reviewed (1, 17).
106
SAMPLE COLLECTION
Carcasses or tissues collected for virus isolation from dead ducks
should be chilled at 4 C immediately; if they cannot be delivered to
a diagnostic laboratoiy within 24 hr, the tissues should be frozen,
preferably at -70 C or lower, and stored until they can be shipped on
dry ice (freezing at temperatures warmer than -70 C may result in
loss of viability of the virus). Primary isolation of the virus is best
achieved from samples of liver, spleen, or kidney tissue that have
been homogenized in buffered saline and clarified by low speed
centrifugation.
PREFERRED CULTURE MEDIA AND’SUBSTRATES
Virus isolation may be attempted by inoculating clarified tissue
homogenates onto cell cultures, or into ducklings or duck embryos.
Cell Cultures
Isolation of DVE virus may be made in primary duck embryo
fibroblasts (DEFs) (8, 13, 19), or preferably, primary Muscovy
DEFs (MDEFs) (8, 13). Cell monolayers grown in medium
consisting of Eagle minimal essential medium (EMEM) containing
10% fetal calf serum (FCS), 2 mM glutamine, and 0.17% sodium
bicarbonate and gentamicin are washed with serum-free EMEM and
then inoculated with the clarified sample homogenate suspected to
contain DVE virus. The virus is added to the cell monolayer and
incubated for 1 hour at 37 C and then EMEM medium containing
2% FCS, 2 mM glutamine, and 0.17% sodium bicarbonate and
gentamicin is added and the cultures are incubated at 37 C in an
atmosphere containing 5% CO2 This method of isolation may be
modified to a plaque assay by overlaying the monolayer with
maintenance medium containing 1% agarose. Primary Muscovy
duck embryo liver cells may be more sensitive for virus isolation,
(R.E. Gough, pers. comm.). It has been reported (2) that the
isolation of DVE virus in MDEF cells is favored by incubation at
temperatures between 39.5 and 41.5 C. However, an elevated
temperature does not appear to be essential for isolation, which is
often carried out at 37 C. More than one passage may be necessary
for an isolation. The cytopathic effect is characterized by the
appearance of pyknotic, rounded clumped cells that enlarge and
become necrotic after 2-4 days. To confirm the presence of DVE
virus, cultures should be stained with a fluorescent antibody
conjugate using a direct or indirect method specific for DVE virus.
Cell monolayers may also be fixed and then stained with
hematoxylin and eosin to show syncytial formation, intranuclear
inclusions, and marked cytoplasmic granulation.
Ducklings
When inoculated intramuscularly, 1-day-old susceptible ducklings
die within 3-12 days. Muscovy ducklings (Cairina moschata)
(Grimaud Farms, Stockton, Calif.) are more susceptible to DVE
than are white Pekin ducklings. Both gross and microscopic lesions
 Chapter 23 Duck Virus Enteritis

typical of infection with DVE should be seen on postmortem Biological Properties

examination. Uninoculated ducklings, housed separately, should be
maintained as controls. The diagnosis may be confirmed either by
vaccinating ducklings against DVE (Cornell University, Duck
Research Laboratory, Eastport, Long Island, N.Y.) and challenging
them subsequently with the virus isolate, or by staining of tissues
with a fluorescent antibody conjugate specific for DVE virus.
However, virulent strains of the virus do exist, against which
vaccine may be ineffective (12).
The susceptibility of Pekin ducklings to field isolates of DVE virus
can be highly variable and therefore unreliable as the primary
method of isolation. Virus isolation in birds rather than in egg or
cell cultures is not always practical, but it may be necessary for a
successful demonstration of the virus. In the author's recent
experience, even though a herpesvirus could be visualized by
negative stain electron microscopy, and the necropsy and
histopathologic changes observed in Muscovy ducks were
pathognomonic for DVE, isolation of virus was eventually achieved
only in Muscovy ducklings and not in MDEF cell cultures.
Duck Embryos
Primary DVE virus isolations can also be made by inoculation
onto the chorioallantoic membrane (CAM) of 9 to 14-day-old
embryonating Muscovy duck eggs. The embryos may die, showing
characteristic extensive hemorrhages 4-10 days after inoculation.
Two to four serial passages of the homogenized CAMs may be
necessary before an isolation is made. This method of isolation is
not as sensitive as cell cultures or susceptible 1-day-old ducklings.
Pekin duck embiyos vary in their susceptibility to strains of DVE
virus. Embryonating chicken eggs are not very susceptible to
infection with field strains of DVE virus. The virus can, however,
be adapted to chicken embryos by serial passaging.
Infected cells surrounding necrotic foci contain intranuclear
inclusion bodies. Based on plaque-reduction tests, all strains of
DVE virus currently belong to one serotype.
Chicken embryo-adapted DVE virus is used in the preparation of a
live attenuated vaccine, which is recommended for use in birds 2
weeks of age or older. Fattening or breeding ducks may be
vaccinated subcutaneously or intramuscularly to produce active
immunity. The vaccine virus is thought not to spread by contact
from vaccinated to unvaccinated ducks because unvaccinated
contact birds remain susceptible to infection.
Antigen Detection
Virus-neutralization (VN) and immunofluorescence tests are most
commonly used to confirm the identity of DVE virus using either
embryonating eggs or cell cultures. A plaque assay for DVE virus
using duck embryo cell cultures has been described (4).
Hyperimmune antiserum prepared in ewes was used in a direct
fluorescent antibody test for DVE virus in DEF cells, and was
shown to be the next most sensitive assay after isolation in 1 to 9-
day old ducklings (7). Direct or indirect immunofluorescent
tests using antisera to DVE virus prepared in ducks can be used to
detect virus in cell cultures and in frozen tissue sections. A reverse
passive hemagglutination test for DVE has been described (5) but
is reported to be less sensitive than immunofluorescence and plaque
assays. An avidin-biotin-peroxidase method of immunoperoxidase
staining to detect DVE antigen in formalin-fixed, paraffin-
embedded sections of liver and spleen from experimentally infected
birds has been described (11); this method could have diagnostic
potential. Herpesvirus may also be detected in clarified tissue
homogenates by negative stain electron microscopy; this is not,
however, positive confirmation that the herpesvirus is DVE virus.

AGENT IDENTIFICATION Molecular identification

Morphology
Mature virions are enveloped, have typical herpesvirus
morphology, and range in size from 160 to 380 nm. Naked or
unenveloped nucleocapsids may be seen by negative stain electron
microscopy and are between 100 to 110 nm in diameter.
Physicochemical Properties
The virus genome consists of DNA and virus particles are
sensitive to lipid solvents and are rapidly inactivated at a pH <3 or
>10.
Detection of DVE virus by polymerase chain reaction (PCR) has
been reported (9, 10, 14, 15). Primers have been identified that are
able to amplify DNA from DVE virus present in various tissues,
including oesophagus, liver and spleen, from an original outbreak
and after passage in Muscovy duck embryos
The following detailed protocol for the detection of DVE virus
was provided by Dr. W. R. Hansen, US Geological Survey,
Biological Resources Division, National Wildlife Health Center,
6006 Schroeder Road, Madison, WI 53711, USA. This procedure
uses the following commercial items: GeneAmp PCR Reagent Kits
containing dNTPs, lOx amplification buffer for hot start PCR, Taq
DNA polymerase, Lambda PCR control reagents, and Ampliwax
beads (Applied Biosystems), and a 100 base pair molecular size
ladder (Invitrogen).

Extraction of viral DNA This DNA extraction procedure can be used on disrupted cell suspensions from duck plague infected cell culture,
10% ground tissue suspensions, or cloacal swab material in transport medium. This method is used to prepare duck plague DNA for the
known positive PCR controls.
Note: All product transfers in steps i through v are performed inside a biological safety cabinet.

For 10% ground tissue suspension, add 400 μΐ to a 1.5 ml microfuge tube and microfuge at 16,000xg for 5 min. Transfer the
supernatant to a new tube and go to step ii.
i. For cell culture suspensions and cloacal swab material, add 400 μΐ of the sample, or supernatant from step i above, to a 1.5 ml tube
and microfuge at 16,000-20,OOOxg for 45 min, to pellet virus.
ii. Discard the supernatant and resuspend the pellet with 200 μΐ of Tris - EDTA (10 mM Tris-HCl, pH 8.0, 1 mM EDTA) buffer.
iii. Add 10 μΐ of a 5 pg/μΙ proteinase K solution giving a final concentration of 0.2 pg/μΙ, mix thoroughly, and incubate at 56 C for 1
hour.
iv. Add 25 μΐ of 10% sodium dodecyl sulfate solution giving a final SDS concentration of 1%, mix thoroughly, and incubate at 37° C
for one hour.
v. Add 15 μΐ of 5M NaCl giving a final concentration of 0.3 M and mix thoroughly.
vi. Add 300 μΐ of fresh phenol buffered with Tris-HCl, pH 8.0 to the tube, and mix by inverting 50 times.
vii. Microfuge tube at 16,OOOxg for 5 min and transfer the top aqueous phase (sample) to a new tube.
viii. Repeat the phenol extraction steps vii and viii one more time.
107
Peter R Woolcock

ix. Add 500 μΐ of ether to the tube, mix thoroughly, and microfuge at 16,000 x g for one min.
x. Discard the top aqueous phase (ether) and repeat the ether extraction step (x) one more time.
xi. Heat tube with lid open at 56 C for about 15 min or until the smell of ether is gone.
xii. Split tube contents in two and add 2.25 times the sample volume of 100% ethanol to each tube, mix tube contents by inverting tube
several times, and leave at room temp (22 C) for 30 min.
xiii. Microfuge tube at 16,000 x g for 45 min, and discard supernatant.
xiv. Add 200 μΐ of 70% ethanol to gently wash pellet then microfuge at 16,000 x g for 15 min.
xv. Discard the supernatant and diy pellet at 56 C for 30-45 min, with the tube lid open.
xvi. Resuspend the DNA in 30 μΐ of distilled water that is RNAase and DNAase free.
xvii. Store sample tube at 4 C until tested (few days) or at -20 C for long term storage.

Polymerase chain reaction

i. Lower reaction mixtures for the duck plague PCR and the lambda control are prepared in advance in a biosafety cabinet using the
kit manufacturers recommended methods for a hot start PCR. The lower reaction mixture is dispensed into PCR reaction tubes,
sealed with Ampliwax at 80 C as recommended by the manufacturer, and stored at 4 C for 1-2 mo.
ii. The following are the PCR primers for duck plague DNA-directed DNA polymerase gene:
iii. Primer 1 sequence 5’- GAAGGCGGGTATGTAATGTA - 3’ (forward)
iv. Primer 2 sequence 5’ - CAAGGCTCTATTCGGTAATG - 3’ (reverse)
v. The upper reaction mixture is prepared as a master mix according to the kit manufacturer’s recommendations the day of the test,
and distributed to each sample tube including the duck plague and lambda control tubes.
vi. Add 10 μΐ of DNA suspension from the stored sample tubes to PCR lower reaction tubes with corresponding labels.
vii. Place known duck plague DNA diluted to 1 pg/10 μΐ into one control tube and 10 μΐ of distilled water into the no DNA control
tube. Add 10 μΐ of lambda DNA supplied in the kit and 10 μΐ of water to corresponding lambda control tubes.
viii. Place all the tubes in a thermal cycler that is programmed as follows:
One cycle: Hold 94 C for 2 min.
Hold 37 C for 1 min.
Hold 72 C for 3 min.
35 cycles: Hold 94 C for 1 min.
Hold 55 C for 1 min.
Hold 72 C for 2 min.
One cycle: Hold 72 C for 7 min.
Hold 4 C until stored
PCR tubes are stored at 4 C until samples are examined for amplification products.

Electrophoretic analysis of PCR products

i. A fresh lx TAE buffer (40 mM Tris acetate, 1 mM EDTA, pH 8.3) is prepared from a lOx stock for agarose preparation and for use
in the electrophoresis chamber.
ii. A 1% agarose solution is prepared in TAE buffer, heated to dissolve the agarose and, when cool, poured into a gel former with a
comb.
iii. The solidified gel is placed into the electrophoresis chamber and TAE running buffer is added.
iv. PCR test samples, including the duck plague and lambda controls, are mixed 1/10 with Ιμΐ of loading buffer (0.25% (w/v)
bromophenol blue, 0.25% (w/v) xylene cyanol, 0.01 M Tris-HCl, pH 8.0, and 50% (v/v) glycerol) and 10 μΐ of each is added to
individual wells of the gel. The 100 base pair (bp) molecular size markers are added to each side of the gel at 0.4 pg per well.
v. Run the gel for one hour at 120 volts then stain in a 1% ethidium bromide solution for 20 min. Destain the gel for 45 min in
deionized water and view the gel on a UV illuminated light box. Photograph gel to record results.

Duck plague PCR interpretation: A 500 bp amplification band in the lambda control sample indicates the PCR ran successfully. A 446 bp
band in the duck plague known DNA control indicates the duck plague primers are working. A 446 bp band in the unknown test sample
indicates duck plague viral DNA was present. No amplification products will be present in the duck plague or lambda DNA controls. If bands
appear in these negative control products, cross contamination occurred during the and the test must be repeated.

Alternative methods to detect DVE virus DNA have been published by Plummer et al. (14), and Pritchard et al. (15)

SEROLOGIC DETECTION IN THE HOST
Serologic detection of infection is only of importance in
noncommercial waterfowl and may be used to determine prior
exposure of birds to DVE virus.
The humoral response to natural infection with DVE virus is often
low and antibodies may be short-lived (6); cell mediated immunity
is assumed to also play a role in the infection (16). However,
detection of neutralizing antibodies to DVE virus in serum is
possible. VN assays, using a constant serum varying virus method,
may be performed in chick or duck embryos by using embryo-
adapted virus, or in cell cultures. Neutralization indices (NIs)
108
between 0 and 1.5 were detected in domestic and wild waterfowl
that had not been exposed to DVE; an NI of 1.75 or greater was
considered as evidence of prior exposure to DVE virus (3).
Alternatively, sera may be screened using a constant-virus varying-
serum method. In the author’s laboratory, a microtiter neutralization
assay using primary MDEF or DEF cells is used. Serial two-fold
dilutions of each serum sample (heat inactivated at 56 C) are
prepared in 50 μΐ of serum-free EMEM in microtiter plates.
Approximately 102 0 mean tissue culture infective dose (TCID50) of
DVE virus in 50 μΐ of EMEM are added to each well and the
mixtures are allowed to react at 37 C for 1 hr. A suspension of
primary MDEF or DEF cells in EMEM supplemented with 2 mM

L-glutamine, 0.17% sodium bicarbonate, and 10% FCS is adjusted
to contain 3 x 105 cells/ml. Cells are next added to the plates at 100
μΐ per well and the plates are then incubated for up to 96 hr at 37 C
in a humidified 5% CO2 atmosphere. Following incubation, cultures
are observed daily by light microscopy and finally fixed with 10%
formol-buffered saline and stained with 1% crystal violet. The
plates are read macroscopically. The titer for virus-neutralizing
activity is expressed as the reciprocal of the highest dilution of
serum at which there is no evidence of cytopathic effects and
therefore complete virus neutralization has occurred. A titer of less
than 3 log2 is usually considered negative. A VN titer of 8 or
greater is considered significant and is evidence of exposure to
DVE virus (6). VN antibody may also be detected using cell
cultures by mixing sera at a single dilution (e.g., 1:10) with 100-
200 TCID50 virus and then testing inoculated cell cultures for non­
neutralized virus by immunofluorescence. Although this method is
not quantitative, it can be useful for screening large numbers of
sera. These latter methods, using constant virus and varying serum,
require less sera than the NI methods.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
DVE is usually pathologically distinct from other diseases of
waterfowl; however, hemorrhages and necrosis do occur in other
diseases of waterfowl such as duck viral hepatitis, pasteurellosis
{Pasteurella multocida) and some toxic conditions. Occasionally,
lesions caused by DVE virus could be confused with those
produced by highly pathogenic Newcastle disease virus, avian
influenza virus, and poxvirus (16, 17).
REFERENCES
1. Brand, C. J. Duck Plague. In: Field Guide to wildlife diseases, Vol. 1:
General field procedures and diseases of migratory birds, M Friend, ed.
Resources publication 167. U.S. Department of the Interior, Fish and
Wildlife Service, Washington, DC. pp. 117-127. 1987.
2. Burgess, E. C., and T. M Yuill. Increased cell culture incubation
temperatures for duck plague virus isolation. Avian Dis. 25:222-224. 1981.
3. Dardiri, A H., and W. R. Hess. The incidence of neutralizing antibodies
to duck plague virus in serums from domestic ducks and wild waterfowl in
the United States of America. Proceedings, Annual Meeting of the United
States Animal Health Association, pp. 225-237. 1967.
4. Dardiri, A H., and W. R. Hess. A plaque assay for duck plague virus.
Can. J. Comp. Med. 32:505-510. 1968.
109
Chapter 23 Duck Vine
5. Deng, Μ Y., E. C. Burgess, and T. M Yuill. Detection of dock ρΜρκ
virus by reverse passive hemagglutination test Avian Dis. 28 616-62X.
1984.
6. Docherty, D. E., and C. J. Franson. Duck Virus Enteritis. In: Vi ii i··^
Diagnostic Virology, A. E. Castro and W. P. Heuschele, eds. Mosby Yor
Book, St Louis, Missouri, USA. pp. 25-28. 1992.
7. Erickson, G. A., S. J. Proctor, J. E. Pearson, and G. A Giwtrfw
Diagnosis of duck virus enteritis (duck plague). 17th Annual Proceedings of
the American Association of Veterinary Laboratory Diagnostic^·!.
AAVLD, Madison, Wisconsin, USA Roanoake, Virginia, USA pp. 85-90L
1974.
8. Gough, R. E., and D. J. Alexander. Duck Virus Enteritis in Greai-Brii··,
1980 to 1989. Vet. Rec. 126:595-597. 1990.
9. Hansen, W. R, S. E. Brown, S. W. Nashold, and D. L. Knudso·.
Identification of duck plague virus by polymerase chain reaction. Avian Dti
43:106-115. 1999.
10. Hansen, W. R., S. W. Nashold, D. Docherty, E., S. E. Brown, and D. L
Knudson. Diagnosis of Duck Plague in Waterfowl by Polymerase Cham
Reaction. Avian Dis. 44:266-274. 2000.
11. Islam, M R., J. Nessa, and K. M Halder. Detection of duck plague
virus antigen in tissues by immunoperoxidase staining. Avian Path. 22:389-
393. 1993.
12. Kisary, S., and L. Zsak. Comparative studies on duck viral enteritis
(DVE) virus strains in geese. Avian Path. 12:395-408. 1983.
13. Kocan, R. M Duck plague virus replication in Muscovy duck fibroblast
cells. Avian Dis. 20:574-580. 1976.
14. Plummer, P. J., T. Alefantis, S. Kaplan, P. O'Connell, S. Shawky, and
K. A. Schat. Detection of duck enteritis virus by polymerase chain reaction.
Avian Dis. 42:554-564. 1998.
15. Pritchard, L. I., C. Morrissy, K. Van Phuc, P. W. Daniels, and H. A
Westbury. Development of a polymerase chain reaction to detect
Vietnamese isolates of duck virus enteritis. Vet. Microbiol. 68:149-156.
1999.
16. Richter, J. Η. M, and M. C. Horzinek. Duck Plague. In: Virus
Infections of Birds, J. B. McFerran and M S. McNulty, eds. Elsevier
Science Publishers B.V., Amsterdam, the Netherlands, pp. 77-90. 1993.
17. Sandhu, T. S., and S. A Shawky. Duck Virus Enteritis (Duck Plague).
In: Diseases of Poultry, 11th ed. S. Y.M, H. J. Barnes, J. R. Glisson, A M
Fadly, L. R. McDougald and D. E. Swayne, eds. Iowa State Press, pp. 354-
363. 2003.
18. Shawky, S., and K. A. Schat. Latency sites and reactivation of duck
enteritis virus. Avian Dis. 46:308-313. 2002.
19. Wolf, K., C. N. Burke, and M C. Quimby. Duck viral enteritis: a
comparison of replication by CCL-141 and primary cultures of duck embryo
fibroblasts. Avian Dis. 20:447-454. 1976.
 24
HERPESVIRUSES OF FREE-LIVING AND PET BIRDS
Erhard F. Kaleta

SUMMARY. Free-living and pet birds are affected by a large number of different herpesviruses (HVs). The taxonomic status within the
three subfamilies α-, β-, and y-Herpesvirinae is still undetermined for most of the many isolates. HV isolates can be distinguished by
restriction enzyme analysis, cross neutralization tests, and in part by plaque morphology in chick-embryo fibroblast (CEF) and chick embryo
kidney or chick embryo liver cell cultures. Replicating and latently present HVs can be detected in swabs and various tissues by polymerase
chain reactions (PCRs).
Most commonly affected by HVs are various breeds of domestic pigeons, waterfowl, many species of psittacines, owls, black and white
storks, and various finches; eagles, falcons, cormorants, toucans, and quail are less frequently infected. Subclinical infections occur in all
species. Various forms of apparent disease are frequently linked to the presence of debilitating factors such as overcrowding, food primarily
deficiencies, prolonged antibacterial treatment, and poor hygiene. In the acute phase of the disease lesions are primarily hemorrhagic and
inflammatory in nature and in the chronic phases lesions are predominantly necrotic mostly in the pharynx, esophagus, and intestines, but
also in large parenchymal organs and brains.
Agent Identification. Diagnosis of HV infections in live birds is preferably made by virus isolation from buffy coat cells and feather pulp
material. Homogenates of parenchymal organs, bone marrow, or brain tissues from dead birds may be used as inocula for cell cultures of
avian origin. Viral DNA can be detected by PCR. Virus identification is achieved by chloroform treatment of supernatant fluids from heavily
infected cell cultures, cultivation of the isolate in question in the presence of iododeoxyuridine, and electron microscopy. Identification of
serotypes is done by cross neutralization tests.
Serologic Detection in the Host. Subclinical infection is commonly associated with seroconversion. The assay of sera in neutralization tests
identifies infected, possibly also virus positive birds. In many cases several serologically unrelated viruses must be used to detect all
serotypes of HVs known to occur in a particular species of bird. Repeated serologic monitoring is advisable for all bird collections, breeding
stations, and quarantine stations.

and 4 (31,64). Transmission experiments that prove the etiology and

INTRODUCTION
Domestic, free-living, and pet birds are frequent hosts of a large
variety of herpesviruses (HVs). Infections may go unnoticed or may
result in fatal disease. HVs often interfere with captive breeding
programs or with attempts to re-establish free-living bird
populations. In addition, enzootics may occur in wild birds.
CLINICAL DISEASE
More than any other viruses, HVs have a tendency for latency and
persistent infections. Young age, concurrent infections, and
noninfectious noxae may precipitate disease, whereas antibacterial,
antifungal, and antiparasitic treatments may ameliorate the course
of the disease. In any case, clinical signs appear primarily as
nonspecific, general depression of common behavioral traits (46).
Psittacines often have yellowish droppings. However, in a large
number of cases, sudden increases in mortality rates may be the
only signalment evident in many species of birds. Therefore, any
increased death rate should prompt a detailed examination (18).
In psittacines, HV-induced mortality is often preceded by
introductions of latently infected birds, such as South American
conures of the genera Pyrrhura and Cyanoliseus (22). These birds
tend to be more often latently infected and are prolonged shedders
than are other psittacines (21,23). Falcons, and in particular owls,
often acquire fatal infections from preying on persistently infected
domestic pigeons (2). Housing of large numbers of birds of various
species in quarantine stations and pet bird shops provide ideal
circumstances for the horizontal spread of different viruses,
including HV, and also avian paramyxoviruses (10,25,34).
Gross lesions in birds dying from HV-induced diseases (17,24,32)
allow categorization of the disease into three main types:
1. the neoplastic type in chickens due to serotype 1 Marek’s disease
viruses and in pigeons due to an HV antigenically unrelated to
Marek's disease or classical HV infection of pigeons.
Circumstantial evidence for a causal relationship between mucosal
tumors in neotropical parrots and HVs has been reported (47,55).
These mucosal tumors in pharynx and cloaca of neotropical parrots
of the genera Ara and Amazona are histomorphologically similar to
papillomas and are linked to psittacid HVs of genotypes 1, 2, 3,
110
genesis of these papillomatous tumors have.not been reported;
2. the hemorrhagic type in infectious laryngotracheitis (ILT)
infections in chickens and in pheasants (11,13,41), peafowl
(3,5,13,42), and in guinea fowl (75); and
3. the necrotic type, which is found in many birds dying of HV
infections. These birds include owls (6), falcons (51,74), eagles
(16), rural and fancy pigeons (63,71) many psittacines
(30,45,50,54), black storks (Ciconia nigra; 38) and white (Ciconia
ciconia) storks (39), quail (40), and cranes (7), as well as
passeriforms of the families Estrildidae (exotic finches), Ploceidae
(weavers), and Carduelidae (finches, including the common
canary). Respiratory distress, hepatitis, and disseminated focal
necrosis located in liver, spleen, and bone marrow are most
commonly seen (61,68,72,76).
SAMPLE COLLECTION
Latent, non-productive infections are difficult to detect, and
cyclophosphamide treatments before sampling may enhance
recovery of the agent. During pairing time in seed-eating birds that
feed their offspring with crop-milk and/or macerated seeds (e.g.,
pigeons and some psittacines, but also many passerine species), HV
infections change from the latent, non-productive state to the
persistent, productive state.
Swabs of the oropharynx should be placed in complete tissue
culture medium without serum. This medium is suitable for storage
of samples at 4 C for about 1 wk. If necessary, infectivity in
swabbed epithelial cells can be preserved in freezing medium; (80
ml basal medium, Eagle’s [BME] or M199, 10 ml fetal calf serum
[FCS], and 10 ml dimethylsulfoxide [DMSO]; or in sucrose-
phosphate-glutamate albumin [SPGA] buffer) (8).
In addition to swabs, tissue specimens should be taken from all
organs with macroscopically visible lesions, (e.g. liver and spleen)
in birds that die from suspected HV disease. Bone marrow
specimens are valuable if carcasses have advanced autolysis.
Specimens should be minced immediately and immersed in cell­
culture medium with twice the normal strength of antibiotic and
antimycotic drugs. Such samples can be kept refrigerated for up to 1
wk without appreciable loss of infectivity. Freezing of samples
should be avoided. If long-term storage is necessary, tissue
homogenates should be suspended in freezing medium (see above).

Stork HV induce a long-lasting viremia, with the bulk of HV
infectivity associated with peripheral leukocytes (39). Heparinized
whole blood is aseptically drawn from the wing vein of storks and
further processed for virus isolation, as in the case of Marek's
disease herpesvirus (see Chapter 22 on Marek’s disease).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Cell cultures are the preferred substrate and any common cell
culture medium (e.g., BME, minimum essential medium [MEM]
and modifications, or Ml99) that supports the growth and
maintenance of cultured avian embryonic cells or young chick cells
is suitable for the isolation of avian HVs (see Chapter 43 on cell
culture methods). DNA of HVs that are in the non-productive stage
(latency) can be detected by various PCRs.
All known avian HVs multiply well in primary monolayer cultures
of chicken kidney cells (CKCs) and also chick embryo liver cells
(CELC). Marek's disease, ILT, and Lake Victoria Cormorant HV
grow only in chicken kidney epithelium or CELC. It is laborious to
adapt these three viruses to chick embiyo fibroblasts (CEFs). Other
cells (e.g., duck embiyo fibroblasts or cell lines of mammalian
origin) either are not definitely free from adventitious agents or
yield erratic results. Therefore, such cell cultures cannot be
recommended. Cells may be inoculated immediately after plating or
after the formation of subconfluent monolayers. Incubation for
more than 1 wk is not advisable. Instead, inoculated trypsinized
cells should be subcultured at intervals of 4-6 days.
Depending on the particular strain of HV, three types of cellular
alterations can be observed in unstained cultures:
1) Small plaques consisting of roundish refractile cells on top of
otherwise normal-appearing confluent CKCs or CEFs.
2) Large plaques with a lytic center and rounded cells adjacent to
the periphery of the plaque. With extended incubation, more
and more rounded cells detach and float in the medium. In the
final stages a netlike structure of unchanged elongated cells
remains.
3) Syncytial-type plaques composed initially of large irregular
structures.
Upon further incubation, these syncytia detach from the surface of
the culture vessel and assume roughly spherical shapes and float in
the medium and later disintegrate into particulate matter with
irregular boundaries and different diameters. Some avian HV
isolates may contain small and large plaque variants (35).
An inoculum can be considered to be negative if the primary culture
and two subsequent subcultures do not yield any of the described
cytopathologic changes.
Most HV isolates can be kept frozen without detrimental effects on
viral titer. However, most of the stork isolates (39) and at least some
of the strains recovered from psittacines and pigeons (33) are highly
cell-associated. Preservation of such strains requires the addition of
SPGA buffer (8,19) before freezing.
AGENT IDENTIFICATION
Taxonomy
Herpesvirus species of free-living and pet birds are currently not
assigned to any of the three subfamilies of the α-, β-, and γ-
Herpesvirinae (52,60). Moreover, names for the diseases in various
bird species or higher taxons have not yet been coined. In this
paper, names for HV isolates are selected according to suggestions
made by Roizman (60). Table 24.1 presents an updated list of 27
known and sufficiently characterized HV grouped in chronologic
order according to the first description of a defined disease or of the
causative virus. Additional data refer to the main host species (or
group), the provisional species designation (60), the serologic
relatedness of the isolates to each other (37,40), and the
predominant type of lesion in naturally infected birds (32).
Ill
Chapter 24 Herpesviruses of Free-living and Pei Bmk
Characterization
Culture filtrates that are free of bacteria, mycoplasmas,
chlamydiae, and fungi and that induce any of the three types of
cellular focal alterations described above should be examined
further to confirm the presence of HVs. The type of lesions in
affected birds, the tissues that yield isolates, and the types of
cellular alterations are an indication, but not proof, of the presence
of HVs. Virus identification involves physicochemical and
biological properties, and, finally, immunologic identification.
Molecular characterization, e.g. in situ hybridization (ISH),
restriction fragment length polymorphism (RFLP) and several
techniques of polymerase chain reaction (PCR) have gained
increasing importance.
Physicochemical Properties
Essential Lipid. All HVs are sensitive to lipid solvents. HVs
enclosed in syncytia may escape the direct action of chloroform,
leaving some intact particles unaffected. Centrifugation or filtration
through 220-nm filters before chloroform treatment eliminates this
problem.
Filtration. An estimate of the average diameter of virions can be
obtained by sequential filtration sets.
Iododeoxyuridine. Virus replication is inhibited, but not entirely
prevented, by halogenated desoxyribonucleosides.
Morphology. Cell lysates of heavily inoculated cultures showing
cytopathic effect (CPEs) are prepared either by one or two freeze­
thaw cycles or by sonication. After clarification by low-speed
centrifugation, viral particles in the supernatant are pelleted by
ultracentrifugation. The pellet is resuspended in saline, negatively
stained, and examined in a transmission electron microscope. All
complete enveloped HVs have the appearance of a fried egg, that is,
with an irregular envelope and a nucleocapsid roughly in the center.
Naked, nonenveloped particles or particles with disrupted envelopes
may also be seen (9,10,24,45,59,62,69). Naked particles tend to
form clusters consisting of 3-10 nucleocapsids. Because of
relatively low infectivity titers (usually in the range of ΙΟ4—106
median tissue culture infective doses [TdD50]/ml), negative results
are likely. In such situations, several steps of multiplication,
purification, and concentration are needed.
Because of variations in steps used for the processing of samples
for electron microscopy and because of inherent differences in the
examined isolates, diameters of the nucleocapsid vary between 100
nm and 150 nm and of the enveloped particles from 150 nm to more
than 200 nm. Some HVs, such as several stork isolates, have an
envelope that tightly surrounds the nucleocapsid. Others, such as
owl, falcon, eagle, psittacine, crane, and quail HVs, carry a large,
sometimes folded envelope (40). Spikes are not always clearly
discernible on the outer surface of the envelope.
Biological Properties
Embryo Inoculation. Herpesviruses do multiply following
inoculation of yolk sacs or chorioallantoic membranes (CAMs) in
embryonating eggs from chickens or other birds. Inoculation by
either route results in variable embryo mortality and, if the embryo
survives the inoculation for more than 4 days, distinct pox-like
lesions form on the CAM. The embryo itself may be stunted and
have disseminated focal necrosis of the liver and spleen;
occasionally focal lesions are present on the mucosa of the palatine
bone. Allantoic fluid does not agglutinate chicken erythrocytes.
Intranuclear Inclusions. Predominantly eosinophilic Cowdry
Type A intranuclear inclusion bodies surrounded by a distinct halo
can be detected in hematoxylin-and-eosin-stained sections of liver,
spleen, and bone marrow cells of naturally infected birds
(9,10,24,45,59,62,69); in cultured cells inoculated with avian HVs
(9,12,15,34,37,42,51,62); and liver and spleen cells of infected
embryos (6,18,33,48).
Erhard F. Kai eta
Animal Inoculation. Numerous in vivo studies with HVs derived
from domestic birds have yielded valuable information on the
development of signs, lateral spread and lesions and contributed to
the knowledge of pathogenesis, prevention and immunoprophylaxis.
Pathogenicity studies with avian HVs and naturally free-living and
pet birds are generally of limited value. Maintenance of such birds
in biocontainment isolation cabinets is difficult because of the
birds’ sometimes extreme demands on the environment and food.
The general health of such birds and their immune status to HVs are
often unknown; their immunocompetence might be impaired. Legal
rulings on animal protection and ethical reasons prevent the
handling of endangered species.
Data on the host range of HVs can be obtained more effectively by
swabbing the pharynx and cloaca or by assaying purified peripheral
leukocytes for viremia. Indirect evidence for the presence of natural
infections by various HVs can be gathered by testing serum samples
for neutralizing antibodies (15,28). The domestic chicken is not
susceptible to any avian HVs other than Marek's disease HVs and
ILT virus.
Genomic properties. Parts of the genome of some psittacine and
passerine HVs were studied (27,66,67) using consensus primer
PCRs that amplify either a region in the DNA-directed DNA
polymerase gene (70,76) or parts of the UL26 open reading frame
(66,67). The UL6 and UL7 of duck enteritis HV were amplified by
Plummer et al. (56). The results of these studies confirmed in most
instances the genetic heterogeneity of psittacine HVs, the results of
previous cross neutralization tests and earlier data on the restriction
fragment length polymorphisms (26,27,34,37,40). Although
assignment of the examined HVs to any of the three established
subfamilies of the family Herpesviridae is not yet achieved, the
genomic data contribute to the phylogenetic evolution of avian,
mammalian and reptilian HVs (12,14).
Immunologic Identification
Antisera against specific HVs can be produced in rabbits and used
with the plaque-reduction method in primary CEF or CKC cultures
(see serologic detection in the host below) to categorize unknown
HV isolates into serogroups. Avian HVs are poorly immunogenic in
laboratory rodents. The following procedure has been adopted to
raise antisera in rabbits (26,27). Viruses are harvested, and cells are
disrupted by ultrasonic vibration. Cellular debris is removed by
centrifugation at 4000 x g for 30 min. The supernatant fluid is
mixed with 10% (w/v) polyethylene glycol MW 6000, stirred at 4
C, and kept overnight (48). After centrifugation at 4000 x g for 10
min, the pellet is resuspended in Dulbecco’s phosphate buffer and
layered on top of a 12-52% linear sucrose gradient as described by
Lee et al. (48) and centrifuged at 25,000 x g for 1 hr in a Beckman
SW 27 rotor (Beckman Instruments, Inc, Fullerton, Calif.). The
gradient fluid is collected in 2-ml fractions. The same fractions are
titrated in cell cultures for infectious virus. Fractions with the
highest viral content are mixed in equal parts of complete Freund's
adjuvant and are inoculated intradermally on multiple sites on the
back of a rabbit. The first antiserum is collected 4 wk later. Booster
injections are given at 2-wk intervals. Rabbits are bled 2 wk after
the third booster injection is given. Serum can be collected and
stored until used for serotyping unknown HVs.
Using the plaque-reduction method in primary CEF or CKC
cultures, 11 different serotypes (33,37) can be distinguished. In
Table 24.1, available data on the serologic relatedness of
herpesviruses is indicated in the fourth column.
Available, yet preliminary, data on DNA restriction endonuclease
analysis (2,27) seem to confirm the results of conventional
neutralization tests.
The use of monoclonal antibodies for identification and
differentiation of avian HVs is hampered by the large number of
different viruses from various bird species. So far only one report
exists on studies of a psittacine HV (1).
112
SEROLOGIC DETECTION IN THE HOST
Neutralizing antibody in sera of birds can be detected by the
plaque-reduction method in primary CEF or CKC cultures. Thirty to
100 plaque-forming units of virus are reacted with twofold dilutions
of antisera and incubated for at least 1 hr at room temperature. Two
plates are inoculated as negative controls. All cultures are stained
with neutral red (2 ml of a 1:40,000 dilution in phosphate-buffered
saline per 60-mm petri dish culture) after 5-6 days of incubation
and examined macroscopically for plaques. Plaque numbers are
expressed as a percentage of negative controls. The serum dilution
is then plotted against the probit values, and the titer of the antisera
is estimated graphically and enumerated as log2 values.
A less laborious neutralization test can be performed under less
stringent conditions in 96-well microtiter plates. Twofold serum
dilutions ranging from 1:2 to 1:256 are incubated with 100 TCID50
of specific HV for at least 1 hr. Freshly prepared CEF at a
concentration of 106 cells/ml are added. After 5-6 days of
incubation, plates are stained with crystal violet solution, and serum
titers are macroscopically enumerated. The titer of a serum is the
highest dilution that produces no CPEs.
Plaques also can be enumerated by direct or indirect
immunofluorescence (57,58).
Other serologic tests, such as agar gel precipitation, complement
fixation, or enzyme-linked immunosorbent assay are either
insufficiently sensitive or not yet developed and validated (3).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Using the neutralization test, some avian herpesviruses are shown
to be serologically closely related (Table 24.1). These are Marek's
disease and turkey herpesviruses; HVs of pigeons, owls, falcons,
and eagles; and HVs from cranes and bobwhite quail. No serologic
relatedness is detectable among any of the other viruses listed in
Table 24.1. It should be noted that at least five serologically
different herpesviruses exist within birds of the order Psittaciformes
(26). The psittacine HV of the serotype 1 is most frequently
isolated. Also, two serologically distinguishable HVs can be
recovered from pigeons. The serologic status of HVs recently
isolated from passeriforms in this laboratory (exotic finches, weaver
bird, and common canaiy) indicates a relationship to psittacine
viruses (26,27,68).
Any enhanced morbidity and above-normal mortality in free-living
and pet birds requires a comprehensive postmortem and laboratory
examination. Certain bacteria (e.g., Salmonella spp., Klebsiella
spp., Escherichia coli, Mycobacterium spp., Campylobacter spp.,
Pseudomonas spp., Bacillus spp., Erysipelothrix rhusiopathiae, and
Pasteurella spp.) or bacterial exotoxins (e.g., botulism) may cause
focal necrosis in livers.
Hemorrhagic lesions in the respiratory tract might be caused by
certain bacterial infections (e.g., Pasteurella spp.) or by the red
worm Syngamus trachea. Highly pathogenic avian influenza and
Newcastle disease viruses grow readily in cell cultures and
embryonating eggs. Members of both groups of viruses easily can
be detected by hemagglutination in cell culture and allantoic fluids
of inoculated eggs.
Diphtheritic lesions in the intestines might be caused by
Trichomonas spp. if the organisms are found in the pharynx or
esophagus. Jejunal diphtheritic lesions and hemorrhages can be
induced by Clostridium spp.
Chlamydophila (formerly Chlamydia) psittaci, as a possible cause
of respiratory distress, is widespread in various birds (42,46). Its
detection is possible with cell culturing and other techniques.
Laboratory workers must take special precautions to avoid
becoming infected.
Several avian viruses that also induce CPEs and/or intranuclear
inclusions need to be excluded (49,70). These are polyomaviruses
 Chapter 24 Herpesviruses of Free-living and Pet Birds

(especially psittacines), reoviruses, rotaviruses, and adenoviruses
(in many species, particularity in pigeons); paramyxoviruses (in
almost all avian species); orthomyxoviruses (frequent in waterfowl
and gallinaceous birds); togaviruses and coronaviruses (in turkeys);
and also poxiruses (4). Viruses that might be present but do not
necessarily cause CPEs include picomaviruses (in waterfowl and
gallinaceous birds), parvoviruses (in geese and Muscovy ducks),
and some retroviruses (in ducks and turkeys), in psittacines);
Control and vaccination. All HVs are horizontally transmitted via
saliva or droppings. The detection of shedders by virologic
examination of swabs taken from the oropharynx and cloaca (see
above) and separation of shedders from noninfected susceptible
birds greatly helps to reduce fatal infections (23).
Cell-free viruses in the environment are sensitive to inactivation
by ultraviolet light (sunshine) and also heat and chemical
disinfectants (73).
The application of inhibitors of viral DNA synthesis such as
acyclovir and gancyclovir resulted in reduced rates of morbidity and
mortality following experimental exposure of Quaker parakeets
(53). Some strains of pigeon HVs also are sensitive to acyclovir
(65). Biological substances such as various preparations of propolis
and several caffeoylics inhibit the multiplication in vitro and in vivo
of HVs from pigeons and psittacines (35,44). All these drugs need
to be given very early and repeatedly after infection. Local reactions
at the site of injection may occur.
Several attempts have been made to protect psittacines by
adjuvanted vaccines containing partially purified, formol-
inactivated viruses (20,21,29,36,77). The widespread prophylactic
use of such vaccines is limited by several factors. These include the
broad antigenic diversity of psittacine HVs (26,66,67), which
precludes the use of one seed virus for vaccines in all cases and
undesirable side effects such as local inflammatory or
granulomatous to necrotic reactions at the site of inoculation. In
addition, strict but variable governmental regulations for such
’’niche" products in various countries makes it cumbersome for
commercial enterprises to develop and produce these vaccines.
Available information on vaccination-challenge experiments or
seroconversion are promising and favor additional studies on
innocuity, immunogenicity, and duration of protection.

Table 24.1. Updated list of avian herpesviruses (Hvs).

Susceptible bird Provisional HV
Name of (species)/ species Serologically related
No. disease/infection HV isolated from designationA to no. Type of lesion References
1 Marek s disease Chicken GallidHV2 2 Tumorous
Turkey HV
2 infection Turkey, chicken Meleagrid HV 1 1 None
3 Duck viral enteritis Ducks, geese, swans AnatidHVl None Hemorrhagic
Infectious Chicken, pheasants,
4 laryngotracheitis others GallidHVl None Hemorrhagic
5 Pacheco's disease Psittaciformes Psittacid HV 1 20-23, 25 Necrotic 26,61
6 Pacheco's disease Psittaciformes Psittacid HV 2 None Hemorrhagic 26,44
7 Pacheco's disease Psittaciformes Psittacid HV 3 None Necrotic 26, 33
8 Pacheco's disease Psittaciformes Psittacid HV 4 None Necrotic 26
9 Pacheco's disease Psittaciformes Psittacid HV 5 19 Necrotic 26
10 Smadel 's disease Pigeons ColumbidHVl 12,13,14 Necrotic 11,52
Pharyngo
11 esophagitis Pigeons Columbid HV 2 None Necrotic 33
Hepatosplenitis
12 infectiosa strigum Various owls StrigidHVl 10,13,14 Necrotic 6
Inclusion body
13 hepatitis Falcon FalconidHVl 10,12, 14 Necrotic 50, 73
Inclusion body
14 hepatitis Bald eagle nestling Acciprid HV 1 10,12, 13 Necrotic 16
Lake Victoria Phalacrocoracoid
15 None cormorant HV 1 None None® 19
Inclusion body
16 hepatitis Cranes GruidHVl 17 Necrotic 7, 18
17 None Bobwhite quail PercididHVl 16 Necrotic 40
Black and white
18 None storks Ciconiid HV 1 None Necrotic 34,39
Black-footed
19 None penguin Sphenicid HV 1 4? Hemorrhagic 43
20 None Exotic finch EstrildidHV 1 9 Hepatitis 60,71,76
21 None Weaver bird PloceidHVl 5 Hepatitis 60,71
22 None Canary Serinid HV 1 5 None® 27
23 None Exotic finch EstrildidHV 2 5 None® 27
24 None Exotic finch EstrildidHV 3 5 None® 27
25 None Tragopan Tragopanid HV 1 None None® 27
26 None Superb starling Lamprotomid HV 1 5 Hepatosplenitis 27
27 None Toucan Andigenid HV 1 9 Necrotic 9

A Modified from Roizman (49).

B No lesions observed so far

113
Erhard F. Kaleta
REFERENCES
1. Abdala, N. Development of an experimental ELISA for the detection of
antigens and antibodies to the virus of Pacheco disease using monoclonal
antibodies. J. Vet. Med. Ser. B 41:369-380. 1994.
2. Aini, I., L. M Shih, A. E. Castro, and Y. C. Zee. Comparison of
herpesvirus isolates from falcons, pigeons and psittacines by restriction
endonuclease analysis. J. Wildl. Dis. 29:196-202. 1993.
3. Bauer, B., J. E. Lohr, and E. F. Kaleta. Comparison of commercial
ELISA test kits from Australia and the USA with serum neutralization tests
in cell cultures for the detection of antibodies to the infectious
laryngotracheitis virus of chickens. Avian Pathol. 28:65-72. 1999.
4. Bolte, A. L., J. Meurer, and E. F. Kaleta. Avian host spectrum of
avipoxviruses. Avian Pathol. 28:415-432. 1999.
5. Borst, G. H. A., and G. M Lambers. Infectious laryngotracheitis in
peafowl in the Netherlands. Tijdschr. Diergeneeskd. 108:199-200. 1983.
6. Burtscher, H. Die virusbedingte Hepatosplenitis infectiosa strigum 1.
Mitteilung: Morphologische Untersuchungen. Pathol. Vet. 2:227-255. 1965.
7. Burtscher, H., and W. Gruenberg. Herpesvirus-Hepatitis bei Kranichen
(Aves: Gruidae) I. Pathologische Befunde. Zentralbl. Veterinaermed. B
26:561-569. 1979.
8. Calnek, B. W., S. B. Hitchner, and Η. K. Adi dinger. Lyophilization of
cell-free Marek’s disease herpesvirus and herpesvirus of turkeys. Appl.
Microbiol. 20:723-726. 1970.
9. Charlton, B. R., B. C. Barr, A. E. Castro, P. L. Davis, and B. J. Reynolds.
Herpes viral hepatitis in a toucan. Avian Dis. 34:787-790. 1990.
10. Cheeseman, Μ T., and C. Riddell. Esophagitis due to a herpesvirus
associated with mortality in a psittacine aviary. Avian Dis. 39:658-660.
1995.
11. Cornwell, H. J. C., and A. R. Weir. Herpesvirus infection of pigeons.
IV. Growth of the virus in tissue-culture and comparison of its
cytopathogenicity with that of the viruses of laryngotracheitis and pigeon
pox. J. Comp. Pathol. 80:517-523. 1970.
12. Cracraft, J. Avian evolution, Gondwana biogeography and the
Cretaceous-Tertiary mass extinct event. Proc. R. Soc. Lond. B 268:459-469.
2000.
13. Crawshaw, G. J., and B. R. Boycott. Infectious laryngotracheitis in
peafowl and pheasants. Avian Dis. 26:397-401. 1982.
14. Davison, A J. Evolution of herpesviruses. Vet Microbiol. 86:69-88.
2002.
15. Docherty, D. E., and R. I. Romaine. Inclusion body disease in cranes: a
serological follow-up to the 1978 die-off. Avian Dis. 27:830-835. 1983.
16. Docherty, D. E., R. I. Romaine, and R. Night. Isolation of a herpesvirus
from a bald eagle nestling. Avian Dis. 27:1162-1165. 1983.
17. Eskens, U., E. F. Kaleta, and G. Unger. Eine Herpesvirus-bedingte
Enzootie - Pacheco’sche Papageienkrankheit in einem Psittazidenbestand.
Tieraerztl. Prax. 22:542-553. 1994.
18. Foerster, S., C. Chastel, and E. F. Kaleta. Crane hepatitis herpesviruses.
J. Vet. Med. Ser. B 36:433-441. 1989.
19. French, E. L., H. G. Purchase, and K. Nazerian. A new herpesvirus
isolated from a nestling cormorant (Phalacrocorax melanoleucos). Avian
Pathol. 2:3-15. 1973.
20. Fudge, A. M Psittacine vaccines. Vet. Clin. North Am. Small Anim.
Pract. 21:1273-1279. 1991.
21. Gaskin, J. M, D. A. Arnold, and C. M Robbins. An inactivated vaccine
for psittacine herpesvirus infection (Pacheco’s disease). Am. Assoc. Zoo
Vet. Annu. Proc., Arlington, Va. pp. 102-105. 1980.
22. Gaskin, J. Μ, B. Raphael, A. Major, and G. Hall. Pacheco’s disease: the
search for the elusive carrier bird. Am. Assoc. Zoo Vet. Annu. Proc., Seattle,
Wasm. pp. 24-28. 1981.
23. Gerlach, H. Viruses. In: Avian medicine: principles and application. B.
W. Ritchie, G. J. Harrison, and L. R. Harrison, eds. Wingers, Lake Worth,
Fl. pp. 862-948. 1994.
24. Gomez-Villamandos, J. C., E. Mozos, M A. Sierra, and A. Fernandez.
Mortality in psittacine birds resembling Pacheco’s disease in Spain. Avian
Pathol. 20:541-547. 1991.
25. Gough, R. E., and D. J. Alexander. Pacheco’s disease in psittacine birds
m Great Britain 1987 to 1991. Vet. Rec. 132:113-115. 1993.
26. Gravendyck, M, S. Tritt, H. Spenkoch-Piper, and E. F. Kaleta.
Antigenic diversity of psittacine herpesviruses: cluster analysis of antigenic
differences obtained from cross-neutralization tests. Avian Pathol. 25:345-
357. 1996.
27. Gunther, B. M F., B. G. Klupp, M Gravendyck, J. E. Lohr, T. C.
Mettenleiter, and E. F. Kaleta. Comparison of the genomes of 15 avian
114
herpesvirus isolates by restriction endonuclease analysis. Avian Pathol.
26:305-316. 1997.
28. Heffels, U., K. Fritzsche, E. F. Kaleta, and U. Neumann. Serologische
Untersuchungen zum Nachweis virusbedingter Infektionen bei der Taube in
der Bundesrepublik Deutschland. Dtsch. Tieraerztl. Wochenschr. 88:97-
102. 1981.
29. Hitchner, S. B., and B. W. Calnek. Inactivated vaccine for parrot
herpesvirus infection (Pacheco’s disease). Am. J. Vet. Res. 41:1280-1282.
1980.
30. Homer, R. F., Μ E. Parker, E. F. Kaleta, and L. Prozesky. Isolation and
identification of psittacid herpesvirus 1 from imported psittacines in South
Africa. J. S. Afr. Vet. Assoc. 63:59-62. 1992.
31. Johne, R., A. Konrath, M-E. Krautwald-Junghanns, E. F. Kaleta, H.
Gerlach, and H. Muller. Herpesviral, but no papovaviral sequences, are
detected in cloacal papillomas of parrots. Arch. Virol. 147:1869-1880. 2002.
32. Kaleta, E. F. Herpesvirus-induzierte Infektionen und Krankheiten des
Vogels. Tieraerztl. Prax. 11:67-75. 1983.
33. Kaleta, E. F. Infections and diseases of birds caused by alpha- and beta-
herpesvirinae. In: Proc. 3rd International Symposium on Marek’s disease, S.
Kato, T. Horiuchi, T. Mikomi, K. Kirai, eds. Osaka, Japan, Sept. 12-16. pp.
372-388. 1988.
34. Kaleta, E. F. Herpesviruses of birds.—A review. Avian Pathol. 19:193—
211. 1990.
35. Kaleta, E. F. EinfluB von Propolis der Honigbiene (Apis mellifera L.)
auf die Vermehrung einer Klein- und GroB-Plaque-Variante des Tauben-
Herpesvirus in vitro. Tieraerztl. Umsch. 46:553-556. 1991.
36. Kaleta, E. F., and M Bueno Brinkmann. An outbreak of Pacheco’s
parrot disease in a psittacine bird collection and an attempt to control it by
vaccination. Avian Pathol. 22:785-789. 1993.
37. Kaleta, E. F., U. Heffels, U. Neumann, and T. Mikami. Serological
differentiation of 14 avian herpesviruses by plaque reduction tests in cell
cultures. In: Proceedings of the 2nd International Symposium of Veterinary
Laboratory Diagnosticians, Lucerne, Switzerland. June 24—26, 1:38-41.
1980.
38. Kaleta, E. F., T. Mikami, H.-J. Marschall, U. Heffels, M Heidenreich,
and B. Stiburek. A new herpesvirus isolated from black storks (Ciconia
nigra). Avian Pathol. 9:301-310. 1980.
39. Kaleta, E. F., and N. Kummerfeld. Persistent viraemia of a cell-
associated herpesvirus in white storks (Ciconia ciconia). Avian Pathol.
15:447-453. 1986.
40. Kaleta, E. F., H.-J. Marschall, G. Gluender, and B. Stiburek. Isolation
and serological differentiation of a herpesvirus from bobwhite quail (Colinus
virginianus,L. 1758). Arch. Virol. 66:359-364. 1980.
41. Kaleta, E. F. and T. Redmann. Die infektiose Laryngotracheitis bei
Huhn, Pfau und Fasan sowie Moglichkeiten und Grenzen ihrer Bekampfung
durch attenuierte Lebendimpfstoffe. Tieraerztl. Prax. 25:605-610. 1997.
42. Kaleta, E. F. and E. M A. Taday. Avian host range of Chlamydophila
spp. based on isolation, antigen detection and serology. Avian Pathol.
32:435462.
43. Kincaid, A. L., and M Cranfield. Herpesvirus-like infection in black­
footed penguins (Speniscus demersus). J. Wildl. Dis. 24:173-175. 1988.
44. Koenig, B., and J. H. Dustmann. The caffeoylics as a new family of
natural antiviral compounds. Naturwissenschaften 72:659-661. 1985.
45. Krautwald, M-E., S. Foerster, W. Herbst, B. Schildger, and E. F.
Kaleta. Nachweis eines neuen Herpesvirus bei einem ungewohnlichen Fall
von Pachecoscher Krankheit bei Amazonen und Graupapageien. J. Vet.
Med. Ser. B 35:415^120. 1988.
46. Krautwald-Junghanns, M-E., F. Schumacher, and B. Tellhelm
Evaluation of the lower respiratory tract in psittacines using radiology and
computed tomography. Vet. Radiol. Ultrasound 34:382-390. 1993.
47. Krautwald-Junghanns, Μ E., E. F. Kaleta, R. E. Marschang, and K.
Pieper. Untersuchungen zur Diagnostik und Therapie der Papillomatose des
aviaren Gastrointestinaltrakts. Tieraerztl. Prax. 28:272-278. 2000.
48. Lancz, G. J. Rapid method for the concentration and partial purification
of herpes simplex viruses types 1 and 2. Arch. Gesamte Virusforsch.
42:303-306. 1973.
49. Lee, L. F., R. L. Armstrong, and K. Nazerain. Comparative studies of
six avian herpesviruses. Avian Dis. 16:799-805. 1972.
50. Louzis, C., and J. P. Gollet. Mortalite d’etiologie complexe dans une
population de psittacides: epidemiologie, clinique et recherche etiologique.
Rev. Med. Vet. (Toulouse) 136:639-643. 1985.
51. Mare, C. J., and D. L. Graham. Falcon herpesvirus, the etiologic agent
of inclusion body disease of falcons. Infect. Immun. 8:118-126. 1973.
52. Murphy, F. A., C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W.
Jarvis, G. P. Martelli, M A. Mayo, and M D. Summers, eds. Virus

taxonomy. In: Classification and nomenclature of viruses. Sixth Report of
the International Committee on Taxonomy of Viruses. Springer-Verlag,
Vienna, Austria, pp. 114-127. 1995.
53. Norton, T. M, J. Gaskin, G. V. Kollias, B. Homer, C. H. Clark, and R.
Wilson. Efficacy of acyclovir against herpesvirus infection in Quaker
parakeets. Am. J. Vet. Res. 52:2007-2009. 1991.
54. Pacheco, G., and O. Bier. Epizootie chez perroques du Bresil. Relations
avec la psittacose. C. R. Seances Soc. Biol. 105:109-111. 1930.
55. Phalen, D. N., E. Tomaszewski, and G. Wilson. Internal papillomatosis:
A herpesvirus connection? Proc. Ann. Conf. Assoc. Avian Vet., pp. 45-46.
1998.
56. Plummer, P. J., T. Alefantis, S. Kaplan, P. O’Connell, S. Shawky, and
K. A. Schat. Detection of duck enteritis virus by polymerase chain reaction.
Avian Dis. 42:554-564. 1998.
57. Potgieter, L. N. D., A. A. Kocan, and K. M Kocan. Isolation of a
herpesvirus from American kestrel with inclusion body disease. J. Wildl.
Dis. 15:143-149. 1979.
58. Purchase, H. G., C. J. Mare, and B. R. Burmester. Antigenic comparison
of avian and mammalian herpesviruses and protection tests against Marek’s
disease. In: Proceedings of the 76th Annual Meeting U. S. Animal Health
Association, Miami Beach, Fla., Nov. 5-10. pp. 484-^492. U.S. Animal
Health Association, Richmond, Va. 1972.
59. Ramis, A., D. Fondevila, J. Tarres, and L. Ferrer. Immunocytochemical
diagnosis of Pacheco’s disease. Avian Pathol. 21:523-527. 1992.
60. Roizman, B. The family herpesviridae: general description, taxonomy,
and classification. In: The herpesviruses, vol. 1. B. Roizman, ed. Plenum
Press, New York, N. Y. pp. 1-23. 1982.
61. Schoenbauer, M, and H. Koehler, fiber eine Virusinfektion bei
Prachtfinken (Estrildidae). Kleintierpraxis 27:149-152. 1982.
62. Simpson, C. F., J. E. Hanley, and J. M Gaskin. Psittacine herpesvirus
infection resembling Pacheco’s parrot disease. J. Infect. Dis. 131:390-396.
1975.
63. Smadel, J. E., E. B. Jackson, and J. W. Harman. A new virus disease of
pigeons. I. Recovery of the virus. J. Exp. Med. 81:385-398. 1945.
64. Styles, D. K., E. K. Tomaszewaski, L. A. Jaeger, and D. N. Phalen.
Psittacid herpesviruses associated with mucosal papillomas in neotropical
parrots. Virology 325:24-35. 2004.
115
Chapter 24 Herpesviruses of Free-living and Pet Bink
65. Thiry, E., H. Vindevogel, P. Leroy, P.-P. Pastoret, A. Schwers, BL
Brochier, Y. Anciaux, and P. Hoyois. In vivo and in vitro effect of acydovir
on pseudorabies virus, infectious bovine rhinotracheitis virus and pigeon
herpesvirus. Ann. Rech. Vet. 14:239-245. 1983.
66. Tomaszewski, E. K., G. van Wilson, W. L. Wigle, and D. N. Phaten
Detection of hetero-geneity of herpesviruses causing Pacheco’s disease b
parrots. J. Clin. Microbiol. 39:533-538. 2001.
67. Tomaszewski, E. K., E. F. Kaleta, and D. N. Phalen. Molecular
phylogeny of the psittacid herpesviruses causing Pacheco’s disease
correlation of genotype with phenotypic expression. J. Virol. 77:11260-
11267. 2003.
68. Tomaszewski, E. K., M Gravendyck, E. F. Kaleta, and D. N. Phalen.
Genetic characte-rization of a herpesvirus isolate from a superb starling
(Lamprotornis superbus) as a psittacid herpesvirus genotype 1. Avian Dis.
48:212-214. 2004.
69. Tsai, S. S., J. H. Park, K. Hirai, and C. Itakura. Herpesvirus infections in
psittacine birds in Japan. Avian Pathol. 22:141-156. 1993.
70. Van Deventer, D. R., P. Warrener, L. Bennett, E. R. Schultz, S. Coulter,
R. L. Garber, and T. M Rose. Detection and analysis of diverse herpesviral
species by consensus primer PCR. J. Clin. Microbiol. 34:1666-1671. 1996.
71. Vindevogel, H., L. Dagenais, B. Lansival, and P. P. Pastoret. Incidence
of rotavirus, adenovirus and herpesvirus infection in pigeons. Vet. Rec.
109:285-286. 1981.
72. von Rotz, A., A. Ruebel, F. Mettler, and R. Hoop. Letal verlaufende
Herpesvirusinfektion bei Goldsamadinen (Chloebia Gouldinae [Gould]).
Schweiz. Arch. Tierheilkd. 126:651-658. 1984.
73. Wagner, U. Vergleichende Untersuchungen zur Empfindlichkeit
verschiedener aviarer Herpesvirusisolate gegeniiber chemischen
Desinfektionsmitteln. Veterinarxy Medical Thesis. Giessen, Germany. 1993.
74. Ward, F. P., D. G. Fairchild, and J. V. Vuicich. Inclusion body hepatitis
in prairie falcon. J. Wildl. Dis. 7:120-124. 1971.
75. Watanabe, T., and H. Ohmi Susceptibility of guinea fowl to the virus of
infectious laryngotracheitis and egg-drop syndrome—1976. J. Agric. Sci.
Tokyo Nogyo Daigaku 28:193-200. 1983.
76. Wellehan, J. F. X., M Gagea, D. A. Smith, W. M Taylor, Y. Berhane,
and D. Bienzle. Characterization of a herpesvirus associated with tracheitis
in Gouldian finches (Erythrura [Chloebia} gouldiae). J. Clin. Microbiol.
41:4054-4057. 2003.
Π. York, S. M, and C. J. York Pacheco virus vaccine studies—A
preliminary report. In: Proceedings of the 32rd Western Poultry Disease
Conference, Davis, Calif. February 8-10. pp. 101-102. 1983.
 25
POX
Deoki N. Tripathy and Willie M. Reed

SUMMARY. Avian pox is a common viral disease of domestic birds (chickens, turkeys, pigeons, canaries) and wild birds. Approximately
232 species in 23 orders of birds have been reported to acquire natural poxvirus infection. Avian pox is a slow-spreading disease
characterized by the development of proliferative skin lesions (cutaneous form) and/or upper digestive and respiratory tract lesions
(diphtheritic form). The causative agent is a double-stranded DNA virus of the genus Avipoxvirus of the family Poxviridae.
Agent Identification. Pox is routinely diagnosed by histologic examination of proliferative skin, oral, or tracheal lesions for cytoplasmic
inclusion bodies in tissue sections, or viral particles exhibiting typical poxvirus morphology using electron microscopy. The virus is isolated
by inoculation of chorioallantoic membranes (CAMs) of 9 to 12-day embryonating chicken eggs. Pocks develop on the CAM in 5-7 days.
The etiology is confirmed by histopathologic or ultrastructural examination of the CAM lesions for cytoplasmic inclusions or viral particles
with typical poxvirus morphology, respectively.
Immunoperoxidase or indirect fluorescent antibody and agar-gel immunodiffusion (AGID) tests can also be used to detect pox viral antigen
in tissue samples. Antigenic differences among isolates can be determined by immunoblotting, host pathogenicity, and virus neutralization.
Isolated viruses can be evaluated for pathogenicity for susceptible hosts or for susceptibility in avian cell culture. Molecular characterization
is done by restriction fragment length polymorphism (RFLP) analysis of viral genome, polymerase chain reaction (PCR) amplification of
specific genomic fragments and nucleotide sequence determination of the genome or selected fragments.
Serologic Detection in the Host. Serologic detection of infection may be important in experimental studies and for measuring the immune
responses following vaccination. Antibody responses can be measured by AGED, passive hemagglutination, immunoperoxidase, and enzyme-
linked immunosorbent assay (ELISA). Monoclonal antibodies against fowlpox have been used in experimental studies to differentiate strains
of fowlpox virus.
Modified live virus vaccines (fowl pox, pigeon pox, canary pox, turkey pox, and quail pox viruses) of chick-embryo or cell-culture origin
are available commercially.

INTRODUCTION becomes yellowish brown to dark brown. Removal of such lesions

Approximately 232 species in 23 orders of birds have been
reported to acquire a natural poxvirus infection (2). Although the
number of distinct causative agents is unknown, all of them belong
to the genus Avipoxvirus of the family Poxviridae. This genus
includes fowl, turkey, pigeon, canary, and quail viruses, as well as
other avianpox viruses. Fowlpox virus is a common pathogen of
chickens and turkeys. The infection is generally manifested as either
cutaneous or diphtheritic forms, although both types of the disease
may occur in the same bird. In addition, an acute systemic form of
pox is seen in canaries and results in high mortality. All forms of
the disease (acute systemic, cutaneous, and diphtheritic) occurring
either singly or in combination have been observed in canaries (4).
In the cutaneous form, proliferative lesions are primarily confined
to unfeathered areas of skin (e.g., legs, head, and eyelids), whereas
in the much more lethal diphtheritic form, the lesions are found in
the mouth, esophagus, and trachea. The acute systemic form of pox
in canaries is characterized by fibrinous inflammation of serous
membranes, pulmonary edema, and fibrinous pneumonitis. Because
of the economic importance of this disease in commercial poultry,
fowl pox virus and pigeon pox virus vaccines of chorioallantoic
membrane (CAM) or cell-culture origin have been used for more
than 60 yr. In recent years, turkey, canary and quail virus vaccines
have also become available commercially. In spite of regular
vaccination, outbreaks of fowlpox have occurred in all regions of
the US in previously vaccinated chicken flocks.
CLINICAL DISEASE
The cutaneous form of pox is characterized by development of
nodular lesions on various parts of unfeathered skin. A mild form of
the disease may remain unnoticed, with only small focal lesions,
usually on the comb and wattles. In the severe form of the disease,
generalized lesions may occur on any part of the body, such as the
comb, wattle, comer of the mouth, around the eyelids, the angle of
the beak, the ventral surface of the wings, and the vent. Skin lesions
may be small and discrete or may involve large areas through the
coalescence of adjoining lesions. The surface of lesions is moist for
a short time but dries soon, with a rough, irregular surface that
116
before they are not completely dry leaves a hemorrhagic, moist
surface. When the scab is dry it drops off, leaving a scar.
In the diphtheritic form of pox, lesions occur on the mucous
membrane of the mouth, nares, pharynx, larynx, esophagus, or
trachea. Mouth lesions can interfere with feeding. Tracheal lesions
can cause difficulty in breathing and may simulate signs of
infectious laryngotracheitis in chickens. In layers, the disease causes
a drop in egg production, and in young chicks it reduces growth.
Death occurs in cases with the generalized infection or diphtheritic
form of the disease. The acute systemic disease caused by canary
poxvirus results in high mortality in susceptible canaries. Although
all avian species appear susceptible to pox (29), only fowl poxvirus
has been studied extensively.
SAMPLE COLLECTION
Poxviruses are readily isolated from the nodular lesions of infected
birds. Tissues with lesions, preferably recently developed lesions,
can be removed with sterile scissors and forceps by cutting deep
into the epithelial tissue. The material is ground with either sterile
fine sand or 60-mesh aluminum oxide (Norton Alundum; Fisher
Scientific Co., Pittsburgh, PA) with a sterile mortar and pestle or in
a glass grinder. Hanks’ balanced salt solution, saline solution, or
broth is added to make a 10% suspension. The suspension is
centrifuged for 10 min at about 700 x g to remove large tissue
particles. Antibiotics (penicillin and streptomycin) are added to the
supernatant to give respective final concentrations of 1000 IU/ml
and 1 mg/ml, and the suspension is held at room temperature for 30
min to 1 hr before inoculation. A piece of tissue should also be
collected (in 10% neutral buffered formalin) for histopathologic
examination to reveal cytoplasmic inclusion bodies or for
transmission electron microscopy (TEM) to demonstrate virus
particles by negative staining or in ultrathin sections. Serum
samples may be collected to determine previous exposure by
serologic tests.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Poxviruses can be isolated by inoculating the suspect material in

embryonating eggs, susceptible birds, or cell cultures (e.g., chick
embryo kidney cells, chick embryo dermal cells, or quail cells).
Embryo inoculation
The preferred and most convenient hosts are 9 to 12-day-old
embryonating chicken embryos from a specific-pathogen-free flock.
About 0.1 ml of the virus suspension is inoculated on the CAM.
Inoculated embryos are incubated at 37 C for 5-7 days and then
examined for pocks on the CAM. Pox lesions appear as either focal
white opaque pocks or a generalized thickening of the CAM.
Specific diagnosis requires either histologic demonstration of
cytoplasmic inclusion bodies, or viral particles by TEM, or
detection of specific poxvirus antigen in the CAM lesions.
Occasionally, some strains from wild and pet birds fail to grow on
the CAM and may require adaptation.
Chicken inoculation
The suspension made from a lesion is either applied to the comb,
which is then scarified, or applied with a brush to denuded feather
follicles (pluck 5 or 6 feathers). Similarly, wing web is another
suitable site that can be used for inoculation. Susceptible chickens
develop lesions at the site of inoculation in 5-10 days. Later,
generalized lesions may appear during the disease, especially with
virulent field strains. The disease is more severe in susceptible
young birds than in older birds.
Cell culture
Primary chick embryo, chick embryo kidney, chick embryo
dermis, duck embryo, and secondary quail (QT-35) or LMH cells
(16) support the growth of fowl poxvirus, producing a cytopathic
effect (CPE), usually in 4-6 days, although CPE may occur earlier
with high-titer inocula. The cells often become round and refractile,
followed by degeneration. The virus produces plaques in agar-
overlaid monolayers of chick embryo cells or quail (QT-35) cells.
Plaques are produced in 3-5 days in QT-35 cells. Adaptation of
strains to cell culture is necessary for plaque formation, because not
all strains form plaques. The method has been considered unsuitable
for titration of fowl poxvirus, because it is less sensitive than pock
formation on the CAM (12).
AGENT IDENTIFICATION
Physicochemical, Morphologic, and Biological Properties
Fowl poxvirus, the type species of the genus Avipoxvirus, is a
brick-shaped to rectangular virus. Other species of the genus are
morphologically similar. Complete nucleotide sequence of the
genomes of fowlpox virus and canary pox virus has been
determined. The genome of fowl poxvirus is composed of a single
double-stranded DNA molecule of approximately 288 kilobases (1).
The genome of canary poxvirus is 365 kbp (30).
Fowl poxvirus is resistant to ether. It is inactivated by 1% caustic
potash when separated from its matrix. It withstands 1% phenol and
0.1% formalin for 9 days. Inactivation occurs by heating at 50 C for
30 min or 60 C for 8 min. Trypsin has no effect on the DNA or
whole virus. Fowl poxvirus can survive in dried scabs for months or
even years. In this regard, the presence of photolyase gene in the
genome of fowlpox virus appears to play some role in virus
persistence (21, 22). The virus multiplies in the cytoplasm of
infected cells and forms inclusion bodies (Bollinger bodies) that
contain the elementary bodies (Borrel bodies). It causes
proliferation of the epithelium with ballooning degeneration of the
cells and ultimately epithelial cell death. The cytoplasmic type-A
inclusions vary in size and shape and can be demonstrated in
histologic sections of skin, or in diphtheritic or CAM lesions. The
inclusions can be stained by hematoxylin and eosin, acridine
orange, and Giemsa stains and the Feulgen reactions. The
specificity of the viral inclusions can be determined also by
117
Chapter 25 Pox
fluorescent antibody and immunoperoxidase methods (27). Viral
antigen can be detected in lesions by indirect fluorescent antibody
or immunoperoxidase tests using specific antiserum.
A quick method for diagnosis of avian pox uses simultaneous
fixation and dehydration and demonstrates cytoplasmic inclusion in
less than 3 hr (17). Elementary bodies can be demonstrated in
impression or squash-preparation smears stained by the Gimenez
method (25). Negative-contrast TEM can be used for direct
demonstration of viral particles in clinical material, pocks in CAM,
or cultured cells (11).
Antigen Detection in Tissues
Poxviral antigens can be detected in cytoplasmic inclusions of
infected cells (cutaneous or cultured) by direct or indirect
immunofluorescent or immunoperoxidase microscopy using
specific primary antiserum. Appropriate samples would include
fowlpox-infected CAM, skin, or cell culture (27). The
immunoperoxidase technique has the advantage of using a light
microscope and sections can be stored for more than 2 mo without
loss of staining.
Molecular Identification
Restriction fragment length polymorphism has been used for
comparing closely related DNA genomes (7, 16, 24). In this regard,
genomic profiles of quail, canary, mynah and poxviruses from
Hawaiian endangered forest birds are different from those of fowl
poxvirus (9, 24,28).
Cloned genomic fragments of fowl poxvirus can be used
effectively as nucleic acid probes for diagnosis (5). In this
procedure, viral DNA isolated from legions is hybridized either with
32P-labeled or nonradioactive-labeled genomic probes. This method
is especially useful for differentiation of the diphtheritic form of
fowlpox from infectious laryngotracheitis when tracheal lesions are
present (5).genomic DNA sequences of various sizes can be
amplified by polymerase chain reaction (PCR) using specific
primers (8, 10, 18, 24). This technique is very sensitive, especially
when an extremely small amount of virus is present in the sample.
Complete nucleotide sequence of a vaccine like fowlpox virus (1)
and canarypox virus (30) has been determined. Molecular analysis
reveals that while most strains of fowlpox virus from field isolates
have integrated reticuloendotheliosis virus (REV) in their genome,
the vaccine strains of fowlpox virus contain remnants of long
terminal repeats (LTR) of REV (6, 18, 19, 23).
SEROLOGICAL DETECTION IN THE HOST
Agar Gel Immunodiffusion Test
Precipitating antibodies can be detected by reacting test sera against
viral antigens (25). The antigen can be derived by sonication and
homogenization of infected skin or CAM lesions, as well as by
treatment of infected cell cultures as described for ELISA. The
lysed cell suspension is centrifuged and the supernatant is used as
antigen. Gel-diffusion medium is prepared with 1% agar, 8%
sodium chloride, and 0.01% thimersol. The viral antigen is placed
in the central well and the test sera are placed in the peripheral
wells. It is important to include a positive and negative control
serum. The plates are incubated at room temperature. Precipitation
lines develop in 24-48 hr after incubation of the antigen with
antibody to homologous or closely related strains. The test is less
sensitive than the ELISA (3) or die passive hemagglutination test
(26, 29).
Passive Hemagglutination
Antibodies against fowl poxvirus can be measured by a passive
hemagglutination test using tanned horse or sheep erythrocytes (26)
coated with fowl poxvirus antigen. Passive hemagglutinating
antibodies are detectable in some sera of infected birds as early as
Deoki N. Tripathy and Willie M. Reed
1 wk after inoculation and may persist for 15 wk; that is, longer
than precipitating antibodies. Cross-reactions occur among avian
poxviruses.
Virus Neutralization
Virus-neutralizing antibodies usually appear 1-2 wk after natural
infection or experimental inoculation. The antibody response can be
measured either by pock reduction in CAMs or plaque reduction in
cell cultures (12).
ELISA
ELISA is a sensitive method to measure humoral antibody
responses (3), and antibodies can be detected by 7 days after
infection. Fowlpox virus antigens are prepared from either infected
QT-35 cell monolayers or CAM lesions. Infected cells are pelleted
(700 x g for 10 min at 4 C), washed with isotonic buffer (10 mM
Tris, pH 8.0, 150 mM NaCl, 5 mM ethylenediamine tetraacetic acid
[EDTA]) followed by lysis in hypotonic buffer (10 mM Tris, pH
8.0, 10 mM KC1, 5 mM EDTA) containing 0.1% Triton X-100 and
0.025% beta-mercaptoethanol. Nuclei and cellular debris are
removed by low-speed centrifugation (500 x g for 5 min at 4 C) and
the resulting supernatant is used as a source of fowlpox virus
antigens for ELISA or immunoblotting. To isolate viral antigen
from CAM lesions, initial grinding of the lesions with subsequent
detergent treatment as described earlier would be required. Virus
propagated in chicken embryo fibroblasts and chicken embryo
dermis cells has also been used for antigen.
Strain Variability
Fowlpox virus is the type species of the Avipoxvirus genus and
has been studied more extensively than other members of this genus
(i.e., pigeon, canary, turkey, sparrow, junco, quail, mynah and other
avian poxviruses). Differentiation of fowl, turkey, canary, and
pigeon poxviruses on the basis of their pathogenicity for the host
spectrum has been attempted. Although some strains show
pathogenicity for several host species, others either are host-specific
or infect a limited number of species (14, 15). Because natural pox
infections have been reported in several species of wild birds of
different families, as well as in domestic birds, it appears that all
avian species are susceptible to avian pox.
Minor antigenic differences in strains of fowl poxvirus can be
detected by sodium dodecyl sulfate-polyacrylamide gel
electrophoresis and immunoblotting (7, 9, 16, 24), although the
majority of the antigens are cross-reactive. Antigenic profiles of
quail poxvirus and isolates from Hawaiian forest birds are
remarkably different from fowl poxvirus.
Comparison of the genomic profile of fowl, pigeon, and junco
poxviruses after digestion of their DNA with restriction enzymes
and agarose gel electrophoresis revealed that the majority of DNA
fragments co-migrate. However, most isolates could be
distinguished by the presence or absence of one or more DNA
fragments (9, 16, 24). On the other hand, genomic profiles of quail,
canary, mynah and Hawaiian bird poxviruses are different from
profiles of fowl poxvirus (7, 9, 28).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The diphtheritic form of pox in birds with associated respiratory
signs must be differentiated from other respiratory infections,
especially infectious laryngotracheitis, an infection caused by a
herpesvirus that produces intranuclear inclusions (5). Oral lesions
caused by vitamin A, pantothenic acid and biotin deficiency in
young chicks or by T-2 toxin may be mistaken for pox lesions.
Diphtheritic pox lesions in doves and pigeons may be mistaken for
lesions of Trichomonas gallinae, which are diagnosed by
microscopic examination of smears or by culture (29).
118
REFERENCES
1. Afonso, C. L., E. R Tulman, Z. Lu, L. Zsak, G. F. Kutish, and D. L.
Rock. The genome of fowlpox virus. J. Virol. 74:3815-3831, 2000.
2. Bolte, A. L., J. Meurer, and E. F. Kaleta. Avian host spectrum of
avipoxviruses. Avian Pathol. 28:415-432, 1999.
3. Buscaglia, C., R. A. Bankowski, and L. Miers. Cell-culture virus­
neutralization test and enzyme-linked immunosorbent assay for evaluation
of immunity in chickens against fowlpox. Avian Dis. 29:672-680, 1985.
4. Donnelly, T. M., and L. A Crane. An epomitic of avian pox in a research
aviary. Avian Dis. 28:517-525,1984.
5. Fatunmbi, Ο. O., W. M Reed, D. L. Schwartz, andD. N. Tripathy. Dual
infection of chickens with pox and infectious laryngotracheitis (ILT)
confirmed with specific pox and ELT DNA DOT-BLOT hybridization
assays. Avian Dis. 39:925-930,1995.
6. Garcia, Μ, N. Narang, W. M Reed, and A. M Fadly. Molecular
characterization of reticuloendotheliosis virus insertions in the genome of
field and vaccine strains of fowlpox virus. Avian Dis. 47:343-354,2003.
7. Ghildyal, N., W. M Schnitzlein, and D. N. Tripathy. Genetic and
antigenic differences between fowlpox and quailpox viruses. Arch. Virol.
106:85-92,1989.
8. Kim, T. J., and D. N. Tripathy. Reticuloendotheliosis virus integration in
the fowlpox virus genome: not a recent event. Avian Dis. 45:663-669,2001.
9. Kim, Tae-Joong, W. M Schnitzlein, D. McAloose, A. P. Pessier, and D.
N. Tripathy. Characterization of an avian pox virus isolated from an Andean
Condor Vultur gryphus. Veterinary Microbiology 96:237-246, 2003.
10. Lushow, D., T. Hoffman, and Η. M Hafez. Differentiation of avianpox
virus strains on the basis of nucleotide sequences of the 4b gene fragment.
Avian Dis. 48:453-463, 2004.
11. McFerran, J. B., J. K. Clarke, and W. L. Curran. The application of
negative contrast electron microscopy to routine veterinary virus diagnosis.
Res. Vet. Sci. 12:253-257,1971.
12. Morita, C. Studies on fowlpox viruses. Π» Plaque-neutralization test.
Avian Dis. 7:93-98,1973.
13. Moyer, R. W., Β. M Arif, D. N. Black, D. B. Boyle, R. M Buller, K. R.
Dumbell, J. J. Esposito, G. McFadden, B. Moss, A. A. Mercer, S. Ropp, D.
N. Tripathy, and C. Upton. Family Poxviridae. In: Virus Taxonomy:
Classification and Nomenclature of Viruses. Seventh Report of the
International Committeee on Taxonomy of Viruses. Academic Press, San
Diego, pp. 137-157,2000.
14. Reed, W. M, and Ο. O. Fatunmbi. Pathogenicity and immunological
relationship of quail and mynah poxviruses to fowl and pigeon poxviruses.
Avian Pathol. 22:395-400,1993.
15. Reed, W. M, and D. L. Schrader. Immunogenicity and pathogenicity of
mynah pox virus in chickens and bobwhite quail. Poult. Sci. 68:631-638,
1989.
16. Schnitzlein, W. Μ, N. Ghildyal, and D. N. Tripathy. Genomic and
antigenic characterization of avipoxviruses. Virus Res. 10:65-76,1988.
17. Sevoian, M A quick method for the diagnosis of avian pox and
infectious laryngotracheitis. Avian Dis. 4:474-477,1960.
18. Singh, P., T. J. Kim, and D. N. Tripathy. Re-emerging fowlpox:
evaluation of isolates from vaccinated flocks. Avian Pathol. 29:449-455,
2000.
19. Singh, P., W. M Schnitzlein, and D. N. Tripathy. Reticuloendotheliosis
virus sequences within the genomes of field strains of fowlpox virus display
variability. J. Virol. 77:585-586, 2003.
20. Singh, P., T.-J. Kim, and D. N. Tripathy. Identification and
characterization of fowlpox virus strains using monoclonal antibodies. J.
Vet. Diag. Invest. 15:50-54, 2003.
21. Srinivasan, V., W. M Schnitzlein, and D. N. Tripathy. Fowlpox virus
encodes for a novel DNA repair enzyme that restores infectivity of UV-light
damaged virus. J. Virol. 75:1681-1688,2001.
22. Srinivasan, V., and D. N. Tripathy. The DNA repair enzyme, CPD-
photolyase restores the infectivity of UV-damaged fowlpox virus isolated
from infected scabs of chickens. Veterinary Microbiology 108:215-223,
2005.
23. Tadese, T., and W. M Reed. Detection of specific reticuloendotheliosis
virus sequence and protein from REV-integrated fowlpox virus strains. J.
Virol. Meth. 110(l):99-104, June 9, 2003.
24. Tadese, T., and W. M Reed. Use of restriction fragment length
polymorphism, immunoblotting and polymerase chain reaction in the
differentiation of avianpox viruses. J. Vet. Diag. Invest. 15:141-150,2003.
25. Tadese, T., E. A. Potter, and W. M Reed. Development of a mixed agar
gel enzyme assay (AGEA) for the detection of antibodies to poxvirus in
chicken and turkey sera. J. Vet. Med. Sci. 65:255-258,2003.

26. Tripathy, D. N., and L. E. Hanson. A smear technique for staining
elementary bodies of fowlpox. Avian Dis., 20:609-610,1976.
27. Tripathy, D. N., L. E. Hanson, and W. L. Myers. Passive
hemagglutination test with fowlpox virus. Avian Dis. 14:29-38,1970.
28. Tripathy, D. N., L. E. Hanson, and A. H. Killinger. Immunoperoxidase
technique for detection of fowlpox antigen. Avian Dis. 17:274-278,1973.
29. Tripathy, D. N., W. M Schnitzlein, P. J. Morris, D. L. Janssen, J. K.
Zuba, G. Massey, and C. T. Atkinson. Characterization of poxviruses from
forest birds in Hawaii. J. Wildl. Dis. 36:225-230,2000.
119
Chapter 25 Pox
30. Tripathy, D. N., and W. M Reed. Pox. In: Diseases of Poultry, 11th Ed.
Y. M. Saif, H. J. Bames, B. W. Calneck, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, Eds. Iowa State University Press, Ames, pp.
253-269, 2003.
31. Tulman, E. R., C. L. Afonso, Z. Lu, G. F. Kutish, and D. L. Rock. The
genome of canarypox virus. J. Virol. 78:353-366,2004.
 26
BUDGERIGAR FLEDGLING DISEASE AND OTHER
AVIAN POLYOMAVIRUS INFECTIONS
Branson W. Ritchie and Phil D. Lukert

SUMMARY. Avian polyomavirus, which belongs to the family Papovaviridae, genus Polyomavirus, causes acute, highly fatal disease in
many young psittacines.
Agent Identification. Detection of target segments of viral nucleic acid is most easily made by submitting tissues or swabs for polymerase
chain reaction (PCR) based testing. Culture of the virus may be done in budgerigar embryo cell cultures initially, followed by culture in
chicken embryo fibroblast cell cultures.
Serologic Detection in the Host. The virus-neutralization test is the serologic test of choice. Confirmation of disease in birds with
characteristic clinical or gross lesions requires demonstration of viral nucleic acid by in situ hybridization, immunohistochemical staining for
viral proteins or documentation of viral particles by electron microscopy.

INTRODUCTION
Avian polyomavirus (family Papovaviridae, genus Polyomavirus)
causes an acute, highly fatal disease in budgerigar fledglings as well
as peracute, acute, or chronic infections of many other species of
psittacine birds. Disease is most common in young birds but has also
been documented in adults. In budgerigars the mortality rate can vary
from 25 to 100%. Substantial evidence exists that the virus is egg-
transmitted, because intranuclear inclusion bodies are observed in 1-
day-old fledglings. All psittacines should be considered susceptible
to natural infection, but some species develop clinical disease more
readily than others. Passeriformes and some species of
Falconiformes are also affected by avian polyomavirus. Gallinaceous
birds are susceptible to natural infection by avian polyomavirus, but
clinical disease has only been described experimentally in severely
immunocompromised animals. Antibodies generated against
psittacine polyomavirus cross-react with the polyomavirus of
finches; however, nucleic acid sequences of these viruses differ.
Avian polyomavirus differs from mammalian polyomaviruses in
pathogenicity. Polyomaviruses of mammals typically produce
disease only in immunocompromised hosts.
CLINICAL DISEASE
Budgerigars
Acute fatal infections usually occur in fledglings from 1 to 15 days
of age. Affected fledglings may die suddenly with no premonitory
signs or they may exhibit abdominal distention, subcutaneous
hemorrhages, and reduced feather formation. Some birds develop
neurologic signs with ataxia and tremors of the head and neck
several days before death. The death rate is highest in birds affected
at an age of less than 15 days. After 15 days, birds that develop
clinical signs may survive and develop feather abnormalities. Avian
polyomavirus is considered to be one cause of French molt in
budgerigars (1,3).
Nonbudgerigar Psittacine Birds
Both young and adult nonbudgerigar psittacine birds can experience
clinical infections with avian polyomavirus. Although most
infections are subclinical, the disease can be severe and often fatal in
young birds. The peracute form with no premonitory signs is most
common in young birds and as the age increases the acute form is
usually observed. The signs include depression, anorexia, weight
loss, diarrhea, subcutaneous hemorrhages, and dehydration. Birds
normally die within 12^18 hr after developing clinical signs.
Posterior paresis and paralysis within 18 hr of the onset of the
disease is suggestive of polyomavirus infections. Eclectus parrots
and caiques appear to be highly susceptible to disease (4).
In addition to the peracute and acute forms a chronic/progressive
disease has been described and is typified by weight loss, polyuria,
poor feather formation, and recurring bacterial or fungal infections.
120
Birds recovering from the chronic form appear normal, although
some may die months later from kidney failure (4).
SAMPLE COLLECTION
For virus isolation a pool of liver, kidney, spleen, and heart tissues
should be collected and submitted frozen in a plastic bag. Submit
tissue from dying or recently dead birds. Serum samples for serology
may be collected in capillary tubes, centrifuged to separate the
erythrocytes, and stored or shipped under refrigeration (4).
For the detection of viral DNA by PCR-based testing, cloacal swabs
from live birds or swabs of tissue sampled at necropsy are preferred.
Swabs used to culture bacteria are adequate and should be encased in
a protective holder. Swabs used for anaerobic bacterial culture with
gel-type transport media may interfere with the assay and should not
be used (4).
PREFERRED CULTURE MEDIA AND SUBSTRATES
The method of choice for isolation of virus is described by
Bozeman et al (2). A 10% homogenized tissue suspension in cell
culture medium containing antibiotics is prepared, and a monolayer
of budgerigar embryo fibroblast (BEF) cells is inoculated. After
several passages in BEF cells at 4- or 5-day intervals, most isolates
will replicate in chick embryo fibroblast (CEF) cell cultures. The
BEF cell cultures are prepared from 10 to-16-day-old budgerigar
embryos. The medium used is 60% Ham’s F-10 with glutamine and
40% M-199 with Hanks’ salts with glutamine. This medium is
enriched with 4% tryptose phosphate broth and 5% fetal bovine
serum for growth. Maintenance medium has the fetal bovine serum
reduced to 2%.
AGENT IDENTIFICATION
Cell Culture Properties
Cells with enlarged nuclei are first seen 48 hr postinfection with
avian polyomavirus. By 72-96 hr, the cells begin to round up and are
swollen, with greatly enlarged nuclei. Cells fixed and stained with
Giemsa stain exhibit large, clear intranuclear inclusion bodies with
margination of the chromatin. Infectivity titrations of the virus using
cytopathic effect (CPE) as the endpoint are held for 7-9 days.
Titration times may be reduced to 72 hr if immunofluorescence is
used to detect viral infection.
Polymerase Chain Reaction
A DNA probe based test has been developed and is commercially
available (Infectious Diseases Laboratory, Athens, GA.). The DNA
probe based test has been shown to be sensitive and specific (1). The
sample of choice for detecting birds that are shedding viral nucleic
acid is a cloacal swab. The same test can be used to detect viral
nucleic acid in whole unclotted blood. A swab of the cut surface of
the spleen, liver, and kidney can be submitted for PCR-based testing
 Chapter 26 Budgerigar Fledgling Disease and Other Avian Polyomavirus Infections
to document the presence of viral nucleic acid in birds that have died
with suspicious clinical and gross lesions.
Physiochemical Properties
Virions have a buoyant density of 1.34 g/cm3 in CsCl and a mean
diameter of 42 mm (2). The virions are nonenveloped and contain a
4981-bp double-stranded DNA genome. Growth in cell culture is
inhibited by 5-iododeoxyuridine. Freezing and thawing of the virus
for five cycles has no effect on infectivity. The virus is relatively
heat resistant. Incubation of the virus at 56 C for 30 min reduces the
titer by 0.6 log10, and 56 C for 90 min reduces the titer by 1.0 logi0.
SEROLOGIC DETECTION IN THE HOST
A virus-neutralization (VN) test is used for the detection of
antibodies to avian polyomavirus. The test is performed in 96-well
microtiter plates. Virus adapted to CEF cells is used in the test. A
100 mean tissue-culture infective dose (TCID50) dose of virus is used
and twofold dilutions of serum added. The virus-serum mixture is
incubated 30-60 min at 37 C and then a suspension of CEF cells is
added in growth medium. After 72 hr the endpoint may be read by
staining with a fluorescein-isothiocyanate-labeled anti-polyoma virus
globulin or the cells can be held for 7-9 days to read the endpoint by
CPE. Serum endpoints are determined as the last dilution of serum
that prevents detectable infection of the cells. Serum titers of 1:20 or
greater are considered to be positive for VN antibodies. No evidence
of varying serotypes has been shown with avian polyomaviruses of
psittacine birds (5).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Because of the feathering abnormalities in chronic infections,
polyomavirus infection may be confused with psittacine beak and
feather disease. French molt can be caused by psittacine beak and
feather disease virus, polyomavirus, or both. However, no beak
lesions have been associated with polyomavirus infections. In
addition, feather loss is not as extensive in polyomavirus infections
as it is in psittacine beak and feather disease. Inclusion bodies
associated with both viruses are different; those of polyomavirus are
large, clear intranuclear inclusions and those of beak and feather
disease virus are more basophilic and occur in the nucleus and
cytoplasm. In situ hybridization can also be used to differentiate
these viruses.
REFERENCES
1. Bernier, G., M Morin, and G. Marsolais. Papovavirus induced feather
abnormalities and skin lesions in the budgerigar: clinical and pathological
findings. Can. Vet. J. 25:307-310. 1984.
2. Bozeman, L. H., R. B. Davis, D. Gaudry, P. D. Lukert, O. J. Fletcher, and
M J. Dykstra. Characterization of a papovavirus isolated from fledgling
budgerigars. Avian Dis. 25:972-980. 1981.
3. Davis, R. B., L. H. Bozeman, D. Gaudry, O. J. Fletcher, P. D. Lukert, and
M J. Dykstra. A viral disease of fledgling budgerigars. Avian Dis. 25:179-
183. 1981.
4. Ritchie, B. W. Papovaviaridae. In. Avian Viruses: Function and Control,
1st ed. Wingers Publishing, Inc., Lake Worth, Fla. pp. 127-170. 1995.
5. Wainwright, P. Ο., P. D. Lukert, R. B. Davis, and P. Villegas. Serological
evaluation of some Psittaformes for budgerigar fledgling disease virus. Avian
Dis. 31:673-676. 1987.
 27
PSITTACINE BEAK AND FEATHER DISEASE
Branson W. Ritchie and Phil D. Lukert

SUMMARY. Psittacine beak and feather disease can be an acute or chronic disease of psittacine birds and is characterized by necrotic and
abnormally formed feathers, beak necrosis and fractures, and usually death. The disease is caused by a small virus in the family Circoviridae.
Agent Identification. The virus has not been cultured in vitro, but a DNA probe based test can be used to detect the target segments of viral
nucleic acid in infected birds. Virus purified from infected birds will agglutinate cockatoo erythrocytes. Confirmation of disease in birds with
characteristic clinical changes requires demonstration of viral nucleic acid by in situ hybridization, immunohistochemical staining for viral
proteins or documentation of viral particles by electron microscopy.
Serologic Detection in the Host. A hemagglutination-inhibition test can be used to detect antibodies to the virus, but it is of minimal value in
managing the disease in individual birds or in aviaries.

INTRODUCTION SAMPLE COLLECTION

Psittacine beak and feather disease (PBFD) is usually a chronic
disease of psittacine birds that eventually leads to death. It was first
described in various species of Australian cockatoos in the early
1970s (4). The virus that causes this disease belongs to the family of
viruses called Circoviridae. The family includes viruses that infect
Psittaciformes, Columbiformes, Passeriformes, and Anseriformes
and are the smallest known virus of animals with a 14-17 nm
diameter and circular single stranded DNA containing about 1700-
2300 bases. In comparison, parvoviruses are 25 nm in diameter and
have a single- stranded linear DNA with 5000 bases. Psittacine
circovirus has not been grown in vitro, but it has been characterized
by purifying the virus from the skin (feather follicles) of affected
birds (2).
All psittacine birds are probably susceptible to the virus and the
outcome of infection is largely dependent upon the age of the bird
when infected. Young birds are more susceptible to disease after
infection. Generally, the older the bird the longer the incubation
period between infection and appearance of disease. The disease
usually occurs in birds less than 3 yr of age but birds up to 20 yr of
age have been diagnosed with PBFD (1).
Samples that are useful for the detection of psittacine circovirus
nucleic acid are white blood cells and swabs from feather pulp,
necropsy tissue, or environmental areas. Blood samples should be
collected in heparin (0.01 ml heparin to 0.49 ml of blood).
Ethylenediaminetetraacetic acid or excessive heparin may result in
false negative polymerase chain reaction (PCR) based tests. Clotted
blood is unsuitable for nucleic acid detection. Swabs should be
encased in a swab holder and anaerobic swabs with gel-type
protective media are unacceptable. Serum samples for antibody
detection by hemagglutination-inhibition (HI) tests may be submitted
in microhematocrit capillary tubes after centrifugation to separate
cells from the serum (1).
PREFERRED CULTURE MEDIA AND SUBSTRATES
The virus has not been propagated in embryos or cell cultures, but
can be identified and characterized by purifying the virus from
homogenized preparations of skin from infected birds. The nucleic
acid can be extracted and identified by gel electrophoresis or the
virus visualized by electron microscopy.

CLINICAL DISEASE AGENT IDENTIFICATION

The incubation period for the disease is highly variable and may be
influenced by maternal antibodies, virus dose, or the host response to
the infection. The minimum incubation period is 3-4 wk. Virus is
thought to spread by direct contact or through contaminated food and
water. Evidence exists that the virus can be transmitted vertically
through the egg (1).
The first clinical sign of disease is the appearance of necrotic or
abnormally formed feathers. In young birds (less than 2 mo old), all
of the feather tracts may be involved, whereas in older birds the
disease is more prolonged with progressive feather changes
occurring with ensuing molts. Peracute infections occur in neonates
with signs of septicemia, pneumonia, enteritis, rapid weight loss, and
death. The acute form is common in young birds during their first
feather formation. Usually several days of depression occur,
followed by sudden changes in developing feathers, which include
necrotic, broken, bent, and hemorrhagic feathers. Crop stasis and
diarrhea followed by death in 1-2 wk is a usual occurrence in the
acute form of the disease.
The chronic form of PBFD is characterized by symmetrical,
progressive appearance of abnormal feathers during successive
molts. The course of the disease may be protracted and the birds may
experience secondary infections during this period. Birds with
varying degrees of feathering may live months to years before
eventual death, typically from a secondary infection. The beak
lesions usually follow the feather malformations and changes include
longitudinal fractures and necrosis of the palate area (1).
122
Polymerase Chain Reaction (PCR)
A DNA probe based test has been developed and is available
commercially (Infectious Diseases Laboratory, Athens, GA). The test
is sensitive and specific (1). Most infected birds clear an infection
with no signs of disease. Birds with no feather abnormalities that or
blood positive for viral nucleic acid should be retested in 90 days. A
negative test in the absence of clinical changes suggests that the bird
has cleared the infection. A non-lory psittacine bird with a positive
test and developmental feather lesions should be considered infected
but disease can only be confirmed by histopathology. Lories have
been shown to be susceptible to a variant of psittacine circovirus and
birds with advanced feather abnormalities can recovery. Specific
PCR-based testing is necessary to differentiate the two types of
psittacine circovirus that may infect lories and is also required to
provide accurate prognostic information. Once a psittacine aviary is
free of PBFD virus a negative flock can be maintained through
quarantine and testing procedures. Until a commercial vaccine is
available, PCR-based testing will remain the most valuable tool for
the control of this disease.
In situ hybridization can be used to confirm a diagnosis of PBFD
and differentiate it from budgerigar fledgling disease, which is
caused by avian polyomavirus infections (1).
Physicochemical Properties
Virions are 14-17 nm in diameter and are nonenveloped. The viral
DNA is single-stranded and circular, containing approximately 1800
bases. The virus has a density of 1.37 g/cm3 in CsCl (2), and is
highly resistant to heat and disinfectants. Chicken anemia virus,

which is in the same family (Circoviridae), resists 80 C for 1 hr and
resists 5% phenol (5).
SEROLOGIC DETECTION IN THE HOST
The virus will hemagglutinate erythrocytes of cockatoos but not
those of sheep or chickens. An HI test can detect antibodies in
infected birds and is typically used for epizootiological surveys. The
HI test is, however, of minimal value in managing the disease in
individual birds or in aviaries. Virus for the HI test is prepared by
homogenizing feather follicle tracts from affected birds. The virus is
concentrated on sucrose gradients followed by purification on CsCl
gradients (3).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Initially the chronic forms of PBFD may be confused with avian
polyomavirus (budgerigar fledgling disease). The differentiation of
the two diseases may be readily made by PCR-based testing of white
blood cells from the bird. In some cases the intranuclear inclusions of
avian polyomavirus can be differentiated from those induced by
123
Chapter 27 Psittacine Beak and Feather Disease
PBFD virus. The PBFD inclusions tend to be basophilic and are
found in the nucleus and cytoplasm, whereas polyomavirus produces
large clear intranuclear inclusions. In situ hybridization with viral
specific probes can be used to confirm a diagnosis (1).
REFERENCES
1. Ritchie, B. W. Circoviridae. In: Avian Viruses: Function and Control, 1st
ed Wingers Publishing, Inc., Lake Worth, Fla. pp. 223-252. 1995.
2. Ritchie, B. W., F. Niagro, P. Lukert, W. Steffans and K. Latimer.
Characterization of a new virus from cockatoos with psittacine beak and
feather disease. Virology 171:83-88. 1989.
3. Ritchie, B. W., F. Niagro, K. Latimer, P.Lukert, and D. Pesti.
Hemagglutination by psittacine beak and feather disease virus and use of
hemagglutination-inhibition for detection of PBFD virus antibodies. Am J.
Vet. Res. 52:1810-1815. 1991.
4. Perry, R. A. A psittacine combined beak and feather disease syndrome. In:
Proceedings # 55 of Courses for Veterinarians, Sydney, Australia, pp. 81-
108. 1981.
5. Yuasa, N. Effect of chemicals on the infectivity of chicken anemia virus.
Avian Pathol. 21:315-319. 1992.
 28
CHICKEN ANEMIA VIRUS
M. Stewart McNulty and Daniel Todd
SUMMARY. Chicken anemia virus (CAV) causes a disease in 2 to 4 wk-old chickens characterized by increased mortality, anemia, thymic
atrophy, and subcutaneous hemorrhages. Disease occurs following vertical transmission of CAV from a breeder flock.
Agent Identification. Chicken anemia virus can be detected in affected chickens by virus isolation, immunocytochemical and
immunofluorescence techniques, and a variety of molecular methods that detect CAV DNA.
Serologic Detection in the Host. Enzyme-linked immunosorbent assay is the preferred method for detecting antibodies to CAV.
INTRODUCTION
Chicken anemia virus (CAV), formerly known as chicken anemia
agent, is a small DNA virus that causes a disease in chickens called
blue wing, infectious anemia, hemorrhagic syndrome, or anemia
dermatitis syndrome. This disease is characterized by aplastic
anemia, lymphoid depletion in the thymus, atrophy of
hematopoietic tissues, subcutaneous and intramuscular
hemorrhages, and increased mortality (11).
CLINICAL DISEASE
Serological surveys have shown that most commercial chicken
flocks (13) and many specific-pathogen-free (SPF) flocks (14)
possess antibody to CAV. Outbreaks of clinical disease are rare.
Onset of disease is acute and is usually seen from 2 to 4 wk of age.
Disease occurs following infection of in-lay breeding flocks that
have no antibody to CAV. No clinical signs are seen in the
breeders, but CAV is vertically transmitted to the progeny.
Affected chicks are produced from eggs laid over a period of 3-6
wk following infection. Diseased birds are depressed and weak,
and they may be stunted. Mortality rate is variable, usually about
10%, but it may be as high at 60%. At necropsy, carcasses may be
pale with thin, watery blood and yellowish bone marrow.
Thymuses, and, to a lesser extent, bursas, are atrophic. Livers may
be enlarged and yellowish. Skin lesions, in the form of ecchymotic
hemorrhages, commonly occur on the wings. These lesions are
prone to secondary bacterial infection leading to gangrenous
dermatitis. Histologically, lymphocytes are depleted in the thymus,
particularly in the thymic cortex. The bone marrow is aplastic, with
hematopoietic tissue replaced by adipose tissue. The disease is
usually seen in broilers, but it has been seen in replacement laying
pullets. A similar condition in older chicks, sometimes
accompanied by inclusion-body hepatitis, may be due to mixed
infections of CAV and adenovirus. Vertically infected chicks
excrete virus, resulting in horizontal spread to their hatchmates.
Horizontally acquired CAV infection has been associated with
impaired economic performance in broilers (16). The severity of
the disease in horizontally infected chicks is variable, depending on
factors that include age, virus dose and concurrent infections (12).
To our knowledge, there are no peer-reviewed reports documenting
the presence of CAV in avian species other than domestic fowl.
SAMPLE COLLECTION
The easiest way to detect infected flocks is to examine sera for
antibodies to CAV. Dead or sick chicks can be submitted for
attempted virus isolation, detection of viral antigen, or detection of
viral nucleic acid. Tissue samples for virus isolation can be sent to
a laboratory in any virus transport medium. Although CAV is an
extremely heat-resistant virus, samples should be kept cool during
transport to discourage the growth of bacteria whose presence may
complicate isolation of the virus. Most of the isolates of CAV from
124
disease outbreaks have been made from liver, but the virus has also
been isolated from skin, spleen, thymus, lung, heart, bursa, muscle,
feces, and bone marrow. For virus isolation in susceptible chicks or
in MDCC-MSB1 cells (a Marek’s disease virus transformed
chicken lymphoblastoid cell line), 20% tissue suspensions are made
using a stomacher or pestle and mortar in RPMI 1640 medium
(GIBCO-BRL Laboratories, Gaithersburg, Md.) containing 1000IU
penicillin per milliliter and 1000pg streptomycin per milliliter.
Specimens are clarified by centrifugation at 2500 x g for 30 min
before inoculation. Heat (70 C for 5 min) and chloroform treatment
of inocula, using standard methods, may be performed before
inoculation to inactivate other viruses that may be present.
For detection of CAV antigens by immunofluorenscence, acetone-
fixed impression smears of thymus and bone marrow, and cryostat
sections of thymus are prepared using standard methods (10).
For immunocytochemistry, tissues should be fixed in 10% neutral
buffered formalin for no longer than 6 hr; after this time destruction
of CAV antigens occurs (1,24). Fixation for up to 7 days in neutral
buffered formalin has no apparent effect on detection of CAV DNA
in thymus by in situ hybridization (1).
PREFERRED CULTURE MEDIA AND SUBSTRATES
Chicken anemia virus can be isolated either in cultured cells
including MDCC-MSB1 and MDCC-CU147 (5) or by inoculation
of susceptible chicks. Chick inoculation is more straightforward but
requires the availability of chicks derived from SPF flocks that are
free of CAV infection. Many SPF chicken flocks have antibody to
CAV. Chicks used for isolation of CAV must be free of such
antibodies, as the presence of maternal antibody in chicks confers
resistance to experimentally induced disease caused by CAV.
Although MDCC-CU147 cells appear to be susceptible to a wider
range of CAV isolates and produce higher virus yields, MDCC-
MSB1 cells are the most commonly used cells for isolating and
growing CAV. MDCC-MSB1 cells are grown in suspension in
RPMI 1640 medium (GIBCO-BRL) with 5%-10% fetal bovine
serum at 39 C in a 5% CO2 atmosphere. Following seeding at 2 x
105 to 5 x 105 cells per milliliter, cell cultures must be subcultured
every 2-3 days. Following infection of MDCC-MSB1 cells with
CAV, a cytopathic effect develops that is characterized by an
increase in cell size, followed by lysis. CAV-infected MDCC-
MSB1 cell cultures are not capable of successful subculture. Cell
death is also indicated by alkalinity of the medium.
Two tubes or 2 wells in 24 well cell culture plates (Costar,
Coming), each containing 1 ml MDCC-MSB1 cells seeded at 3 x
105 cells per milliliter, are each inoculated with 0.1 ml tissue
suspension. Cultures are incubated at 39 C in a 5% CO2
atmosphere for 48 hr. If the inoculum appears to be toxic,
subculture is carried out for the first two subcultures by transferring
0.3 ml medium and resuspended cells from inoculated cultures to
1 ml fresh cultures containing 3 χ 105 cells. Where toxicity is not a
problem, subcultures are carried out by transferring 0.1-0.2 ml
medium and cells from inoculated cultures to 1 ml warm growth
medium every 48-72 hr. Isolation of CAV in MDCC-MSB1 cells
may require up to 10 subcultures or passages before a cytopathic
effect is evident.

To isolate CAV in chicks, 1-day-old SPF chicks devoid of
maternal antibody to CAV are inoculated intramuscularly with
0.1 ml tissue suspension. After 14 days, heparinized blood samples
are taken, and the hematocrit levels are determined. Levels below
27% indicate anemia and suggest the presence of CAV. Following
euthanasia, inoculated birds are examined grossly and histologically
for CAV lesions. Because low doses of CAV do not produce
anemia experimentally, some birds should be retained and bled
again from 21 to 28 days postinoculation and examined for the
presence of antibodies to CAV. More than one passage in SPF
chicks may be necessary to produce anemia. Once experimental
anemia and associated pathology have been reproduced, isolation of
the virus from livers of inoculated chicks in MDCC-MSB1 cells is
relatively straightforward. Alternatively, CAV antigens and/or
nucleic acids can be demonstrated in the tissues of submitted and/or
inoculated chicks.
AGENT IDENTIFICATION
Chicken anemia virus is a non-enveloped, icosahedral (T = 1)
virus, approximately 25 nm in diameter, comprising 60 structural
units arranged as 12 pentamers (6). The virus possesses a single­
stranded, circular DNA genome, approximately 2.3 kb in size.
CAV has a density of 1.33-1.34 g/ml in CsCl (12). CAV is
classified as the type species of the genus Gyrovirus of the family
Circoviridae (28).
Chicken anemia virus is a remarkably stable virus. It resists
treatment with lipid solvents such as chloroform and ether. It
survives heating at 70 C for 1 hr and is only partially inactivated by
a range of commercial disinfectants, including invert soap,
amphoteric soap, orthodichlorobenzene, iodine disinfectant, and
sodium hypochlorite, and by formaldehyde fumigation (35).
Available evidence suggests that only one serotype of CAV exists.
The existence of a second CAV serotype was suggested when an
antigenically distinct agent was shown to cause similar pathogenic
effects following experimental infection of SPF chickens (26).
However, the causal agent needs to be isolated and molecularly
characterized to confirm whether it represents a second CAV
serotype. Minor antigenic differences between CAV isolates have
been revealed by monoclonal antibody binding studies (15).
Naturally occurring isolates of CAV obtained from chickens appear
to possess similar pathogenicity for young chicks. Naturally
occurring apathogenic isolates have been obtained from turkeys
(23). CAV can be attenuated by passage in MDCC-MSB1 cells
(29) or chicken embryos (22). CAV does not agglutinate the
commonly available avian and mammalian erythrocytes (D. Todd,
unpubl. obs.).
The earliest method to identify CAV was isolation of the virus in
SPF chicks or MDCC-MSB1 cells, as described above.
Confirmation of the identity of putative isolates is achieved by
immunofluorescent staining of infected MDCC-MSB1 cells.
Infected MDCC-MSB1 cells are pelleted by centrifugation at
1500 x g for 10 min, resuspended in a minimal volume of
phosphate-buffered saline, and smeared onto multispot Teflon-
coated slides. These are air-dried, fixed in acetone for 10 min at
room temperature, and stained by direct or indirect
immunofluorescence using chicken antisera to CAV or monoclonal
antibodies that are known to react with all CAV isolates (15). CAV
antigens are found in the nuclei of infected cells. Fine granular
fluorescence usually is present throughout the nuclei, with some
nuclei containing larger spherical inclusions.
Isolates growing in MDCC-MSB1 cells also can be confirmed as
CAV using a neutralization test. Chicken antiserum to CAV and
control chicken serum without antibody to CAV are diluted 1:80 in
RPM1 1640 containing antibiotics, inactivated by treatment at 56 C
for 30 min, cooled, and then added to an equal volume of the
undiluted isolate and incubated for 30 min at 37 C. Samples of
125
Chapter 28 Chicken Anemia Vine
0.1 ml of the virus-serum mixtures are inoculated into each of four
tubes, each containing 0.9 ml MDCC-MSB1 cell suspension
containing 3 * 105 cells per ml. Appropriate virus, serum, and
positive and negative controls also should be included. MDCC-
MSB1 cells are then subcultured at 2-3 day intervals into fresh
medium as described above. If the isolate is CAV, it will be
neutralized by the CAV antiserum and no cytopathic effect will be
evident.
Antisera are prepared by intramuscular inoculation of 4-wk-old
SPF chicks with 1 ml of cell-free CAV. A booster intravenous
inoculation (1 ml) is given 4 wk later, and the birds are completely
bled out after a further 3 wk (13). Hyperimmune rabbit antisera
(10) or mouse monoclonal antibodies (15) can also be used.
More recently developed diagnostic methods are quicker, less
laborious, and/or cheaper than virus isolation. CAV antigens in
diseased birds can be easily and rapidly detected by
immunofluorescent staining of impression smears of thymus and
bone marrow, and of cryostat sections of thymus.
Immunofluorescence is concentrated in the thymic cortex. Antigens
can also be detected by immunocytochemical staining of formalin-
fixed, paraffin-embedded tissues; however, for optimal results
treatment of the sections with protease XIV (Sigma Chemical
Company, St. Louis, Mo.) and fixation with formalin for no more
than 6 hr are necessary (1,24). Immunocytochemical staining is
more technically demanding, slower, and more laborious than
immunofluorescence, and nonspecific staining can occur, but
preservation of tissue morphology is much superior.
Chicken anemia virus nucleic acids in tissues from diseased birds
and infected MDCC-MSB1 cells dan be detected by a number of
techniques, including in situ hybridization (1), dot-blot
hybridization (19,30) and polymerase chain reaction (PCR)
amplification. Dot-blot hybridization methods, which can be
completed in 2-4 days, have a limit of sensitivity of only 105-106
genome copies (1—10 pg CAV DNA) and are likely to be less
sensitive than virus isolation. Greater speed and sensitivity can be
achieved using PCR amplification methods, many variations of
which have been developed. PCR methods that involve the visual
detection of PCR product following agarose gel electrophoresis,
ethidium bromide staining and exposure to UV light generally have
sensitivity limits of 10!-103 genome copies (0.1 - 10 fg) (D. Todd,
unpubl. obs.). Hybridization techniques to detect PCR product have
been employed to enhance sensitivity and to demonstrate specificity
(19,20,25,27,33) but their inclusion makes these PCR methods more
labor-intensive and time-consuming. Nested PCR tests offer the
greatest sensitivity and have been used to detect CAV DNA in
embryonal tissues and egg shell membranes (18) and to demonstrate
the presence of CAV DNA in blood cells and reproductive tissues
from chickens with neutralizing antibodies (2,7). The most
sensitive PCR methods are likely to have greater sensitivity than
virus isolation. While a highly sensitive PCR test may be the
method of choice in research investigations and when examining
biologicals for evidence of contamination with CAV, caution must
be exercised in unreservedly recommending such tests for routine
diagnosis of CAV. Given that low levels of CAV DNA can persist
in chickens for months after infection, detection of virus DNA by a
highly sensitive PCR technique may be of questionable value to the
diagnostician faced with clinical disease problems. The ability to
quantify CAV DNA, made possible by applying competitive (34) or
real time (9) PCR methods, may assist in determining the clinico-
pathological significance of CAV in the clinical problem, but these
methods will not be available in many diagnostic laboratories.
SEROLOGIC DETECTION IN THE HOST
Antibodies to CAV were originally detected by indirect
immunofluorescence and virus neutralization (4,12). However,
both of these tests have now been superseded by enzyme-linked
M Stewart McNulty and Daniel Todd
immunosorbent assay (ELISA). A number of ELISAs have been
described (3,8,21,31,32). Most use CAV grown in MDCC-MSB1
cells as antigen. With the indirect ELISA format, antigen-coated
plates are reacted with dilutions of chicken sera and the presence of
chicken antibodies specific to CAV are detected using an anti­
chicken immunoglobulin enzyme conjugate. In the competitive or
blocking format, the presence of virus-specific chicken antibodies
in test sera is detected when the reaction between the coated antigen
and an enzyme-conjugated virus-specific mouse monoclonal
antibody is prevented or reduced. Competitive or blocking tests
generally exhibit fewer problems in relation to the non-specific
binding of chicken antibodies to cellular antigens.
ELISAs are now available commercially (Flockscreen Chicken
Infectious Anaemia Antibody ELISA kit, Guildhay Ltd. Guildford,
Surrey, United Kingdom; Chicken Anemia Virus (CAV) ELISA
test kit, IDEXX Laboratories, Inc., Westbrook, Maine). Lack of
specificity with some ELISAs is not a major problem in serologic
profiling of commercial flocks, but can cause problems when
testing SPF flocks (17).
Following an outbreak of anemia dermatitis syndrome,
retrospective testing of sera from the breeder flocks, if sera are
available, will identify one or more breeder flocks that were
seronegative at point-of-lay, but that have developed antibodies by
the time disease is recognized in their progeny. These breeder
flocks are probably the source of vertically transmitted virus.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The differential diagnosis of anemia dermatitis syndrome includes
those conditions causing anemia, immunosuppression, and
increased mortality.
REFERENCES
1. Allan, G. M, J. A. Smyth, D. Todd, and M S. McNulty. In situ
hybridization for the detection of chicken anemia virus in formalin-fixed,
paraffin-embedded sections. Avian Dis. 37:177-182. 1993.
2. Brentano, L., S. Lazzarin, S. S. Bassi, T. A. P. Klein, and K. A Schat.
Detection of chicken anemia virus in the gonads and in the progeny of
broiler breeder hens with high neutralizing antibody titres. Vet. Micro. 105:
65-72. 2005.
3. Brewer, J., J. M Saunders, and N. J. Chettle. The development of an
enzyme linked immunosorbent assay to detect antibodies to chicken anaemia
virus, and its comparison with the indirect immimofluorescent antibody test.
In: Proceedings of the International Symposium on Infectious Bursal
Disease and Chicken Infectious Anaemia, Rauischholzhausen, Germany,
pp. 408-412. 1994.
4. Bulow, V. V., B. Fuchs, and M Bertram. Untersuchungen uber den
Erreger der infectiiosen Anamie bei Huhnerkuken (CAA) in vitro:
Vermehrung, Titration, Serumneutralisationtest and indirekter
Immunofluoresenztest. Zentralbl. Veterinaermed. Reihe B 32:679-693.
1985.
5. Calnek, B. W., B. Lucio-Martinez, C. Cardona, R. W. Harris, K. A Schat,
and C. Buscaglia. Comparative susceptibility of Marek’s disease cell lines to
chicken infectious anemia virus. Avian Dis. 44:114-124. 2000.
6. Crowther, R. A, J. A. Berriman, W. L. Curran, G. M Alan, and D.
Todd. Comparison of the structures of three circoviruses: Chicken anemia
virus, Porcine circovirus type 2 and Beak and feather disease virus. J. Virol.
77: 13036-13041. 2003.
7. Imai, K., M Mase, K. Tsukamoto, H. Hihara, and N. Yuasa. Persistent
infection with chicken anaemia virus and some effects of highly virulent
infectious bursal disease virus infection on its persistency. Res Vet. Sci. 67:
233-238. 1999.
8. Lamichlane, C. M, D. B. Snyder, T. Girschick, M A. Goodwin, and S.
L. Miller. Development and comparison of serologic methods for
diagnosing chicken anemia virus infection. Avian Dis. 36:725-729. 1992.
9. Markowski-Grimsrud, C. J., Μ M Miller, and K. A. Schat. Development
of a strain-specific real-time PCR and RT-PCR assays for quantitation of
chicken anemia virus. J. Virol. Meth. 101: 135-147. 2002.
126
10. McNeilly, F., G. M Allan, D. A. Moffett, and M S. McNulty.
Detection of chicken anaemia agent in chickens by immunofluorescence and
immunoperoxidase staining. Avian Pathol. 20:125-132. 1991.
11. McNulty, M S. Chicken anemia agent. In: A laboratory manual for
the isolation and identification of avian pathogens, 3rd ed. H. G. Purchase,
L. H. Arp, C. H. Domermuth, and J. E. Pearson, eds. Kendall/Hunt
Publishing Company, Dubuque, Iowa. pp. 108-109. 1989.
12. McNulty, M S. Chicken anaemia agent: a review. Avian Pathol.
20:187-203. 1991.
13. McNulty, M S., T. J. Connor, F. McNeilly, K. S. Kirkpatrick, and J. B.
McFerran. A serological survey of domestic poultry in the United Kingdom
for antibody to chicken anaemia agent. Avian Pathol. 17:315-324. 1988.
14. McNulty, M S., T. J. Connor, and F. McNeilly. A survey of specific­
pathogen-free chicken flocks for antibodies to chicken anaemia agent, avian
nephritis virus, and group A rotavirus. Avian Pathol. 18:215-220. 1989.
15. McNulty, M S., D. P. Mackie, D. A. Pollock, J. McNair, D. Todd,
K. Mawhinney, T. J. Connor, and F. McNeilly. Production and preliminary
characterization of monoclonal antibodies to chicken anemia agent. Avian
Dis. 34:352-358. 1990.
16. McNulty, M S., S. G. McIlroy, D. W. Bruce, and D. Todd. Economic
effects of subclinical chicken anemia agent infection in broiler chickens.
Avian Dis. 35:263-268. 1991.
17. Michalski, W. P., D. O’Rourke, and T. J. Bagust. Chicken anaemia
virus antibody ELISA: problems with non-specific reactions. Avian Pathol.
25:245-254. 1996.
18. Miller, Μ Μ, K. A. Ealey, W. B. Oswald,, and K. A Schat. Detection
of chcken anemia virus DNA in embryonal tissues and eggshell membranes.
Avian Dis. 47: 662-671. 2003.
19. Notebom, Μ Η. M, C. A. J. Verscheuren, D. J. van Roozelaar, S.
Veldkemp, A. J. van der Eb, and G. F. de Boer. Detection of chicken
anaemia virus by DNA hybridization and polymerase chain reaction. Avian
Pathol. 21:107-118. 1992.
20. Novak, R., and W. L. Ragland. Competitive DNA hybridization in
microtitre plates for chicken anaemia virus. Mol. Cell. Probe. 15:1-11.
2001.
21. Pallister, J., K. J. Fahey, and M Sheppard. Cloning and sequencing of
the chicken anaemia virus (CAV) ORF-3 gene, and the development of an
ELISA for the detection of serum antibody to CAV. Vet. Microbiol.
39:167-178. 1994.
22. Schrier, C. C. Chicken anaemia agent vaccine. European Patent
Application 92202864.2. 1992.
23. Schrier, C. C. and H. J. M Jagt. Chicken anaemia viruses of low
pathogenicity. US Patent Application 2001/0023664 Al
24. Smyth, J. A, D. A. Moffett, M S. McNulty, D. Todd, and D. P.
Mackie. A sequential histopathologic and immunocytochemical study of
chicken anemia virus infection at one day of age. Avian Dis. 37:324-328.
1993.
25. Soine, C., S. K. Watson, E. Rybicki, B. Lucio, R. M Nordgren, C. R.
Parrish, and K. A. Schat. Determination of the detection limit of the
polymerase chain reaction for chicken infectious anemia virus. Avian Dis.
37:467^176. 1993.
26. Spackman, E., S. S. Cloud, C. R. Pope, and J.K. Rosenberger.
Comparison of a putative second serotyoe of chicken infectious anemia virus
with a prototypical isolate. I. Pathogenesis. Avian Dis. 46: 945-955. 2002.
27. Tham, K. M, and W. L. Stanislawek. Detection of chicken anaemia
agent DNA sequences by the polymerase chain reaction. Arch. Virol.
127:245-255. 1992.
28. Todd, D., M Bendinelli, P. Biagini, S. Hino, A. Mankertz, S. Mishiro,
C. Niel, H. Okamoto, S. Raidal, B. W. Ritchie, and G. C. Teo.
Circoviridae. In: Virus Taxonomy, VUIth Report of the International
Committee for the Taxonomy of Viruses. C.M Fauquet, MA. Mayo, J.
Maniloff, U. Desselberger, and L.A. Ball, eds. , Elsevier/Academic Press,
London, pp 327-334. 2004.
29. Todd, D., T. J. Connor, V. M Calvert, J. L. Creelan, B. M Meehan, and
M S. McNulty. Molecular cloning of an attenuated chicken anaemia virus
isolate following repeated cell culture passage. Avian Pathol. 24:171-187.
1995.
30. Todd, D., J. L. Creelan, and M S. McNulty. Dot blot hybridization
assay for chicken anemia agent using a cloned DNA probe. J. Clin.
Microbiol. 29:933-939. 1991.
31. Todd, D., D. P. Mackie, K. A. Mawhinney, T. J. Connor, F. McNeilly,
and M S. McNulty. Development of an enzyme-linked immunosorbent
assay to detect serum antibody to chicken anemia agent. Avian Dis.
34:359-363. 1990.

32. Todd, D., K. A. Mawhinney, D. A. Graham, and A. N. J. Scott.
Development of a blocking enzyme-linked immunosorbent assay for the
serological diagnosis of chicken anaemia virus. J. Virol. Meth. 82: 177-184.
1999.
33. Todd, D., K. A. Mawhinney, and M S. McNulty. Detection and
differentiation of chicken anemia virus isolates by using the polymerase
chain reaction. J. Clin. Microbiol. 30:1661-1666. 1992.
127
Chapter 28 Chicken Anemia Virus
34. Yamaguchi, S., N. Kaji, Η. M Munang’andu, C. Kojima, M Mase, and
K. Tsukamoto. Quantification of chicken anaemia virus by competitive
polymerase chain reaction. Avian Path. 29: 305-310. 2000.
35. Yuasa, N. Effect of chemicals on the infectivity of chicken anaemia
virus. Avian Pathol. 21:315-319. 1992.
 29
AVIAN INFLUENZA
David E. Swayne, Dennis A. Senne and David L. Suarez

SUMMARY. Avian influenza (Al) is caused by type A influenza virus, in the family Orthomyxoviridae. Type A influenza viruses are
serologically categorized into 16 hemagglutinin (H1-H16) and 9 neuraminidase (N1-N9) subtypes. All subtypes have been identified in
birds. Infections by influenza virus have been reported in a variety of domestic and wild birds, but most infections are subclinical. In poultry,
influenza virus infections can be clinical, but the features are variable depending on virus strain, host species and breed, host age, concurrent
infections, physiologic stresses, and environmental factors. Some H5 and H7 strains are highly pathogenic for poultry, producing a systemic
disease with high mortality, and all H5 and H7 strains should be considered to have the potential to mutate from low (LP) to high
pathogenicity (HP). Both LP and HP H5 and H7 strains isolated from poultry are notifiable to the World Organization for Animal Health
(OIE).
Agent Detection or Identification. Although several diagnostic tests can be used for detection of avian influenza, the initial diagnosis is
preferably made by virus isolation via inoculation of embryonating chicken eggs, demonstration of hemagglutinating activity, and
verification as avian influenza virus by agar-gel immunodiffusion (AGID) or other antigen-detection tests. Once a virus has been isolated,
additional biologic and molecular studies can be performed to characterize the virus that isn’t possible by other means. This includes virus
subtyping, testing of pathogenicity in chickens or other species, and for H5 and H7 subtypes the determination of amino acid sequence at the
hemagglutinin proteolytic cleavage site to develop the appropriate control strategies. We do have an increased ability to rapidly diagnose and
characterize Al by detection of nucleic acids specific for Al viruses and potentially by rapid and sensitive immunoassays, but these tests will
not replace virus isolation in our ability to characterize Al viruses.
Serologic Detection in the Host. Serologic detection of infection in the host is important for moderate-to-large scale surveillance by
industry or government and for early diagnostic detection programs. Detection of type A group-specific antibodies via AGID or enzyme-
linked immunosorbent assay is preferred as the initial step for detection of primary infection, but confirmation and subtype determination via
hemagglutination-inhibition and neuraminidase-inhibition tests are crucial adjuncts.

INTRODUCTION
Avian influenza virus (AIV) infections occur in a variety of
domestic and wild bird species. The endemic nature of AIV in wild
birds including ducks, gulls and shorebirds provides for a constant
but low risk of introduction into poultry populations. In North
America, infections in commercial poultry occur primarily in
domestic turkeys, with avian and swine influenza viruses. However,
outbreaks can be seen in domestic and imported exotic birds, ratites,
and occasionally in chickens, quail, and upland game birds.
Infections in the latter three groups have been detected most often
in live bird marketing systems traditionally found in large
metropolitan settings. The greatest incidence of the disease in
domestic poultry occurs where there is opportunity for co-mingling
or indirect contact with waterfowl, seabirds, and/or pigs.
Historically, the best-known avian influenza virus (AIV) is fowl
plague virus, an H7 subtype, which has caused poultry losses since
the late 1800s in many parts of the world. The term fowl plague has
been replaced by highly pathogenic or high pathogenicity avian
influenza (HPAl) and is caused by some H5 and H7 strains (5).
Epizootics of HPAl since 1995 have included: 1) H7N3 in Pakistan
during 1995, 2001 and 2004; 2) H5N1 in Asia during 1996-2005;
3) H7N4 in Australia in 1997; 4) H5N2 in Italy during 1997; 5)
H7N1 in Italy during 1999-2000; 6) H7N3 in Chile during 2002; 7)
H7N7 in The Netherlands during 2003; 8) H7N3 in Canada during
2004; 9) H5N2 in USA during 2004; 10) H5N2 in South Africa
during 2004, and 11) H7N7 in North Korea (9,10,12,14,16,28).
Where there is suspicion or confirmation of Al, state and/or federal
authorities should be notified.
CLINICAL DISEASE
The outcome of infection produced by AIV isolates varies from no
obvious clinical signs to 100% mortality. Birds of all ages and most,
if not all, avian species are susceptible to infection. Common signs
or lesions in the major poultry species (chickens and turkeys)
infected with LPAI viruses include slight-to-severe declines in egg
production; increased mortality; diarrhea; respiratory difficulties;
and occasionally, deposits of urates in the kidneys. Infections with
HPAl viruses results in severe disease which can present as edema
128
of the head, comb, and wattles; and hemorthages on the serosal and
mucosal surfaces of viscera including the proventriculus, on the
shanks of the legs, and on the comb and wattles. Ruptured mature
ovarian follicles (yolks) and accompanying inflammation
("peritonitis”) are frequently observed in active layers with either
LP or HPAl viral infections. Birds that die peracutely may exhibit
few, if any, obvious clinical signs or gross lesions. The period of
time during which virus may be recovered after infection depends
greatly upon the strain of virus, the type of sample, and the host
species and varies from 1-28 days in domestic poultiy (29) and
probably longer for wild species. However, AIV is infrequently
recovered from experimentally infected poultry after 14 days.
Detailed reviews on avian influenza are available (2,23,28).
SAMPLE COLLECTION
For Virus Isolation
Samples from respiratory (trachea, lung, air sac, and sinus
exudate) and digestive systems are suitable for virus isolation. They
can be swabs or tissue. Cloacal swabs are typically best for AIV
isolation from wild birds or domestic ducks. However, both tracheal
or oropharyngeal, and cloacal swabs should be collected from
domestic poultry. Some HPAl viruses can be isolated from liver,
spleen, blood, heart, or brain of clinically ill birds.
Dry sterile swabs preferably of a synthetic material, such as
Dacron and not calcium alginate, should be used to obtain samples
of tracheal, oropharyngeal or sinus exudate and of cloacal contents.
Swabs with wooden shafts should be avoided unless the swabs are
immediately removed from the specimen tube and discarded after
expelling the swab contents into the transport medium (the wooden
shaft may be treated with formalin that can interfere with
virus/RNA detection). The swabs are placed in 2-3.5 ml of sterile
transport medium prepared from brain-heart infusion, tryptose,
nutrient, or peptone broth, or cell-culture medium containing 1%
bovine serum albumin. A soft copper or nichrome loop may be used
for small birds (19). Specimens should be kept at 4 C after
collection and during transport. Low levels of antibiotics, e.g. 200
pg/ml gentamicin sulfate and 5 pg/ml amphotericin B, can be added
to the transport medium to reduce growth of bacterial and fungal
contaminants during transportation but antibiotics should used as an

adjunct to chilling and not as an alternative to chilling. When
isolation cannot be attempted immediately, samples can be stored at
4 C for up to 48 hr, or frozen (preferably at -70 C) for longer
periods. Samples can be shipped with frozen gel packs if they will
arrive at the laboratory within 48 hr.
For Reverse Transcriptase Polymerase Chain Reaction (RT-
PCR)
Specimens suitable for virus isolation are generally suitable for
RT-PCR (see collection of samples for virus isolation above).
However, tracheal or oropharyngeal swabs are the specimens of
choice for gallinaceous birds because they are sensitive, easy to
process, and generally contain less extraneous organic material that
can interfere with RNA recovery and amplification by PCR.
Caution should be used when testing cloacal swabs by real-time
RT-PCR (RRT-PCR) because of the concerns with false negative
results due to poor RNA recovery or presence of PCR interfering
substances. The use of RT-PCR for screening of environmental
samples needs to be done with caution because there may be a poor
correlation between a positive PCR result and presence of viable
virus; e.g. inactivated virus cannot be isolated but may yield a
positive RRT-PCR test result. Therefore, RT-PCR is not
recommended to assure an environment free of avian influenza
virus, because of the potential for the test to identify inactivated
virus, providing a false positive. Calcium alginate swabs should be
avoided for collection of samples for RT-PCR because they are
reported to produce inhibition for PCR.
When using RRT-PCR, particular attention should be given to the
selection of an appropriate method for RNA extraction to maximize
recovery. The RNA extraction step is considered one of the key
steps for a successful test. Several commercial kits are suitable for
the recovery of RNA from clinical specimens. The isolation of good
quality RNA that is void of PCR inhibiting substances is essential
for accurate test results. Organic extraction methods such as Trizol
(Invitrogen, Carlsbad, CA) are generally better than silica gel
membrane kits for most specimens and are especially good for
cloacal swabs and tissues that have a high organic content.
However, the toxic chemicals (phenol, guanidine isothiocyanate,
and chloroform), and additional labor and processing time required
for this method makes it less desirable than other methods. Silica
gel membrane kits such as RNeasy (Qiagen, Valencia, CA) have
been successfully used for processing tracheal and oropharyngeal
swabs, but this system has lower sensitivity for tissue suspensions
and cloacal swabs. This is most likely because of the heavy organic
load in these specimens produces extraneous RNA or other
substances that compete for binding sites on the silica membrane
resulting in lower recovery rates of target RNA. The MagMAX kit
(Ambion, Austin, TX) uses specially engineered magnetic beads to
absorb RNA and is more resistant to RNA saturation problems
associated with silica gel membrane kits. The MagMAX kit can be
performed in 96-well plates and therefore is more suitable than
other extraction methods for high throughput testing of
oropharyngeal or tracheal swabs. However, the suitability of this
method for extraction of tissue suspensions and cloacal swabs has
not yet been fully evaluated.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Virus Isolation
The preferred method of diagnosis requires isolation of AIV from
clinical swabs or tissue in embryonating chicken eggs. For cloacal,
tracheal, oropharyngeal, or sinus swabs received in appropriate
transport media, the fluid is centrifuged at low speed (1000-1500 x
g) to sediment debris and the supernatant is added to antibiotic
medium. The following are suggested antibiotics and the maximum
dose per ml that can be used singularly or in combination: penicillin
(10,000 IU/ml), streptomycin (10,000 pg/ml), amphotericin B
129
Chapter 29 Avian Influenza
(20 gg/ml), gentamicin sulfate (1000 pg/ml), and kanamycin sulfate
(650 pg/ml). Supernatant should be kept at 22-25 C for 30 to 60
min just before inoculation, to allow the antibiotics to reduce the
level of bacterial contamination.
If further reduction in bacterial contamination is required to reduce
embryo deaths or non-viral hemagglutinating activity (HA) of egg
fluids, the supernatant can be filtered through pre-wet 0.22-0.45-μιη
reusable or disposable membrane filters. However, filtration can
remove low levels of virus from samples and reduce isolation rates.
For tissue specimens, a 10% ground suspension is made in
antibiotic-containing brain-heart infusion, tryptose, nutrient, or
peptone broth, or cell-culture medium containing 1% bovine serum
albumin. Grinding is accomplished in a mechanical homogenizer,
stomacher, or mincing with sterile scissors and ground either in a
sterile glass tissue grinder or with a sterile mortar and pestle using
sand or similar abrasive materials. Alternatively, small tissue
fragments (1 cm3) are placed in 2-3.5 ml medium, frozen and
thawed, vigorously vortexed, centrifuged, and the supernatant
diluted in equal volumes of medium containing antibiotics. Tissue
suspensions are clarified by low-speed centrifugation (1000-1500 x
g) and placed at room temperature for 30 to 60 min before
inoculating embryos.
Chicken embryos, 9-11 days old, are injected via the allantoic sac
(see Chapter 43 on virus propagation in embryonating eggs) with
0.2-0.3 ml of clinical specimen. However, inoculation of embryos
via the yolk sac route or the use of cell cultures (MDCK or VERO)
with added trypsin has been more sensitive for the isolation of
swine-origin influenza viruses from poultry. Three to five embryos
per sample are usually adequate. Eggs are incubated at 35-37 C for
3-5 days. If virus is present, some embryos may die following
inoculation, but some may not, depending on the virulence of the
virus. Amnioallantoic fluid (AAF) from eggs with dead embryos as
well as from eggs with surviving embryos should be collected and
analyzed for HA. A second passage may be required for some
viruses. Additional passages can be made by diluting the AAF 1:10
in antibiotic medium and inoculating a new set of eggs. The eggs
from additional passages are incubated and tested using the same
procedure as for the first passage.
RT-PCR
RT-PCR procedures have been developed to aid in the detection of
ATV in clinical samples and to facilitate assessment of
pathogenicity of H5 and H7 ATV (18,33). Both traditional RT-PCR
assays with analysis of the PCR product on an agarose gel and real­
time RT-PCR (RRT-PCR) assays have been described in the
literature. Most of the methods have levels of sensitivity
comparable to virus isolation, and are being commonly used as
primary screening tests for avian influenza throughout the world. Of
the two commonly used methods, each has its strengths and
weaknesses. The traditional RT-PCR requires less expensive
equipment that is available in many diagnostic laboratories, but
does require additional labor and cross contamination is an ongoing
concern. The RRT-PCR tests are less labor intensive, can be
performed more rapidly, and have a reduced probability of cross
contamination in the laboratory, but it does require expensive
equipment to perform. Although many different RT-PCR tests for
avian influenza have been described, few have been extensively
validated for fitness for purpose with field samples in comparison to
the performance standard of virus isolation.
In general, both RT-PCR assays have four steps: 1) isolation of
the RNA; 2) conversion of the viral RNA to cDNA by the use of
reverse transcriptase; 3) amplification of the cDNA by PCR; and 4)
evaluation of the PCR product (amplicon) for the presence or
absence of the target DNA sequence. For traditional RT-PCR the
specificity of the amplicon is confirmed by electrophoresis of the
amplicon in an agarose gel containing ethidium bromide, then
comparing the size of the amplicon to markers of known molecular
David E. Swayne, Dennis A. Senne and David L. Suarez
weight. The detection of the PCR product of the proper size
however provides only a presumption of the specific product, and
additional confirmation can be provided by several methods
including enzyme restriction enzyme endonuclease assays, Southern
Blot hybridization, or by direct sequencing. The need for post­
amplification processing of the amplicon is one of the major
drawbacks of using traditional RT-PCR as a diagnostic assay
because of the increased labor and the high potential for
contamination of the laboratory and cross contamination of
samples. Extreme precautions, such as the use of dedicated
equipment and separation of sample processing activities from post
amplification processing activities, must be taken to prevent cross
contamination. The RRT-PCR assays differ primarily in the
analysis of the amplicon, which is done with fluorescently labeled
probes or dyes and special thermocyclers that accurately measure
light levels at different wavelengths. Several different strategies are
available for the fluorescently labeled probes, including Taqman
probes, Scorpion probes, Fret probes and others. The Taqman
probes, also known as hydrolysis probes, are the most commonly
used, and includes both an excitation dye and a quencher dye.
Normally, the light produced from the excitation dye is dampened
by the close proximity of the quencher dye. However, when the
Taqman probe binds to the PCR product, the excitation dye is
cleaved away from the probe and quencher dye by Taq polymerase,
and the light produced from the excitation dye is no longer
dampened by the quencher dye. This light produced is quantitative
and is proportional to the amount of PCR product present in the
reaction. The light level is taken after every PCR cycle, and the
results can be visualized in real-time with no additional post-PCR
processing. Because the probe must specifically bind to the PCR
product, an additional level of assurance is provided that the PCR is
specific for the intended agent.
Although many different RT-PCR tests and even alternative RNA
amplification tests have been described, most of these have never
been validated for use with field samples. Validation is the
determination of fitness for a particular use, and includes testing of
a prescribed number of positive and negative field samples against a
performance standard. In the U.S. a RRT-PCR assay described by
Spackman et al. for detection of ATV RNA in clinical specimens
from poultry was developed and validated with clinical specimens
(n = 1,550) from live-bird market surveillance (22). The AIV assay
was further validated (n = 3,500) during an outbreak of LPAIH7N2
in Virginia in 2002. The assay has three sets of primers and probes
that are used in separate reactions, one to identify any type A
influenza viruses (Matrix assay), one to identify H5 strains and one
to identify H7 strains of ATV. The matrix test is targeted to a highly
conserved region of the influenza genome, and it can detect any
type A influenza virus, including swine, equine, and human
influenza viruses. Because the hemagglutinin gene is known for its
high variability, it has been difficult to develop a single test that
would identify all H5 or all H7 viruses. The test validated for use in
the U.S. has been shown to identify most H5 viruses from around
the world, but the H7 test is more restricted in its geographic reach.
The test used in the U.S. will identify North American origin H7
viruses, but it will not detect Eurasian H7s. Alternative
primer/probe sets are available for H7s from other geographic
regions, and the diagnostician must be aware of the strains that are
likely to occur in their region. Since the matrix (M) assay has the
highest level of sensitivity, samples are first screened with the M
primers/probe then positive specimens are tested with the H5 and
H7 assays. In the U.S. this assay is considered an official test for
avian influenza, and it being used by more than 39 state
laboratories, that have demonstrated proficiency in testing, as a
front line surveillance tool for Al.
The use of rapid molecular diagnostic tools can still be considered
to be in its early stages, and additional technical advances should be
expected. These incremental improvements in performance are
130
likely to come by improvements in the critical control points of
RNA extraction, RT-PCR amplification, and primer and probe
design. Opportunities to increase sensitivity, specificity, throughput
and ease of use are likely to occur, and will become adopted as part
of the official protocol. Additionally, consideration for ongoing
analysis of test performance needs to be considered for all
molecular diagnostic tests, since specificity is directly related to
primer and probe design, and genetic variation or drift may affect
test performance. Future research goals will include the use of an
internal positive control (unrelated to the target cDNA) is also
highly recommended to monitor for presence of PCR inhibiting
substances that could cause a false negative test results. Several
different strategies for an internal control have been described.
AGENT IDENTIFICATION
Physicochemical, Morphologic and Biological Properties
The influenza viruses are a diverse group of viruses that belong to
the family Orthomyxoviridae, are enveloped (ether-sensitive), and
contain single-stranded ribonucleic acid (RNA) that is segmented
and has negative polarity. Two major internal components, the
matrix protein (M) and ribonucleoprotein (RNP), are group-specific
proteins that designate type specificity (i.e., A, B, or C). There are
two surface glycoproteins, the hemagglutinin (H) and
neuraminidase (N) glycoproteins, that project from the lipid
membrane and participate in the infection process and define
subtype specificity (i.e., H1-H16 and N1-N9). Influenza virions
can be either spherical forms or short rods (80-120 nm) or
filamentous forms (400-800 nm long).· Influenza viruses are
relatively stable at pH 7-8 but are labile at the low pH range. Al
viruses are sensitive to heat inactivation with inactivation at
pasteurization temperatures (55.6-63.3 C) in 3 to 6.2 min or
minimal cooking temperature (70 C) in a few seconds (26,27).
Initial Identification
Hemagglutinating Activity (HA). The surface H glycoprotein of
ATV isolates will bind to receptors on a variety of mammalian and
avian erythrocytes, and this phenomenon is the basis for screening
of AAF for presence of hemagglutinating agents. Small amounts of
AAF can be harvested aseptically from eggs 24—48 hr after
inoculation with a syringe and needle without killing the embryo
(see Chapter 44 on virus propagating in embryonating eggs). This
early sampling can speed diagnosis because HA or specific ATV
antigen can be detected long before the embryo dies. HA is
determined by making twofold dilutions in a microtiter plate
followed by the addition of an equal volume of 0.5% washed
chicken erythrocytes. In some cases alternative RBCs need to be
considered. In particular the Hl and H3 swine viruses that
commonly infect turkeys no longer hemagglutinate chicken RBCs.
The use of turkey RBCs should be considered as an alternative,
although guinea pig and horse RBCs may be used (25,30). Diluting
the AAF avoids the occasional prozone effect that can occur with
undiluted egg fluids.
If HA is observed, the remaining AAF should be harvested after
the egg has been chilled for 4—12 hr at 4 C. Chilling kills the
embiyo and lessens the chance of contaminating the fluids with
erythrocytes, which can absorb influenza virions.
Embryos that survive the incubation period and AAF that lacks
HA can be discarded after a sample of fluid is removed for an
additional egg passage.
Fluids from AJV-infected eggs occasionally may fail to exhibit
HA, particularly when virus levels are less than that needed to cause
hemagglutination, usually ΙΟ5—106 mean embryo infectious dose
(EID5o)/ml. If the fluids are HA-negative, an additional passage is
optional to be certain that isolations are not missed because of low
levels of virus in the sample.

After demonstrating HA in AAF, the agent responsible for such
HA must be determined. Common hemagglutinating agents for
birds include AIV, avian paramyxoviruses including Newcastle
disease virus (NDV) (see Chapter 30), a hemagglutinating
adenovirus (see Chapter 19), and hemagglutinating bacteria. For the
initial determination, some diagnostic laboratories run microtiter
hemagglutination-inhibition (HI) tests to ascertain the presence or
absence of NDV. If NDV antiserum inhibits the HA, NDV is
present, but this inhibition does not exclude the possibility that the
fluid also contains one or more other viruses. Confirmation of AIV
in HA-positive samples is done by demonstrating the presence of
type- and subtype-specific antigens (see below).
Type Classification
Influenza viruses are grouped into three types (A, B, or C) based
on highly conserved internal components of the virion, namely the
M and RNP proteins or genes. All avian, swine, and equine
influenza viruses share common type A M and RNP proteins/genes
that can be identified by any of four methods: 1) the agar-gel
immunodiffusion (AGID) test with processed AAF or
chorioallantoic membranes (CAMs) which is the most commonly
used to identify AIV; 2) an antigen-capture solid-phase or flow-
through enzyme-linked immunosorbent assay (ELISA) with AAF or
suitable clinical specimens; 3) visualization by the direct fluorescent
antibody (DFA) and indirect fluorescent antibody (IFA) or
immunoperoxidase (IP) tests with tissues or CAM smears and
frozen sections; and 4) detection of the M gene of ATV in clinical
specimens, AAF or vaccines by RT-PCR or assays.
The AGID Test to Detect AIV Antigen. The procedure utilizes
influenza A-positive and negative control sera, influenza A antigen,
and an unknown sample (antigen). Either AAF or CAM from
embryonating eggs can be the unknown antigen, but CAM is
preferred because of higher virus content. Briefly, CAMs should be
rinsed in phosphate-buffered saline (PBS) (pH 7.2), pooled, and
carefully drained, opening pockets to remove excess fluid, before
they are ground in an electric blender or hand-operated tissue
grinder and used (undiluted) as antigen in the AGID test (6).
Alternatively, undiluted AAF can be used as the unknown antigen,
but the infectivity titer probably needs to be at least ΙΟ5-106 mean
embryo lethal dose (ELD50) to give satisfactory results (15). If the
undiluted AAF is negative for influenza A antigen by the AGID
test, it may be necessary to concentrate the AAF by acid
precipitation of the antigen to eliminate the possibility of a false
negative result because of a low virus titer. Briefly, eight to 10 ml
of AAF is acid precipitated (IN HC1, pH 4.0, 4 C) for 60 min in an
ice bath. The precipitate is centrifuged at 1000 x g for 10 min at 4
C, the supernatant is discarded, and the pellet is resuspended in 80-
100 μΐ glycine-Sarkosyl buffer. The resulting antigen is tested by
the AGID test.
The AGID test can be performed in Petri dishes with 0.9% agarose
(ME grade) in PBS (0.01 M, pH 7.2) with an additional 8% NaCl. A
seven-well template with a center well surrounded by six evenly
spaced wells is used. The wells are 2.4 mm apart and 5.3 mm in
diameter.
The precipitin line will be present within 24 hr at room
temperature and may increase in density for up to 48 hr. If a
precipitin line develops between the suspect antigen and the
positive serum, and if that line is continuous with the line between
the adjacent positive antigen and the antiserum, the agent can be
identified as type A influenza virus.
Antigen Capture to Detect AIV Antigen. Detection of ATV in
samples can be done by demonstrating the presence of specific
influenza viral antigens with colorimetric assays. Commercially
licensed test kits for human and veterinary medical use such as
Directigen Flu A® (Becton Dickinson Microbiology Systems,
Sparks, MD), NOW Flu A® (Binax, Portland, ME) Flu Detect®
(Synbiotics, San Diego, CA) and others are available that use
131
Chapter 29 Avian influenza
monoclonal antibody technology to demonstrate type A influenza
antigens in a solid-phase, flow-through ELISA. This test will detect
ATV antigens in AAF or directly in clinical specimens (cloacal and
tracheal/orophaiyngeal swabs) from birds using a 15 min procedure
(31). These test kits have potential use for rapid screening of poultry
flocks for avian influenza (Al), but vary in sensitivity, false positive
rate and the chickens must be in the acute stage of the disease, that
is, showing clinical respiratory or systemic signs or be dead, to
provide sufficient viral antigen (minimum of 1055 EIDso/ml of
AAF) for detection. An experimental antigen-capture ELISA (AC-
ELISA) using microtiter plates will also detect type A influenza
viral RNP in cloacal and tracheal/oropharyngeal swabs (11).
However, in waterfowl surveys, presumably because of low virus
titers, AC-ELISA had low sensitivity and specificity as compared to
virus isolation in chicken embryos (3).
Visual Demonstration of AIV Antigen. Demonstration of ATV
antigen in tissue by immunocytochemistry, immunohistochemistry,
or immunofluorescent microscopy has value for rapid diagnosis of
Al, especially HPAI, but should be utilized only as an adjunct to
virus isolation. DFA staining of acetone-fixed tissue impression
smears can give a presumptive diagnosis of Al in less than 1.5 hr
(4). Impression smears of liver and kidney are easiest to prepare and
give the most consistent results, especially for diagnosis of HPAI.
However, impression smears of tracheal mucosa and cloacal bursa
also provide satisfactory results and are necessary samples to
diagnose LPAI. ATV can also be demonstrated in fresh-frozen
sections by DFA, IFA, and IP tests (20) and in formalin-fixed tissue
sections by immunohistochemistry (7,20). However, formalin
fixation reduced the ability %of immunofluorescent and
immunochemistry procedures to detect AIV. Detection of antigen in
kidney tissue sections by the IP test was consistent only when virus
titers were 105 ELD5()/g of tissue or higher. The IFA and IP tests are
considered to be more sensitive than the DFA test.
Molecular Detection of Type-specific RNA. For those
laboratories routinely testing for Al by RRT-PCR, this assay can
also be used to detect presence of ATV in AAF, vaccines or clinical
specimens utilizing primers/probes specific for RNA that codes for
the highly conserved M protein, a type-specific protein, or H5, H7
or other HA subtypes if available.
Subtype Classification
Once an isolate or viral proteins have been identified as type A
influenza by either the AGID test, solid-phase ELISA, AC-ELISA,
or RT-PCR, the next step is H and N subtyping. There are currently
16 Η (H1-H16) and 9 N (N1-N9) subtypes recognized as
determined by the HI (15) and neuraminidase-inhibition (NI) (32)
tests, respectively. The HI and NI tests are performed in microtiter
plates with monospecific reference sera directed against whole virus
preparations or purified H and N antigens. Alternatively, molecular
subtyping assays, utilizing, have been developed for North
American lineages of H5 and H7 ATV (22) but are not yet available
for the other subtypes. All isolates identified as subtypes H5 and H7
are Notifiable Avian Influenza (NAT) and should be reported to
state and federal authorities. The H5 and H7 NAI can be LP or
HPAI viruses. Subtype determination is beyond the scope of most
diagnostic laboratories not specializing in influenza viruses.
Assistance is available from the National Veterinary Services
Laboratories (NVSL), Ames, Iowa. The NVSL is a reference
laboratory of the World Organization for Animal Health (OIE).
The HI Test to Subtype AIV Isolates. Four HA units of the newly
isolated virus can be tested against sera of known H subtypes with a
suspension of 0.5% chicken erythrocytes (see Chapter 47).
However, because of antigenic differences between ATV subtypes
and slight differences even within subtypes, the AIV should be
identified only by experienced personnel using monospecific
antisera in reference laboratories.
David E. Swayne, Dennis A. Senne and David L. Suarez

With HI tests for ATV, care must be taken in selecting reagents steric hindrance. Steric hindrance can occur if the antiserum used
used to identify the H subtype of the virus to avoid problems with for H subtyping also contains N antibodies that are homologous

Table 29.1. Amino acid sequences at the HAO cleavage site of H5 and H7 AIV strains (modified from Senne et al., 1996 (18).
Virus Strain Subtype Pathotype HAO Cleavage site sequence
A/Chicken/Hidalgo/26654-1368/94 H5N2 LPAI PQ------------ ....................RETR
*
GLF
A/Emu/NY/12716-67/94 H5N9 LPAI PQ------------ --------------- RETR*
GLF
A/Turkey/CA/6878/79 H5N3 LPAI PQ------------ ................... RETR
*
GLF
A/Chicken/Queretaro/14588-19/95 H5N2 HPAI PQ------------ -------- RKRKTR
*
GLF
A/Γurkey/England/91 H5N1 HPAI PQ------------ --------- RKRKTR
*
GLF
A/Γ urkey/Ireland/83 H5N8 HPAI PQ------------ --------- RKRKKR
*
GLF
A/Chicken/Hong Kong/220/97 H5N1 HPAI PQ------------ —RERRRKKR
GLF
*
A/Chicken/NY/13142-5/94 H7N2 LPAI p E------------ ------------ NPKTR
*
GLF
A/Turkey/Italy/977/99 H7N1 LPAI P £------------ ------------- 1 PKG R
G
* LF
A/Quail/AR/16309-7/94 H7N3 LPAI PE------------ ----------- -N PKT R
*
G LF
A/Chicken/Chile/176822/02 H7N3 LPAI PE G
------------ K PKT R
* LF
A/Chicken/Canada/AVF VI/04 H7N3 LPAI *
GLF
PE.................------------ NPKTR
A/Chicken/Victoria/85 H7N7 HPAI p e------------ ---- IPKKREKR
GLF
*
A/Chicken/The Netherlands/04 H7N7 HPAI PE------------ ------- 1 PKRRRR
*
GLF
A/Turkey/Italy/4580/99 H7N1 HPAI P E................. —IPKGSRVRR
G
* LF
A/Chicken/Chile/4325/02 H7N3 HPAI PEKPKTCSPLSRCRKT R
G
* LF
A/Chicken/Canada/AVFV2/04 H7N3 HPAI PE----- NPKQA YQKRMTR*GLF
* indicates cleavage site, dashes are used for alignment. Basic amino acids arginine (R) and lysine (K) are shown in bold.

with the unknown isolate. The specific reaction of the N antibodies
can interfere nonspecifically with the H, leading to nonspecific
inhibition and possible misidentification of an isolate (17).
The NI Test to Subtype AIV Isolates. The NI test is used to
identify the other important surface antigen of the influenza viruses
(8,32). This test, being more complex than the HI test, is generally
performed only by those engaged actively in influenza research or
influenza virus characterization. All nine of the known influenza N
subtypes have been identified in avian species.
Pathogenicity Determination
Chicken Pathogenicity Test. Assessment of pathogenicity of a
newly isolated ATV is critical for appropriate control strategies and
international trade. Precautions should be taken to assure adequate
containment of the virus before attempting bird inoculations.
Pathogenicity testing of new isolates should be conducted according
to guidelines published by the OIE and the U.S. Animal Health
Association (13). Procedures currently recommended include
intravenous inoculation of eight 4 to 8-wk-old chickens, and, if the
isolate is of the H5 or H7 subtype, determination of the amino acid
sequence at the cleavage site of the H. Isolates that are lethal for six,
seven or eight (>75%) of eight experimentally inoculated chickens,
or have an intravenous pathogenicity index (IVPI) >1.2 in 6-wk-old
susceptible chickens are considered HPAI. In addition, H5 or H7
subtype viruses that do not meet the >75% mortality criteria but
have an amino acid sequence at the H cleavage site that is
compatible with HPAI viruses are also classified as HPAI (see
Molecular Assessment of Pathogenicity below). Isolates that do not
meet the criteria to be classified as HP should be designated simply
as ATV or LPAIV with its corresponding H and N subtype
designation.
Avian influenza virus isolates from any H subtype can be
pathogenic, but to date, only H5 and H7 subtypes have been HP.
However, the vast majority of H5 and H7 subtypes are LPAI.
Molecular Assessment of Pathogenicity. An understanding of the
molecular basis for pathogenicity of AIV has made it possible to
predict virulence of some strains of H5 and H7 subtype viruses
based on presence or absence of a virulence marker at the cleavage
132
site of H protein. The virulence marker for HPAI is characterized by
the presence of multiple basic amino acids at the H cleavage site
(Table 29.1); however, caution should be exercised because some
recent HPAI viruses have been shown not to have this virulence
marker (10,24).
The method by which the presence of multiple basic amino acids
at the cleavage site can be determined has largely been limited to
RT-PCR amplification of the coding sequences surrounding the
cleavage site of the H protein, followed by sequencing of the
amplicon by automated sequencing methods (18,33). This approach
has been used to obtain sequences from a large number of H5 and
H7 subtype viruses representing different temporal, geographical
and host origins. However, as with any molecular based assay,
success in the amplification of the target sequence will depend on
the sensitivity of the primers used.
Phylogenetic Analysis
As part of the routine characterization of AIV from new outbreaks,
the viruses will be at least partially sequenced for the hemagglutinin
and other viral genes. The sequence information, as mentioned
previously can help determine the pathogenic potential for H5 and
H7 viruses, and additionally can be used for molecular
epidemiology purposes. The sequence data can be compared to the
influenza sequence database either through a blast search of the
National Center of Biological Information or by phylogenetic
analysis using a variety of available programs. The phylogenetic
analysis principally provides a graphical representation of the
relationships or closeness of viruses. The NCBI blast search is a
quick and inexpensive way to determine the sequence similarity to
all the sequence information available in GenBank. Further
information on the origins of a virus isolate may be gained by
phylogenetic analysis. The determination of the origin of a virus is
useful to understand how the outbreak may have occurred. For
example, the Virginia LP H7N2 in 2002 affected 197 flocks and
cost the government in excess of 60 million dollars. Phylogenetic
analysis clearly showed that this virus was not a recent introduction
from wild birds, but was related to the viruses that were being
isolated from the live bird marketing system in the Northeast USA
(21). This information helped provide the basis for the decision to

eradicate the virus and helps us understand that the virus was well
adapted to poultry and could spread easily from flock to flock. The
minimum sequence information necessary for a reasonable tree is at
least 300 base pairs, but the more sequence information available
the more discriminatory the phylogenetic trees As sequencing has
become cheaper and more available, the expectation is more to
sequence all eight gene segments to provide the most
comprehensive view of the isolate possible.
SEROLOGIC DETECTION IN THE HOST
Routine surveillance in individual birds or flocks for serologic
evidence of ATV infections is important for early detection and
regulatory surveillance. Four major tests are used: AGID, ELISA,
HI and NI. Historically, the virus-neutralization (VN) test has been
performed as is done with other viruses, such as NDV. Specificity is
similar to an HI test, but the VN test is infrequently used for
diagnostic purposes in poultry medicine.
The AGID Test for Antibody Detection in the Host. The AGID
is the preferred serologic surveillance test in the U.S.A, because a
single test detects serologic response in all bird species and against
infection by all type A influenza viruses. Type A AGID test
reagents (antigen and positive serum) are readily available from the
NVSL and a commercial company (Charles River-SPAFAS,
Norwich, CT). Alternatively, CAMs can be processed as described
previously in the section on the AGID test to detect ATV antigen
and used as the test antigen (6). Briefly, the CAM is ground, frozen
and thawed three times, and centrifuged at a low speed (500-1500 x
g). The supernatant is removed and inactivated with formalin (0.1%
final concentration). The antigen can be used immediately or after
incubating at 37 C for 36 hr to assure virus inactivation. The CAM
from three eggs should yield about 1 ml of antigen. The antigen can
be stored at 4 C for several weeks or frozen indefinitely at -10 C.
An antigen consisting principally of M protein can also be prepared
from a virus suspension in AAF (15). Care should be taken to
balance the concentration of antigen to match the antiserum so that
the precipitin line forms midway between the antigen and antiserum
well. Only antigen and antiserum that produces a single, narrow,
bold line that extends completely into adjacent test wells
(containing negative serum) should be used. Also, a set of known
strong and weak positive serums and negative serums should be
used to assure adequate sensitivity and specificity of the reagents.
A protocol for preparation of antigen and antiserum is available
from the NVSL.
The AGID influenza type A test for antibody detection in the host
utilizes unknown test sera, influenza A test antigen, and influenza A
positive control antiserum. The precipitin line between the ATV test
antigen and positive antiserum will be present within 24 hr at room
temperature and will increase in density for up to 48 hr; however,
interpretation of most test results can be made at 24 hr.
Sera from infected chickens or turkeys will yield positive AGID
results within 5-6 days and up to 3 mo after the appearance of
clinical signs. Because not all sera will be of the same potency, 20
or more individual sera should be tested from a flock. All AGID-
positive sera samples should be subtyped by HI and NI tests.
An ELISA for Antibody Detection in the Host. Several indirect
ELISA test kits to detect type A group-specific RNP and M
antibodies are commercially available (Synbiotics, San Diego, CA;
IDEXX, Westbrook, ME). ELISA procedures have also been
developed for internal use by diagnostic laboratories (1). The
indirect ELISA is a reliable test amenable to semi-automation and
the rapid survey of large numbers of samples, but test results should
be interpreted on a flock and not an individual bird basis. Strong
positive reactions on ELISA correlate well with AGID. However,
reactions in the suspect range should be retested by AGID or HI
tests to confirm ATV infections. The threshold for ELISA-positive
reactions should be set to avoid false positives. Indirect ELISA tests
133
Chapter 29 Avian Influenza
are species specific, although the available commercial kits will
detect serologic response in both chickens and turkeys.
Development of a competitive ELISA would result in a single test
usable for all avian species.
The HI Test for Antibody Detection in the Host. The HI test
allows avian influenza H subtypes to be differentiated on the basis
of the antigenic character of the H and is an essential follow-up test
for AGID-positive sera samples. This subtype specificity makes the
HI test of limited value in initial screening of suspect birds or
flocks, unless secondary spread of a previously identified ATV is
being monitored. A large battery of control sera and test antigens
representing all 16 of the known H subtypes would be necessaiy for
detecting primary infection of an unknown H subtype. However,
that still would not rule out the possibility that a serum might
contain antibodies to a new H subtype not yet described, or because
of antigenic differences caused by antigenic drift. HI testing for
subtyping purposes is best suited for references laboratories,
especially because sera may need to be treated with a receptor­
destroying enzyme to eliminate nonspecific HI reactions (15).
The NI Test for Antibody Detection in the Host. The NI test
allows ATV to be differentiated on the basis of the antigenic
character of the N and is an essential follow-up test for AGID-
positive samples. NI testing is best suited for reference laboratories.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The influenza viruses produce a wide range of clinical signs and
lesions, and diagnosis depends upon viral and serologic
identification, especially in the initial flocks. Isolates must be
distinguished from all other hemagglutinating agents, including
some avian adenoviruses, Newcastle disease virus (NDV), and other
avian paramyxoviruses by use of the AGID test with known
positive monospecific influenza A antiserum, by the use of ATV
specific antigen capture tests, or by RT-PCR assays specific for
ATV or NDV. Diagnosis can be complicated by the presence of
other microorganisms, such as mycoplasmas. Dual isolations of
influenza virus and Newcastle disease virus are not unusual.
Standard laboratory techniques using specific antisera to neutralize
other viruses or antibiotics to control bacterial growth are helpful in
such situations.
ACKNOWLEDGMENT
The authors thank CW. Beard for contributions to prior editions.
REFERENCES
1. Adair, B.M, D. Todd, E.R. McKillop, and MS. McNulty. Detection of
influenza A type-specific antibodies in chicken and turkey sera by enzyme-
linked immunosorbent assay. Avian Pathol. 18:455-463. 1989.
2. Alexander, D.J. A review of avian influenza in different bird species.
Vet.Microbiol. 74:3-13. 2000.
3. Alfonso, C.P., B.S. Cowen, and H. Vancampen. Influenza A viruses
isolated from waterfowl in two wildlife management areas of Pennsylvania.
J.Wildl.Dis. 31:179-185. 1995.
4. Allan, G.M and MS. McNulty. A direct immunofluorescence test for the
rapid detection of avian influenza virus antigen in tissue impression smears.
Avian Pathol. 14:449-460. 1985.
5. Bankowski, R.A. Introduction and objectives of the symposium. In:
Proceedings of the First International Symposium on Avian Influenza, RA
Bankowski, ed. U.S. Animal Health Association, Richmond, Virginia, pp.
vii-xivl981.
6. Beard, C.W. Demonstration of type-specific influenza antibody in
mammalian and avian sera by immunodiffusion Bull.World Health Organ.
42:779-785. 1970.
7. Brown, C.C., H.J. Olander, and D A. Senne. A pathogenesis study of
highly pathogenic avian influenza virus H5N2 in chickens, using
immunohistochemistry. J.Comp.Pathol. 107:341-348. 1992.
David E. Swayne, Dennis A. Senne and David L. Suarez
8. Deusen, R.A., V.S. Hinshaw, D.A. Senne, D. Pellacani, and R.A. Van-
Deusen. Micro neuraminidase-inhibition assay for classification of influenza
A virus neuraminidases. Avian Dis. 27:745-750. 1983.
9. Elbers, AR.W, T.H.F. Fabri, T.S. de Vries, J.J. de Wit, A Pijpers, and
G. Koch. The highly pathogenic avian influenza A (H7N7) virus epidemic in
The Netherlands in 2003--lessons learned from the first five outbreaks.
Avian Dis. 48:691-705. 2004.
10. Hirst, M, C.R. Astell, M Griffith, S.M Coughlin, M Moksa, T. Zeng,
D.E. Smailus, R.A. Holt, S. Jones, MA. Mana, M Petrie, M Krajden, D.
Lawrence, A Mak, R. Chow, D.M Skowronski, Tweed S Aleina, S. Goh,
R.C. Branham, J. Robinson, V. Bowes, K. Sojonky, S.K. Byme, Y. Li, D.
Kobasa, T. Booth, and M Paetzel. Novel avian influenza H7N3 strain
outbreak, British Columbia. Emerging.infectious. diseases. 10:2192-2195.
2004.
11. Kodihalli, S., V. Sivanandan, D.A. Halvorson, K.V. Nagaraja, and MC.
Kumar. Antigen-capture ELISA for rapid diagnosis of avian influenza virus
in commercial turkey flocks. Journal of Veterinary Laboratory
Diagnosticians 5:438-440. 1993.
12. Lee, C.W., D.E. Swayne, J.A. Linares, D.A. Senne, and D.L. Suarez.
H5N2 avian influenza outbreak in Texas in 2004: the first highly pathogenic
strain in the United States in 20 years? J. Virol, in press2005.
13. OIE. International Animal Health Code.
http://www.oie.int/eng/normes/MCodeZA 00003.htm 2002.
14. OIE. Highly pathogenic avian influenza in South Africa. OIE Disease
Information 17(33):http://www.oie.int/eng/info/hebdo/AIS 32.HTM2005.
15. Palmer,D.F., M.T.Coleman, W.D.Dowdle, and G.O.Schild. Advanced
laboratory techniques for influenza diagnosis. Immunology series no. 6. U.S.
Department of Health, Education and Welfare, Public Health Service,
Centers of Disease Control, Atlanta, Georgia. 1975
16. Rojas, H., R. Moreira, P. Avalos, I. Capua, and S. Marangon. Avian
influenza in poultry in Chile. Vet.Rec. 151:1882002.
17. Schulman, J.L. and E.D. Kilbourne. Independent variation in nature of
hemagglutinin and neuraminidase antigens of influenza virus:
distinctiveness of hemagglutinin antigen of Hong Kong-68 virus.
Proc.Natl.Acad.Sci.U.S.A. 63:326-333. 1969.
18. Senne, D.A., B. Panigrahy, Y. Kawaoka, J.E. Pearson, J. Suss, M
Lipkind, H. Kida, and R.G. Webster. Survey of the hemagglutinin (HA)
cleavage site sequence of H5 and H7 avian influenza viruses: amino acid
sequence at the HA cleavage site as a marker of pathogenicity potential.
Avian.Dis. 40:425-437. 1996.
19. Siemens, RD., R.S. Cooper, and J.S. Orsbom. Isolation of type-A
influenza viruses from imported exotic birds. Avian Dis. 17:746-751. 1973.
134
20. Slemons, R.D. and D.E. Swayne. Replication of a waterfowl-origin
influenza virus in the kidney and intestine of chickens. Avian Dis. 34:277-
284. 1990.
21. Spackman, E., D.A. Senne, S. Davison, and D.L. Suarez. Sequence
analysis of recent H7 avian influenza viruses associated with three different
outbreaks in commercial poultry in the United States. J Virol. 77:13399-
13402. 2003.
22. Spackman, E., D.A. Senne, T.J. Myers, L.L. Bulaga, L.P. Garber, ML.
Perdue, K. Lohman, L.T. Daum, and D.L. Suarez. Development of a real­
time reverse transcriptase PCR assay for type A influenza virus and the
avian H5 and H7 hemagglutinin subtypes. J.Clin.Microbiol. 40:3256-3260.
2002.
23. Suarez, D.L. and C.S. Schultz. Immunology of avian influenza virus: a
review. Dev.Comp.Immunol. 24:269-283. 2000.
24. Suarez, D.L., D.A Senne, J. Banks, I.H. Brown, S.C. Essen, C.W. Lee,
RJ. Manvell, C. Mathieu-Benson, V. Moreno, J.C. Pedersen, B. Panigrahy,
H. Rojas, E. Spackman, and D.J. Alexander. Recombination resulting in
virulence shift in avian influenza outbreak, Chile. Emerging Infectious
Diseases 10:693-699. 2004.
25. Suarez, D.L., P.R. Woolcock, A.J. Bermudez, and D.A Senne. Isolation
from turkey breeder hens of a reassortant H1N2 influenza virus with swine,
human, and avian lineage genes. Avian Dis. 46:111-121. 2002.
26. Swayne, D.E. Microassay for measuring thermal inactivation of H5N1
high pathogenicity avian influenza virus in naturally-infected chicken meat.
International Journal of Food Microbiology In press:2006.
27. Swayne, D.E. and J.R. Beck. Heat inactivation of avian influenza and
Newcastle disease viruses in egg products. Avian Pathol. 33:512-518. 2004.
28. Swayne, D.E. and D.A. Halvorson. Influenza. In: Diseases of Poultry,
11th ed. Y.M Saif, H.J. Barnes, AM Fadly, J.R. Glisson, L.R. McDougald,
and D.E. Swayne, eds. Iowa State University Press, Ames, LA. pp. 135-160.
2003.
29. Swayne, D.E. and RD. Slemons. Evaluation of the kidney as a potential
site of avian influenza virus persistence in chickens. Avian Dis. 36:937-944.
1992.
30. Tang, Y., C.W. Lee, Y. Zhang, D.A Senne, R. Dearth, B. Byrum, D.R.
Perez, D.L. Suarez, and Y.M Saif. Isolation and characterization of H3N2
influenza A virus from turkeys. Avian Dis. 49:207-213. 2005.
31. Vakharia, V.N., E.T. Mallinson, and P.K. Savage. A 15-min test for Al.
Broiler Industry July:42-46. 1996.
32. Webster, R.G. and C.H. Campbell. An inhibition test for identifying the
neuraminidase antigen on influenza viruses. Avian Dis. 16:1057-1066. 1972.
33. Wood, G.W., J.W. McCauley, J.B. Bashiraddin, and D.J. Alexander.
Deduced amino acid sequences at the haemagglutinin cleavage site of avian
influenza A viruses of H5 and H7 subtypes. Arch.Virol. 130:209-217. 1993.
 30
NEWCASTLE DISEASE VIRUS AND OTHER AVIAN PARAMYXOVIRUSES
Dennis J. Alexander and Dennis A. Senne

SUMMARY. Avian paramyxoviruses are members of the family Paramyxoviridae, genus Avulavirus. Nine serotypes are recognized and are
termed APMV-1 (which is synonymous with Newcastle disease virus [NDV]) to APMV-9. APMV-1 viruses naturally infect a large range of
avian species, but other avian paramyxoviruses appear to be restricted in their host distribution. APMV-1, APMV-2, APMV-3, APMV-6 and
APMV-7 viruses have produced significant disease in naturally infected poultry. In poultry, NDVs can cause a range of clinical signs from
subclinical to sudden very high mortality, depending on virus strain and host. Virulent NDV is a World Organization for Animal Health
(OLE) listed notifiable disease and subject to international reporting.
Agent Identification. Diagnosis of all avian paramyxoviruses is by isolation and identification of the virus. Virus isolation is usually done
by the inoculation of embryonating chickens’ eggs. For NDVs, it is necessary to test for pathogenicity to determine if statutory control
measures should be enforced. Vaccination of poultry and other birds for Newcastle disease is practiced throughout the world and vaccination
for APMV-3 infections in turkeys is done in some countries. For NDVs, tests based on RT-PCR have been developed that facilitate detection
of the virus in clinical specimens from infected animals; in addition a molecular-based assessment of virulence is also available.
Serologic Detection in the Host. Serologic tests have limited diagnostic value in vaccinated poultry, but in unvaccinated birds, may provide
a rapid early indication of infection. Caution should be exercised in relating positive serology to disease signs in view of the subclinical
nature of infections of birds with most avian paramyxoviruses and because of cross-reactions that may occur between serotypes.

INTRODUCTION
Three virus families, Rhabdoviridae, Filoviridae and
Paramyxoviridae, form the order Mononegavirales. These are
viruses with negative-sense, single-stranded, nonsegmented, RNA
genomes. The family Paramyxoviridae has two subfamilies. The
subfamily Pneumovirinae consists of two genera, Pneumovirus,
which includes the mammalian respiratory syncytial viruses and
Metapneumovirus which includes the avian pneumovirus
responsible for turkey rhinotracheitis and swollen head syndrome.
The subfamily Paramyxovirinae consists of five genera. The genus
Morbillivirus includes measles, rinderpest, and the distemper
viruses. The genus Paramyxovirus includes Sendai virus and other
mammalian parainfluenza viruses. The genus Henipavirus which is
formed from the recently discovered Nipah and Hendra viruses. The
genus Rubulavirus includes mumps virus and human parainfluenza
viruses 2 and 4. Newcastle disease (ND) virus (APMV-1), and the
other avian paramyxoviruses (APMV-2 to APMV-9) are placed in
the genus Avulavirus (16). The name avian paramyxoviruses has
been retained rather than adopting the name avulaviruses. It should
be noted that avian paramyxovirus type 1 (APMV-1) and ND virus
(NDV) are synonymous, although the term pigeon paramyxovirus
type 1 (PPMV-1) has been used to distinguish the antigenic variant
APMV-1 virus responsible for the continuing panzootic in racing
and other types of pigeons. Nine distinct serotypes of avian
paramyxovirus have been defined using standard serologic tests (6).
The prototype strains are listed in Table 30.1.
Avian paramyxovirus type 1 (or ND) viruses are important
pathogens for birds of all types, and in most countries infection with
virulent forms is a notifiable disease, suspicion of which requires
immediate notification of animal health authorities. It is an OIE
listed notifiable disease. NDV has a worldwide distribution,
although in some countries, only viruses of low virulence for
chickens have been reported. NDV has a large host range and has
been reported to infect more than 240 species of birds, probably all
species of bird are susceptible to infection.
CLINICAL DISEASE
The clinical signs seen in birds infected with NDV vary widely
and are dependent on factors such as the virus strain, host species,
age of host, presence of other organisms, environmental stress, and
the immune status of the host. In chickens the disease caused by
different strains of NDV may vary from sudden death with 100%
mortality to subclinical infection. The influence of host species may
be equally marked and, for example, viruses causing severe disease
135
in chickens and turkeys may cause few signs of disease in ducks.
The clinical signs that may be associated with ND are respiratory
distress; diarrhea; cessation of egg production; depression; edema of
head, face, and wattles; nervous signs; and death. Some, all, or none
of these signs may be present.
Avian paramyxovirus type 2 and APMV-3 infections of turkeys
are common in some countries (including the United States) and are
usually associated with respiratoiy disease and egg production
problems. APMV-2 viruses have afso been reported in chickens.
APMV-3 viruses have been associated with nervous disease with
high mortality in some captive psittacine species. APMV-6 and
AMPV-7 virus infections in turkeys have been associated with
respiratory signs and elevated mortality. APMV-5 viruses have
been isolated from budgerigars and lorikeets in association with
invariably lethal disease. All other isolations of other serotypes of
avian paramyxoviruses have been made from commercial or feral
birds with no associated disease.
SAMPLE COLLECTION
For virus isolation
For all avian paramyxoviruses, the samples associated most
consistently with successful virus isolation have been feces or
cloacal swabs. Viruses have also been isolated frequently from the
respiratory tract using tracheal/orophaiyngeal swabs. Thus, it is
important when taking samples for virus isolation that
tracheal/oropharyngeal swabs and cloacal swabs or fecal material
are included regardless of the clinical signs or the postmortem
lesions. Additional samples collected from dead birds should reflect
the clinical signs (e.g., brain if neurologic signs were evident) and
the obviously affected organs. Virulent NDV is commonly isolated
from lung, spleen, liver, heart, and brain. Ideally, all samples should
be dealt with separately. In practice, it is usual to make pools of the
organs and tissues, but to treat tracheal/oropharyngeal swabs and
fecal samples separately, both from each other and from organ and
tissue samples. However, tissues/organs from different birds should
not be pooled, to avoid the possibility of neutralization of ND virus
from one bird by specific antibodies from another bird. For birds
showing neurologic signs before death, especially when
investigating APMV-1 infections in pigeons, it is advisable to
process brain samples separately from other organs and tissues. In
NDV vaccinated flocks suspected of being infected with virulent
NDV, sampling of daily mortalities has been shown to be more
productive in detecting the virus than the random sampling of birds
in the flock.
Swabs should be placed in sufficient antibiotic medium to ensure
full immersion. Fecal samples and finely minced tissues or organs
Dennis J. Alexander and Dennis A. Senne
should be placed in antibiotic medium as 10-20% w/v suspensions.
The antibiotic medium should be based on phosphate-buffered
saline at pH 7.0-7.4 (checked after the addition of antibiotics).
Protein based media e.g. brain heart infusion (BHI) or tris-buffered
tryptose broth (TBTB) have also been used and may give added
stability to the virus, especially during shipping. The antibiotics
used and their concentrations may be varied to suit local conditions
and availability. Very high levels of antibiotics may be necessary
for fecal samples; suggested levels are: 10,000 IU/ml penicillin, 10
mg/ml streptomycin, 0.25 mg/ml gentamycin, and 5,000 IU/ml
nystatin. These levels can be reduced up to fivefold for tissues and
tracheal swabs. If control of Chlamydophila is desired 0.05-0.1
mg/ml oxytetracycline should be included.
Successful isolation is enhanced by rapid processing of samples.
Virus infectivity in tissues or organs is destroyed by putrefaction
and this should be avoided by refrigerating samples at 4 C or on ice
during transport or storage. Placing samples in antibiotic medium
for transportation should be done in addition to chilling and not as
an alternative to chilling. Most avian paramyxoviruses appear to be
able to survive in fecal samples for long periods even at relatively
high ambient temperatures. Most NDVs will survive a single
freeze-thaw cycle with little loss in infectivity, but this may not be
the case with other avian paramyxoviruses.
For RT-PCR
The use of real time RT-PCR (rRT-PCR) assays in diagnostic
laboratories is becoming increasingly popular. A one step rRT-PCR
assay has been shown to be highly sensitive in detecting NDV RNA
in clinical samples (21) and has been used in the U.S. as a front line
test in place of virus isolation in outbreaks of virulent ND and for
surveillance.
Samples suitable for the isolation of NDV, for the most part, also
can be used for rRT-PCR (see collection of samples for virus
isolation above). However, tracheal or oropharyngeal swabs are the
specimens of choice because they contain the nucleic acid, are easy
to process, and generally contain less extraneous organic material
that can interfere with RNA recovery and amplification by PCR.
Particular attention should be given to the selection of an
appropriate method for RNA extraction to maximize recovery.
Good quality RNA not containing PCR inhibiting substances is
essential for successful amplification in the rRT-PCR assay. Also,
use of an internal positive control (unrelated to the target cDNA) is
highly recommended to monitor for presence of PCR inhibiting
substances that could cause a false negative test result. Several
commercial kits are suitable for the recovery of RNA from clinical
specimens. The three commercial RNA extraction kits that have
been most thoroughly evaluated for rRT-PCR assays are Trizol
reagent (Invitrogen, Carlsbad, CA), RNeasy (Qiagen, Valencia, CA)
and MagMAX (Ambion, Austin, TX). Trizol is an organic
extraction method that works well for most specimens and has been
shown to be best for extraction of RNA from suspensions of tissue.
Although the Trizol kit will also work well for swab specimens, the
toxic chemicals (phenol, guanidine isothiocyanate, and chloroform)
required for this method makes it less desirable than other methods.
The RNeasy extraction kit has been used extensively for processing
tracheal and oropharyngeal swabs but has lower sensitivity for
tissue suspensions and cloacal swabs, most likely because of the
heavy organic load in these specimens; the extraneous RNA
competes for binding sites in the extraction column, resulting in
lower recovery rates of target RNA. The MagMAX kit can be
performed in 96-well plates and therefore is more suitable than
other extraction methods for high throughput testing. However, the
suitability of this method for extraction of tissue suspensions and
cloacal swabs has not yet been fully evaluated.
136
PREFERRED CULTURE MEDIA AND SUBSTRATES
Virus isolation
Newcastle disease virus and most other avian paramyxoviruses
will grow well in a variety of cell culture systems. Avirulent NDVs
and other avian paramyxoviruses usually require the addition of
trypsin (0.005-0.01 mg/ml) to facilitate growth in cell cultures.
However, the most sensitive method of isolation for all these
viruses is the inoculation of embryonating chicken eggs.
Samples in antibiotic media should be left at least 30 min at room
temperature before inoculation (this step can be omitted if samples
have been stored overnight or longer at -4 C). Suspensions of
tissues and organs or swab washings should be centrifuged at 1000
x g for 10-20 min, and 0.1-0.3-ml volumes of the supernatant are
inoculated into the allantoic cavity of four or five 9 to 11-day-old
embryonating chicken eggs. Eggs should be obtained from a
specific-pathogen-free (SPF) flock; if this is not possible, eggs
obtained from a flock free of NDV antibodies may be considered.
Use of eggs from antibody-positive flocks will reduce the ability of
the virus to grow and the success of virus isolation.
Inoculated eggs should be placed at 37 C and candled regularly.
Eggs with dead or dying embryos and all eggs 5-7 days after
inoculation should be chilled to 4 C, and the allantoic/amniotic
fluids collected and tested for hemagglutinating activity. Ideally,
negative fluids diluted 1:10 in antibiotic medium should be
passaged at least once more. Some laboratories use undiluted
allantoic fluid for the second and subsequent passages; no work has
been done to show which method is the moje sensitive. To expedite
diagnosis, some laboratories have used two 3 day passages and
reported comparable results to two 6 day passages, but this has not
yet been fully evaluated. Positive fluids need to be tested for
freedom from bacteria. If bacteria are present the fluids may be
passed through a 450-nm membrane filter or centrifuged to remove
bacteria and repassaged in eggs after the addition of more
antibiotics.
Avian paramyxovirus type 5 viruses do not grow in the allantoic
cavity of chick embryos, and several reports exist of greater success
at isolating some other avian paramyxoviruses by inoculation into
the yolk sac rather into than the allantoic cavity. For avian
paramyxovirus isolations, consideration should be given to
inoculation of material in to the yolk sac of 6 to 8-day-old chick
embryos in addition to the allantoic cavity of 9 to 11-day-old eggs;
this is essential for APMV-5 viruses.
RT-PCR
For NDV, most RT-PCR assays have been developed to aid in the
identification or characterization of isolates by using primers that
amplify portions of the genome related to a specific function, for
example the fusion gene cleavage site and virulence (3, 10, 14, 19).
Both conventional RT-PCR and nested RT-PCR assays have been
used. More recently, a one step rRT-PCR assay has been developed
to aid in the detection of NDV specific RNA in clinical samples as
well as to provide a rapid method to distinguish between viruses of
low and high virulence (21). This is especially important in
outbreaks of virulent NDV where birds may be co-infected with
both vaccine and virulent virus.
In general, RT-PCR assays have four steps: isolation of the RNA;
conversion of the viral RNA to cDNA by the use of reverse
transcriptase; amplification of the cDNA by PCR; and evaluation of
the PCR product (amplicon) for presence or absence of the target
DNA sequence. Specificity of the amplicon is usually confirmed by
electrophoresis of the amplicon in an agarose gel containing
ethidium bromide, then comparing the size of the amplicon to
markers of known molecular weight. However, other methods such,
as enzyme restriction endonuclease assays and direct sequencing
have been used to confirm specificity of the amplicon. The need for
post-amplification processing of the amplican is one of the major

drawbacks of using RT-PCR as a diagnostic assay because of the
high potential for contamination of the laboratory and cross
contamination of samples. Extreme precautions, such as the use of
dedicated equipment and separation of sample processing activities
from post amplification processing activities, must be taken to
prevent cross contamination.
Real time RT-PCR assays differ from conventional RT-PCR
assays in that they require special thermocyclers and use
fluorogenic hydrolysis (Taqman) probes or fluorescent dyes that,
respectively, bind to specific targets on the PCR product or non-
specifically to any double stranded DNA molecule, to monitor for
presence of target DNA after each PCR cycle, thus providing results
in real time. The major advantages of the one step rRT-PCR assay
is that results can usually be obtained in less than three hr and the
elimination of the post amplification processing step, thus reducing
concerns about cross contamination of samples. Unfortunately,
many smaller laboratories have been hampered from using this
technology because of the high start-up costs associated with
purchasing the real time thermocyclers.
The rRT-PCR assay described by Wise et al. (21) for detection of
NDV RNA in clinical specimens was developed and validated
during an outbreak of virulent ND in the U.S. in 2002-03 and
eventually replaced virus isolation as the front line test during the
outbreak. The rRT-PCR assay showed a sensitivity of 95% when
results were compared to virus isolation on more than 1,400
specimens. The assay has three sets of primers and probes that are
used in separate reactions: a matrix primer/probe set that is
designed to detect most strains of NDV, a fusion primer/probe set
that can identify virulent strains of NDV (including many PPMV-1
viruses) and a primer/probe set designed to detect low virulent
strains of the virus. Samples are first screened with the matrix
primers/probe then positive specimens are tested with the low
virulent and fusion and primers/probe sets to confirm presence of
low or highly virulent virus, respectively. At the peak of the
outbreak, between 1,000 and 1,500 samples were tested daily by
rRT-PCR. Testing capacity is mostly controlled by the extraction
method used and availability of sufficient number of real time
thermocyclers. In the U.S. the rRT-PCR assay has been authorized
for use in more than 35 laboratories as a front line surveillance tool
for NDV.
AGENT IDENTIFICATION
Virus Identification
Hemagglutination activity in bacteria-free fluids will be due to one
of the nine avian paramyxovirus serotypes or one of the 16
influenza A virus subtypes. Most diagnostic laboratories will be
primarily concerned with the presence of APMV-1 (NDV), which
can be confirmed or ruled out by hemagglutination-inhibition (HI)
tests with specific antiserum. Alternatively, procedures based on
RT-PCR [see below] can be used to confirm the presence of
APMV-1 (NDV) at this stage. In laboratories where differentiation
of the avian paramyxovirus serotypes is done routinely, subjecting
the hemagglutinating agent to HI tests against a range of specific
antisera representing all the serotypes is usually considered most
practicale.
Antisera used for virus identification is generally prepared in
chickens. Most laboratories have their own methods for the
production of such antisera. For APMV-1 viruses of low virulence
and other avian paramyxoviruses, suitable serum can usually be
obtained by the infection of 6- to 9-wk-old SPF chickens with 0.1
ml of infectious allantoic fluid by injection into the leg muscle and
nasal instillation of a further 0.1 ml of infectious allantoic fluid at
the same time. This is repeated after 2 wk and the serum collected
after another 3 wk.
Specific polyclonal chicken sera can be used in most serologic
tests, such as virus neutralization, agar gel immunodiffusion, and
137
Chapter 30 Newcastle Disease Virus and other Avian Paramyxoviruses
enzyme-linked immunosorbent assay (ELISA), for identifying and
serotyping isolated viruses. However, the conventional method
usually employed is the HI test, which is described in Chapter 47 on
serological procedures.
Serotype identification for avian paramyxoviruses is usually
straightforward, although some levels of cross- reaction may be
seen between the various serogroups. The most important of these is
the cross-reaction seen in HI tests between APMV-1 and APMV-3
viruses, particularly when the latter are isolated from psittacines or
other caged or exotic birds. Usually, confusion due to this
relationship can be avoided if adequate control sera and antigens are
used.
Several laboratories have produced monoclonal antibodies (mAbs)
to representatives of some of the avian paramyxovirus serotypes
and these may be employed in HI tests or other tests to give highly
specific serotyping of avian paramyxoviruses and even divisions
within serotypes (see below). mAbs can be added to the initial
battery of antisera used for virus identification to give maximum
information about an isolate at an early stage.
Morphology and Physicochemical Properties
Avian paramyxoviruses are RNA viruses with helical capsid
symmetry and have an nonsegmented, single-stranded genome of
negative sense. The RNA has a molecular weight of about 5 x 106,
which makes up about 5% by weight of the virus particle.
Nucleotide sequencing of the complete NDV genome has shown it
to consist of 15,156 nucleotides, although there may slight
variations with different strains. The capsid of avian
paramyxoviruses is assembled in the cytoplasm and becomes
enveloped by modified cell lipoprotein membrane as the virus is
budded from the cell surface. Two functional virus glycoproteins
are inserted in the envelope, one (HN) possesses hemagglutination
and neuraminidase activities, the other (F) is the fusion protein.
During the infection process the HN protein is responsible for
attaching the virus to the cell and the F protein brings about fusion
between the cell and virus membranes to allow the genetic material
to enter the cell.
As seen by negative contrast electron microscopy, avian
paramyxoviruses consist of pleomorphic particles that are usually
rounded and 100-500 nm in diameter or are present as filamentous
forms about 100 nm across. Surface projections on the envelope,
approximately 8 nm long, represent the HN molecule, with the F
molecules forming smaller projections. Virus envelopes are
frequently disrupted so that a characteristic herring-bone
nucleocapsid about 18 nm across may be seen emerging or free in
virtually all paramyxovirus electron microscope preparations. The
presence of nucleocapsid may serve as a useful method for
distinguishing paramyxoviruses from influenza viruses, as the
nucleocapsid of the latter is rarely ever seen.
Pathogenicity of NDV
Isolates of NDV require further diagnostic characterization in
addition to identification as APMV-1 serotype. Not only may
different NDV strains show extremes of pathogenicity, but also
viruses of low virulence are enzootic in feral birds in most
countries. Use of live vaccines is almost universal, and exacerbation
of infections with viruses of low virulence may mimic disease
produced by highly virulent virus. Therefore, characterization to
assess the virulence of the isolated virus is extremely important to
ensure that the virus conforms to the definitions laid down in
control and/or eradication policies.
Pathotypes. Newcastle disease virus strains and isolates have
been grouped into five clinico-pathological groups that relate to the
disease signs and lesions produced in infected fully susceptible
chickens (9): 1) viscerotropic velogenic NDV, which produces
acute lethal infections in which hemorrhagic lesions are prominent
in the gut; 2) neurotrophic velogenic NDV, which produces high
Dennis J. Alexander and Dennis A. Senne
mortality preceded by respiratory and neurologic signs (gut lesions
are absent); 3) mesogenic NDV, which produces low mortality,
acute respiratory disease, and nervous signs in some birds; 4)
lentogenic NDV, which produces mild or inapparent respiratory
infections; and 5) asymptomatic enteric NDV, which are avirulent
viruses that appear to replicate primarily in the gut. These groups
are not completely clear-cut and some overlapping between the
signs associated with the different groups has been reported.
If an NDV isolate is suspected to be virulent for chickens or other
poultry species, it should be submitted to a reference laboratoiy for
assessment. In the United States such viruses may be propagated
only in a biosafety level 3 (BSL-3) laboratoiy, and similar or stricter
restrictions apply in many other countries.
Pathogenicity Tests for NDV.
Several pathogenicity tests have been developed to differentiate
between NDV isolates of high and low virulence with some level of
standardization. However, international agencies such as the World
Organization for Animal Health [OIE] have adopted the
intracerebral pathogenicity index [ICPI] test as the in vivo test used
for defining the virulence of NDV isolates.
Intracerebral Pathogenicity Index (ICPI). The ICPI is determined
by inoculating 0.05 ml of a 1:10 dilution of infectious, bacteria-ffee
allantoic fluid in sterile isotonic saline (antibiotics must not be
present) into the brains of each of 10 1-day-old (24 to 40 hr-old)
chicks from SPF parents. The birds are observed daily for 8 days
and, at each observation, scored 0 if normal, 1 if sick, and 2 if dead.
Birds that are sufficiently sick to be unable to eat or drink must be
killed humanely and scored as dead at the next observation. The
ICPI value is the mean score per bird per observation. Viruses very
virulent for chickens give values approaching 2, lentogenic viruses
give values close to 0 (Table 30.2).
Some evidence exists that NDV isolates from unusual species may
not show their true virulence for chickens in pathogenicity index
tests until passaged several times in chickens.
By internationally accepted definition, viruses that cause ND for
which control measures should be imposed and trade restrictions
may be applied are those with an ICPI of 0.7 or greater.
When tested, other avian paramyxoviruses have usually produced
indices similar to those of lentogenic NDV isolates. However,
several reports have been made of psittacine APMV-3 viruses
producing ICPI values of 1.0 or more, which emphasizes the need
to differentiate APMV-1 viruses from other avian paramyxoviruses
correctly.
Molecular Assessment of Pathogenicity.
An understanding of the molecular basis that controls the virulence
of NDV strains (18) has meant that it is now possible, using
nucleotide sequencing techniques, to assess whether or not an
isolate has the genetic make up to be highly pathogenic for poultry.
The viral F protein brings about fusion between the virus membrane
and the cell membrane so that the virus genome enters the cell and
replication can begin. The F protein is therefore essential for
replication, but during replication, NDV particles are produced with
a precursor glycoprotein, F0, that has to be cleaved to Fl and F2
polypeptides, which remain bound by disulphide bonds, for the
virus particles to be infectious. This post translation cleavage is
mediated by host cell proteases.
The cleavability of the F0 molecule has been shown to be related
directly to the virulence of viruses in vivo. A large number of
studies have confirmed the presence of multiple basic amino acids
at the F0 cleavage site in virulent viruses. Usually the sequence has
been 113RQK/RR
*
F 117 in virulent viruses, but most have had a basic
amino acid at position 112 as well. In contrast, viruses of low
virulence usually have the sequence 113K/RQG/ER * L 117.
138
Thus there appears to be the requirement of a basic amino acid at
residue 113, a pair of basic amino acids at 115 and 116 plus a
phenylalanine at residue 117 if the virus is to be virulent for
chickens (Table 30.3). The presence of these basic amino acids at
these positions means that cleavage can be affected by a protease or
proteases present in a wide range of host tissues and organs, but for
lentogenic viruses, cleavage can occur only with proteases
recognizing a single arginine, i.e. trypsin-like enzymes. Lentogenic
viruses are therefore restricted in the sites where they are able to
replicate to areas with trypsin-like enzymes, such as the respiratory
and intestinal tracts, whereas virulent viruses can replicate and
cause damage in a range of tissues and organs resulting in a fatal
systemic infection.
This molecular basis of virulence has been incorporated into the
internationally recognized definition of viruses that cause ND for
which control measures should be imposed and trade restrictions
may be applied, as an alternative to the ICPI test. Defining such
viruses as those where “Multiple basic amino acids have been
demonstrated in the virus (either directly or by deduction) at the C-
terminus of the F2 protein and phenylalanine at residue 117, which
is the N-terminus of the Fl protein. The term ‘multiple basic amino
acids’ refers to at least three arginine or lysine residues between
residues 113 and 116. Failure to demonstrate the characteristic
pattern of amino acid residues as described above would require
characterization of the isolated virus by an ICPI test. [In this
definition, amino acid residues are numbered from the N-terminus
of the amino acid sequence deduced from .the nucleotide sequence
of the F0 gene, 113-116 corresponds to residues -4 to -1 from the
cleavage site.]”
It is worth noting that all the so-called mesogenic viruses fall
within this definition, possessing basic amino acids at the F0
cleavage site and having ICPI values >0.7.
The method by which the presence of multiple basic amino acids
at the cleavage site can be determined has largely been limited to
RT-PCR amplification of the coding sequences surrounding the
fusion protein cleavage site, followed by sequencing of the
amplicon by automated sequencing methods (19). This approach
has been used to obtain sequences from a large number of isolates
of different temporal, geographical and host origins. However, as
with any molecular based assay, success in the amplification of the
target sequence will depend on the sensitivity of the primers used.
Although the primers published by Seal et al. (19) work well for
most NDV strains, they have shown limited sensitivity in
amplifying viruses of genotype 6 isolated from ducks. Other
methods for differentiating low from highly virulent NDV by RT-
PCR have been described (3, 10); however, they do not provide
direct confirmation of the presence or absence of multiple basic
amino acids at the fusion protein cleavage site
Newcastle Disease Virus Strain Differentiation Using
Monoclonal Antibodies
Using conventional serologic techniques, NDV strains and isolates
had been considered to form an antigenically homogeneous group.
This meant that diagnosis usually resulted in little information
relating to the source or the spread of the virus involved. MAbs may
detect slight variations in antigenicity, such as single amino acid
changes at the epitope to which the antibody is directed. Several
groups of workers have developed mAbs against NDV strains,
primarily for diagnostic or epidemilogical purposes. Some workers
have used mAbs to distinguish between specific viruses, for
example, two groups have described mAbs which distinguish
between the common vaccine strains Hitchner Bl and La Sota (11,
17) whereas other mAbs have been used in distinguish vaccine

Table 30.1. Avian Paramyxoviruses.
Prototype virus strain Usual natural hosts
APMV-1/Newcastle disease virus Numerous
APMV-2/chicken/Califomia/Yucaipa/56 Turkeys, passerines
APMV-3a/ turkey/Wisconsin/68 Turkeys
APMV-3A/parakeet/Netherlands/449/75 Psittacines, passerines
APMV-4/duck/Hong Kong/D3/75 Ducks
APMV-5Zbudgerigar/Japan/Kunitachi/74 Budgerigars, lorikeets
APMV-6/duck/Hong Kong/199/77 Ducks
APMV-7/dove/Tennessee/4/75 Pigeons, doves
APMV-8/goose/Delaware/l 053/76 Ducks and geese
APMV-9/duck/New York/22/78 Ducks
viruses from an epizootic virus in a given area (20). MAb typing
was also used to establish the uniqueness of the variant NDV
responsible for the pigeon panzootic and specific mAbs have
proven particularly useful in identify the spread of this virus around
the world.
However, although use of mAb panels showed that viruses
grouped on their ability to react with the same mAbs shared
biological and epizootiological properties and that viruses tend to
remain fairly well conserved antigenically during outbreaks or
epizootics (7) this approach to epizootiological assessments of ND
outbreaks has been largely supplanted by phylogenetic analysis.
Phylogenetic analysis
Nucleotide sequencing, after RT-PCR and phylogenetic analysis,
has been used by a number of authors to assess genetic differences
and genotypes of ND viruses. It has been established that sequences
of as little as 250 base pairs give meaningful phylogenetic analyses,
comparable with those obtained with much longer sequences (15,
19), which means that sequencing and phylogenetic analyses can be
done rapidly. In the preliminary characterization studies of NDV,
six lineages (I to VI) were determined using restriction enzyme
analysis (8). These groupings have subsequently been confirmed,
and two further lineages (VII and VHT) and several sublineages
within these have been identified through nucleotide sequencing
studies (13). Aldous et al., (4) studied the nucleotide sequences of a
375-nucleotide fragment at the 3’ end of the fusion protein gene,
which includes the region encoding the nuclear localization signal
sequence and the precursor fusion protein cleavage activation site,
of 338 isolates of NDV representing a range of viruses of different
temporal, geographical and host origins. They concluded that the
isolates divided into six broadly distinct groups (lineages 1 to 6).
Lineages 3 and 4 were further subdivided into four sublineages (a to
d) and lineage 5 into five lineages (a to e). Essentially lineages 1, 2,
4 and 5 corresponded to the earlier defined lineages I, Π, VI and
VH, with comparable sub-lineages but that the geno-groupings ΙΠ,
IV, V, VUI corresponded to their sublineages (3a to 3d). In addition
lineage 6 represent a new geno-group. Aldous et al., (4) proposed
that genotyping of NDV isolates should become part of diagnostic
virus characterization for reference laboratories by producing the
375-nucleotide sequence of the F gene routinely for all viruses and
comparing the sequences obtained with other recent isolates and 18
viruses representative of the recognized lineages and sub-lineages.
Such preliminary analysis should allow rapid epidemiological
assessment of the origins and spread of the viruses responsible for
ND outbreaks.
139
Chapter 30 Newcastle Disease Virus and other Avian Paramyxoviruses
Disease produced in naturally infected poultry
Very common, worldwide, varies from very severe to inapparent disease,
depending on strain and host infected
Common, probably worldwide, mild respiratory disease or egg production
problems; severe if exacerbation occurs
Turkeys only, in North America and Europe, mild respiratory disease but
severe egg production problems worsened by exacerbating organisms or
environment
No infection of poultry reported
None known
No infection of poultry reported
Mild respiratory disease and slightly elevated mortality in turkeys; none in
ducks or geese
Natural infections of turkeys with respiratory disease and ostriches have been
reported
No infection of poultry reported
None known
SEROLOGIC DETECTION IN THE HOST
Detection of an immune response to NDV or other avian
paramyxoviruses may serve a useful diagnostic function, allowing
detection of infections in unvaccinated birds and the monitoring of
response to vaccination. Numerous serologic tests may be used to
detect antibodies, but the most commonly used for this group of
viruses is the HI test. Details of the procedures for this test are given
in Chapter 46 on titration of biological suspensions.
Hemagglutination-Inhibition
Suitably diluted infectious allantoic fluid may be used as antigen
in HI tests for all avian paramyxoviruses except APMV-5. Use of
noninfectious antigens usually is desirable; and for NDV formalin-
inactivated virus (infectious allantoic fluid treated with 0.1%
formalin) is often used as antigen. However, the hemagglutinin­
neuraminidase (HN) protein of some avian paramyxoviruses is not
stable when treated with formalin and for those viruses beta-
propriolactone (0.05% final concentration) may be used as an
alternative to formalin for inactivation. Hemagglutinating activity
was not detected in the original APMV-5 isolates, but later viruses
placed in this serotype have been shown to agglutinate red blood
cells if concentrated following growth in chick embryo cell cultures.
Some evidence exists that minor antigenic differences between
strains of NDV can result in different HI titers with the same
antiserum. This is particularly true using the variant PPMV-1 virus
as antigen.
Interpretation of HI Response
Serum titers will vary with the amount of antigen used in the test;
figures quoted in this section assume 4 HA units of virus. For all
avian paramyxovirus serotypes, birds that have not been immunized
or infected usually have HI titers of less than 1:8, and nonspecific
titers above this level are rare for most avian species. However, sera
from other species may cause agglutination of chicken red blood
cells to titers high enough to mask low positive inhibition. This
agglutination, caused by the presence of natural serum agglutinins,
can be removed by treatment of the sera with concentrated chicken
red blood cells before testing. Alternatively, use of red blood cells
from the homologous species can be considered.
In the absence of vaccination, a positive specific HI response is
confirmation of infection of the birds with that serotype. However,
the possibility of cross-reaction between some avian
paramyxoviruses should be considered, especially between viruses
of APMV-1 (NDV) and APMV-3 serotypes.
Dennis J. Alexander and Dennis A. Senne

Inactivated vaccines for APMV-3 viruses are used in the United available commercially. The main advantage of ELISAs over more
States and Europe and use of APMV-2 vaccines has been conventional tests, such as HI tests, is that they can be semi­
undertaken in some countries. Little is known of the interpretation automated, enabling results to be obtained rapidly and
of the immune response to vaccines for these serotypes. Although inexpensively, especially when sera are to be screened for
considerable work has been done in attempts to assess the likely antibodies to several viruses (see Chapter 47 on serologic
outcome of infection with virulent NDV at different levels of procedures). As a result, ELISAs have often become the method of
immunity, care must be taken in making such assessments due to choice for flock screening programs, particularly those aimed at
the effects other factors may have. In broad terms titers at the low assessing vaccine response. Studies aimed at standardizing ELISA
end of those measurably positive may protect against death in tests and comparing them with conventional tests, for example
Adair et al., (1), have concluded that ELISAs for NDV antibodies
Table 30.2. Pathotypes and intracerebral pathogenicity indices__________ usually show good reproducibiEty, high comparative sensitivity and
Pathotype Range of indicesA Examples of viruses® specificity, and correlate well with the HI test.
ICPI The ELISAs should be modified and validated for species on
Herts 33, N.Y. Parrot which it is being used. ELISA tests are usually extremely sensitive
Viscerotropic
1.5-2.0 70181, CA2089/72 and this may restrict their value for diagnostic testing when
velogenic
antigenic relationships exist between different viruses, which is the
Neurotropic Texas GB
velogenic
1.5-2.0 case with avian paramyxoviruses. Both these problems could be
*,Roakin Komarov
*, addressed by use of competitive or blocking ELISAs employing one
Mesogenic 1.0-1.5 *,
Mukteswar *
H or more mAb to NDV, although mAb(s) should be evaluated to
Hitchner Bl *
, La determine that they react with all strains of NDV and not other
Lentogenic 0.2-0.5 *,
Sota Clone 30 * avian paramyxoviruses.
Ulster 2C
*, *,
V4
Asymptomatic enteric 0.0-0.2 MC110 DIFFERENTIATION FROM CLOSELY RELATED AGENTS
A ICPI = intracerebral pathogenicity index in 1-day-old chicks, See text
for details. Because of their abiEty to cause agglutination of red blood cells,
B Strains marked with an asterisk are used routinely as vaccines in some usually without concentration or treatment, problems in
countries. differentiating avian paramyxoviruses are primarily from each other
uncomplicated infections. However, even high titers will not and from influenza viruses. Preliminary distinction from influenza
prevent some replication of challenge virus and significant egg viruses can be done by examination in the electron microscope
production losses may occur in flocks with prechallenge mean titers where negative contrast staining will reveal morphologic
as high as 1:256. With most lentogenic live NDV vaccines, HI titers differences, most notably the presence of the characteristic
of 1:16 to 1:64 are usually obtained following a single dose. nucleocapsid emerging from disrupted paramyxovirus particles. The
Repeated vaccination with similar or more virulent Eve virus abiEty of paramyxoviruses, but not influenza viruses, to cause
vaccines may increase the immune response considerably, and if oil hemolysis of chicken red blood ceUs at pH 7.0 has also been used in
emulsion inactivated vaccines are included, titers up to 1:1024 to the past. Influenza A viruses can be confirmed in allantoic fluid by
1:4096 are common. Multiple vaccinations with either Eve-, killed- the agar gel immunodiffusion test with type A positive antiserum,
or combinations of both virus vaccines wiU also increase the level or by the use of antigen capture immunoassays (membrane bound or
of crossreactivity between serotypes of APMVs in the HI test. flow-through) designed to detect influenza A viruses. The antigen
capture immunoassay tests are not Ecensed for veterinary use but
Enzyme-linked Immunosorbent Assays for NDV Antibodies have been shown to detect all 16 subtypes of avian influenza virus
Numerous ELISA tests have been developed for the detection of (ATV) and are highly specific. Differentiation between APMV-1
antibodies to NDV and several ELISA kits for this purpose are and ATV can also be done by the use of RT-PCR (conventional and
real time), with primers directed to the highly conserved matrix
Table 30.3. Amino acid sequences at the F0 cleavage site of APMV-1 protein genes of both APMV-1 and ATV. RT-PCR assays have also
viruses modified from Aldous & Alexander (2) been developed that can discriminate between virulent and vaccine
F0 Cleavage site amino acids 111 to virus. However, it is recommended for definitive identification that
Virus strain Pathotype
119 isolates be submitted to a reference laboratory that can that can use
Herts 33 velogenic FIG-
-GRRQRR
* a battery of polyclonal sera against each of the paramyxoviruses, or
Essex ‘70 velogenic FVG-
*
-GRRQKR initially against the most likely serotypes, in HI tests.
Differentiation of avian paramyxoviruses into serotypes can be
Texas GB velogenic -GRRQKR
FIG-
*
more of a problem due to antigenic relationships between viruses of
617/83 PPMV-1 FIG-
*
-GGRQKR different serotypes, which are apparent in most conventional tests.
34/90 velogenic -GKRQKR
FVG-
* This cross reaction in serologic tests is most marked between
Beaudette C mesogenic FIG-
*
-GRRQKR APMV-1 and APMV-3 viruses (particularly APMV-3 viruses
isolated from psittacines). Usually the use of adequate control
Roakin mesogenic FIG-
*
-GRRQKR
antigens and antisera leaves tittle doubt in serotyping isolates from
La Sota lentogenic *
-GGRQGR
LIG- these groups, but mAbs specific for APMV-1 and APMV-3 have
Hitchner Bl lentogenic LIG-
*
-GGRQGR been employed to simplify differentiation (5).
asymptomatic The development and application of RT-PCR or rRT-PCR assays
D26 LIG-
-GGKQGR
* has made it possible to differentiate quickly NDV from other avian
enteric
asymptomatic paramyxoviruses based on genetic differences and to detect
MC110 LIG-
-GERQER
*
enteric mixtures of low and highly virulent ND virus in the same sample.
asymptomatic However, such assays are not yet available to confirm the presence
1154/98 LIG-
*
-GRRQGR
enteric or distinguish between the other avian paramyxoviruses.
note that all virulent viruses have phenyalalanie (F) at position 117, the Fl
N-terminus
140

REFERENCES
1. Adair, B. Μ, M S. McNulty, D. Todd. T .J. Connor, and K. Bums.
Quantitative estimation of Newcastle disease virus antibody levels in
chickens and turkeys by ELISA. Avian Pathol. 18:175-192. 1989.
2. Aldous, E. W. and D. J. Alexander, Technical Review: Detection and
differentiation of Newcastle disease virus (avian paramyxovirus type 1)
Avian Pathol. 30(2): 117-128. 2001.
3. Aldous, E. W., M. S. Collins, A. McGoldrick, and D. J. Alexander. Rapid
pathotyping of Newcastle disease virus (NDV) using fluorogenic probes in a
PCR assay. Vet. Microbiology. 80:201-212. 2001.
4. Aldous, E. W., Mynn, J. K. Banks, J. and D. J. Alexander, (A molecular
epidemiological study of avian paramyxovirus type 1 (Newcastle disease
virus) isolates by phylogenetic analysis of a partial nucleotide sequence of
the fiision protein gene. Avian Pathol. 32: 239-357. 2003.
5. Alexander, D. Avian Paramyxoviridae— recent developments. In:
Proceedings of the 1st European Society for Veterinary Virology Congress,
Liege. Vet. Microbiol. 23:103-114. 1990.
6. Alexander, D.J. Newcastle disease, Other Avian Paramyxoviruses and
Pneumovirus infections: Newcastle disease. In: Diseases of Poultry. Y.M
Saif [ed in chief] Iowa State University Press USA pp 64-87. 2003.
7. Alexander, D. J., R. J. Manveil, J. P. Lowings, K. M Frost, M S.
Collins, P. H. Russell, and J. E. Smith. Antigenic diversity and similarities
detected in avian paramyxovirus type 1 (Newcastle disease virus) isolates
using monoclonal antibodies. Avian Pathol. 26:399-418. 1997.
8. Ballagi-Pordany, A., E. Wehmann, J. Herczeg, S. Belak, and B.
Lomniczi. Identification and grouping of Newcastle disease virus strains by
restriction site analysis of a region from the F gene. Archiv. Virol. 141: 243-
261. 1996.
9. Beard, C. W., and R. P. Hanson. Newcastle disease. In: Diseases of
poultry, 8th edition. M S. Hofstad, H. J. Barnes, B. W. Calnek, W. M Reid,
and H. W. Yoder, eds. Iowa State University Press, Ames, Iowa, pp. 452-
470. 1984.
10. Creelan, J. L., D. A. Graham, and S. J. McCullough. Detection and
differentiation of pathogenicity of avian paramyxovirus serotype 1 from
field cases using one-step reverse transcriptase-polymerase chain reaction.
Avian Pathology 31:493-499. 2002.
141
Chapter 30 Newcastle Disease Virus and other Avian Paramyxovinee
11. Erdei, J., K. Bachir, E. F. Kaleta, K. F. Shortridge, and B. LommoL
Newcastle disease vaccine (La Sota) strain specific monoclonal antibody.
Arch. Virol. 96:265-269. 1987.
12. Hanson, R. P., and C. A. Brandly. Identification of vaccine strains of
Newcastle disease virus. Science 122:156-157. 1955.
13. Herczeg, J., S. Pascucci, P. Massi, M Luini, L. Selli, I. Capua, I. and Bl
Lomniczi. A longitudinal study of velogenic Newcastle disease vnws
genotypes isolated in Italy between 1960 and 2000. Avian Pathol. 30: 163-
168. 2001.
14. Jestin, V., and A. Jestin. Detection of Newcastle disease virus RNA in
infected allantoic fluids by in vitro enzymatic amplification (PCR). Arch.
Virol. 118:151-161. 1991.
15. Lomniczi, B., E. Wehmann, J Herczeg, A. Ballagi Pordany, E F.
Kaleta, O. Werner, G. Meulemans, P. H. Jorgensen, A. P. Mante, A. L
Gielkens, I. Capua, and J. Damoser. Newcastle disease outbreaks in recent
years in western Europe were caused by an old (VI) and a novel genotype
(VII). Archiv. Virol. 143: 49-64. 1998.
16. Mayo, M A. A summary of the changes recently approved by ICTV.
Archiv Virol 147,1655 - 1656. 2002.
17. Meulemans, G., M Gonze, M C. Carlier, P. Petit, A. Bumy, and L. E
Long. Evaluation of the use of monoclonal antibodies to hemagglutination
and fusion glycoproteins of Newcastle disease virus for virus identification
and strain differentiation purposes. Arch. Virol. 92:55-62. 1987.
18. Rott, R., and H.-D. Klenk. Molecular basis of infectivity and
pathogenicity of Newcastle disease virus. In: Newcastle disease. D. J.
Alexander, ed. Kluwer Academic Publishers, Boston, Mass. pp. 98-112.
1988.
19. Seal, B. S., D. J. King, and J. D. Bennett. Characterization of Newcastle
disease virus isolates by reverse transcription PCR coupled to direct
nucleotide sequencing and development of sequence database for pathotype
prediction and molecular epidemiological analysis. J. Clin. Microb.
33(10):2624-2630. 1995.
20. Srinivasappa, G. B., D. B. Snyder, W. W. Marquardt, and D. J. King,
Isolation of a monoclonal antibody with specificity for commonly employed
vaccine strains of Newcastle disease virus. Avian Dis. 30:562-567. 1986.
21. Wise, M G., J. C. Pedersen, D. A. Senne, D. Kapczynski, D. J. King, D.
L. Surarz, B. S. Seal, and E. Spackman. Development of a real time reverse
transcription-polymerase chain reaction for detection of Newcastle disease
virus RNA in clinical samples. J. Clin. Microbiol. 42(1): 329-338. 2004.
 31
AVIAN METAPNEUMOVIRUS
Richard E. Gough and Janice C. Pedersen

SUMMARY. Avian metapneumovirus (aMPV)) is an upper respiratory tract infection primarily of turkeys and chickens caused by a virus
belonging to the genus metapneumovirus . The disease can cause significant economic losses in turkey flocks, particularly when exacerbated
by secondary pathogens. Mortality is variable but may exceed 80% in susceptible turkey poults. In turkey breeding flocks infection can
result in serious egg production problems. In chickens infection may lead to mild respiratory signs, egg production problems and swollen
head syndrome (SHS).
Agent Identification. Virus detection and identification can be difficult unless samples are taken early in the course of the disease. Virus
isolation in cell cultures, embryonated hen’s eggs, tracheal organ cultures and molecular methods have all been used successfully to detect
aMPV but the degree of success will depend on the strain of virus. Electron microscopy, virus neutralization and molecular techniques are
widely used to identify the virus. The use of monoclonal antibodies and molecular studies have revealed antigenic diversity between the
isolates studied.
Serologic Detection in the Host. Confirmation of infection is best obtained by serologic tests, particularly enzyme-linked immunosorbent
assay (ELISA) methods. In many countries where the disease is endemic vaccination is practiced which may complicate interpretation of
results.

INTRODUCTION infraorbital sinuses, the so-called swollen head syndrome (SHS),

Avian metapneumovirus (aMPV) previously referred to as avian
pneumovirus (APV) and avian rhinotracheitis (ART) virus is an
acute, highly contagious upper respiratory tract infection of turkeys
and chickens.
In turkeys the virus causes a disease known as turkey rhinotracheitis
(TRT). The agent responsible for the disease has been confirmed as
a member of the genus Metapneumovirus in the family
Paramyxoviridae (24). Until recently, APV was thought to be the
sole member of the Metapneumovirus genus but recent reports from
many countries have indicated that similar viruses have been
detected in humans associated with respiratoiy tract infection in
children (21). Avian metapneumovirus (aMPV) has been further
classified into four subtypes: A, B, C and D, based on nucleotide
and deduced amino acid sequence data (10). It is probable that other
subtypes exist but have not yet been detected and identified.
Serologic evidence suggests that the disease is now widespread
throughout the world and of considerable economic importance,
particularly in turkeys. Australasia appearing to be the only region
in which aMPV has not been reported. There is serological and
molecular evidence that aMPV occurs in a variety of other avian
species, including pheasants, guinea fowl, ostriches, passerines and
various waterfowl (21), but there is no evidence that serious disease
occurs in these species.
CLINICAL DISEASE
The various clinical signs associated with aMPV infection in
turkeys have been detailed (13). Signs in young turkey poults
include snicking, rales, sneezing, nasal discharge, foaming
conjunctivitis, swelling of the infraorbital sinuses and
submandibular edema. Secondary adventitious agents can
dramatically exacerbate the clinical signs. In laying turkeys,
infection normally results in only mild respiratory signs but with an
associated marked drop in egg production, as much as 70%. In
some flocks of adult turkeys, subclinical infections have been
detected by seroconversion. When disease is seen, the morbidity
can be as high as 100%, with mortality ranging from 0.5% in adult
birds to 85% in young poults. The clinical signs of infection in
chickens are less characteristic than the disease in turkeys. In
laying flocks, particularly broiler breeders, there is a marked drop in
egg production, often preceded by respiratory signs. Severe
respiratoiy distress may occur in broiler chickens particularly when
exacerbated by secondary pathogens such as infectious bronchitis
virus, mycoplasmas, and Escherichia coli. The clinical signs
associated with this may be swelling of the periorbital and
142
torticollis, incoordination and depression. Unlike subtype A & B,
the U.S. strain (subtype C) has not been shown to naturally induce
disease in chickens. Previous work has demonstrated that different
strains of a MPV have a specific tropism for chickens or turkeys
(7). Although there is evidence that aMPV can infect other species
of birds, clinical signs associated with the virus have been rarely
reported (12). Subtype D metapneumoviruses have been reported to
occur in ducks and is associated with respiratory signs and egg
production problems (28).
SAMPLE COLLECTION
It is very important to take samples for attempted virus isolation in
the early stages of infection. Ideally live birds in the acute phase of
the disease should be sampled using sterile swabs from the upper
respiratory tract. The samples for virus isolation have been nasal
exudates, choanal cleft swabs and scrapings of sinus and turbinate
tissue. The virus has also been isolated from trachea and lungs, and
occasionally viscera of affected turkey poults. Isolation of virus is
rarely successful from birds showing severe chronic signs as the
extreme clinical signs are usually due to secondary adventitious
agents. This certainly applies to SHS of chickens in which the
characteristic signs appear to be due to secondary Escherichia coli
infection. Furthermore, for reasons that are unclear, virus isolation
from chickens appears to be more difficult than from turkeys.
For samples requiring dispatch to a diagnostic laboratory, it
essential that the samples are sent immediately on ice. Where delays
of more than three days are expected, the samples should be frozen
when collected and sent frozen. Swabs for attempted virus isolation
should be sent on ice fully immersed in virus transport medium but
those for PCR analysis can be sent dry.
For virus isolation, a 20% (v/v) suspension of the nasal exudate or
homogenised tissue is made in phosphate-buffered saline (PBS) at
pH 7.0-7.4 containing antibiotics. This is then clarified by
centrifugation at 1000 * g for 10 min and the supernatant passed
through a 450 nm membrane filter.
PREFERRED CULTURE MEDIA AND SUBSTRATES
To maximize the chances of successfully isolating the virus, a
multiple approach to diagnosis is recommended. This is particularly
relevant when dealing with different subtypes or genotypes which
may require varied in vitro methods to isolate the virus. This was
illustrated particularly well in North America where it was shown
that primary isolation of subtype C aMPV was not associated with
ciliostasis in tracheal organ cultures. This was in contrast to the

European experience and elsewhere in which tracheal organ
cultures were shown to be the most reliable method for the primary
isolation of subtype A and B aMPV (10).
Tracheal Organ Culture
Tracheal organ cultures are prepared from turkey embryos or very
young turkeys obtained from flocks free of specific antibodies to
aMPV. Tracheas from chicken embryo or l-to-2-day-old chicks
may also be used. Transverse sections of trachea are rinsed in PBS
(pH 7.2), placed one to a tube in Eagles medium with antibiotics,
and held at 37 C. For inoculation with infective material, the tubes
are drained, and 0.1 ml of bacteria-free inoculum is added. After
incubation for 1 hr at 37 C, growth medium is added and the
cultures are incubated at 37 C on a roller apparatus rotating at 30
revolutions per hour. Cultures are examined daily after agitation on
a laboratory mixer to remove debris from the lumen. Ciliostasis
may occur within 7 days of inoculation on primary passage but
usually is produced rapidly and consistently only after several blind
passages.
Culture in Embryonating Eggs
Six to 8-day-old embryonating chicken or turkey eggs, from flocks
known to be free of aMPV antibodies, are inoculated by the yolk-
sac route with 0.1-0.2 ml of bacteria-free material from infected
birds and incubated at 37 C. Within 7-10 days, there is usually
evidence of stunting of the embryos with few deaths. Consistent
embryo mortality is normally seen only after four to five passages
so this method of isolation is both time consuming and expensive.
Cell Culture
Various cell cultures have been used for the primary isolation of
aMPV, including chicken embryo cells, VERO cells and more
recently the QT-35 cells, with varying degrees of success.
However, once the virus has been adapted to growth in
embryonating eggs or tracheal organ cultures, in which it grows
only to low titers, the virus will readily replicate to high titers
following multiple passages in a variety of primary chicken or
turkey embryo cells and in Vero, BSC-1 and QT-35. The virus
produces a characteristic cytopathic effect (CPE) with syncytial
formation within 7 days.
AGENT IDENTIFICATION
Morphology
By negative-contrast electron microscopy, the virus can be
identified as having a paramyxovirus-like morphology.
Pleomorphic fringed particles, roughly spherical and 80-200 nm in
diameter, are commonly seen. Occasionally much larger
filamentous forms are present, which may be up to 1000 nm in
length. The surface projections are 13-14 nm in length and the
helical nucleocapsid, that can sometimes be seen emerging from
disrupted particles, is 14 nm in diameter with an estimated pitch of
7 nm per turn.
Physiochemical Properties
The genome of aMPV is unsegmented and composed of single­
stranded negative sense RNA of approximately 15 kilobases with a
helical symmetry. In sucrose gradients, the buoyant density of an
isolate from turkeys was found to be 1.21 g/ml with an approximate
molecular weight of 500 x 106. The same virus was also shown to
have 8 structural polypeptides of which 2 were glycosylated and 3
were non-structural virus-specified proteins. These have now been
identified as follows; nucleoprotein (N), phosphoprotein (P), matrix
protein (M), second matrix protein (M2), surface glycoprotein (G),
fusion protein (F), a small hydrophobic protein (SH) and a viral
RNA-dependant RNA polymerase (L). In common with other
members of the family Paramyxoviridae, the infectivity of the virus
143
Chapter 31 Avian Metapneumovirus
is rapidly destroyed by lipid solvents, heat (56 C for 30 min), and
extremes of pH. Studies with a subtype C strain of virus, isolated
from turkeys in the USA, reported that the virus was resistant to pH
5-9 for one hour. The study also reported that the viability of the
virus was significantly reduced after 6 hr at 50 C, 2 days at 37 C, 4
wk at 20 C and less than 12 wk at 4 C. In addition, the study
reported that several disinfectants were effective in reducing the
viability of the virus (29)
Biological Properties
Unlike other members of the family Paramyxoviridae, aMPV do
not possess hemagglutination (HA) or neuraminidase activity.
Molecular Identification
Due to the fastidious nature of aMPV, RT-PCR is significantly
more sensitive and rapid method for the detection of aMPV than
standard virus isolation methods (1,23). RT-PCR procedures
targeted to the F, M, and G genes are used for the detection of
aMPV, but are limited in specificity and have not been shown to
detect all subtypes (3,4,22,23). These subtype specific assays are
successfully used for the detection and diagnosis of endemic strains
(17,23,26). However, limitations of subtype specific assays need to
be recognized when conducting diagnostic testing for respiratory
disease. Primers directed to conserved regions of the N gene have
been shown to have broader specificity, detecting representative
isolates from A, B, C, and D subtypes (3). RT-PCR assays directed
to the G gene have been successfully used for genotype or subtype
identification (14,15,17).
Nasal exudates, choanal cleft swabs, and turbinate specimens
collected 2-7 days post exposure are the preferred specimen. It has
been shown, that aMPV can be detected from specimens collected
7-10 days post exposure, however, the viral concentration is
considerably less thus reducing the success of detection (1,23). Five
swabs from a single flock can be pooled to increase recovery rate.
Isolation of aMPV from chickens is difficult and has succeeded
only in a limited number of cases, for this reason, molecular tests
are the method of choice for the detection of aMPV in chickens
(16). In addition, RT-PCR has been used to genotype and confirm
the identity of an aMPV isolated from chickens (17,27). It is
important to remember that PCR detects viral RNA, not live virus;
therefore, a positive PCR does not necessarily confirm an active
infection.
Antigen Detection
A number of different assays have been developed for the
detection of aMPV antigens using immunostaining methods. The
most popular techniques have involved the use of
immunoperoxidase (IP), immunofluorescence (IF) and immunogold
staining and are described in detail elsewhere (10). These
techniques, in particular IP and IF, have been used to detect virus
specific antigen in both fixed and unfixed tissues and smears from
turkeys and chickens.
Immunological Detection Techniques
Monoclonal antibodies have been used in virus neutralization tests
to differentiate subtypes of aMPV (6,8). Neutralization tests using
monospecific antiserum can also be used to confirm the identity of
viruses isolated in cell or organ cultures. Because of low
concentrations of virus, the method most commonly used is the
alpha test (constant serum-diluted virus). The serum-virus mixtures
are incubated at 37 C for 45 min and then assayed in cell or organ
cultures for viable virus. A reduction in infectivity titer of 102.0 or
more is considered to be significant.
The immunodiffusion test has also been used to confirm the
identity aMPV isolates (13). Briefly, isolates are cultivated in cell
cultures to give an infectivity titer of approximately 106.0 median
tissue culture infective doses (TCID50) per ml. After extensive CPE
Richard E. Gough and Janice C. Pedersen
has occurred, the cell debris is removed and the supernatant
concentrated by ultracentrifugation. The resulting concentrates are
treated with 0.2% N-lauroylsarcosine (Sigma, St. Louis, Mo.) to
produce antigens for the immunodiffusion test. Using monospecific
aMPV antiserum, the antigens are tested by double
immunodiffusion in 1% agarose. After approximately 24 hr at 37
C, the tests are examined and any precipitin lines that stain with
02% Coomassie brilliant blue R are interpreted as positive.
Included in the test are appropriate positive and negative control
antigens and sera. A precipitin line between the reference
monospecific antiserum and test antigen confirms the identity of the
virus.
SEROLOGIC DETECTION IN THE HOST
Due to difficulties in isolating and identifying aMPV,
confirmation of infection is usually achieved by serological
methods, particularly in unvaccinated chicken flocks. The most
commonly employed method is the enzyme-linked immunosorbent
assay (ELISA). Other methods that have been used to detect aMPV
antibodies are virus neutralization, microimmunofluorescence and
immunodiffusion tests.
Ideally, both acute and convalescent serum samples should be
obtained for testing. The sera should be heated at 56 C for 30 min
before testing; if the testing of the sera is delayed, it should be
stored at -20 C. In chickens, the serological response to aMPV
infection is weak when compared to the response in turkeys (7).
Enzyme-Linked Immunosorbent Assay
Numerous commercial ELISA kits, together with in-house assays,
have been developed for the detection of aMPV antibodies (5,10)
Although the indirect ELISA has been very useful for screening
large numbers of sera for aMPV antibodies, differences in
sensitivity and specificity between tests have been reported to occur
between commercial kits (18,19). This is principally due to
variations in the antigenicity and purity of the viral antigen used in
the preparation of the ELISA kit. It appears that that sensitivity of
the ELISA is less when a heterologous strain of aMPV is used as
antigen, even though the strain appears closely related by virus
neutralization test (10) Competitive or blocking ELISA kits have
also been developed, incorporating an aMPV specific monoclonal
antibody (mAb).These kits claim to have a broad spectrum of
sensitivity and specificity for all subtypes of aMPV and can be used
for testing sera from a variety of avian species. ELISA antigens
have been prepared in a variety of substrates including various cell
cultures and tracheal organ cultures (10).
Fluorescent Antibody Test
Several techniques have been described for the detection of aMPV
antibodies using indirect immunofluorescence (HF) tests on infected
tissues or cell cultures. Studies have shown that antibodies to
aMPV in infected turkeys can be detected by HF 5 days after the
appearance of clinical signs (10). The technique has limited
application for the large scale testing of poultry sera and has been
mainly used for research purposes.
Virus Neutralization Test
Antibodies to the virus have been detected by standard virus
neutralization (VN) techniques in tracheal organ cultures and
various sensitive cell cultures, such as CEF, chicken embryo liver,
and VERO cultures (13). Using a neutralization assay in CEF
cells, it was shown that neutralizing antibody could be detected
within 5 days of the appearance of clinical signs and was declining
by day 13. There is a good correlation between VN results and
ELISA and immunofluorescence results (10). There are cross
reactions between subtype A and B viruses so the VN test is not
suitable for distinguishing subtype antibodies.
144
The VN test can be carried out in confluent monolayers of chicken
embryo cells in 96-well flat-bottomed microtitre plates. Briefly, 30-
300 median TCID of virus are reacted with two-fold serial dilutions
of test serum at 37 C in 5% CO2. After 1 hr, 25ul is transferred from
each dilution in the neutralization plate to the corresponding well on
the cell culture plate. The plates are sealed and incubated at 37 C in
5% CO2, together with appropriate serum and virus controls. After 1
hr, 200 μΐ of maintenance medium is added to each well, the plates
are sealed and incubated at 37 C in CO2 for 7 days. The cultures are
examined daily for CPE and after 7 days the serum titres are
determined and expressed as the reciprocal (log2) of the highest
dilution of serum that completely inhibits viral CPE. A titre of >23
is considered positive.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Strain Variability
When aMPV was first detected in Europe, it was believed there
was only one serotype of the virus, represented by subtypes A and
B. These were differentiated on the basis of nucleotide sequence
analysis of the attachment (G) protein gene (14) and by mAb
analyses (6,8). However, this situation changed with the emergence
of a different aMPV in North America, designated subtype C (9,25).
More recently, reports from France have indicated the presence of a
fourth subtype of aMPV, designated subtype D (2,28). It is probable
that other strains of aMPV exist, which are genetically distinct from
subtypes A, B, C and D. These other subtypes of the aMPV may
remain undetected using conventional f*CR based techniques;
therefore a multi diagnostic approach is recommended when
investigating outbreaks of respiratory disease in poultry.
Newcastle Disease
Some strains of Newcastle disease virus and other members of the
genus Paramyxovirus, such as PMV-3 (see Chapter 30 on
Newcastle disease virus and other avian paramyxoviruses), may
cause respiratory disease and egg production problems in chickens
and turkeys that closely resemble aMPV. Paramyxoviruses are
similar in morphology but can usually be easily distinguished from
aMPV because they possess HA and neuraminidase activity.
Infectious Bronchitis
Infections of chickens with infectious bronchitis (IB) virus can
result in respiratory disease and egg production problems that are
similar to aMPV. Swollen head syndrome (SHS) in chickens has
also been described as being associated with infectious bronchitis
virus and E. coli (11,20) Serologic and molecular identification of
the infecting virus is probably the simplest method of making a
differential diagnosis.
Avian Influenza
Infection of chickens or turkeys with the milder strains of avian
influenza viruses can result in disease similar to aMPV. Virus
isolation and the demonstration of HA activity by influenza viruses
will distinguish between the viruses.
Bacteria and Mycoplasma
A wide range of bacteria and Mycoplasma species have been
reported to cause disease signs very similar to aMPV. Frequently,
such organisms may be present as secondary or adventitious
invaders and may cause considerable diagnostic problems.
Distinction must rely on negative isolation or demonstration of
antibodies to aMPV .

REFERENCES
1. Alkhalaf, A.N., L.A.Ward, RN.Dearth and Y. M Saif. Pathogenicity,
transmissibility and tissue distribution of avian pneumovirus in turkey
poults. Avian Dis. 46:650-659. 2002.
2. Bayon-Auboyer, Μ H., C. Amauld, D.Toquin and N. Eterradossi.
Nucleotide sequences of the F, L and G protein genes of two non-A/non-B
avian pneumoviruses (APV) reveal a novel APV subgroup. J. Gen. Virol.
81:2723-2733. 2000.
3. Bayon-Auboyer, MH., V. Jestin, D. Toquin, M Cherbonnel and N.
Eterradossi. Comparison of F-, G- and N-based RT-PCR protocols with
conventional virological procedures for the detection and typing of turkey
rhinotracheitis virus. Arch Virol. 144:1091-1109. 1999.
4. Bennett, R.S., J. Nezworski, B.T. Velayudhan, K.V. Nagaraja,
D. H.Zeman, N.Dyer, T.Graham, D.C. Lauer, MK. Njenga and D.A.
Halvorson. Evidence of avian pneumovirus spread beyond Minnesota
among wild and domestic birds in central North America. Avian Dis.
48:902-908. 2004.
5. Chiang, S.J., A.M Dar, S.M Goyal, K.V. Nagaraja, D.A. Halvorson and
V. Kapur. A modified enzyme-linked immunosorbent assay for the detection
of avian pneumovirus antibodies. J. Vet. Diagn. Invest. 12:381-384. 2000.
6. Collins, MS., R .E .Gough and D .J .Alexander. Antigenic differentiation
of avian pneumovirus isolates using polyclonal antibody and mouse
monoclonal antibodies. Avian Pathol. 22:469-479. 1993.
7. Cooke, J.K.A., S. Kinloch and MM. Ellis. In vitro and in vivo studies in
chickens and turkeys on strains of turkey rhinotracheitis virus isolated from
the two species. Avian Pathol. 22:157-170. 1993a.
8. Cook, J. K. A., Β. V. Jones, Μ. M Ellis, Jing Li and D. Cavanagh.
Antigenic differentiation of strains of turkey rhinotracheitis virus using
monoclonal antibodies. Avian Pathol. 22:257-273. 1993b.
9. Cook, J.K.A., MB. Huggins, S.J. Orbell and D.A. Senne. Preliminary
antigenic characterization of an avian pneumovirus isolated from
commercial turkeys in Colorado, USA. Avian Pathol. 28:607-617. 1999.
10. Cook, J.K.A. and D. Cavanagh. Detection and differentiation of avian
pneumoviruses (metapneumoviruses). Avian Pathol. 31:117-132. 2002.
11. Droual, R. and P R. Woolcock. Swollen head syndrome associated with
E. Coli and infectious bronchitis virus in the Central Valley of California.
Avian Pathol. 23:733-742. 1994.
12. Gough, R.E., MS. Collins, W.J. Cox and N.J. Chettle. Experimental
infection of turkeys, chickens, ducks, guinea fowl, pheasants and pigeons
with turkey rhinotracheitis virus. Vet. Record. 123:58-59. 1988.
13. Gough, R.E. Avian pneumoviruses. In: Diseases of Poultry, 11th ed. Y.
M Saif, H. J. Bames, J.R. Glisson, A M Fadly, L.R. McDougald and D.E.
Swayne. Iowa State University Press, Ames, Iowa, pp 92-99. 2003.
14. Juhasz, K., and A. J. Easton. Extensive sequence variation in the
attachment (G) protein gene of avian pneumovirus: evidence for two distinct
subgroups. J. Gen. Virol. 75:2873-2880. 1994.
Chapter 31 Avian Metapneumovina
15. Lwamba, H.C.M, R. Alvarez, M.G. Wise, Qingzhong, Yu, D.
Halvorson, MK. Njenga and B.S. Seal. Comparison of full-length genome
sequence of Avian metapneumovirus subtype C with other paramyxoviruses^
Virus Research. 107:83-92. 2005.
16. Mase, M,S. Asahi, K.Imai, K.Nakamura and S. Yamaguchi. Detection
of turkey rhinotracheitis virus from chickens with swollen head syndrome
by reverse transcriptase-polymerase chain reaction (RT-PCR). J. Vet Med.
Sci. 58:359-361.1996.
17. Mase, M, S. Yamaguchi, K. Tsukamoto, T. Imada, K. Imai and K
Nakamura. Presence of avian pneumovirus subtypes A and B in Japan.
Avian Dis. 47:481-484.2003.
18. McFarlane-Toms, I.P and R.J.H. Jackson. A comparison of three
commercially available ELISA tests for detecting antibodies to turkey
rhinotracheitis virus (TRTV). In: E. Kaleta and U. Heffels-Redman(Eds).
Proceedings of the International Symposium on Infectious Bronchitis and
Pneumovirus infections of Poultry. Rauischolzhausen, Germany, pp26-37.
1998.
19. Mekkes, D. R. and J. J. de Wit. Comparison of three commercial ELISA
kits for the detection of turkey rhinotracheitis virus antibodies. Avian Pathol.
27: 301-305. 1999.
20. Morley, A.J. and D.K. Thomson. Swollen-head syndrome in broiler
chickens. Avian Dis. 28:238-243. 1984.
21. Njenga, MK., H.M Lwamba and B.S. Seal. Metapneumoviruses in
birds and humans. Virus Research. 91:163-169. 2003.
22.. Pedersen, J.C., L. Roland, D.L. Reynolds and A. Ali. The sensitivity
and specificity of a reverse transcriptase-polymerase chain reaction assay for
the βλάβη pneumovirus (Colorado strain). Avian Dis. 44:681-685. 2000.
23. Pedersen, J.C., D.A. Senne, B. Panigrahy and D.L. Reynolds. Detection
of avian pneumovirus in tissue and swab specimens from infected turkeys.
Avian Dis. 45:581-592. 2001
24. Pringle, C.R. Virus Taxonomy-San Diego. Arch.of Virology. 143:1449-
1459. 1998.
25. Senne, D.A., RK. Edson., J.C. Pedersen and B. Panigrahy. Avian
pneumoxdrus update. Proceedings of American Veterinary Medical
Association 134th Annual Congress. Reno, NV, USA. ppi90.1997.
26. Shin, H.J., F.F. Jirjis, M.C. Kumar, MK. Njenga, D.P. Shaw, S.L. Noll,
K.V.Nagaraja and D.A. Halvorsen. Neonatal avian pneumovirus infection in
commercial turkeys. Avian Dis. 46:239-244. 2002.
27. Tanaka, M,H. Tanuma, N.Kokumai, E.Oishi, T. Obi, K. Hiramatsu and
Y. Shimizu. Turkey rhinotracheitis virus isolated from broiler chicken with
swollen head syndrome in Japan. J. Vet. Med. Sci. 57:939-945.1995.
28. Toquin, D., MH. Bayon-Auboyer, N. Etteradossi, H. Morin and V.
Jestin. Isolation of a pneumovirus from a Muscovy duck. Vet. Record.
145:680
29. Townsend, E., D.A. Halvorson, K.E.Nagaraja and D.P.Shaw.
Susceptibility of an avian pneumovirus isolated from Minnesota turkeys to
physical and chemical agents. Avian Dis. 44:336-342. 2000.
 32
INFECTIOUS BRONCHITIS
Jack Gelb, Jr. and Mark W. Jackwood

SUMMARY. Infectious bronchitis (IB) is caused by infectious bronchitis virus (IBV), a member of the family Coronaviridae. IBV is highly
host specific, causing natural infections mainly in chickens. Primary infections in young chickens typically produce respiratory disease but
some strains may cause kidney lesions. Layers and breeders commonly suffer egg production losses with or without evidence of respiratory
disease signs. Numerous serotypes of the virus have been responsible for outbreaks in commercial chickens in spite of the use of attenuated
live and inactivated vaccines. IB is a growing problem for poultry producers because only a limited number of serotypes are available for
vaccination, and the cross-protection elicited against unrelated field strains may be minimal.
Agent Identification. Presumptive diagnosis is made in a suspect flock based on clinical signs consistent with the disease and evidence of
IBV serum antibody production as demonstrated by enzyme-linked immunosorbent assay (ELISA). Isolation and identification of the
causative serotype of IBV is required for definitive diagnosis. Serotype identification may be achieved by virus-neutralization,
hemagglutination-inhibition, type-specific monoclonal antibodies, or reverse transcriptase-polymerase chain reaction followed by restriction
fragment length polymorphism or sequencing. Cross-challenge tests in chickens may be used to determine the potential protection afforded
by immunization with various IBV vaccines or field strains to control the disease.
Serologic Detection in the Host. ELISA is preferred method for detecting serum antibody response, but it does not identify serotype­
specific antibodies. Acute and convalescent sera response is useful in sera diagnosis and for monitoring flock vaccination titers.

INTRODUCTION SAMPLE COLLECTION

Infectious bronchitis (IB) is a highly contagious clinically acute
disease of the respiratory and urogenital tract of chickens, caused by
infectious bronchitis virus (IBV), a member of the family
Coronaviridae. The disease is common throughout the world where
chickens are produced commercially. Mixed infections involving
IBV, Newcastle disease virus (NDV), avian adenovirus group 1,
Mycoplasma, and coliform bacteria are common and may confuse
diagnostic efforts.
Many serotypes of IBV are recognized and have practical
significance in the control of IB, because immunity following
infection or vaccination with one serotype often is not protective
against infections with unrelated serotypes. In the United States, the
most often isolated IBV serotypes in commercial poultry are
Arkansas (Ark), Connecticut (Conn), Delaware (DE/072/92), and
Massachusetts (Mass). Previously unrecognized antigenic variants
have been recovered from multiage commercial layer complexes
with respiratory disease or egg production problems (10). Many
antigenic variant serotypes also have been reported in European
countries and Australia (7). Undoubtedly, many more strains will be
isolated from these and other countries as emphasis on IBV
surveillance increases. For an in-depth review of IB, refer to
Cavanagh and Naqi (4). A detailed discussion of IBV antigen,
genome and antibody detection assays prepared by De Wit (6) is
also available.
CLINICAL DISEASE
Chickens are the primary natural host, although pheasants may be
susceptible to IBV or highly similar coronaviruses (3). In chickens a
short incubation period (24—72 hr) is a unique characteristic of the
disease. Young chicks display acute respiratory disease signs and
lesions in the trachea. Morbidity can approach 100%, but mortality
is generally below 5% in outbreaks not complicated by secondary
pathogens or concurrent infections. In layer chickens, IBV causes
decreased egg production and quality. Lymphoid cell infiltration
and epithelial cell degeneration of the oviduct wall have been
observed. Nephropathogenic strains such as Holte, Gray, and
Australian T produce enlarged kidneys with distended tubules and
ureters containing uric acid crystals. Diarrhea, dehydration,
depression, and death may occur in affected birds.
146
Samples for IBV isolation must be obtained as soon as clinical
disease signs are evident. Tracheal swabs are preferred and are
placed directly into cold media with antibiotics to suppress bacterial
and fungal growth and preserve the viability of the virus. Sterile
swabs are used to swab 5-10 clinically affected birds per flock.
Cotton-tipped swabs of varying sizes * are available (Fisher
Scientific, Pittsburgh, Penn.) depending on the age and breed of the
chicken. The swabs are placed in 2-3 ml of cold sterile tryptose
phosphate broth (TPB) (pH 7.0-7.2) containing 10,000 IU/ml
penicillin, 10,000 IU/ml streptomycin, and 250 IU/ml amphotericin
B. Swab tubes are immediately placed on ice and are frozen at -20
C at the earliest convenience.
Other tissues, such as lung, kidney, oviduct, cecal tonsil and
proventriculus may be collected using aseptic techniques. Tissues
are placed in clean, labeled, tightly sealed plastic specimen bags or
sterile tubes and are frozen at -20 C. Cloacal swabs may be obtained
and are handled as described above. All swabs and tissue samples
should be frozen and transported in an insulated container to a
diagnostic virology laboratory.
Because IBV persists in the intestinal tract, isolation of some
strains from cecal tonsil and cloacal swabs is possible for several
weeks after the disappearance of clinical signs. Accordingly,
isolating IBV from these sites does not confirm its role as the
causative agent in a recent disease outbreak.
The frozen TPB containing tracheal and cloacal swabs is thawed,
mixed, and incubated at room temperature (about 22 C) for 30-60
min prior to inoculation to reduce the possibility of bacterial and
fungal contamination. Contamination sometimes associated with
virus isolation from cloacal swabs may be avoided by centrifuging
the swab tube broth at 1000 x g for 15 min and then passing the
supernatant fluid through a 0.22 or 0.45-μιη sterile syringe filter.
Tissue homogenates (10% w/v) are prepared in TPB with
antibiotics by disrupting lung, kidney, oviduct, or cecal tonsil using
a glass tissue grinder (Tenbroeck, VWR Scientific Products, West
Chester, Penn.) or mortar and pestle. The homogenates are
incubated at room temperature for 30-60 min.
Sentinel chickens have been used to help facilitate IBV isolation in
commercial flocks (9). Specific-pathogen-free (SPF) chickens
immunized against IBV vaccine serotype(s) are placed with IBV-
susceptible sentinels in pens or cages in commercial chicken
houses. After a 1-wk exposure period, the field-exposed sentinels
are removed, and tracheal swabs are collected for virus isolation
attempts. Several successive weekly placements increase the
possibility of isolating IBV. The use of IBV-immune sentinels

provides a better opportunity for isolating IBV antigenic variants
free of contaminating vaccine virus serotypes that may be cycling in
commercial chickens.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Infectious bronchitis virus is most commonly grown in
embryonated eggs, tracheal organ culture (TOC), and chicken
kidney cell culture. The embryonated egg is preferred for primary
isolation attempts.
Embryonated Chicken Eggs
Embryonated chicken eggs from an SPF source are recommended
for virus isolation. Ten 9 to 11-day-old embryos are inoculated by
the chorioallantoic sac route with 0.2 ml of swab tube broth or
tissue homogenate. The eggs are candled daily, with mortality
between days 2 and 7 postinoculation (PI) considered to be virus­
specific. On day 3 PI, five eggs are removed from the incubator and
are placed at 4 C for 18-24 hr. Chorioallantoic fluid harvested
aseptically from inoculated eggs should be free of bacteria and
fungi and give a negative hemagglutination (HA) reaction with
chicken red blood cells (CRBCs). The remaining embryos are
incubated up to 7 days and are then observed for typical IBV
lesions, such as stunting, curling, clubbing of the down, or urate
deposits in the mesonephros of the kidney. Cutaneous hemorrhage
is often noted with embryo-lethal strains of IBV. Chorioallantoic
membranes are collected, homogenized, and tested for avian
adenovirus group 1 by the immunodiffusion method. Group 1
adenovirus infections of commercial chickens are common, and the
virus often produces stunted embryos indistinguishable from IBV-
infected embryos.
Some IBV field isolates are not embryo-adapted and do not cause
death or produce lesions on the first passage. Therefore, a minimum
of three passages should be made before a virus isolation attempt is
considered to be negative. Particular attention should be given to
urate deposits in the mesonephros of the kidney in evaluating
embryos inoculated with field isolates.
Organ Cultures
Chicken TOC may be used to isolate IBV. The primary advantage
in using TOC over embryonated eggs is that non-embryo-adapted
field strains of IBV produce a rapid ciliostasis in TOC on the first
passage, eliminating the need for multiple passages. A disadvantage
is that a cell culture facility is needed for preparing and maintaining
TOC. Other potential limitations of TOC involve differentiating or
detecting viruses other than IBV in field samples. NDV and IBV
produce extensive ciliostasis by 3 days PI. Avian adenovirus
replicates in TOC, but because it does not produce rapid and
complete ciliostasis, its presence may go undetected.
Cell Cultures
Primary isolation of IBV in chicken kidney cell culture is not
recommended, because the virus requires adaptation in
embryonated eggs before it will grow in cell culture.
AGENT IDENTIFICATION
Physicochemical Properties
Coronaviruses are enveloped, single-stranded RNA viruses with
helical symmetry (see Chapter 45 on virus identification and
classification for characterization techniques). The virion is
pleomorphic and has a diameter of 80-120 nm. The envelope
consists of large club-shaped spike proteins that give the surface of
the virion its characteristic corona appearance. Coronavirus
replication occurs in the cytoplasm. Inhibitors of DNA, such as the
halogenated nucleotide 5-iodo-2-deoxyuridine, do not inhibit IBV
multiplication, indicating that the virus contains RNA and not
147
Chapter 32 Infectious Brondnta
DNA. Most strains of IBV are inactivated after 15 min at 56 C. IBV
is inactivated by lipid solvents, such as chloroform and ether.
Sensitivity to lipid solvents can also be used to screen LBV field
isolates for contaminating naked viruses, such as avian adenovirus
group 1 and reovirus.
Serological Identification by Virus Neutralization (VN) and
Hemagglutination-Inhibition (HI)
Virus Neutralization. Neutralization of an IBV field isolate by
known serotype-specific IBV antiserum establishes its identity. The
VN test may be performed in embryonated eggs, chicken kidney
cell culture, or TOC. The test may be conducted using the constant­
serum diluted-virus (alpha) or diluted-serum constant-virus (beta)
method. In addition, a constant-virus constant-serum VN procedure
(5) has been useful for serotyping IBV field isolates. VN tests are
performed in embryonated eggs by reacting 32-320 mean embryo
infectious doses (ΕΠ)50) of an IBV field isolate with antisera to
known strains containing 1-20 units of antibody. The antibody unit
concentration is determined by titration against the homologous
IBV serotype. The highest dilution of antiserum protecting 50% of
the inoculated embryos is equal to one antibody unit. As concurrent
infections with two or more IBV serotypes are common, reciprocal
VN tests are sometimes required to identify all IBV in field isolates.
Antiserum to the field isolate is reacted against known IBV
serotypes to establish the identities of the causative serotypes.
Hemagglutination Inhibition. Hemagglutination antigen for the HI
test is prepared from chorioallantoic fluid harvested from IBV-
inoculated embryonated eggs. Neuraminidase type V in PBS (pH
7.2) at 1.0 units/ml final concentration is used to treat IBV for 30
min at 37 C (24). HA antigen titration is performed in standard U-
bottom 96-well microtiter plates using CRBCs. Treatment of IBV
with bacterial phospholipase C was initially thought to enable the
virus to agglutinate CRBCs (1,16). However, HA antigens produced
using highly purified phospholipase C preparations often had
considerably lower titers than those produced using unpurified
phospholipase C preparations. Subsequent studies (24,25)
determined that treatment of IBV with purified neuraminidase
preparations consistently produced high-titer HA antigens. These
findings suggested that the unpurified phospholipase C preparations
were contaminated with neuraminidase.
The microtiter HI test may be used to serotype IBV (1,16).
Neuraminidase-treated HA antigen is first prepared from the field
isolate. A concentration of 4-8 HA units of antigen is added to
twofold dilutions (1:2 to 1:1024) of serotype-specific known IBV
antiserum. After incubation at room temperature for 30 min,
CRBCs (0.5%-1.0%) are added, and the test is read 30-60 min
later. The inhibition of HA of the field isolate by a known antiserum
identifies the serotype of IBV but caution must be used when
interpreting this test because cross-reactivity is not uncommon.
Production of Serotyping Antiserum for VN and HL Antiserum
suitable for serotyping IBV isolates using the VN or HI procedures
is produced preferably in SPF chickens. Typically, 3-to-8-wk-old
chickens are inoculated intratracheally with about 105 ELD50 of IBV
per bird. The chickens are placed in isolation rooms or Horsfall
isolation units. Two weeks PI, the chickens are reinoculated by
intravenous injection with at least ΙΟ5 ΕΠ)50 of IBV. Blood samples
are collected from chickens 2 wk after intravenous injection of IBV.
Serum is harvested, pooled, and inactivated at 56 C for 30 min
before being used in VN or HI serotyping procedures.
It is important for antisera to be highly specific for the
homologous IBV serotype and to not cross-react with heterologous
virus serotypes. Repeated inoculations (three or more) or the use of
adjuvants in preparing serotyping antisera is not advisable because
antibodies may cross-react with heterologous IBV serotypes.
Jack Gelb, Jr. and Mark W. Jackwood
Monoclonal Antibody Identification of IBV Antigens
Type-specific monoclonal antibodies specific to the SI subunit of
the spike glycoprotein of serotypes Mass, Conn, and Ark have been
produced (13) and used to identify the respective serotypes by
antigen-capture enzyme-linked immunosorbent assay (AC-ELISA)
(23). Other serotypes may be identified as IBV but not identified to
the specific serotype using a group-specific monoclonal to the M
glycoprotein of IBV (13, 23). Allantoic fluid from IBV-inoculated
embryonated chicken eggs is best suited for identification of IBV by
AC-ELISA although tissue homogenates can be used.
Immunoperoxidase staining (22) and immunofluorescent antibody
assays have also been used to identify serotypes using type-specific
IBV monoclonal antibodies.
Molecular Identification
Several reverse transcriptase-polymerase chain reaction (RT-PCR)
assays have been developed for identifying IBV serotypes. The
assays use serotype-associated sequence variations in the SI subunit
of the spike glycoprotein gene to identify and differentiate strains
and variants.
Generally, allantoic fluids harvested following the inoculation of
eggs with clinical samples are used for RNA extraction and RT-
PCR amplification (2, 11, 12). A RT-PCR restriction fragment
length polymorphism (RFLP) assay has been developed that
differentiates IBV types based on unique electrophoresis banding
patterns of restriction enzyme-digested fragments of the RT-PCR
amplified SI gene (12,18). The RT-PCR RFLP test can identify all
known serotypes of IBV as well as variant viruses. The RT-PCR
RFLP procedure may be used in conjunction with a RT-PCR assay
that uses universal primers to the conserved membrane and
nucleocapsid genes (2). Although that assay does not identify virus
type, it does amplify all types of IBV and can be used in
conjunction with a biotin-labeled DNA probe (11), or nucleic acid
sequencing to verify the presence of IBV in the sample
SI genotype-specific RT-PCR can also be used to identify specific
IBV serotypes (14). SI gene primers specific for serotypes Mass,
Conn, Ark, and JMK are used in conjunction with a universal
primer set that amplifies all IBV serotypes. Specific primers for the
DE/072/92 and California serotypes have also been developed.
Other IBV types can be detected using the general primers, but the
specific serotype cannot be identified. Both RT-PCR RFLP and
genotype specific RT-PCR are capable of detecting more than one
IBV type in a clinical sample. In addition, clinical samples
inactivated with an equal volume of buffered (pH 4.5) phenol or
spotted on Finders Technology Associates (FTA) cards (Whatman
Inc. Florham Park, NJ) can be used as a source of template for RT-
PCR amplification (21). These inactivated samples can be safely
transported to the laboratory and with the proper permits they can
be imported from abroad.
Cycle sequencing of the RT-PCR amplified hypervariable amino
terminus region of SI may be used to identify previously
recognized field isolates and variants (17,19). Comparison and
analysis of sequences of unknown field isolates and variants with
reference strains available in GenBank (National Center for
Biotechnology Information http://www.ncbimlm.nih.gov/) can
establish potential relatedness and is a significant advantage of
sequencing.
The major uses of RT-PCR tests are virus identification and its
application in the understanding of epidemiological investigations
during IBV outbreaks. The RT-PCR tests, as they now exist
however, do not provide information on viral pathogenicity.
Cross-Challenge Studies
Cross-challenge tests in chickens are an important adjunct to SI
genotyping or serotyping for antigenically characterizing an IBV
field isolate. Immunization of chickens with antigenically distinct
148
serotypes may produce a greater degree of protection than would be
predicted on the basis of serotyping results.
Cross-challenge tests are conducted by immunizing ten 3-to-6-wk-
old SPF chickens by eye drop with known IBV serotypes and
challenging them 4 wk later by eye drop inoculation with an
unknown field isolate. Appropriate controls are included in cross­
challenge tests. The immunized chickens challenged with the
homologous strain must be protected. Nonimmunized control
chickens inoculated with the challenge virus must be susceptible.
Isolation facilities are required to prevent inadvertent cross­
infection between groups of chickens immunized with different
serotypes. Protection is evaluated most commonly by collecting
tracheal swabs at 4 or 5 days after challenge and assessing them for
challenge virus by performing virus isolation attempts in
embryonated eggs. Chickens from which virus is not isolated are
considered to be protected. Other methods for determining
protection following challenge include evaluating microscopic
lesions in the trachea or measuring ciliary activity in TOC explants
(20).
Antigenically novel field isolates should be used as challenge
viruses following immunization of SPF chickens with vaccine(s)
containing the serotype(s) currently approved for use in the region
or country where the isolate was recovered. The results of these
studies will establish the cross-protective potential of a vaccine(s)
against field isolate challenge.
SEROLOGIC IDENTIFICATION IN THE HOST
Serodiagnosis of IBV infection in commercial chickens is best
performed by demonstrating an ascending serum antibody response
in recovered chickens using the enzyme-linked immunosorbent
assay (ELISA). Commercially available ELISA kits detect
antibodies common to all IBV serotypes (IDEXX Laboratories,
Inc., Westbrook, Maine; Synbiotics Corp., San Diego, California)
and are not capable of identifying serotype-specific antibodies
induced by the IBV strain(s) responsible for the outbreak.
Nonetheless, the ELISA is a very valuable, inexpensive, and easy to
use tool for serodiagnosis of IBV to rule out other common causes
of respiratory disease such as NDV, infectious laryngotracheitis
virus, or Mycoplasma. Commercial IBV ELISA kits with computer-
facilitated data analysis capabilities are available. ELISA systems
using 96-well microtiter plates and a single-serum dilution approach
are used to evaluate immune status in commercial flocks. Acute and
convalescent serum samples, preferably from the same chickens in a
suspect IBV-infected flock, are tested by ELISA. It is recommended
that serum from acute samples be stored at -20 C until convalescent
samples are obtained. Both groups of sera can then be run at the
same time to minimize variability. An increase in antibody titer
between acute and convalescent serum samples is indicative of an
IBV infection. Commercial ELISA systems for measuring IBV
serum antibody have been compared with VN and HI serology and
found to give favorable results (26,27).
The use of VN or HI tests for serodiagnosis is generally not
recommended. These tests are expensive and tedious to perform on
a routine basis. In addition, interpretation of the results may be
difficult because sera of commercial chickens often contain cross­
reacting antibodies resulting from multiple infections with
heterologous vaccinal and field strain serotypes (8). Antibodies
produced by young chickens tend to be more serotype-specific,
whereas cross-reactions with heterologous VN and HI antigens are
common in breeders and layers (15).

DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Respiratory disease associated with IBV infections may be
clinically indistinguishable from mild respiratory forms of
Newcastle disease, infectious laryngotracheitis, and low pathogenic
avian influenza. In these cases, diagnosis depends on isolation and
identification of the virus or demonstration of an increase in specific
antibody production associated with recovery from infection.
Virulent strains of NDV and infectious laryngotracheitis virus
cause a more severe disease than occurs in IB outbreaks.
Neurological signs or visceral lesions with high mortality are
observed in flocks infected with virulent NDV. Infectious
laryngotracheitis virus can produce a hemorrhagic tracheitis with
high mortality in serious outbreaks. In addition, infectious
laryngotracheitis spreads more slowly in affected flocks.
Infectious coryza and mycoplasmosis may also resemble IB
complicated by pathogenic coliform bacteria. Swollen head
syndrome is associated with IBV, Escherichia coli, and high
ammonia levels. Facial swelling is also observed in infectious
coryza and Mycoplasma infections.
Nephritis observed in chickens infected with nephropathogenic
strains of IBV resembles kidney changes seen in several disease
conditions, such as infectious bursal disease, mycotoxicosis, or
other toxicities.
REFERENCES
1. Alexander, D. J., and N. J. Chettle. Procedures for the haemagglutination
and the haemagglutination inhibition tests for avian infectious bronchitis
virus. Avian Pathol. 6:9-17. 1977.
2. Andreasen, J. R. Jr., M W. Jackwood, and D. A. Hilt. Polymerase chain
reaction amplification of the genome of infectious bronchitis virus. Avian
Dis. 35:216-220. 1991.
3. Cavanagh, D., P. Britton, R. E. Gough, K. Mawditt, D. de B. Welchman.
Coronaviruses from pheasants (Phasianus colchicus) are genetically closely
related to coronaviruses of domestic fowl (infectious bronchitis virus) and
turkeys. Avian Pathol. 31:81-93. 2002.
4. Cavanagh, D. and S. A. Naqi. Infectious bronchitis. In: Diseases of
poultry. 11“' ed. Saif, Y. Μ., H. J. Bames, J. R. Glisson, A. M. Fadly, L. R.
McDougald, and D. E. Swayne. Iowa State University Press Ames, LA. 1 Ol­
li 9. 2003.
5. Cowen, B. S., and S. B. Hitchner. Serotyping of avian infectious
bronchitis viruses by the virus-neutralization test. Avian Dis. 19:583-595.
1975.
6. De Wit, J.J. Technical review. Detection of infectious bronchitis virus.
Avian Pathol. 29:71-93. 2000.
7. Gelb, J., Jr., C. L. Keeler, Jr., W. A Nix, J. K. Rosenberger, and S. S.
Cloud. Antigenic and S-l genomic characterization of the Delaware variant
serotype of infectious bronchitis virus. Avian Dis. 41:661-669. 1997.
8. Gelb, J., Jr., and S. L. Killian. Serum antibody responses of chickens
following sequential inoculations with different infectious bronchitis virus
serotypes. Avian Dis. 31:513-522. 1987.
9. Gelb, J., Jr., J. K. Rosenberger, P. A. Fries, S. S. Cloud, E. M Odor, J. E.
Dohms, and J. S. Jaeger. Protection afforded infectious bronchitis virus-
vaccinated sentinel chickens raised in a commercial environment. Avian
Dis. 33:764-769. 1989.
10. Gelb, J., Jr., J. B. Wolff, and C. A. Moran. Variant serotypes of
infectious bronchitis virus isolated from commercial layer and broiler
chickens. Avian Dis. 35:82-87. 1991.
11. Jackwood, M W., Η. M Kwon, and D. A. Hilt. Infectious bronchitis
virus detection in allantoic fluid using the polymerase chain reaction and a
DNA probe. Avian Dis. 36:403-409. 1992.
12. Jackwood, M W., N. Μ H. Yousef, and D. A. Hilt. Further
development and use of a molecular serotype identification test for
infectious bronchitis virus. Avian Dis. 41:105-110. 1997.
13. Karaca, K., S. Naqi, and J. Gelb, Jr. Production and characterization of
monoclonal antibodies to three infectious bronchitis virus serotypes. Avian
Dis. 36:903-915. 1992.
149
Chapter 32 Infectious Bronchitis
14. Keeler, C. L., K. L. Reed, W. A. Nix, and J. Gelb. Serotype
identification of avian infectious bronchitis virus (IBV) by RT-PCR of the
peplomer (S-l) gene. Avian Dis. 42:275-284. 1998.
15. King, D. J., and S. R. Hopkins. Evaluation of the hemagglutination­
inhibition test for measuring the response of chickens to avian infectious
bronchitis virus vaccination. Avian Dis. 27:100-112. 1983.
16. King, D. J., and S. R. Hopkins. Rapid serotyping of infectious bronchitis
virus isolates with the hemagglutination-inhibition test. Avian Dis. 28:727—
733. 1984.
17. Kingham, B. F., C. L. Keeler, Jr., W. A. Nix, B. S. Ladman, and J. Gelb,
Jr. Identification of avian infectious bronchitis virus by direct automated
cycle sequencing of the S-lgene. Avian Dis. 44:325-335. 2000.
18. Kwon, Η. Μ, M W. Jackwood, and J. Gelb, Jr. Differentiation of
infectious bronchitis virus serotypes using polymerase chain reaction and
restriction fragment length polymorphism analysis. Avian Dis. 37:194-202.
1993.
19. Lee, C-W., D. A. Hilt, and M. W. Jackwood. Typing of field isolates of
infectious bronchitis virus based on the sequence of the hypervariable region
in the SI gene. Veterinary Diagnostic Investigation. 15:344-348. 2003
20. Marquardt, W. W., S. K. Kadavil, and D. B. Snyder. Comparison of
ciliary activity and virus recovery from tracheas of chickens and humoral
immunity after inoculation with serotypes of avian infectious bronchitis
virus. Avian Dis. 26:828-834. 1982.
21. Moscoso, Η., E. O. Raybon, S. G. Thayer, and C. L. Hofacre. Molecular
detection and serotyping of infectious bronchitis virus from FTA filter
paper. Avian Dis. 49:24-29. 2005.
22. Naqi, S. A monoclonal antibody-based immunoperoxidase procedure for
rapid detection of infectious bronchitis virus in infected tissues. Avian Dis.
34:893-898. 1990.
23. Naqi, S. A., K. Karaca, and B. Bauman. A monoclonal antibody-based
antigen capture enzyme-linked immunosorbent assay for identification of
infectious bronchitis virus serotypes. Avian Pathol. 22:555-564. 1993.
24. Ruano, M, J. El-Attrache and P. Villegas. A rapid-plate
hemagglutination assay for the detection of infectious bronchitis virus.
Avian Dis. 44:99-104. 2000.
25. Shultze, B., D. Cavanagh, and G. Herrler. Neuraminidase treatment of
avian infectious bronchitis coronavirus reveals a hemagglutinating activity
that is dependent on sialic acid-containing receptors on erythrocytes.
Virology 189:792-794. 1992.
26. Thayer, S. G., B. N. Nersessian, B. Rivetz, and O. J. Fletcher.
Comparison of serological tests for antibodies against Newcastle disease
virus and infectious bronchitis virus using ImmunoComb® solid-phase
immunoassay, a commercial enzyme-linked immunosorbent assay, and the
hemagglutination-inhibition assay. Arian Dis. 31:459-463. 1987.
27. Thayer, S. G., P. Villegas, and O. J. Fletcher. Comparison of two
commercial enzyme-linked immunosorbent assays and conventional
methods for avian serology. Arian Dis. 31:120-124. 1987.
 33
TURKEY CORONAVIRUS
Mark W. Jackwood and James S. Guy

SUMMARY. Turkey coronavirus (TCoV) is the cause of coronaviral enteritis in turkeys. TCoV produces an economically significant
enteric disease in commercial turkeys, and has been associated with poult enteritis and mortality syndrome (PEMS). Young turkeys are
affected and diarrhea is the most common clinical sign.
Agent Identification. Virus can be isolated from fecal droppings, cloacal swabs, intestinal contents, intestines and the bursa of Fabricius.
The virus is propagated in embryonating eggs and identified by electron microscopy, fluorescent antibody tests, immunohistochemistry,
antigen capture enzyme linked immunosorbent assay (ELISA), or reverse transcriptase-polymerase chain reaction (RT-PCR).
Serologic Detection in the Host Antibodies against TCoV can be detected by the indirect fluorescent antibody test, commercial ELISA for
infectious bronchitis virus (IBV) or competitive ELISA. TCoV is closely related to, and should be differentiated from IBV as well as a
number of other viruses that cause enteric disease in turkeys.

INTRODUCTION affected. Characteristic microscopic lesions of the intestinal tract

Turkey poult enteritis is a severe and extremely important disease
in commercial turkeys because it can lead to enormous economic
losses. An enveloped positive-stranded RNA virus designated
turkey coronavirus (TCoV) is the etiologic agent of turkey
coronaviral enteritis. The original TCoV described in Minnesota in
1951 (TCoV [Minnesota]), which causes bluecomb disease, initially
was believed to be similar to bovine coronavirus, a group Π
coronavirus (9, 22, 24). However, recent studies have shown that
TCoV (Minnesota) and other TCoV isolates associated with
enteritis and PEMS in turkeys are antigenically and genomically
similar to each other and to a group ΙΠ coronavirus, infectious
bronchitis virus (IBV) (3,10, 11).
In 1997, Guy et al. (10) reported that a TCoV isolate from North
Carolina turkeys (NC95) was similar to other TCoV isolates as well
as TCoV (Minnesota), and these viruses likewise were similar to
IBV. Their conclusions were based on cross reactivity of polyclonal
antibodies in the fluorescent antibody test and immunoperoxidase
procedures. In addition, they found that a monoclonal antibody
directed against the membrane protein of IBV reacted with the
TCoV. Since that report, several other studies conducted on TCoV
isolates, showed that the order of the genes at the 3’ end of the
genome was similar to IBV (1, 3, 15, 16, 21) reinforcing the fact
that IBV and TCoV are closely related.
The most important structural protein in coronaviruses is the spike
glycoprotein. The S glycoprotein forms club shaped projections on
the surface of the virus particles. It is anchored in the envelope of
the virus and consists of two subunits designated SI and S2. Spike
mediates virus attachment to the host cell and is for the most part
responsible for host cell specificity. In addition neutralizing
antibodies are directed against the SI subunit of spike (2).
Published sequence data for the TCoV spike gene (GenBank Acc.
Nos. AY342356 and AY342357) shows that TCoV spike and IBV
spike are clearly different (less than 23% amino acid similarity).
The TCoV spike sequence was also important in establishing that
different isolates of TCoV appear to be genetically similar (greater
than 90% similarity).
CLINICAL DISEASE
Young turkeys less than 4 wk of age are most susceptible to the
disease and clinical signs are usually observed from 2 to 3 days
post-infection (14). Clinical signs can occur suddenly and consist of
watery, frothy droppings that may contain mucus and urates (13).
Birds often show depression, anorexia, dehydration, and weight
loss. Morbidity is near 100% and mortality can be variable
depending on the age of the bird, secondary pathogens,
management, and environmental conditions (13). Lesions associated
with the disease are pale, thin-walled and flaccid intestines, with
frothy watery contents (14). Most all of the intestinal tract can be
affected but usually the lower gut, including the ceca are commonly
150
are an increase in crypt depth, a decrease in villous length, a
decrease in intestinal diameter, cuboidal epithelium with a loss of
microvili, and an increase in heterophils and lymphocytes in the
lamina propria (13). In the bursa of Fabricius, characteristic
microscopic lesions consist of epithelial necrosis with replacement
of the normal pseudostratified columnar epithelium with a stratified
squamous epithelium (13).
SAMPLE COLLECTION
Samples for TCoV isolation include fecal droppings, cloacal
swabs, intestinal contents, intestines, or bursa of Fabricius. Because
coronaviruses are extremely labile, only fresh droppings should be
collected and the samples should be kept cold (on ice at 4 C or
frozen) at all times. Cold phosphate buffered saline (PBS) pH 7.4 or
minimal essential medium should be added to the clinical samples
and mixed well or homogenized if the samples are tissues. Next the
samples are clarified by centrifugation, and filtered through a
0.45 pm filter and stored frozen, preferably at -80 C.
PREFERRED CULTURE MEDIA AND SUBSTRATES
The preferred laboratoiy host system is specific-pathogen-free
(SPF) embryonating turkey eggs between 15 and 21 days of
incubation. Commercial eggs can be used as long as they do not
contain TCoV specific antibodies. Chicken embryonating eggs
between 16 and 18 days of age can also be used to propagate the
virus. Eggs are inoculated via the allantoic cavity and virus is
collected from the gastrointestinal tract at 48 to 72 hr post­
inoculation.
Attempts to grow TCoV in cell culture have been unsuccessful.
The Bluecomb virus, TCoV (Minnesota), was reported to grow in
HRT-18 cells, a human rectal adenocarcinoma cell line (7);
however, recent studies have failed to verify this (10).
AGENT IDENTIFICATION
Electron microscopy. The virus can be identified by negative
contrast electron microscopy or immune-electron microscopy. The
characteristic 60 to 180nm pleomorphic, enveloped particles with
club-shaped projections (spikes) can be observed in intestinal
contents, intestines, and bursa of Fabricius. However, virus particles
can be difficult to identify in “dirty samples” and it is recommend
that the source of virus be from the embryonic gastrointestinal tract
following propagation of the virus in embryonating eggs.
Fluorescent antibody test and immunohistochemistry. Direct
and indirect fluorescent antibody (FA) tests have been described for
detection of TCoV in intestines, bursa of Fabricius, and embryo-
infected gastrointestinal tissues (4, 18). Frozen tissue sections are
fixed in ice cold acetone for 10 min and stored at 4 C or
immediately stained with anti-TCoV antibodies directly conjugated

with fluorescein isothiocyanate (FITC) for direct FA or for indirect
FA, anti-TCoV antibodies are detected with the appropriate
secondary anti-gammaglobulin conjugated with FITC. Direct and
indirect FA tests have been shown to be useful for detection of viral
antigens in tissues and antibodies in serum, respectively (18). The
direct FA test, using FITC-conjugated turkey anti-TCoV antibodies,
was found to be suitable for detection of viral antigens during the
acute stages of the disease, whereas the indirect FA test was useful
for detection of anti-TCV antibodies, and for monitoring flocks for
exposure to TCoV (18). It was reported that TCoV can be detected
from 1 to 35 days post exposure when monoclonal antibodies are
used in the FA test (4). The sensitivity of that test was 69% and the
specificity was 96% when compared to virus isolation.
Immunohistochemical procedures (indirect FA and indirect
immunoperoxidase procedures) also were used to detect the virus in
frozen tissue sections prepared from intestinal tissues and bursa of
Fabricius (4). Frozen tissue sections were fixed in ice-cold acetone
and stored at 4 C prior to immunological staining. Indirect FA
utilized TCoV-specific monoclonal antibodies and FITC-conjugated
anti-mouse IgG. The indirect immunoperoxidase procedure utilized
TCoV-specific monoclonal antibodies and a commercially available
avidin-streptavidin immunoperoxidase kit. The virus was detected
from 1 to 35 days post exposure, and the sensitivity of the test was
61%, whereas specificity was 96% when compared to virus
isolation.
Antigen capture enzyme linked immunosorbent assay. Using
TCoV-specific antisera prepared in rabbits and guinea pigs, a
double-antibody ELISA was developed to detect TCoV in intestinal
contents (8). The test was found to be more sensitive than electron
microscopy for detection of TCoV. Additionally, the test was not
specific for TCoV as IBV was also detected. Briefly, TCoV-specific
antibody is coated onto a 96 well ELISA plate and intestinal
contents from turkey poults with diarrhea are added to the well.
After incubation, the plate is washed with PBS and secondary
antibody specific for TCoV conjugated to peroxidase is applied.
Following incubation, the plate is again washed and the appropriate
substrate applied to detect the virus.
Reverse transcriptase-polymerase chain reaction. Several RT-
PCR tests have been developed to detect TCoV in intestinal
contents, fecal droppings, and tissues. All of the tests reported to
date cross-react with IBV. Breslin et al. (4) reported an RT-PCR
test for TCoV that amplifies a 1100 bp region spanning the matrix
and nucleocapsid genes. The sensitivity of the test was 160 ΕΠ)50
and the identity of the amplified product was confirmed by nucleic
acid sequencing. Velayudhan et al. (23) used 3 sets of primers
designed to amplify the polymerase gene and the nucleocapsid gene
of TCoV. The sensitivity was between 1 and 10 ng/ml of RNA and
cross-reactions with IBV were identified with another set of primers
specific for the spike gene of IBV. Finally Sellers et al. (19)
developed a multiplex RT-PCR test that amplifies the nucleocapsid
gene of TCoV as well as IBV, and Spackman et al. (20) developed
a real-time RT-PCR test that amplifies the matrix protein gene of
both TCoV and IBV. Sensitivity of the multiplex and real-time tests
was from 1-5 ng of RNA and 1100 gene copy numbers respectively.
Generally, the RT-PCR test can detect TCoV between 1 and 14
days post exposure in cloacal swabs and intestinal tissues with
cloacal swabs providing more consistent results.
Procedures for extraction of viral RNA vary but the most widely
used is Trizol LS reagent (Invitrogen, Inc., Carlsbad, CA); this
reagent is used according to the manufacturer’s instructions. The
RT-PCR reaction conditions vary with each set of primers but in
general follow the recommendations of the RT-PCR kit
manufacturers and consist of a 30 to 60 min reverse transcription
step followed by heat denaturation for 5 min and 35 to 40 PCR
cycles. The PCR products are observed on an agarose gel following
electrophoresis or are sequenced. The real-time RT-PCR products
were detected with a specific probe labeled with a fluorescent dye.
151
Chapter 33 Turkey Coronavirus
SEROLOGIC DETECTION IN THE HOST
The indirect fluorescent antibody test (IFAT) has been established
to detect antibodies to TCoV (5, 18). Antigen for this test consists
either of frozen sections of TCoV-infected embryo intestines or
epithelium exfoliated from bursa of Fabricius of infected turkeys
(13). Frozen tissue sections are prepared from intestinal tissues of
TCoV-infected turkey embiyos, 24-48 hr after inoculation with
embryo-adapted TCoV strains. Bursa of Fabricius epithelial cells
from experimentally infected turkeys are spotted onto microscope
slides, air-dried, and fixed in ice-cold acetone. Dilutions of sera are
prepared in PBS and applied to the slides. Following incubation, the
slides are washed in PBS and incubated with FITC conjugated anti­
turkey IgG (H&L, Kirkegaard & Perry Laboratories, Gaithersburg,
MD). The slides are washed and examined for fluorescence with a
microscope containing an ultraviolet light source.
Serodiagnosis of TCoV can be demonstrated by ascending serum
antibody titers using the ELISA test. A commercially available
ELISA test for IBV (IDEXX, Westbrook, Maine) cross-reacts and
can be used to detect TCoV serum antibodies in turkeys when a
conjugated secondary antibody against turkey immunoglobulin
(goat anti-turkey IgG H&L, Kirkegaard & Perry Laboratories,
Gaithersburg, MD) is used (17). A competitive ELISA test was also
reported. That test utilizes a recombinant baculovirus expressed
TCoV nucleocapsid protein and a biotin-labeled monoclonal
antibody against the TCoV nucleocapsid protein (12). The ELISA
tests are reported to detect TCoV antibodies beginning on day 10
through day 28 post exposure in experimentally infected turkeys
(12), and both tests cross-react with IBV antibodies.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Differentiation of TCoV from IBV infection is important because
of the close relationship between those two viruses. TCoV has been
detected for up to 14 days post exposure in the gastrointestinal tract
of experimentally infected chickens by RT-PCR (14). IBV,
however, has a strict host range infecting only chickens and
pheasants (6). In addition, TCoV has a tropism for intestinal and
bursa of Fabricius epithelium of turkeys, whereas IBV typically
infects the upper respiratory tract, kidneys and reproductive tract of
chickens (11).
Other causes of turkey enteric disease include a number of viruses
including turkey astrovirus, reovirus, rotavirus, and enterovirus, as
well as bacteria, protozoa and fungi. Differentiation of TCoV from
those infectious agents can be accomplished using the tests
described above.
REFERENCES
1. Akin, A., T. L. Lin, C. C. Wu, T. A. Bryan, T. Hooper and D. Schrader.
Nucleocapsid protein gene sequence analysis reveals close genomic
relationship between turkey coronavirus and avian infectious bronchitis
virus. Acta Virol. 45:31-38. 2001.
2. Boursnell, Μ, Μ M Binns, T. Brown, D. Cavanagh and F. M Tomley.
Molecular biology of avian infectious bronchitis virus. Karger,New York
0:65-82. 1989.
3. Breslin, J. J., L. G. Smith, F. J. Fuller and J. S. Guy. Sequence analysis of
the turkey coronavirus nucleocapsid protein gene and 3' untranslated region
identifies the virus as a close relative of infectious bronchitis virus. Virus
Res. 65:187-193. 1999.
4. Breslin, J. J., L. G. Smith, H. J. Bames and J. S. Guy. Comparison of
virus isolation, immunohistochemistry, and reverse transcriptase-polymerase
chain reaction procedures for detection of turkey coronavirus. Avian Dis.
44:624-631. 2000.
5. Breslin, J. J., L. G. Smith and J. S. Guy. Baculovirus expression of turkey
coronavirus nucleocapsid protein. Avian Dis. 45:136-143. 2001.
6. Cavanagh, D. and S. A. Naqi. Infectious bronchitis. In: Diseases of
poultry. 11th Saif, Y. Μ, H J. Bames, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne eds. Iowa State University Press Ames, IA.
101-119. 2003.
Mark W. Jackwood and James S. Guy
7. Dea, S., S. Garzon and P. Tijssen. Isolation and trypsin-enhanced
propagation of turkey enteric (bluecomb) coronaviruses in a continuous
human rectal adenocarcinoma cell line. Am J. Vet. Res. 50:1310-1318.
1989.
8. Dea, S. and P. Tijssen. Detection of turkey enteric coronavirus by
enzyme-linked immunosorbent assay and differentiation from other
coronaviruses. Am. J. Vet. Res. 50:226-231. 1989.
9. Dea, S., A. J. Verbeek and P. Tijssen. Antigenic and genomic
relationships among turkey and bovine enteric coronaviruses. J. Virol.
64:3112-3118. 1990.
10. Guy, J. S., H. J. Bames, L. G. Smith and J. Breslin. Antigenic
characterization of a turkey coronavirus identified in poult enteritis- and
mortality syndrome-affected turkeys. Avian Dis. 41:583-590. 1997.
11. Guy, J. S. Turkey coronavirus is more closely related to avian infectious
bronchitis virus than to mammalian coronaviruses: A review. Avian
Pathology 29:207-212. 2000.
12. Guy, J. S., L. G. Smith, J. J. Breslin and S. Pakpinyo. Development of a
competitive enzyme-linked immunosorbent assay for detection of turkey
coronavirus antibodies. Avian Dis. 46:334-341. 2002.
13. Guy, J. S. Turkey coronavirus enteritis. In: Diseases of poultry. 11th ed.
Saif, Y. M, Bames, H. J., Glisson, J. R, Fadly, A. M, McDougald, Swayne,
D. E. eds. Iowa State Press Ames, Iowa. 300-307. 2003.
14. Ismail, Μ M., A. Y. Tang and Y. M. Saif. Pathogenicity of turkey
coronavirus in turkeys and chickens. Avian Dis. 47:515-522. 2003.
15. Lin, T. L., C. C. Loa and C. C. Wu. Existence of gene 5 indicates close
genomic relationship of turkey coronavirus to infectious bronchitis virus.
Acta Virol. 46:107-116. 2002.
16. Lin, T. L., C. C. Loa and C. C. Wu. Complete sequences of 3' end
coding region for structural protein genes of turkey coronavirus. Virus Res.
106:61-70. 2004.
152
17. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, H. L. Thacker, T. Hooper
and D. Schrader. Detection of antibody to turkey coronavirus by antibody­
capture enzyme-linked immunosorbent assay utilizing infectious bronchitis
virus antigen. Avian Dis. 44:498-506. 2000.
18. Patel, B. L., E. Gonder and B. S. Pomeroy. Detection of turkey
coronaviral enteritis (bluecomb) in field epiomithics, using the direct and
indirect fluorescent antibody tests. Am. J. Vet. Res. 38:1407-1411. 1977.
19. Sellers, H. S., M D. Koci, E. Linnemann, L. A. Kelley and S. Schultz-
Cherry. Development of a multiplex reverse transcription-polymerase chain
reaction diagnostic test specific for turkey astrovirus and coronavirus. Avian
Dis. 48:531-539. 2004.
20. Spackman, E., D. Kapczynski and H. Sellers. Multiplex real-time
reverse transcription-polymerase chain reaction for the detection of three
viruses associated with poult enteritis complex: Turkey astrovirus, turkey
coronavirus, and turkey reovirus. Avian Dis. 49:86-91. 2005.
21. Stephensen, C. B., D. B. Casebolt and N. N. Gangopadhyay.
Phylogenetic analysis of a highly conserved region of the polymerase gene
from 11 coronaviruses and development of a consensus polymerase chain
reaction assay. Virus Res. 60:181-189. 1999.
22. Tijssen, P., A. J. Verbeek and S. Dea. Evidence of close relatedness
between turkey and bovine coronaviruses. Adv. Exp. Med. Biol. 276:457-
460. 1990.
23. Velayudhan, B. T., H. J. Shin, V. C. Lopes, T. Hooper, D. A. Halvorson
and K. V. Nagaraja. A reverse transcriptase-polymerase chain reaction assay
for the diagnosis of turkey coronavirus infection. J. Vet. Diagn. Invest.
15:592-596. 2003.
24. Verbeek, A., S. Dea and P. Tijssen. Genomic relationship between
turkey and bovine enteric coronaviruses identified by hybridization with
BCV or TCV specific cDNA probes. Arch Virol. 121:199-211. 1991.
 34
ENTERIC VIRUSES
Don Reynolds and Ching Ching Wu

SUMMARY. With the exception of hemorrhagic enteritis virus (covered elsewhere) enteric viruses of poultry occur primarily in young
poultry. Characteristic clinical signs include diarrhea, anorexia, litter eating, ruffled feathers and poor growth. Intestines may have lesions;
intestines are typically dilated and are filled with fluid and gaseous contents. The sequela to clinical disease is often stunting and / or ranting
of the birds resulting in uneven flocks. Various viral agents (or combinations of these agents) can cause enteric disease and / or have been
identified from the intestinal contents of birds inflicted with enteric disease. Those viruses that cause and / or are associated with enteric
diseases of young poultry include astrovirases, coronaviruses, enteroviruses, rotaviruses and torovirus.
Agent Identification. A number of techniques have been used to detect enteric viruses. Many of the enteric viruses were first identified by
the direct visualization of the virion using electron microscopy (EM). Techniques that employ EM still remain the method of choice (or may
be the only method available) for detecting many of the enteric viruses (31). Immune electron microscopy (IEM) has been advantageous for
identifying many enteric viruses, especially those viruses for which physicochemical characteristics are little known. The expense,
availability, and experience of EM operator have limited the use of EM for the routine diagnosis of enteric viruses. Other techniques such as
fluorescent antibody (FA), genome electropherotyping, enzyme-linked immunosorbent assay (ELISA), and hemagglutination, have also been
used for the detection of some of the enteric viruses. Advances in molecular biology and genomic sequencing have allowed for the reverse
transcriptase polymerase chain reaction (RT-PCR) to be developed and used effectively for detecting some of the enteric viruses.
Serologic Detection in the Host. Detection of antibodies is used for the diagnosis of certain enteric virus infection (VN, ELISA).

INTRODUCTION SAMPLE COLLECTION

Enteric diseases that occur in young birds (less than 6 wk of age)
are problematic for poultry producers. A number of viruses have
been associated with enteric disease of young birds (35). Some of
these viruses are enteropathogens. However, the role that other viruses
play in enteric disease has yet to be determined. For example, in
turkeys a disease once known as ’’bluecomb disease” is caused by a
coronavirus. However, a similar condition in turkeys known as "poult
enteritis" or "turkey viral enteritis" has been associated with other
viruses including rotavirus and astrovirus infections. A similar
condition in chickens that has been commonly referred to as
"malabsorption syndrome," "stunting syndrome," etc., has been
associated with numerous viral agents, including reoviruses and
enteroviruses. Within the past decade, poult enteritis and mortality
syndrome (PEMS) has been determined to be an infectious disease
perhaps involving enteric viruses. Those enteric viruses that have been
associated with PEMS include coronaviruses and astrovirases (4).
CLINICAL DISEASE
The clinical disease varies with respect to the severity of clinical signs
and symptoms depending on the agent(s) and the avian species
involved. However, there are a number of characteristics that are
common among all the enteric virus infections. The clinical disease
most commonly occurs within the second or third week of life and lasts
10 to 14 days. Therefore, most birds that contract enteric viral disease
recover from the clinical disease by 6 wk of age. Characteristic
clinical signs and symptoms most often include diarrhea (watery
droppings), anorexia, litter eating, listlessness, and various types
of enteritis. The intestinal tracts are often filled with watery contents,
gas, and, in some instances, partially digested feed. The ceca are
usually dilated and filled with gaseous, frothy contents. Mortality is
variable and dependent upon the agent(s) and avian species involved.
Generally, mortality is only slightly to moderately increased.
However, with coronavirus infections of turkeys, losses of 50% or
more have been reported especially in PEMS cases (4, 11).
Morbidity, as a result of decreased growth (stunting), is of
primary concern. Typically, 5% to 20% of a flock that has
experienced enteric viral disease becomes stunted and remains so
throughout the growout period.
153
Intestinal samples collected from birds experiencing clinical
disease (diarrhea, etc.) are of greatest benefit for isolating and
identifying most enteric viruses. The intestinal tract should be
removed from the bird in its entirety starting from the point where the
duodenum joins the ventriculus and continuing distally to the
cloaca (vent); that is, the entire intestinal tract distal to the
ventriculus. The number of tracts needed depends upon the age
and size of the birds involved. Typically, intestinal tracts
from five to 10 birds are adequate. Ihe intestinal tracts can be placed
in any container free from viral contaminants. A sterile plastic bag
such as a Whirl Pac® (Nasco, Fort Atkinson, WI) is convenient.
The intestinal tract should be cut into small sections of 2-5 cm in length
when placing it into the sterile container (Whirl Pac®). This allows
the samples to be processed easier and aids obtaining intestinal
contents. The intestinal samples can then be stored and/or shipped by
freezing at temperatures of -20 C or lower. Intestinal contents are an
important source of virus-infected material. Although it is not
necessary to ligate the intestinal tract, no attempt should be made to
empty the intestinal tract of its contents. Intestinal tracts that have
been fixed in formalin or other fixatives prove to be of limited value,
because fixation usually results in inactivation of viruses.
Once intestinal tracts are frozen, they can be stored for indefinite
periods of time, as freezing appears to have minimal effects on most
enteric viruses. Samples can be removed from the freezer at any
convenient time for further processing. Processing the intestinal
samples for further virus isolation and identification involves the
following steps:
1) Thaw intestinal samples slowly, preferably at 4 C. In some
instances (nonenveloped viruses) freeze-thawing multiple times aids
in rupturing intestinal cells that harbor virus and breaks down tissue
for easier handling of the sample.
2) Dilute the samples with sterile phosphate-buffered saline (PBS;
pH 7.4) to a workable solution. Other diluents can be used;
however, PBS is economical and convenient. The extent of dilution
necessary depends on the sample. If the sample consists of watery
diarrhea, it will take less dilution than a sample consisting of solid
fecal material. Typically, a dilution of 1:5 to 1:10 (sample:
diluent) is adequate.
3) Homogenize the sample. This may be accomplished in a
number of ways. It is most convenient to place the plastic bags
containing the sample and diluent in a stomacher for 3 min and
allow the stomacher to homogenize the sample. By this method, the
sample does not leave its original container (Whirl Pac®), thus
minimizing the risk of contaminating the sample, laboratory, and
personnel. Numerous samples may be done quickly without the
Don Reynolds and Ching Ching Wu
necessity of cleaning equipment, etc. Other methods to homogenize
tissue such as using tissue grinders, blenders, or digitally
expressing the tracts by hand can be as effective. Another convenient
method is to “roll” the samples contained within a plastic bag with a
small wall paper roller that can be obtained at a local home
improvement store.
4) Sonicate samples in an ice bath for at least 1.5 min. Sonication
should be accomplished by 30-sec intervals of sonication followed
by 30-sec intervals of rest (no sonication) to allow heat dispersion.
Sonication aids in liberating viruses from tissue and organic
material. It also aids in dispersing aggregates of viruses. One
must be careful when using this step, because sonication may
affect membraned viruses. Additionally, sonication detaches pili
from bacteria that are present in the sample. Depending on the
intended use of the sample, the pili may pose potential
problems. Therefore, one may elect to omit sonication or
sonicate after bacteria have been removed.
5) Clarify the sample by subjecting it to centrifugation
between 400 and 500 x g. This clarifies the sample of most of the
Astroviruses
PREFERRED CULTURE MEDIA AND SUBSTRATES
Chicken astroviruses have been reported to have been
propagated in chick embryo liver cells (CEL, see Chapter 43 on
primary cell culture for procedures). Briefly, CEL cells were grown
to near confluency in 6mm petri dishes (5). The inocula (0.2 ml
sonicated filtrate, as indicated above) can be adsorbed onto the
monolayer with gentle rocking motions followed by the addition of
media. Cytopathic effect (CPE) was observed after 6 days of
incubation at 5% CO2 and 38.5 C.
AGENT IDENTIFICATION
Astroviruses are small round, non-enveloped viruses that typically
measure 28 to 30 nm in diameter (5) (with a positive-stranded RNA
genome). They have characteristic five-pointed or six-pointed star-
like surface projections detected by negatively stained electron
microscopy (EM). The family Astrovirdidae is divided into 2
genera: mammalian and avian astroviruses.
Avian astroviruses have been associated with enteric diseases in
turkeys causing diarrhea and high mortality. Astroviruses were first
reported in turkeys of age 6-11 days. Two types of turkey
astroviruses (TAstV) have been identified TAstV-1 and TAstV-2.
These two types differ immunologically and genetically from the
other avian astroviruses, avian nephritis virus, duck virus hepatitis
type 2 and chicken astrovirus (34).
The complete genomic sequence of TAstV was reported by Koci
et al (18, 20). The genome is 7,325 nucleotides and contains three
ORFs; ORF la, ORF lb and ORF2, and there is a frame shift
between ORF la and ORF lb. The protein products for ORF la, and
ORF lb are unknown as yet, but are predicted to be non-structural
proteins. It is possible that the product of ORFa is a serine protease
and the product of ORF lb is a RNA-dependent RNA polymerase
(5, 20). ORF2 encodes the viral capsid protein of 73-80 kDa.
Classical tests to detect astroviruses include electron microscopy,
fluorescent antibody detection and agar gel diffusion assay. These
tests, while more user friendly, lack the required sensitivity for
accurate diagnosis.
Recent advances in molecular biology have opened the door for
the development of many diagnostic assays for the detection of
avian astroviruses and are described here.
154
particulate matter. The supernatant is saved and used for further
processing. The pellet should not be discarded, because it may
retain appreciable amounts of virus.
6) The supernatant is filtered through a 0.45 pm filter. Usually, it is
advisable to filter the supernatant through larger filters (such as
1.2 pm, 0.8 pm or 0.65 pm) before attempting to filter through
a 0.45 pm filter. Positive pressure syringe filters are useful for
this procedure. If the samples are difficult to filter, the
clarification step (see step 5 above) can be repeated increasing the
centrifugation force up to 5,000 x g. The sonicated filtrate can be
frozen and stored. Repeated freezing and thawing may have some
unwanted effect on some viruses. Therefore, it is advisable to
aliquot this material in several containers before freezing. The
collection of additional tissues or the use of other procedures may
be of greater benefit depending upon the specific agent being
sought.
Reverse transcription-polymerase chain reaction (RT-PCR)
assay
A RT-PCR assay was described in 2000 by Koci et al (19, 20).
PCR primers were designed to amplify two fragments, an 802 bp
fragment of viral polymerase gene amplified by primers MKCap8
(TCATCATCCTCTCACACTGG) and MKCapl9
(AGCAGCAGTAGGTGGCAGTG) and 849 bp fragment of viral
capsid gene amplified by primers MKPollO
(TGGCGGCGAACTCCTCAACA) and MKPolll
(AATAAGGTCTGCACAGGTCG). Total RNA isolated from the
intestines and/or feces (experimentally infected or commercial
turkeys with an acute enteric disease) using the TRIzol total RNA
isolation reagent (Life Technologies, Rockville, MD) were
subjected to reverse transcription to cDNA using SuperScript
Reverse Transcriptase (Life Technologies). The cDNA was used as
target in the PCR amplification using the above-mentioned primers.
The PCR products were electrophoresised in a 1.1% agarose gel in
TAE buffer, stained with ethidium bromide, and visualized by UV
light. This RT-PCR assay has specificity for TAstV.
Multiplex RT-PCR
A multiplex RT-PCR was described for the detection of turkey
astrovirus and turkey coronavirus TCoV (37). Intestine and feces
from commercial turkey flocks and from turkey embryo intestines
inoculated with TCoV orTAstV-2 were used to develop the assay.
PCR primers (TCVnucleo forward, GGTAGCGGTGTTCCTGA,
and TCVnucleo reverse, CCCTCCTTACCTTTAGT) for the
detection of TCoV were designed to amplify a 598 bp fragment
within the nucleocapsid gene of TCoV. PCR primers for TAstV-2
were designed to amplify the 802 bp fragment of viral polymerase
gene as mentioned above. The amplified TCoV nucleocapsid gene
sequence is conserved with nucleocapsid gene sequence of
infectious bronchitis virus (IBV). This assay was specific for
TAstV-2, TCoV, and IBV. The sensitivity or the detection limit of
the multiplex RT-PCR was between 5 to 10 ng.
In situ hybridization
In situ hybridization was described in 2002 by Behling-Kelly et al
(6), in which tissue samples were taken from experimentally
inoculated 3-day-old turkey poults with TAstV-2. Tissues assayed
were intestines, spleen, bursa and thymus. Tissues were de­
paraffinized, digested with proteinase K, and hybridized overnight
with a digoxigenin-labeled riboprobe. The riboprobe was generated
by ZtawHI digested plasmid p25.5, which contains a 1.5 kb segment
of the extreme 3' end of the TAstV-2 genome. In vitro transcription

with T7 RNA polymerase and digoxigenin-labeled UTP was used as
an antisense riboprobe (1.6 kb in length).
The in situ hybridization assay is used to detect viral replication in
tissues. It was able to detect TAstV-2 in duodenum, cecal tonsils,
jejunum, distal small intestine and large intestine, but not in bursa,
thymus or spleen. TAstV-2 was detected after 1 day post
inoculation (PI) in cecal tonsils and distal small intestine, then in all
other tissues on day 3 PI. The signals were extensive in distal small
intestine and cecal tonsils. The signals were relatively infrequent
by day 9 PI.
Multiplex real time RT-PCR
A multiplex real time RT-PCR test was recently developed (38)
for the detection of TAstV-2 and TCoV. Virus detection was
evaluated with samples collected from poults inoculated at 1 day of
age with each virus. Cloacal swabs and intestinal samples were
obtained at 1,2, 3, 4, 6, 9, 14, 17, and 21 days after inoculation and
also from field samples. Primers for the real time RT-PCR for
astro viruses were designed to amplify a 112 bp fragment of the
polymerase gene, the sequence of the forward primer is ( TAV
4248F) 5’-TCC TCC ATG ATT CTC ATA AG- ‘3 and for the
reverse primer (TAV 4360 R) 5’-CTT GAC CTG GCA AAC T-‘3
and the probe sequence (TAV 4274 PB) 5’- [4J-AAG ATG CGG
CGC TTG TA-{TAMRA}-‘3. Primers for TCoV were designed to
amplify a 110 bp fragment of the matrix gene and their sequences
are: forward primer (TCoV 2F) 5’- AGT GGC TTG CTA AGT-‘3,
for the reverse primer (TCoV 112R) 5’-GCT TTG GTC ACC AGT-
‘3 and for the probe (TCoV 51 PB) 5’-{TXRed}-TAT GCA CAC
CGG ATA GAC G-{BHQ-2}-‘3.
Assay sensitivity was determined using in vitro transcribed RNA
and varied by target between 150 gene copies for TAstV-2 alone
and 2200 gene copies for TCoV when multiplexed. The TAstV-
2/TCoV test was able to detect the astrovirus isolate (NC/96) and
five additional field isolates as well as TAstV-2.
In the poults experimentally inoculated with TAstV-2, the virus
could be detected in both cloacal swabs and intestinal tissue from
Small Enteric Viruses
PREFERRED CULTURE MEDIA AND SUBSTRATES
Enteroviruslike particles from chickens can be serially
propagated by inoculating the chorioallantoic membrane
(CAM) of embryonated chicken eggs. Enteroviruslike
particles from turkeys can be propagated by inoculating
embryonated chicken eggs by the yolk sac route. Inocula can
be prepared from intestinal content samples as described above (see
Sample Collection). Procedures for CAM and yolk sac
inoculation are described in Chapter 44 on virus propagation in
embryonating eggs.
AGENT IDENTIFICATION
Small enteric viruses (18-24 nm in diameter) are a group of small
viruses that are similar in size and detected by EM but generally
cannot be differentiated on the basis of morphology (14), Included
in this category are enterovirus, parvovirus, calicivirus and
astroviruses. Enteroviruslike virus was detected in young turkeys
with enteritis. The virus can be propagated in embryonated turkey
eggs, with buoyant density of 1.33 g/ml in CsCl, and has a single­
stranded RNA genome of approximately 7.5 kb. The standard
diagnostic assay for the detection of small enteric viruses is EM in
which the intestinal contents from affected turkeys are used to
evaluate the presence of virus (15, 36).
Immunohistochemistry. Paraffin embedded tissue is used to
evaluate the presence of enterovirus-like particles. Embedded tissue
155
Chapter 34 Enteric Viruses
day 1 to day 14 PI and the highest proportion of poults positive for
virus detection was between days 4 and 9 PI.
SEROLOGICAL DETECTION IN THE HOST
Neutralization test: A virus neutralization assay was described
recently for Astrovirus (5). In this microtitre neutralization test,
two-fold dilutions of serum were mixed with an equal volume of
virus diluted in Eagle’s modified essential medium to give 200
median tissue culture infective doses per 0.1 ml, the sera were
incubated at room temperature for 1 h and 0.1 ml from each dilution
was placed into four microtitre wells in a 96-well plate and 0.1 ml
growth medium and 3xl04 LMH cells. A virus titration series and
negative serum were included in each test. The plates were
incubated for 5 days at 38.58 C in a CO2 atmosphere and then read
microscopically. The serum titer was the dilution where only 50%
of wells showed CPE. Also, a virus neutralization test in
embryonated turkey eggs was described by Tang et al (39), in
which 100 EID5o of TAstV 1987 isolate and TAstV 2001 isolate
were mixed with six 10-fold serial dilutions of guinea pig antisera,
then inoculated into 22-day-old turkey embryos by the amniotic
route. After 96 h of incubation at 37 C, embryos were examined for
intestinal lesions.
Enzyme-linked immunosorbent assay. An ELISA system was
developed by Tang et al (39). This system is based on the purified
turkey astrovirus isolates (TAstV1987 and TAstV2001). The
purified antigens were used at 2g/ml in 0.05 M carbonate­
bicarbonate coating buffer and, after blocking step with 3% bovine
serum albumin in phosphate-buffered saline with 0.1 Tween-20
(PBS-T), anti- TAstV 1987 and TAstV 2001 were added in 1:400
dilution, then goat anti-guinea pig IgG (H+L) horseradish
peroxidase labeled antibody diluted in 1:20,000 was added, then
substrate 3,3’, 5,5’-tetramethylbenzidine (TMB) mixed with equal
volumes of peroxidase solution B was added for color development
at 405 nm.
are mounted on N-aminoethylaminopropyltrimethoxysilane treated
glass slides, processed through xylene-ethanol, and digested with
0.1% trypsin. The tissue sections are treated with methanol and 3%
peroxide to quench endogenous peroxidase. Normal goat serum is
used as blocking agent at a 1:10 dilution. An avidin-biotin block
was used to block endogenous biotin in the tissue sections.
Unlabelled goat anti-turkey IgG was added to prevent binding of the
biotinylated goat anti-turkey IgG to IgG -producing cells. Hyper
immune turkey anti-enterovirus serum adsorbed with intestinal
powder was added in 1:160 dilution and followed by biotinylated
goat anti-turkey IgG. The substrate ExtrAvidin peroxidase
conjugate is added followed by another substrate 3-amino-9-
ethylcarbazole. Sections were counterstained with Mayer’s
hematoxylin then mounted in glycerol gelatin and examined by
light microscopy. Positive tissue samples were from ileum, jejunum
and duodenum, with the most severely affected tissues being
jejunum and ileum (16).
Immunofluorescent antibody assay
The immunofluorescent antibody assay (IFA) is used to detect
virus in the infected tissues. Formalin-fixed, paraffin-embedded
tissue sections were mounted on glass slides, deparaffinized, and
digested with 0.1% trypsin. Slides were incubated with normal goat
serum diluted 1:10 to reduce non-specific background staining.
Hyperimmune turkey anti-enterovirus serum diluted 1:60 was
added, followed by fluorescein-labeled goat anti-turkey IgG
globulin (Kirkegaard & Perry Laboratories, Gaithersburg, MD).
Stained sections were examined for infected cells using a
Don Reynolds and Ching Ching Wu
fluorescence microscope (Nikon Optiphot; Nikon Inc., Garden City,
N.Y.) (16).
Enzyme-Linked Immunosorbent Assay
In 1993, an antigen-capture ELISA was developed for the
diagnosis of enterovirus infection in turkey (15, 16). The samples
were intestinal contents from naturally and experimentally infected
turkeys. Hyper immune turkey anti-enterovirus serum in 1:1600
dilution in carbonate buffer was used. Five percent non fat dry milk
was used as a blocking reagent. Fecal samples were sonicated and
concentrated by centrifugation and diluted in minimum essential
medium at 1:5 dilution. Guinea pig anti-enterovirus antibody was
diluted at 1:800 in tris buffered saline and used as primary antibody
for ELISA. Sheep anti guinea pig IgG peroxidase -labeled antibody
was used at 1:1000 in tris-buffered saline as secondary antibody. 2,
2’-Azino-bis (3-ethyl-benz-thiazoline-6-sulfonic acid) in 0.05 M
citrate buffer with 3% hydrogen peroxide was used as a substrate.
Color development was read at 410 nm. The sensitivity and
specificity for this ELISA system compared to EM were 0.963 and
879, respectively.
0.
Coronaviruses
PREFERRED CULTURE MEDIA AND SUBSTRATES
There is currently no known cell culture system that is able to
support turkey coronavirus (TCoV) infection and this is a
significant limitation both for the ease of diagnosis and the
investigation of the virus biology. Turkey coronaviruses can be
propagated/isolated in embryonating chicken or turkey eggs more
than 15 days of age by amniotic route of inoculation. Twenty two or
23-day turkey embryos are commonly used for isolation and
propagation of TCoV (21). The inoculum is prepared from the
intestines, intestinal contents, or bursal tissues of suspected turkeys
or turkey poults. The intestines, intestinal contents, or bursal tissues
are homogenized with 5 volumes of PBS or TBS by motar and
pestle or a tissue homogenizer. The homogenates are centrifuged at
500 x g for 30 min. The supernatant is filtered through a 0.45 pm
membrane filter membrane prior to inoculation into eggs. If
necessary, antibiotics (penicillin or streptomycin) can be added to
the filtrate (inoculum) before inoculation. In addition, the inoculum,
if needed, can be activated by trypsin by adding 10 pg/ml of type
ΧΙΠ trypsin to the inoculum, followed by incubation at 37 C for at
least 1 hr. The air cell end of the egg is disinfected by 70% alcohol
and iodine. A 26-gauge needle with the syringe containing the
inoculum is inserted through a hole in the egg shell (created in the
air cell end of the egg) and subsequently through the chorioallantoic
membrane and reaches the amniotic cavity. One-hundred to 500 pl
of inoculum are injected into the amniotic cavity. The needle is
removed and the hole in the egg shell is sealed by parafilm,
cellophane tape, or silicone gel. Viruses can be recovered from
turkey embiyo intestines or bursae 2 to 5 days after amniotic
inoculation. Turkey coronavirus is detected in turkey embryo
intestines or bursae by immunofluorescent antibody assay (IFA)
using a TCoV-specific antiserum or monoclonal antibody. Electron
microscopy (EM) can also be used for intestinal contents or
homogenates to detect enveloped viruses of 50-200 nm with typical
coronavirus peplomers on the membrane. Definitive diagnosis by
EM can be achieved by immune electron EM (IEM) busing a
TCoV-specific antiserum.
156
Reverse transcription-polymerase chain reaction
A turkey enteroviruslike virus was identified to be through cross
immunofluorescence assay and RT-PCR (14). Turkey
enteroviruslike particle RNA was amplified by RT-PCR with
oligonucleotide primers specific for the polymerase gene (ORF lb)
and the capsid protein gene (ORF2) of TAstV-2. RNA samples for
the RT-PCR were extracted from turkey enteroviruslike virus
infected turkey intestines. The RT-PCR products were of 802 bp
and 849 bp , respectively. Sequence analysis of these RT-PCR
products showed a high degree of similarity to those of TAstV-2
(ORFlb; 98.8% and ORF2; 96.9%).
SEROLOGICAL DETECTION IN THE HOST
Antibodies to enterovirus have been detected by serum
neutralization and indirect immunofluorescence tests. Serology is
useful to determine the status of enterovirus infection in specific
pathogen free birds. However, due to the lack of virus isolates and
reference antisera, routine serological diagnosis is not
recommended (30).
AGENT IDENTIFICATION
Coronaviruses have been reported to cause clinical diseases in
chickens, turkeys, ducks, geese, pheasants, and pigeons and have
been isolated from these animal hosts. Unlike coronavirus induced
infectious bronchitis in chickens, the primary target tissue of
coronavirus in the other avian species is intestinal tract. Based on
antigenic relationship between turkey coronavirus (TCoV) and
other coronaviruses, TCoV was classified as a group 3 coronavirus
with avian infectious bronchitis virus (IBV). The viral particles of
TCoV are surrounded by a fringe of regularly spaced petal-shaped
projections attached to the particles by a short stalk. Turkey
coronaviruses are hemagglutinated with rabbit erythrocytes. Turkey
coronavirus has the buoyant densities of 1.14 to 1.15 and 1.18 to
1.20 g/ml, respectively, using sucrose density gradient
ultracentrifugation (21).
Coronavirus genome contains a single, positive-strand RNA
molecule, which is about 27 to 33 kilobases (KB) and has a
methylated cap at the 5’ end and poly (A) tail at the 3’ end. Genome
organization of coronavirus is 5’-polymerase gene-spike gene (S)-
membrane protein gene (M)-nucleocapsid gene (N)-3’, in which S,
M, and N are the structure genes. The whole TCoV genome consists
of 27,749 nucleotides, excluding poly (A) tail. Turkey coronavirus
polyprotein gene encodes two open reading frames. There are 9
open reading frames in the structure protein genes, representing the
entire S protein gene, tricistronic gene 3, M protein gene, bicistronic
gene 5, and N protein gene in the order of 5’ to 3’(23).
Turkey coronavirus can be identified and/or confirmed by EM,
IEM, IFA, immunohistochemistry, hemagglutination, RT-PCR, and
multiplex PCR.
Electron microscopy
Intestinal contents or homogenates (3 or 5 grams) are placed into a
stomacher bag with addition of 50 ml of water and the stomacher
bag is processed in the stomach machine for 30 sec. Four ml of the
mixture is added with an equal volume of water and centrifuged at
8,000 rpm for 5 min. Four ml of the supernatant is added with an
equal volume of water and centrifuged at 20,000 rpm for 60 min.
The supernatant is poured off and the pellet is added with a mixture
consisting of 4 drops of phosphotungstic acid and 3 drops of 0.1 %

bovine serum albumin and vortexed for 30 sec to 1 min. The stained
pellet is transferred to a nebulizer, sprayed onto the grids, and
observed on an electron microscope. Turkey coronavirus particles
are spherical, enveloped, and surrounded by regularly spaced petal-
or pear-shaped projections. They are 50 to 200 nm in diameter (21).
Immune electron microscopy
Intestines or intestinal contents are mixed or homogenized with 5
volumes of TBS and centrifuged at 250 x g for 10 min. The
supernatant is filtered by 0.8-pm membrane filter, followed by
0.45-pm membrane filter. The filtrate is incubated with diluted
turkey anti-TCoV serum overnight at 4 C. The samples are
centrifuged at 20,000 rpm for 60 min. The pellet is resuspended in
distilled water and added with a 3.0% phosphotungstic acid solution
to yield a final concentration of 1.5% phosphotungstic acid. The
samples are applied to the grids and observed on an electron
microscope (16).
Immunofluorescent antibody assay
The IFA assay for TCoV antigen detection in the intestine or bursa
of Fabricius is a sensitive assay due to the use of a fluorochrome
conjugated antibody (14, 22, 25, 32). TCoV antigen can be detected
in the intestine of experimentally infected turkeys from 1 to 28 days
post infection. The small intestine (jejunum and ileum) is frozen
immediately after collection, embedded in embedding medium, and
sectioned in 6-pm thickness. Tissue sections are fixed in acetone for
30 min at room temperature and incubated with turkey antiserum
specific for TCoV at a dilution of 1:40 in dilution buffer, containing
150 mM phosphate buffer, 0.85 % NaCl, 1 % BSA, and 0.02 %
Tween-20, in a humidifying chamber at room temperature for 30
min. After washing with PBS buffer for 3 times, intestinal sections
are incubated with fluorescein isothiocyanate (FITC) conjugated
goat anti-turkey IgG (H+L) antibody (Kirkegaard & Perry
Laboratories) at a dilution of 1:40 in dilution buffer at room
temperature for 30 min. Sections are read on a fluorescent
microscope (Nikon Optiphot; Nikon Inc.).
Immunohistochemistry
Frozen intestinal or bursal sections can be acetone-fixed, incubated
with TCoV-specific monoclonal antibody (Mab 4.24), and followed
by an immunoperoxidae procedure to reveal TCoV antigens in the
enterocytes in tissue sections on a light microscope (7). This assay
had high specificity (96%) and low sensitivity (61%) when
compared to virus isolation (7).
Hemagglutination
Turkey coronaviruses can agglutinate guinea pig and rabbit
erythrocytes. Turkey coronavirus antigens are propagated, purified,
and concentrated as described in the section of virus neutralization
for TCoV in this Chapter (9, 21). Erythrocyte suspension of 0.5%
are used to mix with equal volume of TCoV antigen. The assay is
performed at room temperature for 1 hr. The procedures of
hemagglutination and hemagglutination inhibition can be referred to
the Chapter on serological procedures.
Reverse transcription-polymerase chain reaction
Several approaches have been used to extract viral RNA from the
intestinal contents/dropping samples. In one method (7), the sample
was prepared as 20% (w/v) suspensions in TNE buffer (0.01 M
Tris-hydrochloride, pH7.4, 0.1 M NaCl, 1 mM
ethylenediaminetetraacetic acid) and sonicated for 30 sec. These
suspensions were clarified by centrifugation at 1000 x g for 10 min
at 4 C and then at 8000 x g for 30 min at 4 C. The supernatant was
layered onto a 20% (w/v) sucrose cushion and centrifuged at 80,000
x g for 2 hr at 4 C. The resultant pellets were incubated in 0.5%
sodium dodecyl sulfate for 5 min at room temperature followed by
two phenol-chloroform extractions. Nucleic acid was precipitated in
157
Chapter 34 Enteric Viruses
cold ethanol and pellets were resuspended in RNAse-free water (7).
In another report (45), the intestines were homogenized in minimom
essential medium (MEM) with penicillin (0.5 U/ml) and
streptomycin (0.5 mg/ml). The homogenate (20% w/v) was
centrifuged at 8,000 x g for 10 min. Viral RNA was extracted from
the supernatant of intestinal homogenate using QIAamp viral RNA
mini kit (Qiagen, Valencia, CA) (45). RNA was subjected to
reverse transcription followed by PCR amplification. Several sets of
PCR oligonucleotide primers designed from the nucleocapsid (N)
protein gene sequence of TCoV were used in PCR amplification:
Nl-upper (CAGCGCCAGTCATCAAAC) and N2-lower
(TGGTCAAACTTGTCAGGGTCC) amplifying 380 bp (45), N3-
upper (CAAGTAAAGGCGGAAGAAAAC) and N4-lower
(GCCTTAGTAATGCGAGAGCCC) amplifying 417 bp (45), and
NF (TCTTTTGCCATGGCAAGC) and NR
(TTGGGTACCTAAAAGTTCATTCTC) amplifying 1230 bp (26).
However, all these primer sets also amplified N gene of infectious
bronchitis virus (IBV).
Multiplex PCR
A rapid, sensitive, and specific multiplex PCR method has been
established for specifically differential detection of TCoV, IBV, and
bovine coronavirus (BCoV) (27). Intestines of turkey embryos
infected with TCoV were homogenized with 5-fold volume of
phosphate buffered saline (PBS) solution. These homogenates were
centrifuged at 1,500 x g for 10 min. Two hundred microliters of
virus-containing supernatants were mixed with 1 ml of RNApure
reagent (GenHunter, Nashville, TN) and incubated on ice for 10
min. After addition of 180 μΐ of chloroform, the mixture was mixed
vigorously for 10 sec and centrifuged at 13,000 x g for 10 min. The
upper aqueous phase was mixed with equal volume of cold
isopropanol and incubated on ice for 10 min. The RNA precipitate
was pelleted by centrifugation at 13,000 x g for 10 min and washed
with 70 % ethanol. The RNA was dissolved in 50 μΐ of diethyl­
pyrocarbonate (DEPC) treated sterile double-distilled water. The
RNA was combined with random hexamers (50 ng) in 11 μΐ of
DEPC-treated water, heat denatured at 70 C for 3 min, and
immediately placed on ice for 5 min. Reverse transcription buffer
containing 200 units of reverse transcriptase (Superscript Π system,
Life Technologies, Gaithersburg, MD) and 0.2 mM of each of the
four deoxynucleotide triphosphates (Promega Corp., Madison, WI)
was added. A total volume of 20 μΐ reverse transcription was
carried out at 42 C for 60 min. The primers used in multiplex PCR
were based on the alignments of spike (S) or N gene sequences
among TCoV, IBV, and BCoV to identify the variable and
conserved regions (23). The upstream primer N103F and
downstream primer N102R common to both TCoV and IBV were
designed according to conserved regions of N gene sequences. The
sequence of upstream primer N103F (cctgatggtaatttccgttggg) and
that of downstream primer N102R (acgcccatccttaataccttcctc)
amplify a 357-bp sequence of TCoV or IBV N gene in the
conserved regions corresponding to nucleotide position 445 to 801
of TCoV N gene. The upstream primer S306F
(tgtatctaatttgggtgggtttga) and downstream primer S306R
(ataagctgctaattgaagggatgc) are specific to TCoV and based on the
alignments of S gene sequences in the variable regions among these
viruses. This set of primers specifies a 727-bp sequence
corresponding to nucleotide position 2,019 to 2,745 of TCoV S
gene (23). The upstream primer S3 (atgtgtgtaggtaatggtcctgg) and
downstream primer S6 (agcaactacgaatcataaaa) are specific to BCoV
and designed according to variable regions of S gene sequences
among these viruses. This set of primers amplifies a 568-bp
sequence corresponding to nucleotide position 1,488 to 2,055 of
BCoV-Quebec S gene. PCR was performed in a 96-well thermal
cycler (GeneAmp, Perkin-Elmer Cetus Corp., Norwalk, CT). The
reaction mixtures contained 2μ1 of cDNA, 0.2 μΜ of each of the
primers N103F, N102R, S306F, S306R, S3, and S6 in 50 μΐ of PCR
Don Reynolds and Ching Ching Wu
buffer comprised of 0.2 mM of each of the four deoxynucleotide
triphosphates, 5 units of Taq DNA polymerase (Promega), 10 mM
Tris-HCl (pH 9.0), 50 mM KC1, 1.5 mM MgCl2, 0.1 % Triton X-
100, and 0.01 % gelatin. The cyclic parameters of the PCR were 94
C for 30 sec for denaturation, 50 C for 1 min for annealing, 72 C for
1 min for extension for 25 cycles followed by 72 C for 10 min final
extension. Two PCR bands of 727 and 357 bp, respectively, were
seen in the TCoV isolates. One PCR band of 357 bp was shown in
the IBV strains. One PCR band of 568 bp was obtained for the
BCoV strains and isolates.
Strain Variability
Turkey coronavirus was identified in the early 1970s as the major
cause of the most costly disease of turkey encountered in Minnesota
between 1950s and 1970s. In addition, outbreaks of turkey
coronaviral enteritis occurred in Quebec, Canada in late 1980s,
Indiana, U.S. in early and mid 1990s, and North Carolina, U.S. and
Virginia, U.S. in mid and late 1990s and has continued to remain as
the disease of threat to the turkey industry in North Carolina,
Virginia, Arkansas, Missouri, and other states in the U.S. in the
2000s. Variability of TCoV strains or isolates from different
geographical locations in different time period can be determined
by immunological methods and molecular approaches.
Immunological methods. Immunofluorescent antibody assay,
ELISA, and virus neutralization are immunological methods that
can be used to study variability of TCoV strains or isolates. The
procedures of these methods have been described in this Chapter.
The cross antigenic reactivity of 18 TCoV isolates from various
geographical locations in the U.S. was studied by IFA using
antibodies to different TCoV isolates (22). Intestinal sections were
prepared from turkey embryos infected with different TCoV isolates
and reacted with polyclonal or monoclonal antibodies specific to
TCoV in immunofluorescent antibody staining. All 18 TCoV
isolates had the same antigenic reactivity pattern with the same
panel of antibodies. This indicates that TCoV isolates from various
geographic locations in the U.S. are antigenically identical or
closely related (22).
Molecular methods. Turkey coronavirus genome is a positive
single-stranded capped RNA with a polyadenylated 3’ end. The 5’
two-thirds of the coronavirus genome consist of two overlapping
open reading frames (ORFs) that encode non-structural proteins
including the viral RNA-dependent RNA polymerase. Another one-
third nucleotide sequences, including the structural protein genes
and 3’ UTR, in the 3’ end have a total of 6,963 nucleotides in the
structural protein genes that consist of the entire S protein gene,
tricistronic gene 3, membrane (M) protein gene, bicistronic gene 5,
and N protein gene in the order of 5’ to 3’ along the genome (23).
PCR, cloning, sequencing, and sequence analysis (including
sequence alignment, degree of sequence homology, and
phylogenetic analysis) are the major molecular methods to
determine variability of TCoV strains or isolates. The 3’-end
structural protein gene sequences of TCoV isolates associated with
outbreaks of acute enteritis in Indiana, North Carolina, and
Minnesota have been studied by carrying out PCR, cloning, and
sequencing (28). TCoV isolates were propagated in 22-day-old
turkey embryos. Total RNA was extracted from the infected
intestines and intestinal content by using guanidinium thiocyanate
and acid-phenol. The RNA was dissolved in 150 μΐ of diethyl­
pyrocarbonate (DEPC) treated sterile double-distilled water. Two
micrograms of the total RNA was heat denatured at 100 C for 3 min
and slowly cooled to 22 C in 15 min in reverse transcription (RT)
buffer (Life Technologies) containing 40 ng of random hexamers.
The reverse transcription was carried out at 42 C for 60 min. Three
microliters of cDNA were used in PCR amplifications with the
primers spanning for 4 overlapping fragments covering the entire
3’end structural protein genes as described in a previous report (23).
One microliter of the amplicon was used to ligate with pCR-Π
158
plasmid vector (Invitrogen) and transformed into E. coli strain
TOPI OF' (Invitrogen). Correct clones were selected and subjected
to sequencing reaction using dideoxy-cycle sequencing method with
the corresponding sequencing primers for both strands. The
nucleotide and deduced amino acid sequence similarities among the
TCoV isolates were analyzed by the Clustal W method in MegAlign
module of the DNAstar program (Lasergene Corp, Madison, WI).
Percent similarities were calculated to find nucleic acid and amino
acid pair distances. Based on the obtained sequences, phylogenetic
trees of TCoV isolates were constructed. Pair-wise comparison of
nucleotide sequence distance for the entire 3’-end structural protein
gene sequences among TCoV isolates revealed the similarity scores
ranging from 92.7 % to 99.4 %. Pair-wise comparison of nucleotide
and deduced amino acid sequence distance of S protein gene
sequences among TCoV isolates had the similarity scores ranging
from 93.0 % to 99.7 % at the nucleotide level or from 92.5 % to
99.3 % at the amino acid level. Phylogenetic analysis according to
the entire 3’-end structural protein region or the deduced amino acid
sequence of S protein gene showed that TCoV isolates were
clustered within the same genomic lineage. This indicates that
TCoV isolates from various geographic locations in the U.S. are
closely related genetically (28).
SEROLOGICAL DETECTION IN THE HOST
Immunofluorescent antibody assay for antibody to TCoV
Frozen turkey intestines infected with TCoV were sectioned at 6-
pm thickness and incubated with 2-fold serially diluted turkey
serum at room temperature for 30 min. The intestinal sections were
subsequently incubated with FITC-conjugated goat anti-turkey IgG
(H+L) antibody (Kirkegaard & Perry Laboratories) at a dilution of
1:40 in dilution buffer at room temperature for 30 min in a
humidifying chamber. Sections were read on a fluorescent
microscope (Nikon Optiphot; Nikon Inc.). The titer of turkey sera
was defined as the reciprocal of the highest dilution of test sample
still having positive staining (25, 32). Alternatively, TCoV-infected
epithelial cells exfoliated from the bursae of Fabricius can be served
as the source of TCoV antigen. Exfoliated TCoV-infected epithelial
cells were spotted onto glass slides, air-dried, and fixed in cold
absolute acetone for 10 min. FITC-conjugated rabbit anti-chicken
immunoglobulin G (ICN Biomedicals, Inc., Costa Mesa, CA) with a
1:40 dilution was used as the secondary antibody (13).
Antibody-capture enzyme-linked immunosorbent assay
Based on the positive antigenic cross-reactivity between TCoV
and IBV, commercially available IBV-coated ELISA plates
(IDEXX, Westbrook, ME) were successfully used for the detection
of anti-TCoV antibody (24). Anti-TCoV hyperimmune turkey
serum and normal turkey serum were used as positive or negative
control sera for optimization of the ELISA. Goat anti-turkey IgG
(H+L) conjugated with horseradish peroxidase (Kirkegaard & Perry
Laboratories) was used as detector antibody (conjugate). The
differentiation between anti-TCV hyperimmune serum and normal
turkey serum were achieved when using 1:40 serum dilution, and
1:1,600 conjugate dilution. Ninety six-well microtiter plates coated
with IBV antigens were incubated with turkey serum samples (1:40
dilution) to be tested in quadruplicate and incubated at 37 C for 1
hr. The plates were subsequently incubated with goat anti-turkey
IgG (H+L) conjugated with horseradish peroxidase (1:1,600
dilution) at 37 C for 1 hr., followed by the addition tetramethyl
benzidine (TMB) solution. Two reference wells that contained all
reagents except serum samples were included in each plate. Positive
and negative control sera as well as test sera were tested in
duplicate. The absorbance value of each well was measured at 450
nm using a spectrophotometer (Vmax™ Kinetic Microplate Reader,
Molecular Devices Corporation, Menlo Park, CA). The ELISA
value or S/P ratio of each test serum was calculated as (absorbance

value of sample serum minus absorbance value of negative control
serum) divided by (absorbance value of positive control serum
minus absorbance value of negative control serum). The optimum
cutoff point to separate positivity and negativity was determined to
be 0.18 by logistic regression analysis. The sensitivity and
specificity of this ELISA relative to IFA test were 93.1 % and 96.7
%, respectively.
Another ELISA to detect TCoV antibody (26) was developed
using the recombinant N protein of TCoV expressed in E. coli
transformed with pTriEx-1 (Novagen, Madison, WI) plasmid
construct carrying N gene of TCoV. The optimum conditions for
differentiation between anti-TCoV serum and normal turkey serum
were: coating concentration of recombinant E. coli-expressed TCoV
N protein at 20 pg/ml, serum dilution of testing turkey serum
sample at 1:200 to 1:800, and conjugate dilution at 1:10,000 or
1:20,000. The optimum cutoff point to separate positivity and
negativity was determined to be 0.18 by logistic regression analysis.
In addition, Recombinant N protein of TCoV produced by
recombinat baculovirus encoding TCoV N gene (rBTCV/N) has
been shown to be useful in detecting antibody to TCoV in an
antibody-capture ELISA (8). Recombinant baculovirus was
generated by co-transfection of linearized AcMNPV DNA (Bac-N-
Bluea DNA, Invitrogen, San Diego, CA) and pBacTCV DNA
carrying TCoV N gene cloned into pMelBac C vector (Invitrogen).
The rBTCV/N protein was diluted 1/80 in 0.2 M carbonate/0.2 M
bicarbonate buffer, pH 9.6, added to 96-well ELISA plates, and
incubated overnight at 4 C. rBTCV/N protein coated plates were
washed three times with PBS plus 0.05% Tween 20 (PBST),
followed by 200 μΐ of block buffer (PBST containing 1% nonfat
dried milk) being added to each well and incubated for 1 hr at room
temperature. Following washing three times with PBST, 75 μΐ of
testing serum, diluted 1:40 in block buffer, was added to each well
and incubated for 30 min at 37 C. Seventy-five μΐ of peroxidase-
labeled goat anti-chicken immunoglobulin G in 1:50 dilution was
added to each well and incubated for 30 min at 37 C. One-hundred
μΐ of 2, 2'-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid)
substrate (Kirkegaard and Perry Laboratories) was added to each
well; color development was stopped after 15 min with 1% (w/v)
SDS in water. Plates were read with a ELISA reader at 405 nm. The
TCoV N ELISA detected antibodies in all antisera prepared against
TCV and IBV strains. Samples were considered positive if their
absorbance was > 0.1. Absorbance values for TCoV and IBV
antisera were > 0.3.
Since TCoV and IBV N gene sequences are conserved and share
cross-reactivity, antibody-capture ELISA based on IBV antigen or
recombinant TCoV N protein can detect serum antibody to TCoV as
well as that to IBV. However, S gene sequences between TCoV and
IBV are markedly different, with only 33.8% to 33.9% of sequence
homology (23). Therefore, antibody-capture ELISA based on TCoV
S protein should be able to detect TCoV-specific antibody,
differentiate between antibodies to TCoV and IBV, and evaluate
TCoV-specific antibody response in the turkey flocks. A TCoV-
specifc antibody-capture ELISA has been achieved for the detection
of antibody to TCoV in turkey sera using recombinant partial S
protein of TCoV expressed in E. coli transformed with pTriEx-1
(Novagen) plasmid construct containing the insert of partial S gene
of TCoV as the coating antigen in the ELISA plates (46). A partial
SI gene fragment of TCoV was ampilified by PCR, cloned into an
expression vector (pTriExl, Novagen), and expressed in E. coli
(Rosetta cells, Novagen). The recombinant partial SI protein was
purified by His-Bind column chromatography (Novagen) and used
to coat the ELISA plates. The optimal parameters for differentiation
between anti-TCoV serum and normal turkey serum by ELISA
were: purified recombinant partial S protein at 20 pg/ml, serum
dilution 1:200 to 1:800, and conjugate dilution 1:10,000, 1:20,000,
or 1:40,000. The optimum cutoff point to separate positivity and
negativity was determined to be 0.32 by logistic regression method.
159
Chapter 34 Enteric Viruses
The sensitivity and specificity of ELISA relative to IFA test were
98.7% and 98.8%, respectively. The recombinant TCoV S protein­
based antibody-capture ELISA is useful in detection,
differentiation, and evaluation of antibody response to TCoV.
Competitive enzyme-linked immunosorbent assay
A competitive enzyme-linked immunosorbent assay (cELISA) was
developed for detection of antibodies to TCoV by using a
recombinant baculovirus-expressed TCoV N protein (as mentioned
above) and biotin-labeled TCoV N protein-specific monoclonal
antibody (Mab 4.23) (13). The rBTCV/N protein was diluted
1:1280 in 0.2 M carbonate/0.2 M bicarbonate buffer and 75 μΐ was
added to each well in 96-well ELISA plates and incubated overnight
at 4 C. rBTCV/N protein-coated plates were washed three times
with 0.01 M PBS, pH 7.2, containing 0.05% Tween 20 (PBST), 200
μΐ of block buffer (PBST containing 1% nonfat dry milk) was added
to each well and incubated for 1 hr at 25 C. After washing three
times with PBST, positive and negative control sera and test sera
were diluted 1:10 in block buffer and 50 μΐ of each were placed in
duplicate wells and plates were incubated for 60 min at 25 C. A
diluent control consisting of block buffer (50 μΐ) also was placed in
duplicate wells. Washing three times with PBST, 50 μΐ of biotin-
labeled MAb 4.23 diluted 1:160 in block buffer were added to each
well and incubated for 60 min at 25 C. Washing three times with
PBST, 75 μΐ of streptavidin-horseradish peroxidase (Kirkegaard and
Perry Laboratories) diluted 1:200 in block buffer was added to each
well and incubated for 30 min at 37 C. Washing three times with
PBST, 100 μΐ of 2,2’-azino-bis (3- ethylbenzthiazoline-6-sulfonic
acid) substrate (Kirkegaard and Perry Laboratories) were added to
each well; color development was stopped after 20 min with 1%
(w/v) SDS in water. Plates were read on an ELISA reader (BT 2000
MicroKinetics Reader, Fisher Scientific) at 405 nm. Optical
densities of duplicate wells, including positive and negative control
sera wells, and diluent wells were averaged. Percentage of
inhibition of optical densities of test serum wells relative to negative
control serum was calculated after subtracting the diluent control,
which was subtracted from all test and control well averages, to
yield a corrected value. Percentage of inhibition was calculated as
100 - (100 x [test serum - diluent/negative control - diluent]). Sera
were considered to be positive if inhibition >45% was observed and
negative if inhibition <45%. The cELISA was shown to have a
sensitivity of 92.9% and a specificity of 96.2% when compared with
IFA. The cELISA also detected antibody to IBV.
Virus neutralization
Turkey coronavirus is propagated in embryonating turkey eggs as
described above and infected intestines are harvested 3 days after
inoculation. Collected intestines are homogenized with 5 volumes
of TBS by mortar and pestle or a tissue homogenizer. After freeze
and thaw three times and sonication, the homogenate is centrifuged
at 8,000 x g for 20 min. The supernatant was ultracentrifuged at
100,000 x g for 3 hr through a cushion of 15 ml of 30% sucrose
solution. After resuspension of the pellet in TBS, the sample was
layered on the top of 40 to 65% sucrose gradient and
ultracentrifuged at 100,000 x g for overnight. Two TCoV-
containing fractions with sucrose densities of 1.18 to 1.20 and 1.14
to 1.15 g/ml, respectively, are collected, titrated, and used in virus
neutralization (10, 21). The serum samples to be tested are 10-fold
serially diluted and incubated with 0.01, 0.1, or 1 egg infective dose
(EID50) of TCoV at 37 C for 1 h. Two-hundred microliters of
mixture are inoculated into the embryonating turkey eggs as
described above. The intestines from the turkey embryos are
collected 3 days after inoculation and examined by IFA as described
above. The virus neutralization titer is expressed as the reciprocal of
the highest dilution of the serum sample capable of neutralizing
virus without causing infection to turkey embryos.
Don Reynolds and Ching Ching Wu
Hemagglutination inhibition
Turkey coronavirus antigens are propagated, purified, and
concentrated as described above (10, 21) and are diluted to yield
four hemagglutination units. The serum samples to be tested are
adsorbed with kaolin and mixed with erythrocytes to minimize non­
specific agglutination. The serum is diluted to 1:5 with sterile PBS
and added to an equal volume of a 25% kaolin suspension in PBS.
Rotaviruses
PREFERRED CULTURE MEDIA AND SUBSTRATES
Avian group A rotaviruses have been propagated in primary
cultures of chicken kidney, turkey kidney, and chicken embryonic
liver cells. However, the continuous cell line derived from
fetal rhesus monkey kidney, which is referred to as the MA 104
cell line, is the most widely used and convenient method for the
isolation and propagation of these viruses.
Roller tubes are convenient for initial propagation of rotavirus
isolates, although when propagation of large amounts of virus
is needed, roller bottles can easily be used. Stationary cultures
of MA 104 cells may also support avian rotavirus growth, and the
continuous rolling of cultures (as with roller tubes or bottles)
aids in rotavirus isolation and propagation.
Trypsin activation of rotaviruses is essential for cell culture
propagation, as is the incorporation of trypsin into the maintenance
media. Type IX trypsin (Sigma Chemical Co., St. Louis, MO) is
widely used for activation. Not all type IX trypsin has the same
activity. The amount of trypsin activity may be influenced by
factors such as age and different manufacturers' lots. Therefore, it
is advisable to titrate the amount of trypsin needed in the
maintenance media before virus inoculation. This is done by
incorporating different concentrations of trypsin (usually 0.5,
1.0, 1.5 ... 4.0 pg/ml) into the maintenance media and using these
media in roller tubes containing confluent monolayers of MA 104
which have not been infected with virus. Usually within hours, the
higher concentrations of trypsin will cause the monolayers to
detach from the glass roller tube. The optimum concentration
of trypsin to be used in the maintenance media is that concentration
that will leave at least 50% of the monolayer attached to the glass
after 24 hours.
Avian rotaviruses other than Group A rotaviruses have not been
routinely isolated or propagated in cell culture. Isolation and
propagation of these viruses have been limited to orally
infecting birds that are known to be free of other enteropathogens
(specific-pathogen-free [SPF] birds are desirable) with
preparations of these agents. Virus can be recovered from the
intestinal tracts of these birds several days following inoculation.
The following procedure can be used to isolate and
propagate group A rotaviruses in cell culture:
1) Screw-capped tubes are seeded with MA 104 cells and grown
to confluency using either Eagle's minimum essential (EMEM) or
Dulbecco's modified Eagle's medium (DMEM) supplemented
with 10% fetal bovine serum (FBS) and antibiotics (penicillin
50 IU/ml, streptomycin 50 pg/ml, and amphotericin B 0.125
pg/ml). If the screw-capped tubes form a tight seal, they need
not be incubated under conditions supplemented with CO2. All
cultures are incubated at 37 C.
2) Cell monolayers must be washed with serum-free media (or
other balanced salt solutions) three times in order of get rid of
any residual FBS that may inhibit the virus or inactivate the
trypsin to be added.
3) The inoculum containing the virus is prepared from the
sonicated filtrate as described above. The inoculum must first be
activated with trypsin before inoculation onto the cell monolayer.
This is accomplished by the addition of type IX trypsin to a
final concentration of 10-20 pg/ml of inoculum. Some samples
160
After thorough mixing and incubation at room temperature for 30
min the serum-kaolin preparation is centrifuged at 500 x g for 30
min and the supernatant (serum) is used. Erythrocytes are added to
the kaolin-adsorbed serum in a similar manner. The procedures of
hemagglutination and hemagglutination inhibition can be referred to
the Chapter 47 on serological procedures.
may contain substances that are toxic to the cells. If this is the
case, dilute the sample 1:25 or 1:50 with serum-free media and
then add type IX trypsin.
4) The trypsin-activated inoculum is placed onto the cell monolayer.
For screw-capped tubes, 0.2 ml of inoculum per tube is typically
used. Either tubes can be rotated by hand once every 10 to 15
min, or, they can be placed directly into a roller-drum
apparatus and rotated. The inoculation period is 1 h.
5) Following inoculation, the monolayers are washed with serum-
free media to get rid of any residual inoculum. Maintenance
medium, consisting of antibiotic containing serum-free EMEM
or DMEM with 1-2 pm/ml of type IX trypsin, is added to each
tube.
6) Virus-inoculated cells are incubated for 48 to 72 h before
harvesting. CPE is typically seen within 24 h of inoculation.
However, initial isolates may need to be blind-passaged several
times before CPE is observed. For a complete description of
rotavirus CPE in MA104 cells, see Theil et al. (41).
7) Virus is harvested between 48 and 72 h after inoculation.
Tubes containing cells are frozen at -20 C or lower, thawed,
sonicated, and clarified by centrifugation at 500 x g for 10
min.Virus is contained in the supernatant, which can be used for
further passage, purification, and so on.
AGENT IDENTIFICATION
Avian rotaviruses are double-stranded (ds) RNA viruses ranging
in size from 60 to 75 nm. Rotaviruses may be observed as
double-shelled particles ranging in approximate size from 70
to 75 nm or as single-shelled particles ranging in approximate
size from 60 to 65 nm. Rotaviruses possess a distinct
morphology that aids in their identification. For more
information see McNulty (29) or Theil (41). The buoyant
density of rotaviruses in cesium chloride is approximately 1.36 g/
cm3 for double- shelled particles and 1.38 g/cm3 for single­
shelled particles. Avian rotaviruses are classified according to
groups based on serologic assays and genome electropherotyping.
To date, there have been three groups of avian rotaviruses
identified. The group of rotaviruses isolated most commonly
from turkeys is the group D rotavirus, also referred to as
rotavirus-like virus and para-rotavirus. Another group
frequently isolated from avian species is Group A. A third group
(which has not been placed into a designated group) referred to as
the atypical rotavirus occurs infrequently in turkeys.
A number of assays can be used to identify rotaviruses. Two such
assays, IEM and electropherotyping, which are capable of
detecting and distinguishing the various groups of avian
rotaviruses, are described under serologic detection and
strain variability. There are commercially available assays that
are capable of detecting rotaviruses. Examples of such assays
would include latex agglutination assays and ELISAs. As of this
writing, kits that are commercially available are directed towards
the detection of mammalian (usually human) group A
rotaviruses and are of limited value because they are unable to detect
group D or atypical avian rotaviruses.

Serologic Identification
Assays employing immune serum are beneficial for detecting
and differentiating avian rotaviruses. The most commonly used
serologic techniques for antigen detection are the FA and LEM
techniques. For further information on how to perform direct and
indirect fluorescent antibody techniques, see Gardner (12). The
IEM technique is described below.
Immune Electron Microscopy (IEM). The following
procedures are used:
1) Preparation of antisera. Convalescent antisera from
infected birds (SPF birds are preferred) or hyperimmune antisera
from inoculated animals can be used. Before being used, sera are
heat-inactivated at 56 C for 30 min, subjected to
ultracentrifugation at approximately 45,000 x g for 45 min, filter-
sterilized, and aliquoted. Aliquoted sterile sera can be stored at
4 C. A determination of the optimum working dilution can be
made by serially diluting the sera in sterile PBS and
performing the rest of the IEM procedure. Typically,
working dilutions of convalescent sera will range from 1:50 to
1:200 sera:PBS). Working dilutions of hyperimmune sera are
usually much higher.
2) Preparation of the sample. When examining intestinal samples,
the intestinal tracts can he processed as described above (see Sample
Collection). The resulting sonicated filtrate is used for the rest
of the procedure. When examining cell-culture material, the
supernatant obtained from harvesting infected cells (see
Preferred Culture Media and Substrates) is used.
3) Incubation of the sample and antisera. The volume of sample
that can be combined with antisera (’’antisera’’ refers to the
working dilution of antisera, see above) is dependent upon a
number of variables such as the strength and/or dilution of the antisera,
the amount of sample used, and the equipment available. Typical
total volumes of sample plus antisera preparation are 0.5 to 1.0 ml.
Ratios of sample to antisera are generally between 2:1 and 4:1,
(e.g., 0.5 ml sample plus 0.2 ml antisera). The incubation can also
vary depending upon the sample and antisera involved. For
maximum effect, the sample/antisera preparation can be
incubated at 4 C overnight, although incubation for 1 h at room
temperature is usually sufficient.
4) Pelleting the virus/antibody complexes. Following incubation,
virus/antibody complexes contained in the sample/antisera
preparation are pelleted by subjecting the preparation to
ultracentrifugation at approximately 55,000 x g for 45 min. Mark
ultracentrifuge tubes before ultracentrifugation in order to
locate pellet (see below). If the sample was prepared from
intestinal samples (or similar material), it may contain much
unwanted debris that may interfere with the final preparation when
viewed on the EM. To remove such debris, the sample/antisera
preparation can be pelleted through a layer of 40% to 60% sucrose.
The layer of sucrose will act as a barrier to hold back low-density
debris. The sucrose layer should not be used if the sample is
relatively pure (such as cell-culture material) because some
debris aids in the spread of the stained sample on the grid (see
below). Additionally, the sucrose may act to hold back viruses
with low buoyant densities along with the debris. Therefore, caution
must be taken depending on the intended use of the preparation. If the
sample/antisera preparation is pelleted through the layer of
sucrose, the sucrose must be washed away by discarding the
supernatant (containing the sucrose), resuspending the pellet in
PBS, and pelleting as before.
5) Resuspending the sample preparation. Following
ultracentrifugation, die supernatant is discarded, and the pellet can be
resuspended in sterile high-quality water or tris buffer (pH 7.2).
Note that the ultracentrifuge tubes need to be marked before
pelleting so as to locate the pellet, since a visible pellet is
rarely identifiable. The pellet should be resuspended in 1 drop
(from a Pasteur pipet) of the chosen diluent.
161
Chapter 34 Enteric Viruses
6) Staining the sample preparation with negative stain. To the
drop containing the resuspended pellet, add 1 drop (from a Pasteur
pipet) of 3% phosphotungstic acid (PTA) stain. In this way,
the final PTA concentration of the sample preparation is
approximately 1.5%. The 3% PTA stain is prepared by adding
3 g of PTA in high quality water and adjusting the pH to 7.2-
7.4 with IN potassium hydroxide. The final staining solution can
be filtered through a 0.22-pm filter and stored in a light-proof
container. Proteinaceous material (e.g. antibody, debris) aids in
spreading the sample over the grid. If the sample is relatively
clean of any debris (such as a sample derived from cell culture),
then difficulty in achieving the proper spread of the sample over
the grid may occur. Adding a low percentage of protein (e.g.
0.1% bovine serum albumin) to the diluent may help alleviate this
problem. The sample can be mixed with the stain by pipeting
the preparation up and down with a Pasteur pipet. Place a drop
of the stained preparation onto a 300-or 400-mesh carbon-coated
Formvarg grid. After 1 to 3 min, blot the drop from the grid
using bibulous paper held at one edge of the grid.
7) Viewing the specimen. View the specimen at 80 KV at
magnifications from 30,000 to 60,000. Clumps of virus usually
have from five to hundreds (sometimes thousands) of virus
particles. For descriptions of rotaviruses observed by IEM, see
Theil et al (41) and Saif et al (36).
Strain variability
Rotaviruses are one of the major etiological agents of
gastroenteritis in various species of mammals and birds. In recent
years, avian rotaviruses have been isolated from turkeys, chickens,
guinea fowl and pheasants causing diarrhea and high mortality.
Avian rotaviruses are morphologically identical and antigenically
related to mammalian rotaviruses. Avian rotaviruses contain 11
segments of double stranded (ds) RNA that code for six structural
proteins (VP 1-4, VP6 and VP7) and six non structural proteins
(NSP1-6). Rotavirus particles consist of 3 layers: the central core,
the inner capsid protein and the outer capsid protein. The inner
capsid protein VP6 is the most abundant protein and possesses the
group and subgroup antigens. The complete genomic sequence of
avian rotavirus was reported in 2001 by Ito, et al (17).
Rotaviruses isolated from different species can be distinguished by
the electrophoretic migration patterns (electropherotypes) of their
dsRNA upon agarose gel electrophoresis (44). The characteristic
electropherotypes of rotaviral dsRNA of different specimens can be
used as specific markers of different virus populations. Like
mammalian group A rotaviruses, segments 7, 8 and 9 of avian
group A rotaviruses migrate as a triplet. Unlike their mammalian
counterparts, segment 5 of avian rotavirus migrates very close to
segment 4. Avian electropherogroup A rotaviruses display a 5-1-3-
2 migration pattern, whereas mammalian electropherogroup A
rotaviruses show a 4-2-3-2 pattern, thus permitting a
differentiation of avian and mammalian strains (42, 43). There have
been a lot of improvements in the diagnosis of mammalian
rotaviruses, especially human rotavirus, in recent years but this is
not the case for avian rotaviruses.
Avian rotaviruses can be placed into groups based on serologic
assays such as FA and IEM procedures (see above), and
electropherotyping. Rotaviruses have a genome consisting of
double-stranded RNA with 11 segments. When the genome is
extracted from the virus and subjected to electrophoresis on
polyacrylamide gel, the resulting pattern of bands is referred to as
the virus' electropherotype (see below for procedure). The various
groups of avian rotaviruses have distinctive electropherotypes
(banding patterns). Slight variations of avian rotaviruses within a
group have been observed. This is generally not detected by
serologic assays but is detected by polyacrylamide gel electrophoresis.
Polyacrylamide Gel Electrophoresis of Avian Rotavirus RNA.
The following procedures are used:
Don Reynolds and Ching Ching Wu
1) Preparation of virus. The ability to distinguish visible bands in the
final gel may depend on the amount of background material present in
the virus preparation. Although there are procedures that will assist
in concentrating and purifying the viral RNA (see below), depending
on the situation, it may be advantageous to purify the virus before RNA
extraction in order to decrease unwanted background. Intestinal samples
can be processed as described above (see sample collection). The
resulting sonicated filtrate can be used or further purified by
fluorocarbon extraction. Fluorocarbon extraction can be
accomplished by mixing the sample with cold (4 C) 1,1,2-
trichloro-l,2,2-trifluoroethane (Freon) and homogenizing it
with a high-speed mixer for 2 to 3 min. The resulting mixture can be
centrifuged at 300 to 500 x g to separate the organic from the aqueous
phase. The aqueous phase (top layer) contains virus. The virus
preparation can be further purified by ultracentrifugation techniques
such as pelleting the virus through a layer of sucrose (see above) or
using isopycnic separation.
2) RNA extraction. RNA can be extracted from the virus
preparation by first suspending the virus preparation in a reducing
buffer (2% sodium dodecyl sulfate, 20% glycerol, 4% 2-
mercaptoethanol, 30% urea in tris-glycine buffer). The preparation
can be centrifuged and the supernatant retained. Phenol-chloroform
(3:2) is added to the supernatant and mixed. This mixture is
Toroviruses
PREFERRED CULTURE MEDIA AND SUBSTRATES
There is currently no cell culture system to support Torovirus
growth, and the virus cannot be propagated in chicken embryos, but
can be propagated by inoculating 24-25 day-old turkey embryos by
the amniotic route (1).
AGENT IDENTIFICATION
Stunting syndrome is an enteric disease of turkeys causing
diarrhea, reduced weight gain, poor feed efficiency, and
malnutrition. Infection usually occurs around 1-3 wk of age.
Chickens are refractory to infections by turkey torovirus, this
characteristic aids in differentiating them from other enteric
pathogens such as TCoV. Torovirus has been proposed to be the
stunting syndrome agent (SSA) based on infection of turkey
embryos following amniotic inoculation with filtrate from intestinal
cultures passed through a 0.1 micron filter. Electron microscopy of
intestinal fluid and epithelial cell lysate has identified pleomorphic
enveloped virus particles of 60-95 nm diameter (2, 3). Loss of
infectivity with ether treatment confirms that the virus is enveloped.
The viral genome is thought to be positive-sense, single-stranded
RNA due to the sensitivity of genomic nucleic acid to RNAse
treatment, and amplification of genome by reverse-transcriptase-
polymerase chain reaction but not by polymerase chain reaction.
Torovirus haemagglutinates rat erythrocytes at 4 C and at room
temperature.
Fluorescent antibody assay. A FA assay has been developed for
detecting Torovirus in intestinal tissues (33). The FA assay uses
convalescent antiserum from turkeys inoculated with SSA. There
has also been an indirect fluorescent antibody (IFA) assay
developed for detecting serum antibodies to SSA. SSA can be
detected in experimental infections between 2-3 days PI. Peak FA
scores were seen 3 days PI and began to wane by 4 days PI.
Specificity was 95% and sensitivity was 100%. Seroconversion to
SSA starts at around 7 days PI and all birds have seroconverted by
12 days PI.
162
centrifuged as before. The top layer contains the extracted RNA and
can be used for electrophoresis. Additional techniques to purify
the RNA may include cold ethanol precipitation, and CF 11 cellulose
chromatography; see Theil (40,41).
3) Electrophoresis of RNA. The amount of sample needed and the
conditions that can be used during electrophoresis are largely
dependent on the method and type of equipment being used.
Standard-sized gels, mini gels, and Phast® gels (Pharmacia Co,
Piscataway, NJ) have been used successfully. Conventional
standard-size gels, using a vertical gel apparatus, generally require 20
μΐ of sample, whereas the Phast® system requires 2 μΐ.
Conventional vertical gels can be run for 4 to 5 hr at 40
mA using 7.5% polyacrylamide gels. Phast® gels can be run
at 12 mA for 175 volt-hours (about 1 h) using 10-15%
polyacrylamide gradient gels. These two methods are a contrast
between the largest/slowest and smallest/fastest techniques that
will allow for reasonable results. The method and parameters used
must be determined by the user.
4) Staining the gel. The staining method most commonly used for
dsRNA viruses is the silver staining method. For further information,
see Theil (40, 42) and Phastsystem development technique file No.
210 available from Pharmacia.
SEROLOGIC DETECTION IN THE HOST
Dot-immunobinding avidin-enhanced ELISA
Toroviruses react specifically in this assay with anti-sera from
turkeys infected with torovirus but not with antisera against a range
of common veterinary pathogens such as bovine coronavirus, avian
IBV , Newcastle disease virus, and transmissible gastroenteritis
virus of swine (2,3). Likewise the following viral agents have been
found not to react with anti-serum from turkeys infected with
torovirus: turkey coronavirus, bovine coronavirus, bovine Breda-1
virus, bovine Breda-2 virus, avian IBV, avian influenza virus,
Newcastle disease virus, and transmissible gastroenteritis virus of
swine (2,3).
Virus neutralization
A virus neutralization assay has been developed in 24-25 day old
turkey embryos. Virus infection was assayed according to the
presence of intestinal lesions and by maltase release assay (1).
Briefly, turkey embryos were inoculated with turkey torovirus plus
antisera via the amniotic cavity at 24-25 days of incubation. The
jejunal maltase activity of the torovirus-inoculated turkey embryos
and the intestinal lesions (intestines from the infected turkey
embryos were pale, thin walled, and distended with fluid) were used
as indicators of viral infection (or lack thereof = viral neutralization)
when compared to positive control embryos (virus only, no antisera,
contained in the inoculum) and negative control embryos (no virus,
PBS only in the inoculum).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
The enteric viruses can be differentiated from each other using the
characteristics and techniques described above. Additionally, other
nonviral agents must also be considered when attempting to diagnose
enteric diseases in young birds. Both infectious and noninfectious
agents need to be considered. Examples of infectious agents include
protozoal agents (e.g., Eimeria, Cryptosporidia, Hexamita) and
bacterial agents (e.g., Salmonella spp.). Examples of noninfectious
agents may include toxins, and nutrients (deficiencies and excesses).
Enteric disease is a complex disease entity that may have a complex
etiology. Therefore, numerous agents (both viral and nonviral) may be
involved.

REFERENCES
1. Ali, A., and D. L. Reynolds. The in vitro propagation of stunting
syndrome agent. Avian Dis. 42:657-666. 1998.
2. Ali, A., and D. L. Reynolds. Characterization of the stunting syndrome
agent: physicochemical properties. Avian Dis. 44:426-433. 2000.
3. Ali, A., and D. L. Reynolds. Characterization of the stunting syndrome
agent: relatedness to known viruses. Avian Dis. 44:45-50, 2000.
4. Barnes, H. J., and J. S. Guy. Poult enteritis-mortality syndrome. In:
Diseases of Poultry, 11th ed. Y. M Saif, H. J. Barnes, J. R. Glisson, A. M
Fadly, L. R. McDougald, and D. E. Swayne, eds. Iowa State Press, Ames. Iowa,
pp. 1171-1180. 2003.
5. Baxendale. W, and T. Mebatsion. The isolation and characterisation of
astroviruses from chickens. Avian Pathol. 33:364-370. 2004.
6. Behling-Kelly, E., S. Schultz-Cherry, M Koci, L. Kelley, D. Larsen, and
C. Brown. Localization of astrovirus in experimentally infected turkeys as
determined by in situ hybridization. Vet. Pathol. 39:595-598, 2002.
7. Breslin, J. J., L. G. Smith, H. J. Barnes, and J. S. Guy. Comparison of
virus isolation, immunohistochemistry, and reverse transcriptase-polymerase
chain reaction procedures for detection of turkey coronavirus. Avian Dis.
44:624-631. 2000.
8. Breslin, J. J., L. G. Smith, and J. S. Guy. Baculovirus expression of
turkey coronavirus nucleocapsid protein. Avian Dis. 45:136-143. 2001.
9. Dea, S., G. Marsolais, J. Beaubien, and R. Ruppanner. Coronaviruses
associated with outbreaks of transmissible enteritis of turkey in Quebec:
hemagglutination properties and cell cultivation. Avian Dis. 30:319-326.
1986.
10. Dea, S., and P. Tijssen. Identification of the structural proteins of turkey
enteric coronavirus. Arch. Virol. 99:173-186,1988.
11. Dziuk, Η. E., O. A. Evanson, and C. T. Larson. Physiologic effects of
fasting and bluecomb in turkeys. Am. J. Vet. Res. 30:1045-1056. 1969.
12. Gardner, P. S. Immunofluorescence. In: Clinical
Virology Manual. S. Specter and G. J. Lancz eds. Elsevier
Science Publishing Co., New York. pp. 95-109. 1986.
13. Guy, J. S., L. G. Smith, J. J. Breslin, and S. Pakpinyo. Development of a
competitive enzyme-linked immunosorbent assay for detection of turkey
coronavirus antibodies. Avian Dis. 46: 334-441. 2002.
14. Guy, J. S., A. M Miles, L. Smith, F. J. Fuller, and S. Schultz-Cherry.
Antigenic and genomic characterization of turkey enterovirus-like virus
(North Carolina, 1988 isolate): identification of the virus as turkey astrovirus
2. Avian Dis. 48:206-11. 2004.
15. Hayhow, C. S., and Y. M. Saif. Development of an antigen-capture
enzyme-linked immunosorbent assay for detection of enterovirus in
commercial turkeys. Avian Dis. 37: 375-379. 1993.
16. Hayhow, C. S., Y. M Saif, K. MKerr, and R. E. Whitmoyer. Further
observations on enterovirus infection in specific-pathogen-free turkey
poults. Avian Dis. 37. 124-134. 1993.
17. Ito, Η., M Sugiyama, K. Masubuchi, Y. Mori, and N. Minamoto.
Complete nucleotide sequence of a group A avian rotavirus genome and a
comparison with its counterparts of mammalian rotaviruses. Virus Res.
75:123-38. 2001.
18. Koci, M D., B. S. Seal, and S. Schultz-Cherry. Molecular
characterization of an avian astrovirus. J. Virol. 74:6173-6177. 2000.
19. Koci, M D., B. S. Seal, and S. Schultz-Cherry. Development of an RT-
PCR diagnostic test for an avian astrovirus. J. Virol. Methods 90:79-83.
2000.
20. Koci, M D., S. Schultz-Cherry. Avian astroviruses. Avian Pathol.
31:213-227. 2002.
21. Lin, T. L., C. C. Loa, S. C. Tsai, C. C. Wu, T. A. Bryan, H. L. Thacker,
T. Hooper, and D. Schrader. Characterization of turkey coronavirus from
turkey poults with acute enteritis. Vet. Microbiol. 84:179-186. 2002.
22. Lin, T. L., C. C. Loa, C. C. Wu, T. A. Bryan, T. Hooper, and D.
Schrader. Antigenic relationship of turkey coronavirus isolates from
different geographic locations in the United States. Avian Dis. 46:466-472.
2002.
23. Lin, T. L., C. C. Loa, and C. C. Wu. Complete sequences of 3’ end
coding region for structural protein genes of turkey coronavirus. Virus Res.
106:61-70. 2004.
24. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, H. L. Thacker, T. Hooper,
and D. Schrader. Detection of antibody to turkey coronavirus by antibody­
capture enzyme-linked immunosorbent assay utilizing infectious bronchitis
virus antigen. Avian Dis. 44:498-506. 2000.
25. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, H. L. Thacker, T. Hooper,
and D. Schrader. 2001. Humoral and cellular immune responses in turkey
poults infected with turkey coronavirus. Poultry Sci. 80:1416-1424. 2001.
163
Chapter 34 Enteric Viruses
26. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, T. Hooper, and D.
Schrader. Expression and purification of turkey coronavirus nudeocapsid
protein in Escherichia coli. J. Virol. Methods 116:161-167. 2004.
27. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, T. Hooper, and D.
Schrader. Differential detection of turkey coronavirus, infectious bronchitis
virus, and bovine coronavirus by a multiplex polymerase chain reaction. J.
Virol. Methods 131:86-91. 2006.
28. Loa, C. C., T. L. Lin, C. C. Wu, T. A. Bryan, T. Hooper, and D.
Schrader. Comparison of 3’ End Encoding Regions of Turkey Coronavirus
Isolates from Indiana, North Carolina, and Minnesota. Intervirol. 49:230-
238. 2006.
29. McNulty, M. S. Viral enteric infections. Rotavirus infections.
In: Diseases of Poultry,
11th ed. Y. M Saif, H. J. Barnes, J. R. Glisson, A. M Fadly, L. R. McDougald,
and D. E. Swayne, eds. Iowa State Press, Ames. Iowa. pp. 308-320. 2003.
30. McNulty, M. S., and J. S. Guy. Viral enteric infections.
Avian enteroviruslike viruses. In: Diseases of Poultry, 11th ed. Y. M
Saif, H. J. Barnes, J. R. Glisson, A. M Fadly, L. R. McDougald, and D. E.
Swayne, eds. Iowa State Press, Ames. Iowa pp. 308-320.2003.
31. McNulty, M S., W. L. Curran, D. Todd, and J. B. McFerran. Detection
of viruses in avian faeces by direct electron microscopy. Avian Pathol.
8:239-247. 1979.
32. Patel, B.L., D. R. Deshmukh, and B. S. Pomeroy. Fluorescent antibody
test for rapid diagnosis of coronaviral enteritis of turkeys (bluecomb). Am. J.
Vet. Res. 36:1265-1267. 1975.
33. Reynolds, D. L., J. Oesper, A. Ali. The fluorescent antibody and
indirect fluorescent antibody assays for diagnosing stunting syndrome of
turkeys. Avian Dis 44:313-317. 2000.
34. Reynolds, D. L., and S. L. Schultz-Cherry. Astrovirus infections. In:
Diseases of Poultry, 11th ed. Y. M Saif, H. J. Barnes, J. R. Glisson, A. M
Fadly, L. R. McDougald, and D. E. Swayne, eds. Iowa State Press, Ames. Iowa,
pp. 320-326. 2003.
35. Saif, Y. M. Viral enteric infections. Introduction. In: Diseases of
Poultry, 11th ed. Y. M Saif, H J. Barnes, J. R. Glisson, A. M Fadly, L. R.
McDougald, and D. E. Swayne, eds. Iowa State Press, Ames. Iowa. pp. 299-
300. 2003.
36. Saif, L. J., Y. M Saif, and K. W. Theil. Enteric viruses in diarrheic
turkey poults. Avian Dis. 29:798-811. 1985.
37. Sellers, H. S., M D. Koci, E. Linnemann E, L. A. Kelley, S. Schultz-
Cherry. Development of a multiplex reverse transcription-polymerase chain
reaction diagnostic test specific for turkey astrovirus and coronavirus. Avian
Dis. 48:531-539, 2004.
38. Spackman, E., D. Kapczynski, and H. Sellers. Multiplex real-time
reverse transcription-polymerase chain reaction for the detection of three
viruses associated with poult enteritis complex: turkey astrovirus, turkey
coronavirus, and turkey reovirus. Avian Dis. 49:86-91. 2005.
39. Tang, Y., and Y. M Saif. Antigenicity of two turkey astrovirus isolates.
Avian Dis. 48:896-901. 2004.
40. Theil, K. W. A modified genome electropherotyping procedure
for detecting turkey rotaviruses in small volumes of intestinal contents.
Avian Dis. 31:899-903. 1987.
41. Theil, K. W., D. L. Reynolds, and Y. M. Saif. Isolation and
serial propagation of turkey rotaviruses in a fetal rhesus monkey kidney
(MA104) cell line. Avian Dis. 30:93-104. 1986.
42. Theil, K. W., D. L. Reynolds, and Y. M. Saif. Genomic variation
among avian rotavirus-like viruses detected by polyacrylamide gel
electrophoresis. Avian Dis. 30:829-834. 1986.
43. Wani, S. A., M A. Bhat, S. M Ishaq, M A. Ashrafi, A. S. Buchh, and
M Haq. Detection of a mammalian-like group A rotavirus in diarrhoeic
chicken. Vet. Microbiol. 94:13-18. 2003.
44. Yason, C. V., and K. A. Schat. Isolation and characterization of avian
rotaviruses. Avian Dis. 29: 499-508. 1985.
45. Velayudhan, B. T., H. J. Shin, V. C. Lopes, T. Hooper, D. A.
Halvorson, and K. V. Nagaraja. A reverse transcriptase-polymerase chain
reaction assay for the diagnosis of turkey coronavirus infection. J. Vet.
Diagn. Invest. 15:592-596. 2003.
46. Wu, C.C., M Abdelwahab, C. C. Loa, T. A. Bryan, T. Hooper,and T. L.
Lin. Recombinant partial turkey coronavirus spike protein in antibody­
capture enzyme-linked immunosorbent assay for detection and
differentiation of antibody to turkey coronavirus. In: Proceedings of the 56th
North Central Avian Disease Conference. St. Paul, Minnesota, March, 2005.
p.80.
 35
ONCORNAVIRUSES
LEUKOSIS/SARCOMAS AND RETICULOENDOTHELIOSIS
Aly M. Fadly, Richard L. Witter and Henry D. Hunt

SUMMARY. Avian leukosis virus (ALV), and reticuloendotheliosis virus (REV) are the most common naturally occurring avian
oncornaviruses associated with neoplastic disease conditions in poultry. ALV infects primarily chickens, whereas REV infects chickens,
turkeys, ducks, geese, pheasants, quail, and probably many other avian species. In addition to causing tumors, both ALV and REV can reduce
productivity and induce immunosuppression and other production problems in affected flocks. No vaccines that protect chickens and turkeys
from infection with ALV or REV are available commercially.
Agent Identification A number of biological assays can be used for the detection of ALV and REV infection. Virologic and serologic
criteria, such as assays for virus, antigens or antibodies are very useful in identification and classification of new isolates, surveillance of
pathogen-free and other breeder flocks for freedom of virus infection, establishing infection with one virus and excluding others, and in
safety testing of vaccines. However, such virologic and serologic assays are not particularly helpful in the differential diagnosis of virus-
induced neoplastic diseases of poultry because avian oncogenic viruses are ubiquitous and infection in the absence of tumor formation is
common. Current technology based on molecular hybridization or immunocytochemistry with monoclonal antibodies to cellular and tumor
specific antigens is being used to develop more sensitive and specific procedures for the differential diagnosis of virus-induced avian
neoplasms.
Serological Detection in the Host. Antibodies to ALV can be detected using virus neutralization, Rous Sarcoma Virus-focus reduction
assay or micro-neutralization ELISA. For REV, IFA, flow cytometry, ELISA, AGP, and VN can be used.

INTRODUCTION development of LL in certain lines of chickens following exposure

Lymphoid leukosis (LL), formerly called "big liver disease" or
"visceral lymphomatosis," is caused by ALV. It is the most
common naturally occurring neoplastic disease of chickens induced
by the leukosis/sarcoma (L/S) group of avian oncornaviruses (19).
In early 1990’s, a novel subgroup (J) ALV was found to be
associated with a relatively high incidence of myelocytomatosis in
meat-type chickens (36). ALV is transmitted congenitally or by
contact and occurs worldwide in almost all chicken flocks. Stress or
immunodepression can increase the susceptibility of chickens to
ALV infection and shedding.
Reticuloendotheliosis (RE) designates a group of disease
syndromes caused by the REV group of avian oncornaviruses (62).
The most common clinical diseases are chronic lymphomas and a
runting disease. However, an acute reticulum cell neoplasia can be
induced by a laboratory strain (strain T) that is a mixture of an
oncogene-containing replication-defective virus and a nondefective
helper virus (59). Infection of chicken flocks with REV is
moderately prevalent, but clinical disease is rarely recognized. The
virus is transmitted both vertically and horizontally, and by
inoculation with contaminated biologicals.
Comprehensive reviews on L/S and REV groups of avian
oncornaviruses are available (19, 62).
CLINICAL DISEASE
to ALV after hatch (3,21).
Natural infection with REV seldom results in clinical disease in
chickens. In turkeys, mortality first occurs between 12 and 20 wk of
age. Lymphomas are found in the liver, intestine, heart, and other
visceral organs. Nerves are occasionally enlarged (62). The
neoplastic cells are large and uniform, but their lineage has not been
characterized. However, in a recent outbreak of RE in commercial
turkeys, the tumor cells were identified as T-cell lymphomas (8). In
chickens inoculated at hatching with biologicals contaminated with
REV, a runting disease may develop within 2-3 wk: it is
characterized by bursal and thymic atrophy, retarded growth,
abnormal feather development, and severe immunodepression. An
outbreak of lymphomas was reported in broiler breeder flocks that
had been vaccinated at 6 days of age with a fowlpox vaccine
contaminated with REV (22).
Experimental infection of chickens with REV induces two types of
lymphomas: a bursal lymphoma of B-cell origin that is
pathologically identical to lymphoid leukosis, and a nonbursal
lymphoma of T-cell origin that superficially resembles that of MD
(62). The response varies greatly with the strain of virus, dose, route
of exposure, and species of bird. Because the lesions are usually not
pathognomonic, a diagnosis of clinical disease must be based on
pathologic criteria plus virologic or serologic evidence of infection.
Serotype 2 MD vaccines were also found to enhance the
development of REV-induced B-, but not T-cell lymphoma (2).

In addition to LL and sarcomas, the L/S viruses induce a wide
range of neoplastic conditions, such as osteopetrosis,
hemangiomas, erythroblastosis, nephroblastomas, myeloblastosis,
and myelocytomatosis. The type of tumor is influenced by the
strain of virus; exposure dose; host genotype; and route, sex, and
age at exposure (19). LL, a B-cell lymphoma of chickens, originates
in the follicles of the bursa of Fabricius. Transformed bursa cells
metastasize to the liver, spleen, and other visceral organs (15).
Because the incubation period is relatively long (rarely less than 14
wk), LL is usually a neoplastic disease of breeders and commercial
egg-layers, but not of broilers, roasters, or fryers. The clinical signs
of LL are not specific (19). In advanced cases, enlargement of the
bursa and liver may be detected by palpation. Lesions in liver and
other visceral organs may be diffuse or nodular. Microscopically,
LL is characterized by intrafollicular infiltration of bursal follicles
with tumor cells (19). Marek’s disease (MD) vaccines containing
serotype 2 MD herpesvirus (65) were found to enhance the
164
SAMPLE COLLECTION
Avian Leukosis
Because ALV is ubiquitous in the chicken population, virus
isolation and the demonstration of antigen or antibody have limited
or no value in diagnosing field cases of LL. However, testing for
virus, antigen, or antibody is and has been instrumental in programs
for reducing or eradicating ALV infection. Various materials can
be used to detect virus, antigen, or antibody. Because L/S viruses
are thermolabile it is imperative that materials used for biological
assays for infectious virus be placed on melting ice immediately
after collection and then stored at -70 C until assayed. Samples for
detection of ALV group-specific (gs) antigens are usually collected
in the buffer that is used in a particular test and stored at -20 C.
Samples to be tested by the enzyme-linked immunosorbent assay
(ELISA) are collected in phosphate-buffered saline (PBS)
containing 0.1% Tween 80, whereas samples to be tested by

complement fixation (CF) test are collected in barbital or veronal
buffer.
Whole Blood, Plasma, or Serum. Whole blood or plasma are
most commonly used for virus isolation. Blood can be drawn in
sterile syringes containing 50 units of preservative-free heparin/ml.
Heparin may interfere with the replication of ALVs other than
subgroup A. Other anticoagulants (such as 10% [vohvol] of a 3.5%
sodium citrate solution) may be used, or blood for serum can be
collected in tubes containing 0.1-0.2 ml of 25% heat-inactivated
chicken embryo extract (from embryos known to be free from
ALV) to enhance clotting. Blood should be placed on melting ice as
soon as possible after clotting. Whole blood should be shipped on
ice-cold packs immediately after collection and should not be
frozen. Samples of plasma or serum for virus isolation should be
shipped on dry ice. To avoid interference by neutralizing antibodies,
ALV should preferably be isolated from fresh samples of
leukocytes or whole blood. If delay is necessary, tissue culture (TC)
medium containing 10% dimethylsulfoxide and 15% bovine serum
should be added to the samples, and then the samples should be
slowly frozen and stored at -196 C.
Plasma or serum samples are unsuitable for detection of
exogenous ALV by testing for gs antigen, as endogenous gs antigen
may lead to false-positive results (37).
Meconium and Cloacal or Vaginal Swabs. Meconium from 1-
day-old chicks and cloacal or vaginal swabs from older chickens
can be used to isolate virus or to detect gs antigen (19). Cloacal
swabs are obtained by rotating a sterile cotton swab about five times
in the cloaca. Care should be taken to make sure that the mucosal
surface of the cloaca is swabbed and not to allow excess fecal
material to adhere to the swab. Vaginal swabs are taken by everting
the cloaca as for artificial insemination.Vaginal swabs are not used
to test non-laying hens because the cloaca of such hens is not
readily everted. For virus isolation, the swab is placed in a tube
containing TC medium supplemented with 1000 units of penicillin-
G and streptomycin sulfate, 100 pg gentamicin sulfate, and 5 pg
amphotericin B per ml. Meconium for virus isolation can be
collected by placing a tube containing 1 ml of such TC medium at
the cloacal opening and gently squeezing the abdomen. Before
testing, solid materials should be removed from samples of
meconium by centrifugation at 2000 rpm for 10 min.
Albumen. Albumen can be used for detection of virus or gs
antigen (55). Testing albumen for gs antigen is the most sensitive
and practical means of identifying hens that are likely to transmit
ALV congenitally. Samples of thin albumen can be drawn with a
syringe or Pasteur pipette through a hole punched into the small end
of an unincubated egg. For virus assays, albumen should be
collected from eggs within 48 h of laying. In most cases, hens are
screened for ALV shedding by testing albumen for gs antigen from
two to three consecutively laid eggs per hen. However, identifying
intermittent shedder hens may depend on the frequency of testing
and the number of eggs tested per hen. If eggs are to be hatched, 0.3
ml of albumen can be collected. Techniques should be aseptic, and
the hole should be sealed with paraffin wax, adhesive tape, or
model cement. To facilitate work with albumen, it should be diluted
two-to-four-fold in the buffer to be used in the test. ALV gs antigen
is stable in egg albumen for at least 63 days at 8 C.
Chicken Embryos. Virus recovery from extracts of chicken
embryos is closely associated with congenital transmission of ALV.
However, samples of albumen, blood, and cloacal or vaginal swabs
are easier to handle than embryos. Embryo extracts are prepared by
expressing 9-to-l 1-day-old embryos through a 5-ml syringe and
into 1 ml of PBS. The suspension is frozen and thawed three times
and then clarified by centrifugation at 2000 rpm for 20 min. The
supernatant is used for virus isolation or for detection of gs antigen.
Tumors and Other Tissues. Some tumors may contain large
amounts of virus, but others may contain no detectable virus.
165
Chapter 35 Oncornaviruses Leukosis/Sarcomas and Reticuloendotheliosis
Tumors removed aseptically should be tested fresh or frozen at or
below -70 C. A 5-10% tumor homogenate in PBS or TC medium
can be used for virus isolation or for detection of gs antigen.
However, isolation of ALV from a tumor does not necessarily
suggest a causal relationship between the virus and the tumor, as all
commercial flocks and most chickens in a flock are exposed to
ALV. Histopathology is the most commonly used procedure to
diagnose and differentiate tumors.
Other tissues, such as comb from newly hatched chicks and feather
tips, can be used for detection of gs antigen, although testing of
these materials has been compared with other test procedures only
on a limited scale (10). Feather tips are collected in tubes containing
the buffer to be used in the assay and then disrupted with a tight-
fitting Teflon pestle. The homogenate should be sonicated or frozen
and thawed three times before testing. Liver and magnum of
oviduct collected from freshly killed chickens are considered to be
rich sources of virus (19). Also, recently, feather tips have been
shown to contain a high titer of ALV (56).
Reticuloendotheliosis
The preferred samples for REV isolation are preparations of whole
blood, fresh spleen, and tumor tissue containing intact live cells
from birds of any age with suspect lesions. Cellular inocula can be
stored for several hours at 4 C or for longer periods at -70 C or -196
C after slow freezing in TC medium containing 15% bovine serum
and 10% dimethylsulfoxide. Although virus can be recovered from
plasma and tissue extracts, such cell-free samples are inferior to
cellular preparations because the virus is relatively labile and the
titers of such preparations are often tow. Whole blood is collected
with heparin (50 units/ml) and used undiluted. Because of the ease
with which it is collected and handled, whole blood or blood
lymphocytes are usually the tissue of choice for virus isolation.
For the isolation of REV from tissues, about 1-2 g of spleen or
tumor tissue is collected aseptically, placed in 10-20 ml of TC
medium, gently minced with scalpels or sharp scissors, passed
repeatedly through the barrel of a 10-ml syringe, and filtered
through two layers of sterile gauze. The filtrate is then centrifuged,
and one volume of packed cells (pellet) is resuspended in about nine
volumes of TC medium.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Avian Leukosis
Cell Culture. Unlike sarcoma viruses, most ALVs produce no
visible morphologic changes in culture. Thus, indirect biologic
assays such as complement fixation (CF) for avian leukosis
(COFAL) (46), enzyme-linked immunoabsorbent assay (ELISA) for
ALV (ELISA-ALV) (9, 51), phenotypic mixing (PM) (35),
resistance-inducing factor (RIF) (42), and non-producer (NP) cell
activation (41) tests are used for the detection of ALVs. ELISA-
ALV is the more commonly used test for detection of ALV, because
it is more sensitive and less cumbersome than other tests such as the
COFAL and PM tests. These assays require the use of chicken
embryo fibroblasts (CEFs) with specific host range (Table 1). The
COFAL and ELISA-ALV assays are performed in two phases: 1)
propagation of ALV in CEFs; and 2) detection of ALV gs antigen
by COFAL or by ELISA-ALV.
In addition to the standard ELISA and CF test reagents obtainable
from several commercial sources, both tests require the following
specific reagents: 1) ALV-susceptible CEFs that are free from
endogenous ALV and gs antigen; 2) reference stock of gs antigen,
which may be obtained from CEFs infected with ALV or Rous
sarcoma virus (RSV); 3) highly specific antisera to L/S viral gs
antigen prepared in hamsters or rabbits (19), (monoclonal
antibodies against p27 have been shown to enhance specificity and
sensitivity of the test used to detect gs antigen [14]); and 4) known
Aly M. Fadly, Richard L. Witter and Henry D. Hunt
Table 35.1 Phenotype of CEFs used for detection of exogenous and endogenous AL Vs.
CEFs/ line PhenotvneA
0 C/E
15B1 C/O
alv6B C/AC/E
31V6X15B, C/A
DF-l/J C/E,C/J
RFS
** C/O
aC/E = cells resistant to subgroup E ALVs; C/O = cells susceptible to all subgroups of ALVs.
C/A = cells resistant to subgroup A ALVs; DF-l/J = cells resistant to subgroup E and J ALVs (28).
b= Because alphas line 0 background, cells are also resistant to subgroup E (endogenous) ALV.
*♦= Rapid-Feather Susceptible line (RFS), it is susceptible to all subgroups, but lacks all endogenous virus genes.
ALV or RSV seed stock. Some of these reagents can be obtained
from commercial sources (see appendix).
Reticuloendotheliosis
Cell Culture. Most methods for diagnosis of REV infection by
virus isolation are designed to recover nondefective viruses. This
can be accomplished by propagation of cellular inocula for 9-14
days in avian fibroblast cultures and subsequent demonstration of
viral antigens or the enzyme reverse transcriptase.
Most, and perhaps all, field strains of REV can be easily
propagated in avian cell cultures. Secondary cultures of CEFs are
normally used, although cultures of chicken kidney, duck embryo
fibroblasts, turkey embryo fibroblasts, or quail embryo fibroblasts
are also suitable. Because REV can be transmitted vertically,
embryos should be from breeders free of infection. The QT-35 cell
line, composed of chemically transformed quail fibroblasts, is also
susceptible to infection (7).
For primary isolation, undrained cultures in 35 or 60-mm dishes
with confluent monolayers are inoculated, usually within 6-24 h
after plating, with 0.1 ml of a cellular test sample; cell-free samples
should be inoculated onto drained cultures to which medium is
added after adsorption for 30 min. The cultures are maintained for
7-9 days at 38 C with the first medium change at 24 h and
subsequent changes at 2-to-3-day intervals. A second passage is
accomplished by placement of supernatant fluid into a new culture
maintained in a 35-mm dish (0.5 ml per plate) or a 96-well plate
(0.1 ml per well), which is maintained for 5-7 more days. Controls
include cultures inoculated with a prototype nondefective virus such
as strains T or CS, and uninoculated cultures. It is prudent to use
several uninoculated cultures spaced randomly among test cultures
to monitor adventitious spread of REV, which can be a problem if
cultures are not handled with care.
AGENT IDENTIFICATION
Physiochemical Properties
Avian Leukosis Avian L/S viruses contain a core of two single­
stranded RNA copies (19). They are about 60% protein by weight
and are made up of internal protein, reverse transcriptase, and
envelope proteins. About 35% is lipid derived from the cell
membrane and 4% carbohydrate associated with envelope proteins.
The specific gravity of the virus is 1.16. These viruses are sensitive
to lipid solvent and low pH and are highly resistant to ultraviolet
radiation (19). Because the L/S viruses are thermolabile, long-term
storage without loss of infectivity is possible only below -60 C.
Morphologically, the avian L/S viruses are classified as C-type
particles with a diameter 80 to 100 nm. Members of the avian L/S
virus group cannot be differentiated on the basis of ultrastructure.
Avian L/S viruses contain a serologically unique reverse
transcriptase and a group specific (gs) antigen demonstrable by CF
166
Susceptibility to L/S subgroups
Susceptible Resistant to
A,B,C,D,J E
A B, C, D, J, E
B, C, D, J AE
B, C, D,J ,E A
A B, C, D E,J
A B, C, D, E, J
or ELISA (see section on Preferred Culture Media and Substrates).
Based on properties of viral envelope glycoproteins, members of
L/S group including ALVs from chickens are classified into six
subgroups, A, B, C, D, E, and J (19). Unlike the acute leukemia
viruses of L/S group, exogenous ALVs (belonging to subgroups A,
B, C, D and J) and endogenous ALVs (subgroup E) are not
defective and lack host oncogenes (19). Among the structural
polypeptides (p27, pl9, pl5, pl2, and plO) shared by all members
of die L/S group of avian oncornaviruses including endogenous and
exogenous ALVs, p27 is the most abundant. Techniques for
detecting ALV infection have largely been based on assays for virus
or viral antigen rather than on assays for antibody. In addition to
ELISA and CF tests, immunocytochemical staining procedures such
as immunofluorescence, immunoperoxidase anti-peroxidase, or
protein A-gold can be used to detect gs antigen associated with
ALV particles in sections of various tissues (19, 26). These
procedures also require the use of specific anti-p27 IgG.
Direct ELISA or the CF test can be used for detection of gs
antigen in samples of albumen, cloacal swabs, meconium, whole
blood, or feather pulp. ELISA is preferred over the CF test for
testing virus-rich samples such as cloacal swabs, meconium, or
blood that are unsuitable for testing by CF because of
anticomplement (AC) activity (18).
Reticuloendotheliosis. The properties of REV are typical of
oncornaviruses (62). The virions are about 100 nm in diameter and
bud from the plasma membrane. The particles band at 1.16-1.18
g/cm3 in sucrose gradients. The RNA genome of replication
competent strains is about 9.0 kilobases. Several polypeptides have
been isolated, including two glycoproteins (gp90 and gp20) and five
others (plO, pl2, ppl8, pp20, and p30), of which p30 is the major
gs antigen. The particles also contain a reverse transcriptase.
Biological Identification
Avian Leukosis Enzyme-Linked Immunosorbent Assay
for Avian Leukosis Virus The ELISA-ALV consists of two phases;
virus propagation in CEFs and assay for ALV presence by testing
supernatant fluid for gs antigen by ELISA.
For propagation of exogenous ALVs (subgroups A, B, C, D and J),
CEFs resistant to subgroup E ALV (C/E) are used. For assays of
endogenous viruses, cells that are susceptible to infection with
subgroup E ALV are used.
1) Suspend cells in TC medium at a concentration of 2.5 X 10^/ml.
2) To the cell suspension, add DEAE-Dextran, or polybrene (see
appendix) to a final concentration of 2 pg/ml.
3) Transfer 2 ml of cell suspension to 35-mm plates; other suitable
culture dishes, such as 24 or 48-well microtiter TC plates, can be
used.

4) Test one 35-mm plate per sample, plus one plate per dilution of
1 6
control ALV being titrated (usually six plates; 10’ to 10’ ) of the
prototype ALV, such as RAV-1 in the case of testing subgroup A
viruses. In the case of testing unknown samples, two plates for each
of other subgroups (B, C, D and J) of ALV are also included.
5) On the next day, add 100 μΐ of sample being tested to TC
medium in the corresponding plate; samples can also be added to
the plates on the same day the cells are cultured. Stir inoculum into
medium by gently rotating each tray holding plates.
6) Change medium 24 h after samples are added.
7) Maintain cultures for 7-9 days after inoculation. A second change
of medium is not necessary if cultures are maintained for 7 days
only.
8) If the objective of the assay is to isolate virus, collect 1 ml of
supernatant fluid from all test plates into sterile tubes and save at -
70 C until results of ELISA are available.
9) Add 80 μΐ of 5% Tween-80 to each 35-mm plate; freeze and
thaw cell suspension two times before testing for ALV gs antigen
by ELISA.
For the assay for ALV gs antigen by ELISA, precoated ELISA
plates or kits for detection of ALV gs antigen are available from
various commercial sources (see appendix). ELISA plates for
detection of ALV gs antigen can also be prepared in the laboratory
using commercially available rabbit anti-p27 immunoglobulin G
(IgG). Add 100 μΐ of a 1:1000 dilution (or as recommended by the
manufacturer) of rabbit anti-p27 in carbonate buffer (pH 9.4) to
each well of the ELISA plates. Incubate the plates at room
temperature (25 C) overnight and then store them at 4 C. Plates
coated in the laboratory should not be stored for more than 10 days.
If samples are to be tested by commercial ELISA kits, follow the
instructions provided by die manufacturer. Otherwise, the
following general procedure is recommended for ELISA for ALV:
10) Decant coating solution and drain plates; then wash them three
times with 0.1% Tween-80 in PBS.
11) To minimize nonspecific binding and consequently high
background, 100 μΐ of 5% instant nonfat dry milk in PBS (31) or
1% bovine serum albumin in PBS can be added to each well to
block reacting surface before adding test samples to plates; allow
these blocking agents to incubate for 30 min at 25 C.
12) Add 100 μΐ of test material to each well in the ELISA plate.
Include in each plate wells for known positive and negative
samples, as well as for a reading blank.
13) Incubate for 1 h at 38-40 C.
14) Carefully decant material from plates and drain; wash three
times with 0.1% Tween-80 in PBS.
15) Add 100μ1 of conjugate (peroxidase-conjugated rabbit anti-p27
IgG) to each well. The dilution of conjugate should be determined
by titration or as recommended by the manufacturer.
16) Incubate for 1 h at 38-40 C.
17) Decant conjugate and drain plates; wash three times with 0.1%
Tween-80 in PBS.
18) Add 100μ1 of a freshly prepared enzyme substrate, such as 5
amino salicylic acid in 0.2 M phosphate buffer (pH 6.0). The color
reaction should develop within 30 min.
19) Read absorbance at 490 nm in an ELISA reader or other
suitable spectrophotometer.
20) Samples with absorbance values of 0.2 units above values of
known negative samples are considered positive.
Phenotypic Mixing (PM) Test. The PM test requires CEFs
susceptible to infection with viruses of subgroup A, B, C, D, J, E
(C/O cells), cells resistant to subgroup E ALV (C/E) and stocks of
RSV (Rous-associated virus-0) (RSV[RAV-0]). All cells must be
from embryos free from exogenous and endogenous ALV.
For virus propagation and phenotypic mixing, the ALV is grown
together with RSV under conditions that optimize phenotypic
mixing. In assaying for the presence of phenotypically mixed RSV,
the RSV with the envelope of the ALV must be detected in a system
167
Chapter 35 Oncornaviruses Leukosis/Sarcomas and Reticuloendothebosis
that does not detect RSV(RAV-0), i.e., in cells genetically resistant
to subgroup E L/S virus (35).
Complement Fixation for Avian Leukosis. The COFAL
test is performed in two stages: virus propagation and assay of ALV
gs antigen by the CF test.
For propagation of exogenous ALV, primary or secondaiy C/E
CEFs lacking endogenous viruses are used. For assaying ALV gs
antigen by CF test, hemolysin, guinea pig complement, and
antiserum to ALV gs antigen are required. The procedures for
titration of hemolysin, complement, and antiserum and for running
the COFAL test have been described (46, 60).
Resistance-Inducing-Factor Test. When susceptible
CEFs are all infected with ALV, the cells become resistant to
transformation induced by RSV of the same subgroup as the ALV
(42). This property of interference has been used extensively for
assay of ALV by the RIF test and also in determining the virus
subgroup (19). The presence of ALV is indicated when the number
of foci induced by a standard stock of RSV on test cells is a tenth or
less of the number of foci on susceptible control cells. Negative and
positive controls should be included in each test.
Non-producer Cell Activation Test. The NP test (41)
requires NP cells that are transformed by a defective strain of RSV
(Bryan high-titer strain) and that do not produce virus detectable in
the usual tests on C/E cells. A Japanese quail cell line transformed
by the envelope-defective Bryan high-titer strain of RSV [R(-)Q]
has been used as a source of RSV genome. Test samples are
inoculated onto genetically susceptible cells, virus-free CEF
cultures that are then co-cultivated with NP cells. Cultures infected
with ALV can be identified by testing the supernatant in cultures or
in chicken embryos for presence of RSV. For exogenous ALV, C/E
cells are co-cultivated with R(-)Q cells, and supernatant is assayed
on C/E cells. The R(-)Q cells can also be used in assays for
endogenous ALV, as well as in assays for chick helper factor (19).
Transformation (Focus) Assay for Sarcoma Viruses.
Avian sarcoma viruses transform spindle-shaped flat CEFs into
spherical and refractile foci that can be enumerated by microscopic
examination of cultures (19). Focus formation by RSV was best
seen in cultures grown in base medium 199 and medium F-10,
tryptose phosphate broth, calf serum, and sodium bicarbonate.
Genetically susceptible monolayer CEF cultures are inoculated with
test material. The next day, medium is decanted and is replaced
with an agar overlay. Cultures should be examined daily for RSV-
induced foci, which usually develop within 4-7 days PI.
Chicken Embryos. Genetically susceptible virus-free chicken
embryos can be used to assay for ALVs, as well as for avian
sarcoma viruses. Embryos infected with ALV by intravenous or
yolk-sac inoculation hatch as normal chicks and later develop
neoplasms, such as erythroblastosis and LL (19).
Avian sarcoma viruses induce characteristic pocks on the
chorioallantoic membrane 8 days after inoculation of 9 to 11-day-
old embryos. This procedure of inoculating the chorioallantoic
membrane with sarcoma virus is commonly used in determining the
genetic susceptibility of chickens to the various groups of the L/S
virus. Embryos inoculated intravenously with sarcoma viruses
usually die from sarcoma and hemorrhage within 4 to 5 days (19).
Chickens. Chickens used for in vivo assays of ALVs must be
free from virus infection and genetically susceptible to the tumor
and virus concerned. Intra-abdominal or intravenous inoculation of
susceptible 1-day-old chicks with ALV usually leads to
development of LL as well as other tumors (19). The time required
for the assay depends on the response to be measured and on the
method used to measure such a response. For example, a LL
response can be obtained within 36 wk based on gross lesions and
mortality, whereas such a response can be measured at 16-18 wk on
the basis of gross and microscopic examinations of the bursa of
Fabricius. Generally, the time required for assay of ALV-induced
Aly M. Fadly, Richard L. Witter and Henry D. Hunt
tumors such as erythroblastosis can be shortened if chickens are
infected during embryonic life (19).
Unlike ALVs, sarcoma viruses do not exist in chicken populations
under natural conditions. The most common route used for in vivo
assay of these viruses is subcutaneous in the wing web. The test
sample (100-200μ1) is inoculated between the two layers of the skin
of tiie wing web of 4 to 6-wk-old chickens. Palpable tumors are
usually formed within 7 to 14 days at the site of inoculation. These
tumors either grow progressively and metastasize, eventually killing
the host, or regress completely, leaving a normal appearing wing
web. Regression is known to be influenced by host age, genotype,
and dose of virus. Chickens that survive RSV-induced tumors may
develop LL because ALVs coexist in most sarcoma virus stocks.
Sensitivity is maximum after 14 days by most procedures,
although high concentrations of virus may be detected after shorter
periods and endpoint assays may be conducted by enzyme
immunoassay within 8-9 days.
Flow Cytometry. Microscopic immunofluorescence is a common
technique used to analyze infected cells for expression of virus
proteins and to screen live animals for serum antibodies induced by
retrovirus infection. Flow cytometry is an extension of the
immunofluorescence technique and has several advantages over
microscopic immunofluorescence evaluation. The main advantage
of flow cytometry is its ability to rapidly quantitate the intensity of
the immunofluorescent staining procedure (28, 33). The flow
cytometer can accurately evaluate 2000 cells per second and thus, in
2 to 5 sec, 5 to 10 thousand cells (events) can be evaluated. The
fluorescent intensity of each event is accurately measured by a
photomultiplier which then assigns each event a fluorescent channel
of intensity based on a log scale ranging from 0 to 10,000 channels.
The fluorescent intensity of 5 to 10,000 events is then presented in
graphic form as a normal distribution. The median channel
fluorescent (MCF) intensity of the normal distribution is then
calculated.
Evaluation of CEFs (Line 0 or DFls) infected with field samples
of ALV by flow cytometry requires essentially the same reagents
used in the virus-neutralization test or the microscopic
immunofluorescence technique. Monoclonal antibodies (45) or
reference convalescent chicken serum containing virus specific
antibodies are used to classify and type ALVs expressed in the
infected tissue culture cells. The subgroup of ALV (A, B, C, D or J)
can be determined using antiserum specific for each subgroup.
Controls used in this process consist of uninfected cells and cells
infected with purified and well characterized laboratory reference
strains of ALVs. Recently, this technique has been shown to be very
valuable in determining the subgroup of an extraneous ALV
isolated from commercial Marek’s disease vaccines (20)
1) Samples are inoculated on 35-mm plates containing susceptible
CEFs as described below for ALV.
2) Control cultures consist of uninfected cells and cells infected
with laboratory reference strains. The control and field sample
cultures are harvested by trypsinization, pelleted by centrifugation
(RCF -300), and resuspended in media.
3) One fourth of the cells are then re-cultured in 35 cm tissue
culture plates for an additional 7 to 9 days to amplify weak samples
(see below).
4) The remainder of the cells are pelleted and resuspended in 1ml
flow cytometry media (FCM), a phosphate buffered saline with 1%
bovine serum albumin and 0.1% sodium azide.
5) 100μ1 of each sample (control and field samples) are then added
to three wells of a 96 well U bottom micro titer plate.
6) The first well of each sample is a media control, the second and
third wells receive control chicken serum or monoclonal antibody
and the virus specific chicken serum or monoclonal antibody,
respectively (final concentration of antibody is 1:50 for chicken
serum and 1:1000 for monoclonal).
168
7) The cells are then incubated at 4 C for 20 min, washed twice by 1
min centrifugations using 200 μΐ FCM, and incubated with an
appropriate dilution of either FITC labeled anti chicken
(convalescent chicken serum) or mouse (monoclonal) antibody for
an additional 15 min at 4 C.
8) After the final incubation, the cells are washed twice in FCM and
analyzed by flow cytometry.
9) The MCF of the control and virus specific antisera signal is then
computed and the results are analyzed using a modified sample to
positive (S/P) ratio.
10) The S/P ratio is calculated by subtracting the MCF obtained
using the negative control serum from the MCF obtained using the
virus specific reference sera for all cells analyzed (positive control
reference virus and field virus infected cultures). The value obtained
from the field virus is then divided by the value obtained from the
positive control culture infected with the reference virus. An S/P
ratio of 0.1 or greater indicates a positive field sample.
Caution must be used in the interpretation of negative or slightly
positive S/P values (0.1 to 0.12). A negative result does not
necessarily confirm the absence of virus in the field sample, it could
simply means the reference antisera used does not recognize the
infecting virus. A classic example is the situation observed for
different strains of ALV-J. Chicken antibody induced by the HPRS-
103 strain of ALV-J recognizes cells infected with HPRS-103 but
not cells infected with the ADOL-Hcl strain. In contrast, chicken
antibody induced by strain ADOL-Hcl of ALV-J recognize cells
infected with both the HPRS-103 and Hcl strains of ALV-J (29).
Another potential pitfall is the possibility of a very low titer of virus
in the field sample. The re-cultured cells from all low and negative
samples should be re-analyzed to confirm the result.
Flow cytometry can also be used to screen flocks for serum
antibody to retroviruses. The techniques are essentially the same.
Sera from the flock in question are applied to tissue culture cells
infected with the reference strains of retroviruses. Uninfected cells
are used as a negative control. As indicated above, the MCF of the
field sera is compared to reference sera to compute a S/P ratio. The
same precautions and pitfalls apply to the interpretation of negative
serum samples as mentioned above. Also, it has been shown that
some serum samples may test positive by flow cytometry, but
negative by virus neutralization (29).
Reticuloendotheliosis. A variety of methods exist for the
demonstration of REV infection in cell cultures. However, the
demonstration of antigens by immunofluorescence or enzyme
immunoassay are probably the methods of choice. Only methods for
detection of nondefective strains of REV will be given in detail.
Immunofluorescence, Anti-REV positive test serum is easily
obtained from convalescent chickens (30), and satisfactory
fluorescein-conjugated anti-chicken globulin serum is available
commercially. Alternatively, mouse monoclonal antibodies (11)
and the corresponding anti-mouse globulin serum can be used.
Sample-inoculated monolayer CEFs grown on 96-well, 35 mm
plates, or on glass-coverslips are drained, rinsed with PBS, and
then fixed for 5 min in a mixture of six parts acetone and four parts
95% alcohol and air dried. The fixed monolayers can be stained
immediately or can be stored at -20 C until tested. For staining, a
standard immunofluorescence technique is used (40).
REV-infected cells have finely granular or diffuse fluorescence
throughout their cytoplasm, but not in the nucleus. It is helpful to
critically compare cultures inoculated with test samples with
positive and negative controls. The use of monoclonal antibodies
facilitates interpretation of the test, because of intense specific
staining and the virtual absence of background.
Flow cytometry. Flow cytometry can also be used to detect
and identify REV isolates. Using REV convalescent and
monoclonal antibodies, the test is conducted in a way similar to that
described above for flow cytometry for ALV.

Enzyme Immunoassay. An immunoassay based on
monoclonal antibodies has been described (12). ELISA plates are
coated with a mixture of monoclonal antibodies 11A25 and 11C237
(11), each at a dilution of 1:1000 in coating buffer; plates are then
incubated overnight at room temperature (see ELISA-ALV test).
For the test, wells are treated with 0.1 ml of test samples following
two freeze-thaw cycles to release antigen. The test is conducted in a
way similar to that described above for ELISA-ALV using an
appropriate dilution of a rabbit anti-REV serum and peroxidase-
labeled anti-rabbit IgG conjugate as the primary and secondary
antibodies, respectively.
At present, reagents for this test are not commercially available.
The rabbit serum may be produced by inoculation of a rabbit
subcutaneously at multiple sites with 2 mg of protein from sucrose-
gradient-purified strain T virus in Freund's complete adjuvant,
followed at 21, 35, and 49 days by booster immunizations, each
containing 2 mg of protein in Freund's incomplete adjuvant. Serum
obtained at 63 days is adsorbed against normal CEFs and acetone-
dried chicken liver powder until it fails to react with normal chicken
cells. Availability of the monoclonal antibodies may be arranged
with the laboratory of origin (11, 12).
Complement Fixation. Cells scraped from cultures 14
days after inoculation can be tested for REV-specific antigens by
the complement-fixation (COFAR) test (52). A specific anti-REV
antiserum obtained from rabbits immunized with purified viral gs
antigens is used, and the complement-fixation test is conducted in
the normal manner.
Reverse-Transcriptase Assay. Cells obtained from cultures 14
days after inoculation can also be tested for the enzyme reverse
transcriptase (43). Preceding this test, however, appropriate tests
must be used to rule out other viruses containing reverse
transcriptase, such as ALV in chickens, C-type oncornavirus in
pheasants, or lymphoproliferative disease (LPD) virus in turkeys
(4)·
Cytopathic Effect. Within 5-7 days on initial passage of REV,
a low-grade cytopathic effect may be often seen (though not
always). This effect only rarely culminates in total destruction of
the culture (58). Plaque assays have been described but are not
generally applicable to primary isolation.
Recently, an immunoperoxidase plaque assay has been shown to
be a sensitive and reliable method for detection of REV and
antibody (5).
Although defective REVs have not yet been recognized in field
strains, their presence has not been excluded. The isolation of new
defective strains or the propagation of the defective strain T may
require special procedures, such as the in vitro transformation of
bone-marrow cells or inoculation of birds or embryos. The defective
strain T can also induce foci of transformed cells in quail embryo
fibroblast cultures (27), which may constitute a method of assay.
Molecular Identification
Avian Leukosis. A polymerase chain reaction (PCR) specific for
ALV subgroup A can be used to detect proviral DNA and viral
RNA in various tissues from ALV infected chickens (61). Recently,
several PCR primer sets were developed and have been shown to be
useful in typing of various field strains of ALV (25, 32, 33, 48, 49,
53).
Proviral DNA from infected CEFs or tumors will hybridize with
specific probes, such as pRAV-2 and can be detected by dot blot or
Southern blot assays (19).
Reticuloendotheliosis. A PCR that amplifies the 291 base pairs
product of REV LTR has recently been shown to be a sensitive and
specific method for detection of various strains REV in infected
CEF as well as in blood and tumors of infected birds (1, 13). PCR
and reverse transcriptase PCR can also be used in detection of REV
in contaminated vaccines (22, 23, 39, 57).
169
Chapter 35 Oncornaviruses Leukosis/Sarcomas and Reticuloendoihebosxs
Proviral DNA from infected cell cultures or tumors will hybridize
with specific probes, such as pSNV, and can be detected by dot blot
or Southern blot assays (62). Such tests have powerful specificity
and should be helpful in confirming the identity of putative isolates.
SEROLOGIC DETECTION IN THE HOST
Avian Leukosis
Virus-Neutralization Test. The virus-neutralization test is the
most sensitive test used to determine subgroup-specific antibody to
L/S viruses in chickens. The test requires reference ALV or RSV
stocks, reference antibody to the subgroup of L/S virus concerned,
and genetically susceptible CEF cultures. Virus and antibody stocks
can be prepared in the laboratory or obtained from commercial
sources (see appendix). Stocks of ALV or RSV can be prepared by
inoculating susceptible CEF cultures. Subculturing of infected
cultures or transferring supernatant fluids onto new cultures is used
to enhance the level of infection. Supernatant fluid harvested from
CEF cultures prepared from embryos congenitally infected with
ALV can be used as a source of ALV. Tumors induced by RSV in
wing web or breast muscle can be used as a source of RSV (19).
Reference subgroup-specific antiserum to RSV can be collected
from chickens that have regressed sarcomas induced by respective
virus. Antibody to ALV can be prepared by inoculating susceptible
4 to 6 wk old chickens with respective ALV. Sera can be harvested
at 6 to 16 wk PI, depending on chicken genotype and strain of virus
used.
Antibody to ALV is measured by its reaction with RSV, and the
neutralization of virus is determined by any of the RSV assay
procedures; e.g., in chickens, chicken embryos, or cell culture (19).
A microneutralization test that uses ALV as indicator virus can also
be used (17). The test can be conducted in 96-well microtiter plates,
and the neutralization of the virus is determined by an ELISA on
culture fluids.
Only the cell-culture (RSV-focus-reduction and ALV
microneutralization-ELISA) will be given in detail.
Rous Sarcoma Virus-Focus Reduction Assay. The focus
reduction assay for L/S virus antibody is conducted as follows:
1) Dilute serum 1:5 and inactivate it for 30 min at 56 C in a water
bath.
2) Determine the dilution of RSV that will give about 100 or 1500
focus-forming units of virus, respectively, when foci are counted
grossly
or microscopically. The RSV working preparation should be twice
the concentration determined in step 2. For example, if a 1:200
dilution will give 100 foci per plate, the working preparation should
be a 1:100 dilution.
3) Mix equal volumes of RSV working preparation and the
inactivated diluted serum, and incubate the mixture at 37 C for 40
min.
4) Assay the residual virus in susceptible CEF cultures.
5) Include known positive and negative sera in the test as controls.
6) Count RSV foci at 7 days PI. A serum sample that reduces the
number of foci by 90% or more, compared with that of control
negative serum, is considered positive for antibody. Negative serum
should fail to inhibit the virus, and the number of foci should
compare with the number of controls that have virus only.
Microneutralization-ELISA. The microneutralization-ELISA for
ALV antibody is performed in two phases: virus neutralization and
assay for residual ALV in culture fluids by ELISA.
The virus-neutralization portion is conducted as follows:
1) Inactivate sera for 30 min at 56 C; dilute sera 1:5 in TC medium
without serum.
2) Determine the dilution of ALV that will give 500-1000
infectious units of virus/ml. Use RAV-1, RAV-2, RAV-49, RAV-
50, HPRS-103 or RAV-0 to assay for antibody to ALV of
subgroups A, B, C, D, J or E, respectively.
Aly M. Fadly, Richard L. Witter and Henry D. Hunt
3) Add 50 μΐ of virus preparation to each well in a microtiter plate,
except for three to five wells to be used as cell controls.
4) Add 50 μΐ of inactivated diluted test sera to wells; mix serum
with virus by drawing the content of the well into the tip of a pipette
two to three times.
5) Include known positive and negative sera.
6) Incubate microtiter plates at 37 C for 40 min.
7) Add 5 X 10^ CEFs; cells must be free from endogenous virus
and antigen.
8) Incubate plates for 7 days without changing medium.
9) Add 20 μΐ of 5% Tween 80 to each well; freeze and thaw at least
twice before testing supernatant fluid by ELISA.
For assay of residual ALV, see section on assay for ALV gs
antigen by ELISA. A negative ELISA reading indicates that serum
is positive for ALV antibody, and a positive ELISA reading
indicates that serum is negative for antibody.
A direct ELISA for ALV antibody has been developed (19, 50),
and kits for detecting antibodies to subgroups A, B and J ALV are
commercially available (see appendix). False-positive results due to
cross reactions may occur if antibody to the endogenous virus is
present, particularly when using kits for detection of antibody to
subgroups A and B ALV.
Reticuloendotheliosis
Confirmation of REV infection by serologic procedures involves
evaluation of sera from naturally exposed birds of the suspect flock.
Antibodies are induced at various frequencies and persist for varied
periods. Birds infected congenitally or inoculated with high doses as
embryos may be permanently viremic and fail to develop
antibodies. At least 10-15 sera per group or flock should be tested.
Pooling of sera is not recommended.
Indirect Immunofluorescence. The indirect fluorescent antibody
test is useful for detecting REV antibodies in sera and egg-yolk
extracts (38). Cultures of CEF in 96-well plates are infected with
about 50-100 fluorescent focus-forming units of REV, grown for 3-
5 days under liquid medium and fixed. In a satisfactory antigen,
many but not all cells are infected. The unknown sera are used at a
1:20 dilution in the staining test as described earlier for virus
isolation. Controls with normal serum and heterologous antiserum
on both infected and uninfected cultures are necessary. Tests on
sera from other avian species require the appropriate conjugated
anti-species globulin serum.
Flow cytometry. Flow cytometry can also be used to serologically
identify REV isolates. The test is conducted in a way similar to that
described above for flow cytometry for ALV.
Enzyme Immunoassay. An indirect ELISA in 96-well plates can
also be used for detection of antibodies to REV in chicken sera (54).
This test appears to be more sensitive than immunofluorescence or
serum neutralization. However, sera should be diluted 1:200 to
1:400 to avoid false-positive reactions. A commercial kit for
detection of REV antibodies is available (see appendix).
Agar-Gel Precipitin Test. Antibody-containing sera from REV-
infected chickens form specific bands within 24-72 h in the standard
agar-gel precipitin test when reacted against suitable antigens, e.g.,
extracts of infected cell cultures, lOOx concentrated supernatant
fluids from infected cell cultures, viremic chicken plasma, or virus
particles concentrated by ultracentrifugation and sucrose density­
gradient banding (30).
Either antigen or antibody can be detected in test samples by a test
system in which positive antigen is placed in the center well, and
test sera and positive control sera are placed adjacent to each other
in peripheral wells (30). Specificity of precipitin bands must be
confirmed by reactions of identity with positive controls in adjacent
wells.
Virus Neutralization. The virus-neutralization test is used for
antibody detection when sera cannot be tested by indirect
immunofluorescence or when results of immunofluorescent or
170
precipitin tests must be confirmed. A convenient method employing
96-well plates can be used (6). Twofold dilutions of each test and
control serum in culture medium without calf serum are placed in
wells of 96-well plates at 0.05 ml per well. To each well is added
an equal volume of prototype REV (strain T or CS) containing
about 16 infectious units, as determined by simultaneous titration.
After incubation for 30 min at 37 C, CEFs are added to each well,
and the plate is incubated for 3 days at 38 C in a humidified cell­
culture incubator with 5% carbon dioxide. The monolayer cultures
in each well are then fixed and stained by indirect
immunofluorescence as described earlier. The wells are scored as
positive or negative for virus following microscopic examination.
The neutralization titer is the highest dilution of serum (after
mixture with the virus) that completely neutralizes the test virus.
Alternatively, ELISA can be used to assay for residual REV (see
enzyme immuno assay for detection of REV).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Avian Leukosis
Viruses of the avian L/S group share gs antigens and some unique
characteristics, such as the ability to interact with other members of
the group in RIF, PM, and complementation tests (19). This group
of viruses can be differentiated from other avian oncornaviruses
with C-type particle morphology, such as REV on the basis of a
unique gs antigen, unique reverse transcriptase, and a buoyant
density of 1.16. The L/S viruses are classed according to: 1) the
spectrum of neoplasms they induce (pathotype), and 2) the viral
envelope subgroup.
The neoplastic condition of turkeys known as LPD is induced by
yet another oncornavirus that is distinct from both L/S and RE
viruses (4). However, the incidence of LPD of turkeys has always
been sporadic and the disease has not been reported during at least
the last decade (16).
Pathotypes. Viruses of avian L/S group that induce neoplasms
over a long period of time (slowly transforming viruses) are known
as ALVs, whereas viruses that cause acute neoplasms (apparent
within 2 to 6 wk) are known as avian sarcoma and defective
leukemia viruses.
Subgroup and Strain Variability. Viruses of the avian L/S group
that occur in chickens are divided into six subgroups (A, B, C, D, E
and J) on the basis of their host range in genetically different
chicken cells, their interference with transformation of CEF cultures
by RSV members of the same subgroup, and the viral envelope
antigens detected by virus- neutralization tests (19). Subgroup E
ALV are endogenous ALVs of chickens known to be of low
pathogenicity. Other subgroups of avian L/S viruses are endogenous
viruses rescued from pheasants (F, G), Hungarian partridge (H) and
quail (I) (19).
Laboratory as well as field isolates that belong to one subgroup of
L/S virus are usually termed strains of that subgroup. Tolerance
induction and tumor incidence and type are influenced by the strain
of virus (19).
Characteristics of Vaccine Strains. No commercial vaccine is
available for protection of chickens from infection with ALV.
Results of experimental vaccination with live ALV on shedding and
congenital transmission of the virus were equivocal (19). The use of
experimental recombinant L/S viruses as vaccines (19, 44, 66) may
prove to be a valuable adjunct to current programs for reduction or
eradication of ALV infection.
Reticuloendotheliosis
Strain Variability. All REV regardless of species of origin, are
antigenically related to each other and serologically distinct from all
other oncornaviruses. However, antigenic characterization of
various REV isolates using a panel of 11 monoclonal antibodies

(11) revealed the presence of three different subtypes, A, B and C
(6).
REV-induced immunosuppressive syndromes can usually be
distinguished from lesions induced by infectious bursal disease or
chicken anemia viruses by histopathology. Atrophy of lymphoid
organs with immunodepression, nerve lesions and abnormal feather
development are characteristics of REV-induced immunodepressive
disease.
Characteristics of Vaccine Strains. No vaccines are available,
and control, when warranted, involves removal of virus-shedding
hens from breeding flocks and protection of progeny against
horizontal infection through good management and strict isolation
(62, 64).
Differential Diagnosis of Avian Oncornavirus-Induced Tumors
The pathology of tumor conditions induced by viruses of the L/S
group, particularly those of lymphoproliferative nature, can be
confused with that of tumors seen in MD and RE. Because ALV,
REV and MDV are all ubiquitous in the chicken population and
infection in the absence of tumor formation is common, virologic
and serologic criteria rarely provide a definitive diagnosis.
Techniques based on molecular hybridization, or
immunocytochemistry with monoclonal antibodies to cellular
antigens can be used in the differential diagnosis of avian viral
lymphomas (8,24, 63).
Avian oncomaviral lymphomas originate from either B-cells
(ALV, REV) or T-cells (REV), whereas MD lymphomas are of T-
cell origin (19, 34, 47, 62, 65). These characteristics provide the
basis for tests that distinguish among B- and T-cell lymphomas
using monoclonal antibodies specific for cell surface antigens of B-
and T-lymphocytes.
Because nondefective ALV and REV do not posses viral (v)-onc
gene, they transform target cells by integration within a cellular
(c)onc gene such as c-myc resulting in the enhanced expression of
such gene. The enhanced expression of c-myc is believed to initiate
the lymphomagenic process. These molecular changes are the bases
for testing tumor DNA for the definitive diagnosis of ALV and
REV lymphomas. Using appropriate probes such as pRAV-2,
pSNV, or c-myc, Southern blots and hybridization analysis of tumor
DNA is used to detect clonal insertion of ALV or REV provirus and
alteration in c-myc (19, 62).
PCR has been used for the detection of two copies of the 132-base-
pair repeat in the DNA extracted from MD lymphomas, but not
from DNA extracted from lymphomas induced by ALV or REV
(65). MD lymphomas probably contain a higher frequency of
infected cells and more copies of viral DNA per infected cell than
are typically found in tissues of nontumor-bearing chickens (65).
Recently, it has been shown that MD-induced tumors have many
more copies of MDV genome than MDV latently infected tissues. A
real time PCR technique was developed to differentiate MD-
induced tumors and tumors induced by retroviruses in chickens
coinfected with MDV (24, 63). Also, a PCR has been shown to
detect REV-LTR sequences from lymphomas and brains of REV-
infected chickens, but not from DNA from LL or MD lymphomas
(1 13,22).
PCR assays demonstrate the presence or absence of the respective
virus and thus the same limitations for tumor diagnosis as virus
isolation.
REFERENCES
1. Aly, Μ Μ, E. J. Smith, and A. M Fadly. Detection of
reticuloendotheliosis virus infection using the polymerase chain reaction.
Avian Pathol. 22:543-554. 1993.
2. Aly, Μ. M, R. L. Witter, and A. M Fadly. Enhancement of
reticuloendotheliosis virus-induced bursal lymphomas by serotype 2
Marek’s disease virus. Avian Pathology, 25:81-94. 1996.
171
Chapter 35 Oncornaviruses Leukosis/Sarcomas and Reticuloendothehoes
3. Bacon, L. D., R. L. Witter, and A. M Fadly. Augmentation of
oncornavirus-induced lymphoid leukosis by Marek’s disease herpesviruses
in white leghorn chickens. J. Virol 63:504-512. 1989.
4. Biggs, P.M Lymphoproliferative disease of turkeys, in: B. W. Calnek, H_
J. Bames, C. W. Beard, L. R. McDougald, and Y. M Saif (Eds) Diseases of
Poultry, 10th Ed, pp. 485-489. Iowa State University Press, Ames, Iowa.
1997.
5. Calvert, J. G., and K. Nazerian. An immunoperoxidase plaque assay for
reticuloendotheliosis virus and its application to a sensitive serum
neutralization assay. Avian Dis. 38:165-171. 1994.
6. Chen, P. Y., Z. Cui, L. F. Lee, and R. L. Witter. Serologic differences
among nondefective reticuloendotheliosis viruses. Arch. Virology 93, 233-
245. 1987.
7. Cho, B. R. Cytopathic effects and focus formation by
reticuloendotheliosis viruses in a quail fibroblast cell line. Avian Dis
27:261-270, 1983.
8. Crespo, R, P. R. Woolcock, , A. M Fadly, C. Hall, and H L.
Shivaprasad. Characterization of T-cell lymphomas associated with an
outbreak of reticuloendotheliosis in turkeys. Avian Pathology.31:355-361.
2002.
9. Crittenden, L. B., S. McMahon, M S. Halpern, and A. M Fadly.
Embryonic infection with the endogenous avian leukosis virus Rous-
associated virus-o alters response to exogenous avian leukosis virus
infection. J. Virol. 61:722-725. 1987.
10. Crittenden, L. B., and E. J. Smith. A comparison of test materials for
differentiating avian leukosis virus group-specific antigens of endogenous
and exogenous origin. Avian Dis. 28:1057-1070. 1984.
11. Cui, Z., L. F. Lee, R. F. Silva, and R L. Witter. Monoclonal antibodies
against avian reticuloendotheliosis virus: identification of strain specific and
strain common epitopes. J Immunol. 136:4237-4242. 1986.
12. Cui, Z., L. F. Lee, E. J. Smith, R L. Witter, and T. S. Chang
Monoclonal-antibody-mediated enzyme-linked immunosorbent assay for
detection of reticuloendotheliosis viruses. Avian Dis. 32:32-40. 1988.
13. Davidson, I., A. Borovskay, S. Perl and M Malkinson. Use of the
polymerase chain reaction for the diagnosis of natural infection of chickens
and turkeys with Marek’s disease virus and reticuloendotheliosis virus.
Avian Pathology 24:69-94. 1995.
14. DeBoer, G. F., and A D. Μ E. Osterhaus. Application of monoclonal
antibodies in the avian leukosis virus gs-antigen ELISA. Avian Pathology.
14:39-55. 1985.
15. Ewert, D. L., and G. F. DeBoer . Avian lymphoid leukosis: Mechanism
of lymphomagenesis. In: K. Perk (ed), Immunodeficiency Disorders, pp. 37-
53, Academic Press, Inc., Boston. 1988.
16. Fadly, A. M Neoplastic Diseases of Poultry, in: Y.M Saif, H. J.
Bames, A.M Fadly, J.R Glisson, L.R. McDougald, and D.E. Swayne (Eds)
Diseases of Poultry, 11th Ed. pp. 405-407. Iowa State University Press,
Ames, Iowa. 2003.
17. Fadly, A Μ, T. F. Davison, L. N. Payne, and K. Howe. Avian leukosis
virus infection and shedding in brown leghorn chickens treated with
corticosterone or exposed to various stressors. Avian Pathology. 18:283-298.
1989.
18. Fadly, A. M, W. Okazaki, E. J. Smith, and L. B. Crittenden. Relative
efficiency of test procedures to detect lymphoid leukosis virus infection.
Poultry .Sci. 60:2037-2044. 1981.
19. Fadly, A. M and L. N. Payne. Leukosis/sarcoma group, in: Y.M Sai£
H. J. Bames, A. M Fadly, J. R. Glisson, L. R McDougald, and D. E.
Swayne (Eds) Diseases of Poultry, 11th Ed. pp. 465-516. Iowa State
University Press, Ames, Iowa. 2003.
20. Fadly, A.M, Silva, RF., Hunt, H.D. Detection of exogenous and
endogenous avian leukosis viruses in commercial Marek's disease vaccines.
In: Proceedings of the 170th Annual Meeting of the United States Animal
Health Association, pp. 524-525. 2003.
21. Fadly, A. M, and R L. Witter. Effects of age at infection with serotype
2 Marek’s disease virus on enhancement of avian leukosis virus-induced
lymphomas. Avian Pathology 22:565-576. 1995.
22. Fadly, A. M, R. L. Witter, E. J. Smith, R F. Silva , W. M Reed, F. J.
Hoerr, and M R. Putnam. An outbreak of lymphomas in commercial broiler
breeder chickens vaccinated with a fowl pox vaccine contaminated with
reticuloendotheliosis virus. Avian Pathology, 25:35-47. 1996.
23. Garcia, Μ, N. Narrang, W. M Reed, and A. M. Fadly. Molecular
Charcterization of reticuloendotheliosis virus (REV) insertion in the genome
of field and vaccine strains of fowlpox virus(FPV). Avian Dis. 47:343-354.
2003.
Aly M. Fadly, Richard L. Witter and Henry D. Hunt
24. Gimeno, I. M., R. L. Witter, A. M. Fadly and R. F. Silva. Novel Criteria
for the diagnosis of Marek’s disease virus-induced lymphomas. Avian
Pathology. 34:332-340- 2005.
25. Gingerich, E., R. E. Porter, B. Lupiani, and A. M Fadly Diagnosis of
myeloid leukosis induced by a recombinant avian leukosis virus in
commercial white leghorn egg laying flocks. Avian Dis. 46:745-748. 2002.
26. Glika, F., and J. L. Spencer. Immunohistochemical identification of
group specific antigen in avian leukosis virus infected chickens. Can. J.
Comp. Med. 48:322-326. 1984.
27. Hoelzer, J. D., R. B. Franklin, and H. R. Bose. Transformation by
reticuloendotheliosis virus: development of a focus assay and isolation of a
non-transforming virus. Virology 93:20-30. 1979.
28. Hunt, H. D., L. F. Lee, D. Foster, R. F. Silva, and A. M Fadly. A
genetically engineered cell line resistant to .subgroup J avian leukosis virus
infection (C/J). Virology. 264:205-210. 1999.
29. Hunt, H. D., V. Leathers, C. Lamichhane, G. Rosales, E. Jensen, J.
McKay, and A. M Fadly. Comparison of the different techniques (ELISA,
Fluorescent Antibody, and Virus Neutralization) for detecting serum
antibody to the subgroup J Avian Leukosis Virus (ALV-J). Presented at the
International Symposium on ALV-J and Other Avian Retroviruses, Editors
Kaleta, E.F., Payne, L.N. and Heffels-Redmann, U. Rauischholzhausen,
Germany. 2000.
30. Ianconescu, M Reticuloendotheliosis antigen for the agar gel
precipitation test. Avian Pathology. 6:259-267. 1977.
31. Johnson, D. A., J. W. Guatsch, J. R. Sportsman, and J. H. Eder.
Improved technique utilizing nonfat dry milk for analysis of proteins and
nucleic acids transferred to nitrocellulose. Gene Anal. Technol. 1:3-8. 1984.
32. Lupiani, B., S. M. Williams, R. F. Silva, H. D. Hunt, and A. M Fadly,
Pathogenicity of two recombinant avian leukosis viruses. Avian Dis. 47:425-
432. 2003.
33. Lupiani, B., H. Hunt, R. Silva, and A. Fadly. Identification and
characterization of recombinant subgroup J avian leukosis viruses (ALV)
expressing subgroup A ALV envelope. Virology 276:37-43. 2000.
34. Neumann, U., and R. L. Witter. Differential diagnosis of lymphoid
leukosis and Marek's disease by tumor-associated criteria. I. Studies on
experimentally infected chickens. Avian Dis. 23:417-425. 979.
35. Okazaki, W., H. G. Purchase, and B. R. Burmester. Phenotypic mixing
test to detect and assay avian leukosis viruses. Avian Dis. 19:311-317. 1975.
36. Payne, L. N., S. R. Brown, N. Bumstead, K. Howes, J. A. Frazier and
Μ E. Thouless. A novel subgroup of exogenous avian leukosis virus in
chickens. J. Gen. Virology 72:801-807. 1991
37. Payne, L. N., A. M. Gillespie, and K. Howes. Unsuitability of chicken
sera for detection of exogenous ALV by the group-specific antigen ELISA.
Vet Rec 132:-555-557. 1993.
38. Purchase, H. G., C. G. Ludford, K. Nazerian, and H. W. Cox. A new
group of oncogenic viruses: reticuloendotheliosis, chick syncytial, duck
infectious anemia, and spleen necrosis viruses. J. Natl. Cancer Inst. 51:489-
499. 1973.
39. Reimann, I, and O. Werner . Use of polymerase chain reaction for the
detection of reticuloendotheliosis virus in Marek’s disease vaccines and
chicken tissues. J. Vet. Med, 43:75-84. 1996.
40. Rodriguez, F. R., and F. Deinhardt. Preparation of a semi-permanent
mounting medium for fluorescent antibody studies. Virology 12:316-
317.1960.
41. Rispens, B. Η., P. A. Long, W. Okazaki, and B. R. Burmester. The NP
activation test for assay of avian leukosis/sarcoma viruses. Avian Dis.
14:738-751. 1970.
42. Rubin, H. A virus in chick embryos which induces resistance in vitro to
infection with Rous sarcoma virus. Proc. Natl. Acad. Sci. U.S.A. 46:1105-
1119. 1960.
43. Sarma, P. S., D. K. Jain, Η. K. Mishra, J. L. Vernon, P. S. Paul, and B.
S. Pomeroy. Isolation and characterization of viruses from natural outbreaks
of reticuloendotheliosis in turkeys. J. Natl. Cancer Inst. 54:1355-1359. 1975.
44. Qin, A., Z. Cui, L.F. Lee, and A. M Fadly. Cloning and expression of
envelope gene of subgroup J avian leukosis virus. Chinese Journal of
Virology. 17:54-59. 2001.
45. Qin, A., L.F. Lee, A. M Fadly, H. Hunt, and Z. Cui. Development and
characterization of monoclonal antibodies to subgroup J avian leukosis
virus. Avian Dis. 45:938-945. 2001.
46. Sarma, P. S., H. C. Turner, and R. J. Huebner. An avian leukosis group­
specific complement-fixation reaction. Application for the detection and
assay of non-cytopathogenic leukosis viruses. Virology 23:313-321. 1964.
47. Siccardi, F. J., and B. R. Burmester . The differential diagnosis of
lymphoid leukosis and Marek's disease. USDA Technical Bulletin 1412.
1970.
172
48. Silva, R.F., A. M Fadly, and H. D. Hunt. Hypervariability in the
envelope genes of subgroup J avian leukosis viruses obtained from different
farms in the United States. Virology 272:106-111. 2000.
49. Smith, L.M, S.R. Brown, K. Howes, S. McLeod , S.S. Arshad, G.S.
Barron, K. Venugopal, J.C. McKay and L.N. Payne. Development and
application of polymerase chain reaction (PCR) tests for the detection of
subgroup J avian leukosis virus. Virus Research. 54:87-98. 1998.
50. Smith, E. J., A. M Fadly, and L. B. Crittenden. Observations on an
enzyme-linked immunosorbent assay for the detection of antibodies against
avian leukosis-sarcoma viruses. Avian Dis. 30:488-493. 1986.
51. Smith, E. J., A. Fadly, and W. Okazaki. An enzyme-linked
immunosorbent assay for detecting avian leukosis-sarcoma viruses. Avian
Dis 23:698-707. 1979.
52. Smith, E. J., J. J. Solomon, and R. L. Witter. Complement-fixation test
for reticuloendotheliosis viruses: limits of sensitivity in infected avian cells.
Avian Dis. 21:612-622. 1977.
53. Smith, E.J., S. M. Williams, and A. M Fadly. Detection of avian
leukosis virus subgroup J using the polymerase chain reaction. Avian
Dis.42:375-380. 1998.
54. Smith, E. J., and R. L. Witter. Detection of antibodies against
reticuloendotheliosis viruses by an enzyme-linked immunosorbent
assay.Avian Dis. 27:225-234. 1983.
55. Spencer, J. L., L. B. Crittenden, B. R. Burmester, C. Romero, and R. L.
Witter. Lymphoid leukosis viruses and gs antigen in unincubated chicken
eggs. Avian Pathol. 5:221-226. 1976.
56. Sung, H. W., S. M Reddy, and A. M Fadly. High virus titer in feather
pulp of chickens infected with subgroup J avian leukosis virus. Avian Dis.
46:281-286. 2002.
57. Takagi, Μ, I. Kiyoyasu, N. Hideki, T. §asaki, G. Kisako , and H.
Koyama. Detection of contamination of vaccines with the
reticuloendotheliosis virus by reverse transcriptase polymerase chain
reaction (RT-PCR). Virus Research, 40:113-121. 1996.
58. Temin, Η. M, and V. K. Kassner. Replication of reticuloendotheliosis
viruses in cell cultures: acute infection. J. Virol. 13:291-297. 1974.
59. Theilen, G. H., R. F. Zeigel, and M J. Twiehaus. Biological studies
with RE virus (strain T) that induces reticuloendotheliosis in turkeys,
chickens, and Japanese quail. J. Natl. Cancer Inst. 37:731-743. 1966.
60. U.S. Department of Agriculture, SAM-405. Supplemental assay method
for detecting lymphoid leukosis biocontamination by the COFAL test.
Biologies Laboratories, Veterinary Services, Animal and Plant Health
Inspection Service, Ames, Iowa. 1973.
61. Van Woensel, P. A. M, A. van Blaaderen, R. J. M Mooman, and G. F.
de Boer. Detection of proviral DNA and viral RNA in various tissues early
after avian leukosis virus infection. Leukemia 6 (S3): 1355-1375. 1992.
62. Witter, R.. L. and A. M Fadly. Reticuloendotheliosis, in: Y.M Saif, H.
J. Bames, A.M Fadly, J. R. Glisson, L. R. McDougald, and D. E. Swayne
(Eds) Diseases of Poultry, 11th Ed. pp. 517-536. Iowa State University
Press, Ames, Iowa. 2003.
63. Witter, R. L., I. M. Gimeno and A. M Fadly. Differential diagnosis of
lymphoid and myeloid tumors in chickens[CD-ROM] , set 27. Am. Assoc.
Avian Pathologists, Athens, Georgia. 2005
64. Witter, R. L., and D. W. Salter. Vertical transmission of
reticuloendotheliosis virus in breeder turkeys. Avian Dis. 33:226-235. 1989.
65. Witter, R, L. and K. A. Schat. Marek’s disease. In: Y.M. Saif, H. J.
Bames, A.M Fadly, J.R. Glisson, L.R. McDougald, and D.E. Swayne (Eds)
Diseases of Poultry, 11th Ed. pp. 407-465. Iowa State University Press,
Ames, Iowa. 2003.
66. Wright, S. E., and D. D. Bennett. Avian oncornavirus recombinant
expressing foreign envelope delays tumour formation of ASV-A-induced
sarcoma. Vaccine 10:375-378. 1992.
 36
AVIAN ENCEPHALOMYELITIS
Louis van der Heide

SUMMARY. Avian encephalomyelitis (AE) or epidemic tremor is an infectious viral disease of poultry caused by a picomavirus. Chickens,
turkeys, pheasants, and quail are naturally susceptible. AE is mostly an egg-transmitted disease. If susceptible breeder chickens become
infected with AE virus during production, the offspring may have clinical AE in the first 4 wk of life. Horizontal transmission may also occur
between infected and susceptible chicks, or between mature birds as well. Chick losses and decreased egg production are the main economic
factors of AE.
Agent Identification. The primary preferred diagnostic tests are isolation of AE virus in 6-day embryonating chicken eggs by yolk sac
inoculation and/or demonstration of AE viral antigen in tissues from suspect poultry.
Serologic Detection in the Host. Secondary diagnostic tests identify anti-AE viral antibodies in suspect poultry sera by either the virus­
neutralization test using the embryo-adapted Van Roekel strain of AE virus, the chicken embryo susceptibility test, or an enzyme-linked
immunosorbent assay.

INTRODUCTION Virus Isolation by Yolk Sac Inoculation of Embryonating

Avian encephalomyelitis (AE) is an infectious viral disease of
poultry, which in young chickens, turkeys, pheasants, or quail is
characterized by clinical signs of a central nervous system disorder,
with high morbidity and variable mortality. Older poultry can
become infected but rarely develop clinical signs.
The name epidemic tremor was given to the disease by Dr.
Elizabeth Jones in 1934 (11). In 1939 the name avian
encephalomyelitis was officially adopted. AE is an egg-transmitted
disease; therefore breeder vaccination is an important preventive
measure.
CLINICAL DISEASE
In young chicks, 1—4 wk of age, AE is characterized by neurologic
signs such as ataxia, incoordination, paralysis, or rapid tremors of
the head and neck. Gross lesions are limited to occasional blindness
from cataracts as sequelae of infection. Microscopic lesions include
neuron degeneration (“ghost cells”) particularly in the medulla and
anterior horns of the spinal cord. Glial cell satellitosis of
degenerating neurons is also common. Numerous circumscribed
lymphoid follicles can be found in the pancreas and lymphocytic
aggregates in the muscular tissue of the proventriculus (10).
In adult laying birds, AE infection causes no neurologic signs, but
it depresses egg production by 10-15% on a flock basis. Egg
production returns to normal levels in about 2 wk.
SAMPLE COLLECTION
Virus isolation is best from brain material of birds that show early
clinical signs of AE and have not been affected for more than 2 or 3
days. Brains are harvested aseptically from individual birds or are
pooled from several birds and stored at -20 C (regular freezer) or
lower until prepared for inoculation. Brain material is ground in a
tissue grinder with nutrient broth added to make a 10%-25%
suspension. The suspension is centrifuged at 1000 x g for 10 min,
and the supernatant fluid is collected. Penicillin (10,000 IU per ml)
and streptomycin (100 :g per ml) are added to inhibit growth of any
contaminating bacteria.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Virus Isolation by Intracerebral Inoculation of 1-Day-Old Chicks
Avian encephalomyelitis-susceptible 1-day-old chicks are
inoculated intracerebrally via a 22 or 23-gauge needle with 0.025-
0.03 ml of brain suspension. Brains of chicks that show clinical
signs of AE within 1—4 wk postinoculation (PI) can be harvested
and used for serial passage in susceptible chicks.
Chicken Eggs
For the propagation of AE virus, the embryos used must be from
an AE-susceptible flock. Five-to-6-day-old embryonating eggs are
used for AE virus isolation or propagation. The eggs should be
specific-pathogen-free eggs that are free of chick embiyonal lethal
orphan (CELO; avian adenovirus) virus, to avoid the confusing
similarity of lesions between CELO and AE infection in chicken
embryos and hatched chicks. CELO virus can be distinguished from
AE virus by neutralization tests with specific antisera.
For virus isolation, 0.2-0.5 ml of brain suspension, prepared as
above, is inoculated into the yolk sac of 24 6-day-old embryonating
chicken eggs (use 1.5-inch, 22-gauge needles). Twelve embryos are
examined for lesions at 12 days PI. Gross lesions consist of embryo
immobility (paralysis), leg muscle atrophy, and sometimes death of
the embryo. If no lesions are found, the other 12 inoculated eggs are
allowed to hatch, and the chicks are observed for clinical signs for
the first 10 days posthatch. In making primary virus isolations from
brains of chickens with clinical AE, Butterfield et al. (3) reported
that an average of 12 passages were necessary to adapt 19 field AE
isolates to produce lesions in chicken embryos.
Embryonating eggs are also used for serial passage of established
virus isolates, for virus titrations, and for neutralization tests of field
sera with the embryo-adapted Van Roekel strain of AE virus (5,18).
Cell Culture
Virus isolation with chicken embryo cell or organ culture is not
practical, because no cytopathic effects can be observed.
AGENT IDENTIFICATION
Avian encephalomyelitis virus is an RNA virus, in the family
Picomaviridae, genus Enterovirus (3). The titer of AE virus is not
affected by treatment with ether or chloroform (3). AE virus
particles are spherical with diameters ranging from 16.5 to 25 nm
(3).
Fluorescent Antibody (FA) Test
Direct FA testing has been successful in demonstrating AE viral
antigen in tissues of AE-infected chickens (1,14,17). Cryostat
sections, 6-7pm thick, are cut from brain, pancreas, proventriculus,
and, if needed, heart, ventriculus, and spinal cord, at a microtome
temperature of -15 to -20 C, using a suitable mounting compound.
Sections are mounted on glass slides, air-dried, fixed in cold
acetone for 10 min, and air-dried again. The sections are then
reacted with specific anti-AE virus conjugate for 30 min at room
temperature in a humidified atmosphere, after which the slides are
washed for 20 min in phosphate-buffered saline (PBS) at pH 7.4,
and then coverslips are mounted with equal parts PBS and buffered
glycerol at pH 7.4. Slides can then be examined under the
fluorescent microscope.

173
Louis van der Heide
Strain Variability
All reported AE virus isolates and vaccine strains appear to be
serologically similar to the embryo-adapted Van Roekel strain and
are considered to be the same serotype.
Characteristics of Vaccine Strains
Live Virus Vaccine. The most widely used AE vaccine is the live-
virus vaccine developed from strain 1143 by Calnek et al. (4,6,9).
This strain is a mild field strain that should be kept at a low embryo
passage for vaccine use (not more than two passages); otherwise, it
becomes embryo-adapted and loses its efficacy for oral
administration. Preferred age for vaccination is between 14 and 18
wk, at least 4 wk before the beginning of the laying period.
Application is through the drinking water. Minimum virus titer of
strain 1143 should be 103 0 EID5o per bird dose.
Because the vaccine strain is not embryo-adapted, titration is
accomplished by making serial 10-fold dilutions and inoculating 10
embryos per dilution. The embryos must be from AE-susceptible
stock and are inoculated via the yolk sac with 0.2 ml per embryo.
As controls, 10 embryos are inoculated similarly with the broth
diluent. The eggs for each inoculation group are placed in pedigree
baskets and allowed to hatch. The hatched chicks are identified by
wing bands and placed in a brooder, together with the controls, for
observation for 3 days. A record is then made of the number
showing clinical signs of AE out of the original number hatched in
each group. The EfD50 is calculated by the method of Reed and
Muench (13).
Killed-Virus Vaccine. A beta-propiolactone-killed Van Roekel
strain of AE vaccine is available commercially (Lohmann Animal
Health, Waterville, ME). Suitable immunity is attained with a
vaccine whose virus titer before inactivation is 106 ELD50 per
ml(2,8).
SEROLOGIC DETECTION IN THE HOST
Various serologic tests are used to confirm AE virus infections
for the purpose of retrospective diagnosis.
Virus-Neutralization Test Serum from birds suspected of having
been infected with AE can be tested for virus-neutralizing
antibodies by using the Van Roekel strain and the procedure
outlined in chapter 46 on serologic procedures. The test uses 6-day-
old AE-susceptible embryonating eggs. Five eggs per dilution are
inoculated via the yolk sac with a 22-gauge 1.5-inch needle. The
embryos are examined 12 days PI for typical AE lesions to
determine the titration endpoints. Sera from chickens exposed to AE
usually have a logio neutralization index of 1.5-3.0.
Embryo Susceptibility Test
The embryo susceptibility test has been developed to determine
the AE susceptibility or immunity status of a breeder flock (15,16).
To perform the test, 36 hatching eggs are submitted to the
laboratory. After 6 days of incubation, the eggs are candled, and all
fertile eggs are inoculated via the yolk sac with 0.1 ml of a IO'3
dilution of a suspension of the Van Roekel strain of AE virus (about
1000 mean embryo infective doses [EID50]). Calnek et al. (7) used a
lower dose of 100 EID50 virus per egg. At 12 days PI, the embryos
are examined for specific AE lesions: muscular dystrophy and
embryo immobility. If all embryos have AE lesions, the breeder
flock is considered to be completely AE-susceptible. If 70%-100%
of the embryos are without lesions, the breeder flock is considered
to be adequately immune. The percentage of embryos without
lesions should be reported in the results.
174
Enzyme-Linked Immunosorbent Assay
The enzyme-linked immunosorbent assay (ELISA) is used to
determine antibody levels in blood serum. AE antigen microtiter
plates for ELISA are commercially available (Synbiotics
Corporation, San Diego, CA and IDEXX, Westbrook, ME).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Similar clinical signs, such as paralysis, ataxia, and incoordination
in chicks, can also be caused by other etiologies. Marek’s disease,
including transient paralysis, can be distinguished by virus isolation
and histopathology (10). Newcastle disease can be distinguished by
histopathology (12) and virus isolation with confirmation of a
paramyxovirus type 1 and serologic tests. Encephalomalacia
(vitamin E deficiency) can be distinguished by histopathology (10).
REFERENCES
1. Braune, Μ O., and R. F. Gentry. Avian encephalomyelitis virus. II.
Pathogenesis in chickens. Avian Dis. 15:648-653. 1971.
2. Butterfield, W. K., R. E. Luginbuhl, C. F. Helmboldt, and F. W. Sumner.
Studies on avian encephalomyelitis. ΠΙ. Immunization with an inactivated
virus. Avian Dis. 5:445-450. 1961.
3. Butterfield, W. K., R. E. Luginbuhl, and C. F. Helmboldt.
Characterization of avian encephalomyelitis virus (an avian enterovirus).
Avian Dis. 13:363-378. 1969.
4. Calnek, B. W. Oral vaccine for avian encephalomyelitis. J. Am. Vet.
Med Assoc. 139:1323. 1961.
5. Calnek, B. W., and J. H. Jehnich. Avian encephalomyelitis studies. Annu.
Rept. Univ. Mass. Bull. No. 509-62. Mass. Agric. Exp. Sta., University of
Massachusetts, Amherst, Mass. 1957.
6. Calnek, B. W. , and J. H. Jehnich. Studies on avian encephalomyelitis. Π.
Immune responses to vaccination procedures. Avian Dis. 3:225-239. 1959.
7. Calnek, B. W., R E. Luginbuhl, P. D. McKercher, and H. Van Roekel.
Committee report on a tentative program for the control of avian
encephalomyelitis. Avian Dis. 4:456. 1961.
8. Calnek, B. W., and P. J. Taylor. Studies on avian encephalomyelitis. ΠΙ.
Immune response to betapropiolactone inactivated virus. Avian Dis. 4:116—
122. 1960.
9. Calnek, B. W., P. J. Taylor, and M Sevoian. Studies on avian
encephalomyelitis. V. Development and application of an oral vaccine.
Avian Dis. 5:297-312. 1961.
10. Helmboldt, C. F. Histopathologic differentiation of diseases of the
nervous system of the domestic fowl (Gallus gallus). Avian Dis. 16:229-
240. 1972.
11. Jones, E. E. Epidemic tremor, an encephalomyelitis affecting young
chickens. J. Expt. Med. 59:781-798. 1934.
12. Jungherr, E. L., and E. L. Minard. The pathology of experimental avian
pneumoencephalitis. Am. J. Vet. Res. 5:125-134. 1944.
13. Reed, L. T., and H. Muench. A simple method for estimating fifty
percent endpoints. Am. J. Hyg. 27:493-497. 1938.
14. Sato, G., M Kamada, T. Miyamae, and S. Miura. Propagation of non­
egg-adapted avian encephalomyelitis virus in chick embryo brain cell
culture. Avian Dis. 15:326-333. 1971.
15. Sumner, F. W., R. E. Luginbuhl, and E. L. Jungherr. Studies on avian
encephalomyelitis. II. Flock survey for embryo susceptibility to the virus.
Am. J. Vet. Res. 18:720-723. 1957.
16. Taylor, J. R E., and E. P. Schelling. The distribution of avian
encephalomyelitis in North America as indicated by an immunity test. Avian
Dis. 4:122-132. 1960.
17. van der Heide, L. The fluorescent antibody technique in the diagnosis of
avian encephalomyelitis. Tech. Bull. No. 44. Life Sciences and Agr. Expt.
Sta., University of Maine, Orono, Maine. 1970.
18. Van Roekel, H„ K.l. Bullis, O. S. Hint, and Μ K. Clarke. Avain
Encephalomyelitis. Annu. Rept. Bull. No. 388. Mass. Agric. Exp. Sta.,
University of Massachusetts, Amherst, Mass. 1942.
 37
DUCK HEPATITIS
Peter R. Woolcock

SUMMARY. Duck hepatitis can be caused by at least three different viruses. The more common and internationally widespread is duck
hepatitis virus (DHV) type I (a picomavirus, most closely related to members of the genus Parechovirus (9)), which causes a highly lethal,
acute, contagious infection in ducklings less than 6 wk of age and frequently less than 3 wk old. DHV type I does not cause disease in older
ducks. DHV type Π has only been reported in the United Kingdom. It occurs in ducklings from 10 days to 6 wk of age, and causes pathologic
changes similar to those of DHV type I. DHV type Π is classified as an astrovirus. DHV type HI has been reported only in the United States
and causes liver lesions in young ducklings, but is less virulent than DHV type I. DHV type HI is believed to be a picomavirus, serologically
unrelated to DHV type I virus.
Agent Identification. Diagnosis of hepatitis in ducklings is based upon the characteristic disease pattern in the flock, gross pathological
changes, recovery of virus from dead ducklings, and reproduction of the disease in susceptible ducklings. It is not possible to distinguish
between DHV types I, Π, and ΙΠ on the basis of clinical findings and pathology; however, distinctions can be made from the responses of
ducklings, embryonating eggs, and cell cultures to the virus isolates. A one-step reverse transcriptase polymerase chain reaction for DHV-1
has been reported (10).
Serologic Detection in the Host. Serologic tests have little value in the diagnosis of acute infections caused by DHV types I, Π, and HL
Serum neutralization tests in ovo have been used with all three viruses and in vitro tests have been developed for DHV type 1. These tests
have been used for the assay of immune responses to vaccination and epidemiologic surveys, as well as for virus identification.

INTRODUCTION Duck Hepatitis Virus Type HI

Duck hepatitis virus (DHV) types I, Π, and HI are the cause of
acute, rapidly spreading, fatal viral infections in young ducklings,
characterized primarily by hepatitis. DHV types Π and HI were
recognized as separate entities because they induced hepatitis in
ducklings immune to DHV type I. The duck is the only known
natural host for all three viruses; these diseases are of no known
public health significance. The diseases are economically important
to all duck growers because of their potentially high mortality if not
controlled.
Duck hepatitis virus types I, Π, and ΠΙ should not be confused with
duck hepatitis B virus, a hepadnavirus classified in the same group
as mammalian hepatitis B virus. This virus seems to have minimal
significance for commercial duck production (4, 12).
Duck hepatitis virus type ΙΠ causes clinical signs and pathologic
changes in young ducklings similar to those seen in DHV type I
infections (1). DVH type HI has been reported only in the United
States, where losses of up to 20% have occurred in ducklings
immune to DHV type I (6).
SAMPLE COLLECTION
In infected ducklings, viremia occurs before clinical signs become
apparent. Virus can be recovered from any vital organ, blood, and
feces. Because Ever is the target organ, virus can usually be
recovered by homogenization of liver tissue as a 20% (w/v)
suspension in buffered saline. The suspension is clarified by low-
speed centrifugation.

CLINICAL DISEASE PREFERRED CULTURE MEDIA AND SUBSTRATES

Duck Hepatitis Virus Type I Duck Hepatitis Virus Type I

Duck hepatitis virus type I affects ducklings less than 6 wk of age
in virtually all duck-rearing countries and causes the most common
form of duck hepatitis encountered. The clinical disease is
characterized by sudden onset and rapid spread. Ducklings show
signs of lethargy and ataxia, lose their balance, fall on their sides,
and kick spasmodically before death, which may occur in as little as
1-2 hr following the onset of signs. At death, the head is usually
drawn back in the opisthotonos position. Practically all mortality in
a flock will occur within 3-4 days, with the majority of deaths on
the second day. Gross pathologic changes appear primarily in the
liver, which becomes enlarged with distinct punctate and
ecchymotic hemorrhages. Splenomegaly and swollen kidneys with
some congestion of renal blood vessels may also be seen (14).
Duck Hepatitis Virus Type II
Duck hepatitis virus type Π produced clinical signs and pathologic
changes similar to DHV type I in fattening ducks up to 6 wk of age.
It has only been reported in the United Kingdom (5). Affected birds
may show signs of polydypsia, have loose droppings, and show
excessive urate excretion. They usually die within 1-2 hr following
the onset of signs. Gross pathologic changes are similar to those
produced by DHV type I, but the enlarged spleens may have
scattered pale foci. The alimentary tract is often empty, although the
small intestine may contain mucus; hemorrhagic areas on the
intestinal wall are sometimes seen. Petechial hemorrhages may
occasionally be seen on the heart (5, 6).
175
The presence of DHV type I may be confirmed by one or more of
the following procedures:
1) Subcutaneous (SC) or intramuscular (IM) inoculation of the
isolate into l-to-7-day-old DHV type I-susceptible ducklings.
This is probably the most sensitive and reHable method. The
characteristic clinical disease should follow, with deaths often
occurring within 24 hr of inoculation. Ducklings should show the
gross lesions associated with DVH type I. Virus should be isolated
from Evers to confirm the diagnosis.
2) Inoculation of serial dilutions of Ever homogenate into the
aUantoic sacs of embryonating duck eggs (aged 10-14 days) from a
DHV type I-free flock, or chicken eggs (aged 8-10 days). DHV
type I-infected duck embryos should die within 24—72 hr; chicken
embryos are more variable and erratic in their response and usually
take 5-8 days to die. The allantoic fluid is opalescent or a pale
greenish yeEow. Gross pathologic changes in the embryos include
stunting, subcutaneous hemorrhages over the whole body, and
edema, particularly of the abdominal and hind limb regions. The
embryo Evers may be swollen, red and yeEowish in color, and show
some necrotic foci. The Ever lesions and stunting become more
apparent in embryos that take longer to die.
Peter R. Woolcock
3) Inoculation of primary cultures of duck embryo liver cells (15)
with serial dilutions of liver homogenate containing DHV type I
cause a cytopathic effect (CPE) that is characterized by cell
rounding and necrosis. The cell monolayer at the time of infection
must be washed free of mammalian sera, which inhibit virus
adsorption (3). When the cultures are overlaid with a maintenance
medium containing 1% agarose (w/v), the CPE appears as plaques;
the size of the plaques may be controlled by the addition of 0.1%-
0.2 % fetal calf serum (FCS) to the medium. Plaques appear after
72-96 hr incubation.
Duck Hepatitis Virus Type Π
The presence of DHV type Π may be confirmed by one or more of
the following procedures:
1) Inoculation (SC or IM) of 1 to 7-day-old susceptible ducklings. A
mortality rate of up to 20% may occur within 2-4 days but the
response may be variable. The gross pathology is similar to that
observed in field cases (5).
2) Inoculation into embryonating chicken or duck eggs, via either
the amniotic cavity or yolk sac. Usually no embryo deaths occur
during early passages, but some mortality and pathologic changes
may occur after four passages. Embryos take 6-10 days to show
evidence of infection; when this occurs, the embryos are stunted
and have green, necrotic livers (6).
Duck Hepatitis Virus Type HI
The presence of DHV type HI may be confirmed by one or more
of the following procedures:
1) Intramuscular or preferably intravenous inoculation of liver
suspension into susceptible 1-day-old ducklings. The mortality rate
may reach 20%, with 60% morbidity. No deaths occur in the first 24
hr, and all virus-specific losses occur between the second and fourth
days following inoculation.
2) Inoculation of the suspension onto the chorioallantoic membrane
(CAM) of 10—day—old embryonating duck eggs. The response is
erratic, but some embryo mortality usually occurs within 7-10 days.
Infected CAMs have a dry, crusty appearance, beneath which they
are edematous. The embryos may be stunted and edematous with
hemorrhages in the skin. The liver, kidneys, and spleen become
enlarged. Attempts to cultivate the virus in embryonating chicken
eggs have not been successful.
AGENT IDENTIFICATION
Morphology
All three DHV types are small nonenveloped RNA viruses. DHV
type I has been classified in the family Picornaviridae, most closely
related to members of the genus Parechovirus (9). Virus particle
size has been reported as ranging between 20-40 nm in diameter
(14). DHV type Π has astrovirus-like morphology and virions are
28-30 nm in diameter. It is classified in the family Astroviridae as
duck astrovirus I (DAstV-I) (11). DHV type ΙΠ is thought to be a
picomavirus unrelated to DHV type I and has a particle size of
approximately 30 nm diameter (8).
Physicochemical Properties
All three DHV types are resistant to pH 3, trypsin, and lipid
solvents (e.g., chloroform). The resistance to chloroform is
advantageous, allowing the purification of infectious viruses while
removing high lipid content of duckling liver samples. Chloroform
acts not only as a lipid solvent but also a protein precipitant.
Duck Hepatitis Virus Type L Duck hepatitis virus type I is stable
at 50 C for 60 min, with heat stability unaffected by 1 M divalent
cations (Mg2+). The virus, which is highly stable under adverse
environmental conditions, can be inactivated with 1% formaldehyde
and 2% caustic soda in 2 hr, 2% calcium hypochlorite in 3 hr,
chloramin in 5 hr, 0.2% formalin in 2 hr, 5% phenol, undiluted
176
Wescodyne (an organic iodine solution; Penetone/West, Tenafly,
N.J.) and undiluted Clorox (sodium hypochlorite, Clorox Company,
Oakland, Calif.) (14).
Duck Hepatitis Virus Type Π. Duck hepatitis virus type Π is
stable at 50 C for 60 min. Formaldehyde fiimigation and standard
disinfection procedures have eliminated the infection from
contaminated premises (5).
Duck Hepatitis Virus Type HL Duck hepatitis virus type HI is
inactivated at 50 C irrespective of the presence of MgCl2.
Biological Properties
All three DHV types lack the ability to agglutinate avian or
mammalian erythrocytes.
Strain Variability
Duck Hepatitis Virus Type I. Duck hepatitis virus type I, often
referred to as classical DHV, is genetically highly stable. Viruses
serologically distinct from type I have been reported from India and
Egypt, but their relationship to other DHV types is unknown. An
apparent serologic variant, Bamhardt, has been isolated from one
farm in the United States. It shows partial cross-neutralization with
DHV type 1(1, 13).
Duck Hepatitis Virus Type Π. Duck hepatitis virus type Π,
originally thought to be a variant of type I, is serologically distinct
and is now classified as a separate virus type, namely an astrovirus.
It has only been isolated from ducklings in the United Kingdom. No
serologic variants of type Π virus have been isolated.
Duck Hepatitis Virus Type HI. Duck.hepatitis virus type HI has
been reported only in the United States. There are no serologic
cross-reactions with DHV types I or Π. Although type HI virus has
been isolated from more than one geographic region of the United
States, no variants of type HI have been reported.
Characteristics of Vaccine Strains
Duck Hepatitis Virus Type I. A live-virus vaccine containing
DHV type I, for use in breeder ducks and in susceptible ducklings,
has been produced from attenuated DHV type I passaged more than
80 times in embryonating chicken eggs. The vaccine strain is lethal
for 8 to 10-day-old chicken embryos, causing mortality and lesions
within 48-72 hr of inoculation. Lesions seen in the dead embryos
include stunting, subcutaneous hemorrhaging, edema, hemorrhages
in the liver and kidney, and occasional greenish discoloration of the
liver. Vaccine virus cannot be distinguished from the duckling-
virulent virus on the basis of the types of lesions produced in
chicken embryos, but the time frame for the development of lesions
in embryos is usually shorter with the vaccine virus than with the
duckling-virulent virus. An inactivated DHV type I vaccine has also
been described (16). Both live and inactivated DHV type I vaccines
are licensed for use in the USA.
Duck Hepatitis Virus Type Π. A live attenuated virus vaccine has
been used experimentally under field conditions to protect
ducklings (5). The vaccine virus originated from a field isolate and
was attenuated by 25 serial passages in embryonating chicken eggs
(6). This experimental vaccine, developed in the United Kingdom,
is not licensed for use in the United States.
Duck Hepatitis Virus Type HI. A live attenuated DHV type HI
vaccine has been used in breeder ducks to provide maternal
immunity in newly hatched ducklings. The vaccine, prepared with
virus that was attenuated by 30 serial passages in embryonating
duck eggs, is still experimental and is not currently licensed for use
in the United States.
Differentiation of DHV Isolates. Duck hepatitis virus type I
usually runs a peracute course, and mortality up to 100% within 2-3
days of onset is not uncommon. The sudden onset, rapid spread, and
acute course of this disease are characteristic. Hemorrhagic lesions
in the livers of ducklings less than 3 wk of age are practically

pathognomonic. DHV type ΙΠ rarely causes mortality above 20%.
Mortality caused by DHV type Π ranges between 10% and 50%.
Duck hepatitis virus type I is the only type to produce a CPE in
duck embryo liver cells. DHV type Π may be distinguished by its
distinctive morphology by negative stain electron microscopy. DHV
type ΙΠ is the only type to cause drying and thickening of the CAM
in embryonating duck eggs. When a mixed infection occurs with
type I and type Π or type ΙΠ virus, methods other than cultural
techniques must be used, because DHV type I is more virulent and
overwhelms the other virus types in its expression.
Antigen Detection
Duck Hepatitis Virus Type I. Various serologic tests have been
used for virus identification:
1) One-to-7-day-old ducklings susceptible to DHV type I are
passively immunized (SC) with 1-2 ml specific hyperimmune
serum or specific egg-yolk antibody and then challenged IM or SC
24 hr later with 0.2 ml of the virus isolate (titer not determined). A
control group of uninoculated ducklings is similarly challenged.
Virus identification is based on 80%-100% survival in the passively
immune ducklings and 80%-100% mortality in the controls.
2) One-to-7-day-old DHV type I-susceptible and DHV type I-
matemally immune ducklings are challenged IM or SC with 0.2 ml
of the virus isolate (titer undetermined). Identification is based on
80%-100% losses in the susceptible ducklings and 80%-100%
survival in the maternally immune ducklings.
3) Serial 10-fold dilutions of the virus isolate are mixed with equal
volumes of DHV type I-specific hyperimmune serum diluted 1:5 or
1:10. The mixtures are allowed to react at 37 C or room temperature
for 1 hr and then are inoculated into susceptible ducklings (0.2 ml
SC), into the allantoic cavity of embryonating duck eggs (0.2 ml),
and onto primary duck embryo liver (DEL) cell monolayers (2, 15).
Controls in each case consist of the virus isolate mixed with normal
control serum.
Duck Hepatitis Virus Type Π. Serologic techniques have not
been employed routinely because the immunologic response to
infection of both ducklings and duck embryos is poor. However, a
neutralization assay has been used for virus identification. Chicken
embryos are inoculated via the amniotic cavity with constant-serum
varying-virus mixtures (5). Cross-protection tests have been
performed in 2 to 4-day-old ducklings; these are inoculated with
antisera to types I and Π, and then challenged 3 days later with the
virus isolate (5). DHV type Π can be detected by negative stain
electron microscopy of liver and fecal preparations, and has
astrovirus-like morphology (5, 6).
Duck Hepatitis Virus Type HI. The lower incidence of mortality
(maximum of 20%) in ducklings that are experimentally infected
with DHV type ΙΠ makes virus-neutralization tests in vivo difficult.
A virus-neutralization test using the constant-serum varying-virus
method is possible in embryonating duck eggs inoculated by the
dropped-CAM route. Attempts to induce a CPE with the virus in
cell cultures have not been successful, although the virus has been
detected by direct immunofluorescence in experimentally infected
cell cultures of duck embryo liver and duck embryo kidney (DEK)
(8).
Molecular identification
A one-step reverse transcriptase polymerase chain reaction for
DHV-1 has been reported (10). The assay is based on primers
specific to the sequence coding for the 3D protein. Primers
designated DHV-1 ComF (5’-AAG AAG GAG AAA ATY(C or T)
AAG GAA GG-3’) and DHV-1 ComR (5’- TTG ATG TCA TAG
CCC AAS(C or G) ACA GC-3’) flank a 467 base pair DNA
sequence in the 3D gene. One-step RT-PCR was conducted using
the Maxime RT-PCR PreMix kit (iNikron Biotechnology, Korea).
The 20 μΐ reaction mixtures contained 1U of OptiScript Reverse
Transcriptase, 2.5 mM dNTPs, 2.5 U i-StarTaq DNA polymerase
177
Chapter 37 Duck Hepatitis
and RT -PCR buffer (50 mM Tris-HCl and 75 mM KC1). In
addition, the following components were included in the reaction: 4
μΐ (50 ng) RNA template, 1 μΐ (10 pmol μΓ1) of each specific
primer, and DEPC-treated dH2O to a total reaction volume of 20 μΐ.
A T gradient thermocycler was used for one-step RT-PCR. Reverse
transcription was performed at 45 C for 30 min, after which the
enzyme was inactivated at 94 C for 5 min. PCR amplification was
conducted using an initial denaturation for 20 s at 94 C, followed by
40 cycles of annealing for 30 s at 52 C, extension for 30 s at 72 C
and denaturation for 20 s at 94 C, and a final extension for 5 min at
72 C. The PCR products (10 μΐ) were separated by electrophoresis
(100 V) in horizontal 1.5% agarose gels and Tris-acetate buffer (40
mM tris-acetate, 1 mM EDTA). Gels were stained with ethidium
bromide (0.5 pg ml'1), visualized under UV light and photographed.
The DHV-1 sequences used in this report have been assigned the
following accession numbers in GenBank: DQ219396, DQ226451,
DQ256132, DQ256133, DQ256134.
SEROLOGIC DETECTION IN THE HOST
Serologic tests have little value in the diagnosis of acute infections
caused by DHV types I, Π, and HL
All three DHV types have been used in virus-neutralization tests in
ovo, but their success depends on the expression of the virus in the
assay system used; with type Π and ΙΠ viruses this can be a
problem. In vitro tests have been developed for DHV type I; these
include a plaque reduction assay and a microtiter assay (14, 15).
The plaque reduction assay may be performed using either primary
DEK or DEL cells. Primary cell culture monolayers are prepared in
Eagles minimum essential medium* (EMEM) containing 5%—10%
FCS, 2 mM glutamine, 0.17% sodium bicarbonate, and gentamicin.
Trypsinized cells are seeded into 5-cm-diameter petri dishes, and
then incubated at 37 C in a 5% CO2 atmosphere. Monolayers should
be nearly confluent at 24-48 hr post-seeding. The monolayers are
washed twice with serum-free EMEM or Hanks’ balanced salt
solution to remove all traces of FCS before infecting with DHV
type I. Equal volumes of DHV type I suspended in serum-free
EMEM, adjusted to 200 plaque-forming units per 0.1 ml, are mixed
with equal volumes of serially diluted duck sera (twofold dilutions
in EMEM). The serum samples should be heat inactivated at 56 C
for 30 min before testing. The virus-serum mixtures are incubated at
37 C for 1 hr, and then 0.1-ml aliquots are added to the confluent
cell monolayers, three dishes per dilution. The plates are left for 30
min at room temperature (20-22 C), and then overlaid with agarose
maintenance medium (EMEM containing 2% chicken serum and
0.1%-0.2% FCS to which agarose had been added to a final
concentration of 1% [w/w]). The plates are then placed at 37 C in a
5% CO2 atmosphere. The number of plaques produced is recorded
after 48 hr of incubation. Plaques may be observed using an oblique
light source, or alternatively, monolayers may be fixed with 10%
formol-buffered saline and stained with 1% crystal violet. Serum
antibody titers are expressed as the reciprocal of the highest serum
dilution that reduces the plaque count by 50%.
A microtiter neutralization assay may be performed using primary
DEK cells. Serial twofold dilutions of each serum sample (heat
inactivated) are prepared in 50 μΐ of serum-free basal medium,
Eagle (BME) in microtiter plates. Approximately IO20 median
tissue culture infective doses of DHV type 1 in 50 μΐ of BME are
added to each well and the mixtures are allowed to react at 37 C for
1 hr. Primary DEK cells are suspended in BME supplemented with
10% tryptose phosphate broth, 2 mM L-glutamine, 0.17% sodium
bicarbonate and 2%-4% chicken serum, and are adjusted to contain
3 x 105 cells per milliliter. Cells are next added to the plates at 100
μΐ per well and the plates are then incubated for up to 96 hr at 37 C
in a humidified 5% CO2 atmosphere. Following incubation, cells
are fixed with 10% formol-buffered saline and stained with 1%
crystal violet. The plates are read macroscopically. The titer for
Peter R. Woolcock
virus neutralizing activity is expressed as the reciprocal of the
highest dilution of serum at which a monolayer grew, that is, there
is no evidence of CPE and therefore complete virus neutralization
has occurred. A titer of less than 4 log2 is considered negative.
These neutralization tests have been used to assay humoral immune
responses to vaccination and for epidemiologic surveys, as well as
for virus identification.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Most viral pathogens other than DHV do not cause disease in
ducks less than 6 wk old; all three types of DHV are resistant to
chloroform, which will inactivate most other viral pathogens, for
example, duck virus enteritis, Newcastle disease virus, and avian
influenza virus. Disease outbreaks caused by serologic variants of
DHV type I, type Π, or type HI can present a problem in
determining an etiology, particularly when attenuated classic DHV
type I is present as a result of vaccination. Dual infections of DHV
type I and Chlamydophyla psittaci (2) and influenza virus (7) have
also been reported. Other causes of acute mortality in ducklings
include salmonellosis and aflatoxicosis. The latter disease may
cause ataxia, convulsions, and opisthotonos, as well as microscopic
lesions of bile-duct hyperplasia that are suggestive of duck hepatitis,
but aflatoxicosis does not cause die same characteristic
hemorrhages in the liver.
REFERENCES
1. Calnek, B. W. Duck virus hepatitis. In: Virus infections of birds. J. B.
McFerran and M S. McNulty, eds. Elsevier Science Publishers Β. V.,
Amsterdam, pp 485-495. 1993.
2. Chalmers, W. S., H. Farmer, and P. R. Woolcock Duck hepatitis virus
and Chlamydia psittaci outbreak [letter]. Vet Rec 116:223. 1985.
3. Chalmers, W. S. K., and P. R. Woolcock The effect of animal sera on
duck hepatitis virus. Avian Path 13:727-732. 1984.
4. Femholz, D., H. Wetz, and H. Will Hepatitis B Viruses in birds. In: Virus
infections of birds. J. B. McFerran and M S. McNulty, eds. Elsevier Science
Publishers, Β. V, Amsterdam, pp 111-119. 1993.
178
5. Gough, R. E., E. D. Borland, I. F. Keymer, and J. C. Stuart An outbreak
of duck hepatitis type II in commercial ducks. Avian Path 14:227-236. 1985.
6. Gough, R. E., and J. C. Stuart Astroviruses in ducks (duck virus hepatitis
type Π). In: Virus infections of birds. J. B. McFerran and M S. McNulty,
eds. Elsevier Science Publishers, Β. V., Amsterdam, pp 505-508. 1993.
7. Gough, R. E., and A. S. Wallis Duck hepatitis type I and influenza in
mallard ducks (Anas platyrhynchos). Vet Rec 119:602. 1986.
8. Haider, S. A., and B. W. Calnek In vitro isolation, propagation, and
characterization of duck hepatitis virus type ΙΠ. Avian Dis 23:715-729.
1979.
9. Kim, Μ-C., Y.-K. Kwon, S.-J. Joh, A. M Lindberg, J.-H. Kwon, J.-H.
Kim, and S.-J. Kim Molecular analysis of duck hepatitis virus type 1 reveals
a novel lineage close to the genus Parechovirus in the family
Picornaviridae. Journal of General Virology 87:3307-3316. 2006.
10. Kim, Μ-C., Y.-K. Kwon, S.-J. Joh, J.-H. Kwon, J.-H. Kim, and. S-J.
Kim. Development of one-step reverse transcriptase-polymerasae chain
reaction to detect duck hepatitis virus type 1. Avian Dis 51. 2007.
11. Koci, M D., and S. Schultz-Cherry. Avian astroviruses. Avian Pathol
31:213-227. 2002.
12. Mason, W. S., G. Seal, and J. Summers Virus of Pekin ducks with
structural and biological relatedness to human hepatitis B virus. J Virol
36:829-836. 1980.
13. Sandhu, T. S., B. W. Calnek, and L. Zeman Pathologic and serologic
characterization of a variant of duck hepatitis type I virus. Avian Dis
36:932-936. 1992.
14. Woolcock, P. R. Duck Hepatitis. In: Diseases of Poultry. S. Y.M, H. J.
Bames, J. R. Glisson, A. M Fadly, L. R. McDougald and D. E. Swayne,
eds. Iowa State Press, pp 343-354. 2003.
15. Woolcock, P. R. An assay for duck hepatitis virus type I in duck embryo
liver cells and a comparison with other assays. Avian Path 15:75-82. 1986.
16. Woolcock, P. R. Duck hepatitis virus type I: Studies with inactivated
vaccines in breeder ducks. Avian Path 20:509-522. 1991.
 38
TURKEY VIRAL HEPATITIS
Willie M. Reed

SUMMARY. Turkey viral hepatitis (TVH) is a highly contagious, often subclinical disease of turkey poults fewer than 5 wk of age. Because
of the clinical nature of the disease and lack of a readily available serologic assay, the true incidence of infection is unknown. Turkey viral
hepatitis is characterized by multifocal hepatic and pancreatic necrosis, frequently accompanied by inflammatory cells composed
predominantly of lymphocytes and macrophages and lesser numbers of heterophils. The etiologic agent has not been fully characterized but
has morphologic features of a picomavirus.
Agent Identification The virus can be propagated by yolk sac inoculation in 5 to 7 day-old embryonated chicken embryos. Diagnosis is
based on the presence of typical gross and microscopic lesions in the liver and pancreas of affected poults, lack of isolation of other bacterial
and viral pathogens, and rarely by isolation of the virus.
Serologic Detection in the Host. There are no readily available serologic assay.

INTRODUCTION necessary. The supernatant from centrifugation for 20 min at 1500 x

Turkey viral hepatitis results from infection by picomavirus-like
virus that produces hepatic and pancreatic lesions only in turkeys
(1,2,3,4). The infection is frequently subclinical and occurs only in
turkey poults where poorly defined stressors are necessaiy for
clinical expression. Chickens, quail, pheasants, ducks, mice, and
rabbits are refractory to infection. It is not of major economic
importance, and a high standard of sanitation and good husbandry
minimize the effects of the disease. Turkey viral hepatitis was first
described in North America in 1959 and occurs in most, if not all,
areas of intensive commercial turkey production (5,7). It has also
been reported in Italy and the United Kingdom (2).
g is injected in 0.2 ml amounts into the yolk sac of 5 to 7 day-old
chicken embryos. Embryos are observed for 10 days. Dead embryos
(have cutaneous congestion and hemorrhage.) Mortality usually
occurs between 5 and 10 days postinoculation, but low virus titers
in the inoculum may require a second passage of yolk harvest
before a typical mortality pattern develops. Embryonated turkey
embryos up to 10 days of age are suitable for virus propagation but
are not the preferred culture system, due to the possible presence of
maternal antibodies. Turkey viral hepatitis virus has not been
propagated in cell culture.
AGENT IDENTIFICATION

CLINICAL DISEASE AND PATHOLOGY
Clinical disease is generally seen only in turkeys fewer than 5 wk
of age and is marked by sudden mortality, ranging to 25% (2).
However, morbidity rates of up to 100% have been described in
some flocks (2). Mortality is largely confined to a 4 to 8-day period.
Gross lesions of TVH are confined to the liver and pancreas. The
liver is generally enlarged and contains disseminated, focal to
coalescing, gray and sometimes depressed foci that may be
obscured by the presence of congestion and foci of hemorrhage.
Pancreatic lesions occur less frequently than hepatic lesions.
Lesions in the pancreas occur most commonly on the dorsal surface
and consist of round to oval, gray to white foci.
Microscopic lesions in the Ever are characterized initially by
vacuolation of hepatocytes followed by dense infiltration with
macrophages, lymphocytes, and mononuclear cells and by
proliferation of bile ductules. As the lesions progresses, there is
prominent necrosis with pooling of blood around necrotic foci,
where separated hepatocytes frequently fuse to form syncytial cells.
Inclusion bodies have not been detected. Pancreatic lesions are
similar and are characterized by acinar cell degeneration and
necrosis along with infiltration of macrophages and lymphocytes.
Although vertical transmission of TVH virus is suspected, primarily
based on field observations, this is not proven.
SAMPLE COLLECTION
Livers with characteristic lesions are preferred, although isolation
of the virus can be made from a variety of tissues, including
pancreas, spleen, and kidney, and from the feces. Refrigerated,
intact, dead poults are preferred, but aseptically collected,
refrigerated or frozen livers with lesions are satisfactory.
PREFERRED CULTURE MEDIA AND SUBSTRATES
The turkey hepatitis virus has not been fully characterized but is
reported to have morphologic features of a picomavirus. It is
resistant to chloroform, ether, phenol, and creoline but not to
formalin. The virus will survive in yolk for 6 hr at 60 C, 14 hr at 56
C, and 4 wk at 37 C. It will also survive for 1 hour at pH 2 but not
at pH 10 (8,9). It passes through a 0.1 nm membrane. Lesions in
infected embryos, while highly suggestive of TVH, are not
definitive, and while the finding of characteristic lesions in
diagnostic specimens allows for a strong presumptive diagnosis,
added assurance is secured by reproducing the disease. At least 6,
one to 7-day-old poults are injected intramuscularly,
subcutaneously, or intraperitoneally with 0.2 to 0.5 ml of liver
suspension (preferably) or with yolk fluid from infected embryos
(6). As clinical signs seldom develop, one or more poults should be
euthanized and examined daily, starting 5 to 7 days after
inoculation. A comparable isolated control group should likewise be
examined to preclude preexisting infection. Lesions are usually
much less severe than in natural infections. Neither lesions nor viral
replication occur in chicks.
SEROLOGIC DETECTION IN THE HOST
Although substantial resistance to reinfection has been reported,
no means of serologic identification has been developed. The
characteristic low titer of the virus in yolk following embryo
propagation, usually less than a mean embryo infectious dose of
3.5, has severely hampered further study.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Bacterial infections, particularly from Salmonella sp., Pasteurella
multocida, or Escherichia coli, and infections caused by Group 1
and Group 2 avian adenovirus, reovirus, and Histomonas
meleagridis must be ruled out.

Tissue homogenates should be prepared for embryo inoculation by

grinding in 5-10 parts of nutrient broth or phosphate-buffered
saline. Antibiotics and antifungals, to control possible
contaminating bacteria and fungi, may be used but are seldom
179
Willie M Reed
ACKNOWLEDGEMENT
The contributions of the late Dr. G. H. Snoyenbos, a previous author of this
chapter, are acknowledged and appreciated.
REFERENCES
1. Andral, Β., M Lagadic, G. Bennezeon, D. Toquin, and J. M Florent.
Picoma-like viruses of young turkeys: Pathogenesis of a disease of poults
caused by a picoma-like virus. Avian Pathol. 19:245-254. 1990.
2. Guy, S. J. Turkey viral hepatitis. In: Diseases of Poultry, 10th ed. B. W.
Calnek, H. J. Bames, C. W. Beard, L. R. McDougald, and Y. M Saif, eds.
Iowa State University Press, Ames, Iowa, pp. 773-777,1997.
3. Klein, P. N., A. E. Castro, C. U. Meteyer, B. Reynolds, J. A
Swartzmann-Andert, G. Cooper, R. P. Chin, and H. L. Shivaprasad.
Experimental transmission of turkey viral hepatitis to day-old poults and
identification of associated viral particles resembling picomaviruses. Avian
Dis. 35:115-125. 1991.
180
4. MacDonald, J. W., C. J. Randall, and M D. Dagless. Picoma-like virus
causing hepatitis and pancreatitis in turkeys. Vet. Rec. Ill :322. 1982.
Mongeau, J. D., R. B. Truscott, A. E. Ferguson, and M C. Connell. Virus
hepatitis in turkeys. Avian Dis. 3:388-396. 1959.
5. Snoeyenbos, G. H., and Η. I. Basch. Further studies of virus hepatitis in
turkeys. Avian Dis. 4:477-485. 1960.
6. Snoeyenbos, G. Η., Η. I. Basch, and M Sevoian. An infectious agent
producing hepatitis in turkeys. Avian Dis. 3:377-388. 1959.
7. Tzionabos, T., and G. H . Snoeyenbos. Some physicochemical properties
of turkey hepatitis virus. Avian Dis. 9:152-156. 1965.
8. Tzionabos, T., and G. H. Snoyenbos. Clinical, immunological, and
serological observations on turkey virus hepatitis. Avian Dis. 9:578-591.
1965.
 39
VIRAL ARTHRITIS/TENOSYNOVITIS AND OTHER REOVIRUS INFECTIONS
John K. Rosenberger and Erica Spackman

SUMMARY. Viruses of the family Reoviridae, genus Orthoreovirus, infect a variety of bird species including commercial poultry. Viral
arthritis/tenosynovitis in poultry is the most important pathologic manifestation of avian reovirus infection. A malabsorption syndrome in
chickens that includes stunting, diarrhea, osteoporosis, and fragmentation of the proximal end of the femur has also been associated with
reovirus infection. However, several different etiologic factors have been implicated in malabsorption syndrome. Other disease conditions
associated with reovirus infections include hepatitis, myocarditis, hydropericardium, and respiratory and intestinal tract involvement. Many
reovirus infections are subclinical.

VIRAL ARTHRITIS/TENOSYNOVITIS
Agent Identification. Presumptive diagnosis is based on gross lesions including bilateral enlargement of the shank and tendon bundles
above the hock in chickens, and lesions in chicken embryos inoculated at 5 to 7 days of embryonation via the yolk sac, or cytopathic effects
and syncytia formation in chicken kidney cell cultures. Confirmation of reovirus is through demonstration of specific antigens in embryos,
synovium or cell cultures, by agar gel immunodiffusion, or fluorescent antibody tests.
Serologic Detection in the Host. ELISA, virus neutralization and agar gel immunodiffusion tests can be used to document past infections.
However, because reovirus infections can be subclinical and are ubiquitous, flock history and other information must be evaluated before
interpreting serologic results.

OTHER SYNDROMES
Agent Identification. Diagnosis is best made by virus isolation in embryos or cell cultures with confirmation by detection of reovirus
specific antigens. Experimental reproduction of the field syndrome may be necessary to determine if reovirus is the etiology.
Serologic Detection in the Host. ELISA, virus neutralization and agar gel immunodiffusion tests can be used to document past infections.
However, because reovirus infections can be subclinical and are ubiquitous, flock history and other information must be evaluated before
interpreting serologic results.

INTRODUCTION
Avian reoviruses are prevalent in chickens, turkeys, and other
avian species (13,15,16,17,21,26). Avian reoviruses have been
isolated from chickens affected by an assortment of disease
conditions, including viral arthritis/tenosynovitis (5,9,10,13,15,22),
stunting syndrome (14), respiratory disease (3,6,12,16), enteric
disease (2,6), malabsorption syndrome (11,14), and osteoporosis
(23)
. In addition, avian reoviruses have been found frequently in
clinically unaffected chickens. The severity and nature of the
disease, such as viral arthritis/tenosynovitis that occurs following
reovirus infection, depend upon host age, virus virulence, and route
of exposure. Turkeys infected with reoviruses may present with
similar disease conditions to those described in chickens and
disease presentation is strain dependent. However, strains that
induce a particular disease condition in chickens will not
necessarily induce similar disease in turkeys and vice versa (1, 19).
Therefore, the pathogenic potential of avian reovirus isolates must
be evaluated in their species of origin.
CLINICAL DISEASE
Viral Arthritis/Tenosynovitis
The most commonly recognized disease that is associated with
avian reovirus is viral arthritis/tenosynovitis. The principal signs in
4 to 7-wk-old broilers are bilateral enlargement of the shank and the
tendon bundle above the hock, causing limited tendon movement
and lameness with occasional rupture of the gastrocnemius tendon.
Hepatitis, myocarditis, and splenitis may be seen in 1 to 7-day-old
chicks.
Microscopically, hypertrophy and hyperplasia of the synovial cells
occurs (24). The synovial lining is infiltrated with heterophils,
lymphocytes, plasma cells, and macrophages. In chronic cases,
synoviae develop villus processes with fibrosis of tendon sheaths.
Granulomatous inflammation may encompass and replace tendons.
Lesions in the heart consist of heterophil infiltration between the
myocardial fibers, which may be accompanied by focal areas of
proliferating reticular cells. Perivascular accumulations of
lymphocytes are frequent (7).
181
Malabsorption Syndrome
Reovirus infections have been associated with malabsorption
syndrome, but their exact etiologic relationship remains unclear.
Clinical signs in 1 to 3 wk-old chickens attributed to malabsorption
syndrome include poor pigmentation, abnormal feathering,
osteoporosis, uneven growth, undigested feed in the feces, and
increased mortality (11,14,25). Lesions may include an enlarged
proventriculus, catarrhal enteritis, and lameness associated with
tenosynovitis.
Lesions observed histopathologically include proventriculitis,
myocarditis, atrophy of the cloacal bursa (bursa of Fabricius),
pancreatitis, enteritis, and atrophy of intestinal villi (11,14). Clefts
in the femoral growth plate with necrosis of the cartilage and
fragmentation of the femoral heads have also been reported (11).
SAMPLE COLLECTION
The synovial fluid from the tibiotarsal or tibiofemoral joints
should be collected with a sterile swab, or a 10% extract of
edematous synovium (tendon sheaths) in nutrient broth or cell­
culture medium prepared with a Tenbroeck grinder (VWR
Scientific Products, West Chester, Penn.). Swabs or tissue
homogenates can also be taken from the spleen, cloaca, or trachea.
The digestive and respiratory phases of reovirus infections are of
short duration making virus isolation from those tissues difficult.
When sampling turkeys the bursa of Fabricius should be collected.
Specimens should be stored at -70 C until used, but can be stored at
-20 C for short periods. Repeated cycles of freezing and thawing
should be avoided.
PREFERRED CULTURE MEDIA AND SUBSTRATES
The virus can be cultured in the yolk sac or on the chorioallantoic
membrane (CAM) of embryonating chicken eggs, chick embryo
liver cells, or in chicken kidney cells (CKC) (17). No direct
comparisons have been made between the CKC and embryo
methods, but for original isolation the yolk-sac route in chicken
embryos is preferred.
John K. Rosenberger and Erica Spackman
Embryo Inoculation
The eggs should come from a reovirus-free, antibody-negative
flock. The preferred route of inoculation is the yolk sac in 5 to-7
day-old embryonating chicken eggs; 0.1-0.2 ml of suspect material
is inoculated per egg. The allantoic-sac route of inoculation is
usually not satisfactory. The CAM route can be used to demonstrate
pock-like lesions and cytoplasmic inclusions.
Yolk-sac inoculation kills the embryo in 3-5 days. The embryo is
markedly hemorrhagic or may show a purplish-red discoloration.
The internal organs are congested and hemorrhagic. Embryos that
survive until 17-21 days are slightly dwarfed, and the liver, spleen,
and heart are enlarged and contain necrotic foci.
Inoculation on the dropped CAM of 10-day-old embryonated
chicken eggs kills the embryo in 3-5 days, and pock-like lesions
may develop on the CAM. Inclusion bodies can be seen in the
mesodermal cells of the CAM by using hematoxylin and eosin stain
or fluorescein-labeled antibody.
Cell Culture
Primary CKC from 2 to 6-wk-old chicks are preferred over
chicken embryo fibroblasts for the culture of avian reoviruses. The
medium for CKC appears not to be critical. Satisfactory media are
minimum essential medium (MEM) or Eagle medium (modified),
with Earl’s salt and glutamine; 10% fetal calf serum and sodium
bicarbonate at 1.5 g/liter; and for maintenance, 3% calf serum and
sodium bicarbonate at 1.5 g/liter. Antibiotics used per liter of
medium are 100,000 units of penicillin, 0.1 g dihydrostreptomycin,
and 2.5 mg amphotericin B. A humidified incubator with about 5%
CO2 in air is desirable.
Following inoculation of CKC, syncytia formation occurs often as
early as 24-48 hr. The syncytia float free, leaving holes in the
monolayer. The floating syncytia are bound by a membrane
showing a mass of dead cells with a clear area resembling a halo.
As the virus becomes more adapted to cell culture, the entire cell
sheet may degenerate in 24 hr.
AGENT IDENTIFICATION
Morphology and Physicochemical Properties
The reoviruses are double-stranded RNA viruses in the family
Reoviridae, genus Orthoreovirus (4). The nucleic acid type can be
determined directly by using metabolic inhibitors (4). Multiplication
of the virus is not inhibited in the presence of DNA metabolic
inhibitors, actinomycin-D at 0.5 pg/ml, cytosine arabinoside at 100
pg/ml, or 5-fluoro-2-deoxyuridine at 300 pg/ml in primary CKC
.
(24) The virus is thermostable and resistant to ether, chloroform,
and a pH of 3.0 (13). Structurally, reovirus particles consist of a 45-
nm core and a 75-nm capsid and often form crystalline arrays in the
cytoplasm of infected cells (24). The capsid is an icosahedron
consisting of 92 capsomeres.
Virus Identification
A direct or indirect fluorescent antibody test with antibody against
group-specific antigen can be used for agent identification. The
agar-gel precipitin and virus- neutralization tests can also be used to
identify the virus.
The direct fluorescent-antibody test is reliable for detecting
antigen in infected tissue. The antigen can be demonstrated in the
cytoplasm of infected cells, the synovium, or CKC (6,15).
Molecular methods such as standard and real-time RT-PCR can be
used to detect avian reoviruses (18). RNA for virus detection should
be extracted from the same tissues that are used for virus isolation.
Electropherotyping can be performed by directly running RNA
extracted from a specimen on a 2% agarose gel, however high titers
of virus are necessary to visualize the electropherotype (19).
182
Virus Strain Variability
In Japan, five serotypes of avian reoviruses have been described.
These were isolated from feces, cloacal swabs, and trachea. Their
pathogenicity for the synovial and tendon tissues of chickens was
not determined (6). In the United States, four serotypes have been
identified (16). The isolates from the synovial tissues appeared to be
subtypes of a single serotype (17) and are probably similar to other
isolates (5,9). Although the pathogenicity of the avian reoviruses
should be studied further, all isolates were capable of producing an
arthritis or tenosynovitis on foot-pad inoculation of 2-wk-old
chickens. The avian reoviruses can be differentiated from human
types 1, 2, or 3 by the inability of the avian reoviruses to
hemagglutinate human O erythrocytes and the inability of human
types to grow in the yolk sac of chicken embryos. In addition, the
agar-gel precipitin and virus-neutralization tests can be used to
identify avian reoviruses. Strain differences based on relative
pathogenicity can be demonstrated with antigenically similar or
identical reovirus isolates (14).
SEROLOGIC DETECTION IN THE HOST
The agar-gel immunodiffusion (AGID) test can be used for
documenting past infections. The antigen is prepared from ground
undiluted CAMs from dead embryos that were inoculated when 5-7
days old by the yolk-sac route. Noble agar (1.2%) is used, dissolved
in 0.01 M phosphate buffer at pH 7.2 containing 8% salt and 7.5%
glycine. Glycine is not essential but may give a more distinct
reaction. Wells are prepared about 3 mm in diameter and 3 mm
apart, one centered in a circle of six. Knowh positive serum samples
should be placed in wells 1 and 4 so that a line of identity with
unknown sera can be demonstrated (15). All known avian reovirus
serotypes share a common group-specific precipitin antigen.
Precipitating antibody tends to persist in birds with joint
involvement but may disappear in 4 wk in many birds, so monthly
testing is desirable in screening for infection.
The neutralization test is best accomplished by using a plaque­
reduction test in CKC. For chicken serum, twofold dilutions may be
used. Equal amounts of virus containing 100 plaque-forming units
are mixed with the serum dilutions and incubated at 37 C for 45
min. A 0.2-ml amount is inoculated onto a CKC monolayer in a 60
x 15-mm petri dish and allowed to adsorb for 1 hr with frequent
rotation. Excess fluid is aspirated, and the cells are overlaid with 5
ml of medium consisting of MEM as listed with 5% calf serum,
0.5% lactalbumin hydrolysate, 1% peptone broth, 1.2% purified
agar, 2.2 g/liter sodium bicarbonate, and antibiotics. This is
incubated for 5-7 days and overlaid with 2 ml of 0.001% neutral
red. The plaques are counted in 4—8 hr. The titer of the serum is the
reciprocal of the highest serum dilution that inhibits 90% of the
plaques. Serum titers of 40 or more are considered significant.
Plaque inhibition on the CAM has been used, but the results are
difficult to interpret.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Arthritis/T enosynovitis
Clinical viral arthritis/tenosynovitis must be differentiated from
Mycoplasma synoviae synovitis, bacterial arthritis, and lameness
resulting from anatomical deformities. Viral arthritis can be
diagnosed in clinical outbreaks when there is a marked bilateral
enlargement of the digital flexor and metatarsal extensor tendon
sheaths. The diagnosis should be confirmed by isolation and
identification of the virus. The involved tendon bundle may need
microscopic examination to demonstrate lesions (7). Bacterial
arthritis frequently affects a single joint, but dual infection is not
uncommon, making identification of the primary etiological agent
difficult.

Pathogenic staphylococcus infections are common in affected
joints; less frequent are Salmonella, Pasteurella, and erysipelas
infections. The pathogenic mycoplasmas {Mycoplasma
gallisepticum, Mycoplasma synoviae, and Mycoplasma meleagridis)
are frequently responsible for arthritis. Culture and identification of
the organisms should be attempted.
Marek’s disease and noninfectious conditions such as rickets,
spondylolisthesis, dyschondroplasia, and toxicoses should also be
eliminated as a cause of lameness.
Malabsorption Syndrome
Proventriculitis, growth retardation, and feathering abnormalities
may be caused by other factors, such as reticuloendotheliosis virus
(25) and mycotoxins (20). Parvovirus (8) and calicivirus (27) have
been implicated as possible etiologies for a malabsorptionlike
syndrome.
Embryo Lesions and Cytopathic Effects in Cell Culture
Many viruses cause mortality in chicken embtyos that are
differentiated from reovirus-induced mortality only with difficulty.
Poxviruses and infectious laryngotracheitis virus induce pocks on
the CAM that may resemble those associated with reoviruses. Also,
poxviruses, adenoviruses, and herpesviruses may cause unique
cytopathic effects and inclusion bodies like reoviruses in cell
culture. Physicochemical, molecular and/or serologic tests may be
required for confirming the identity of a reovirus isolate.
REFERENCES
1. al Afaleq, A. I. and R. C. Jones. Pathogenicity of three turkey and three
chickens reoviruses for poults and chicks with particular reference to
arthitis/tenosynovitis. Avian Path. 18, 433-440. 1989.
2. Deshmukh, D. R., and B. S. Pomeroy. Avian reoviruses. ID. Infectivity
and egg transmission. Avian Dis. 13:427—439. 1969.
3. Fahey, J. E., and J. F. Crawley. Studies on chronic respiratory diseases of
chickens. 2. Isolation of a virus. Can. J. Comp. Med. 18:13-21. 1954.
4. Jackson, G. G., and R. L. Muldoon. Viruses causing respiratory infection
in man. IV. Reoviruses and adenoviruses. J. Infect. Dis. 128:812-833. 1973.
5. Johnson, D. C., and L. van der Heide. Incidence of tenosynovitis in
Maine broilers. Avian Dis. 15:829-834. 1971.
6. Kawamura, H., F. Shimizu, M Maeda, and H. Tsubahara. Avian
reovirus: its properties and serological classification. Natl. Inst. Anim.
Health Q. (Yatabe) 5:115-124. 1965.
7. Kerr, K. M, and N. O. Olson. Pathology of chickens experimentally
inoculated or contact-infected with an arthritis-producing virus. Avian Dis.
13:729-745. 1969.
8. Kisary, J., B. Nagy, and Z. Bitay. Presence of parvovirus in the intestine
of chickens showing stunting syndrome. Avian Pathol. 13:339-343. 1984.
9. Olson, N. O., and D. P. Solomon. A natural outbreak of synovitis caused
by the viral arthritis agent. Avian Dis. 12:311-316. 1968.
183
Chapter 39 Viral Arthritis/Tenosynovitis and Other Reovirus Infections
10. Olson, N. O., and R. Weiss. Similarity between arthritis virus and
Fahey-Crawley virus. Avian Dis. 16:535-540. 1972.
11. Page, R. K., O. J. Fletcher, G. N. Rowland, D. Gaudry, and P. Villegas.
Malabsorption syndrome in broiler chickens. Avian Dis. 26:618-624. 1982.
12. Petek, Μ, B. Felluga, G. Borghi, and A. Baroni. The Crawley agent: a
reovirus. Arch. Gesamte Virusforsch. 21:414—424. 1967.
13. Robertson, M D., and G. E. Wilcox. Avian Reovirus. Vet. Bull.
56:155-174. 1986.
14. Rosenberger, J. K. Characterization of reoviruses associated with
runting syndrome in chickens. In: Proceeding No. 66, International Union
of Immunological Societies, Sydney, New South Wales, Australia, pp. 141-
152. 1983.
15. Rosenberger, J. K., and N. O. Olson. Viral arthritis. In: Diseases of
poultry, 10th ed. B. W. Calnek, H. J. Bames, C. W. Beard, L. R_
McDougald, and Y. M. Saif, eds. Iowa State University Press, Ames, Iowa,
pp. 711-720. 1997.
16. Sahu, S. P., and N. O. Olson. Comparison of the characteristics of avian
reoviruses isolated from digestive and respiratory tract with viruses isolated
from the synovia. Am. J. Vet. Res. 36:847-850. 1975.
17. Sahu, S. P., N. O. Olson, and R. W. Townsend. Characterization of
avian reoviruses isolated from the synovia and breast blister. Avian Dis.
23:896-903. 1979.
18. Spackman, E., D. Kapczynski and H. Sellers. Multiplex Real-time RT-
PCR for the Detection of Three Viruses Associated with Poult Enteritis
Complex: Turkey Astrovirus Turkey Coronavirus, and Turkey Reovirus.
Avian Dis. 49: 86-91.2005.
19. Spackman, E., M Pantin-Jackwood, J. M Day and H. Sellers. The
Pathogenesis of turkey origin reoviruses in turkeys and chickens. Avian
Path. 34 (4) In Press. 2005.
20. Stuart, B. P., R. J. Cole, E. R. Waller, and R. E. Vesonder.
Proventricular hyperplasia malabsorption syndrome in broiler chickens. J.
Environ. Pathol. Toxicol. 6:369-386. 1986.
21. van der Heide, L. Viral arthritis/tenosynovitis: a review. Avian Pathol.
6:271-284. 1977.
22. van der Heide, L., M Kalbac, and M Brustolon. Development of an
attenuated apathogenic reovirus vaccine against viral arthritis/tenosynovitis.
Avian Dis. 27:698-706. 1983.
23. van der Heide, L., D. Lutticken, and M Horzinek Isolation of avian
reovirus as a possible etiologic agent of osteoporosis "brittle bone disease";
"femoral head necrosis" in broiler chickens. Avian Dis. 25:847-856. 1981.
24. Walker, E. R., Μ H. Friedman, andN. O. Olson. Electron microscopic
study of an avian reovirus that causes arthritis. J. Ultrastruct. Res. 41:67-79.
1972.
25. Witter, R. L. Reticuloendotheliosis. In: Diseases of poultry, 10th ed. B.
W. Calnek, H. J. Bames, C. W. Beard, L. R. McDougald, and Y. M Saif,
eds. Iowa State University Press, Ames, Iowa. pp. 467-484. 1997.
26. Wooley, R. E., T. A. Dees, A. L. Cromack, and J. B. Gratzek. Infectious
enteritis of turkeys: characterization of two reoviruses isolated by sucrose
density gradient centrifugation from turkeys with enteritis. Am. J. Vet. Res.
33:165-170. 1972.
27. Wyeth, P. J., N. T. Chettle, and J. Labrano. Avian calicivirus. Vet. Rec.
109:477. 1981.
 40
ARBOVIRUS INFECTION
Eileen N. Ostlund and Janies E. Pearson

SUMMARY. Eastern equine encephalitis (EEE), western equine encephalitis (WEE), Highlands J (HJ), West Nile (WN), and turkey
meningoencephalitis (TME) viruses are arboviruses that cause clinical disease in avian species. Eastern equine encephalitis, WEE, and HJ are
members of the genus Alphavirus in the virus family Togaviridae\ TME and WN belong to the genus Flavivirus in the family Flaviviridae.
Infections with EEE and HJ viruses in avian species have been reported primarily in the eastern and southern United States. Infections with
WEE virus have been reported primarily in the western United States. West Nile virus was first recognized in the United States in New York
in 1999. Its current range in the Western Hemisphere extends across the continental United States as well as into Canada, Mexico and the
Caribbean. Turkey meningoencephalitis or Israel meningoencephalitis has been reported only in Israel and South Africa. Clinical
manifestations of these arboviruses differ among poultry and other affected avian species but evidence of nervous system involvement
including incoordination and paralysis are common. EEE and WEE viruses have been reported to cause disease in poultry, game birds and
ratites. The primary disease that has been associated with HJ virus is a drop in egg production in turkeys. Historically, clinical manifestations
of WN infection in avian species were not described. Since the late 1990’s, WN morbidity and mortality in domestic geese and wild birds,
especially corvids, has been documented. TME virus has only been reported to cause disease in turkeys under field conditions.
Agent Identification. Eastern equine encephalitis, WEE, HJ, TME and WN viruses can be isolated from field specimens by inoculating cell
cultures, newborn mice, or embryonating chicken eggs. Identification of EEE, WEE, and HJ isolates can be achieved by complement­
fixation, immunofluorescence, or plaque-reduction-neutralization (PRN) tests. WN isolates are identified by immunofluorescence. TME virus
is identified by virus neutralization in cell culture. Polymerase chain reaction (PCR) can be used to detect EEE, WEE, HJ and WN in tissues.
Antigen capture enzyme linked immunosorbent assay (ELISA) methods have been described for EEE and WN.
Serologic Detection in the Host. Eastern equine encephalitis, WEE, WN, and HJ virus-specific antibodies can be identified in host species
by PRN or hemagglutination-inhibition (HI) tests. Several ELISAs have been described for detection of WNV, EEE or WEE antibody in
avian serum. TME viral antibody can be identified by the HI test.

INTRODUCTION viral disease. Clinical manifestations of natural WN virus infection

The arboviruses comprise a group of taxonomically diverse viruses
clustered together by their ability to replicate in and to be
transmitted by arthropod vectors. Over 530 arboviruses have been
identified. For many arboviruses, birds serve as maintenance hosts;
more than 100 arboviruses have been isolated from avian species
and birds are frequently used as sentinels for the detection of
arbovirus activity. The bidirectional virus transmission between
vectors and maintenance hosts seldom causes ill effects in either.
Only five arboviruses (eastern equine encephalitis [EEE], western
equine encephalitis [WEE], Highlands J [HJ], West Nile [WN], and
turkey meningoencephalitis [TME]) have been reported to cause
disease in avian species. Three of the five: EEE, WEE, and HJ are
members of the genus Alphavirus in the virus family Togaviridae.
West Nile virus and TME belong to the genus Flavivirus in the
family Flaviviridae. Mosquitoes serve as the primary arthropod
vector for EEE, WEE, WN and HJ; mosquitoes and/or culicoides
are suspected vectors for TME. For each virus, the abundance of
insect species competent for virus transmission is a critical factor in
defining geographic areas with virus activity. Vector-borne
transmission is seasonal in temperate climates, peaking in late
summer and early autumn. Direct bird to bird transmission through
feather picking and cannibalism can occur. Direct transmission of
EEE, WEE, TME, and WN viruses has been reported.
Eastern equine encephalitis and WEE viruses have been isolated
from mosquitoes and vertebrates throughout much of the Western
Hemisphere. However, all reports of disease in poultry, game birds,
or domestic avian species have been from the United States with
most disease caused by EEE virus. Natural infection with EEE virus
has been implicated as a cause of clinical disease in emus,
pheasants, pigeons, turkeys, chukar partridges, quail and ducks
(5,9,10,20,26). Clinical avian infections definitively attributable to
WEE are rare but have been reported in turkeys (4). Older reports of
WEE-caused avian disease in the eastern United States were likely
due to the antigenically related HJ virus. HJ virus has been reported
to cause disease in chukar partridges and turkeys in the eastern
United States (6,8,10). West Nile virus has a broad distribution
including portions of Asia, Africa, Europe and North America. Over
150 bird species are susceptible to infection with WN virus (25).
Infections in wild birds range from inapparent to fatal with corvid
species such as crows and blue jays particularly susceptible to WN
184
in domestic poultry have been recognized only in geese (1,18).
TME has only been reported in Israel and South Africa. Turkeys are
the only avian species to be clinically affected by TME (11,17).
Several arboviruses including EEE, WEE, HJ, and WN are
zoonotic with potential to cause disease in humans. Severe
infections and death caused by EEE and WEE viruses have been
reported in laboratory workers (24). Laboratory acquired infections
with WN virus have also occurred (3). Infectious arboviruses may
be present in blood, serum and tissues of birds. Therefore any
laboratory work with avian specimens and arboviruses should be
done at the appropriate biosafety level. Biosafety Level 2 practices
are recommended for processing diagnostic specimens. All bird
necropsies should be done in a Class 2 biological safety cabinet. For
manipulations of cultures, EEE, WEE and HJ are assigned to
Biosafety Level 2. EEE and WEE vaccines are recommended for all
personnel who are working with these agents. WN and TME viruses
are assigned to Biosafety Level 3 (24). Unless suitable containment
facilities and laboratory safeguards are available and used, no
attempts should be made to isolate any of these arboviruses. An
alternative is to send all tissues from suspicious cases or possible
isolates to a reference laboratory. Due to public health concerns,
confirmed cases of EEE, WEE, HJ, and WN viral infections should
be reported to public and animal health officials. TME is an exotic
disease in the United States and suspect or cases must be reported to
animal health officials.
CLINICAL DISEASE
Clinical disease caused by EEE viral infection has been reported
primarily in young chukars, quail, emus, and pheasants in the
eastern and southern United States. Isolated natural cases also have
been reported in young Pekin ducks, turkeys, quail, and whooping
cranes. Newly hatched chickens are very sensitive to experimental
infection. Clinical signs of EEE infection typically reflect
perturbation of the nervous system. Visceral involvement is less
common. Signs may include depression, drowsiness,
incoordination, torticollis, paralysis, tremors and death. Mortality is
quite variable but may approach 100%. A significant drop in egg
production, without mortality, can occur in EEE-infected turkey
hens (28).

Clinical disease caused by WEE viral infection of avian species is
rare and historical reports of WEE prior to the ability to distinguish
HJ from WEE are tenuous. Historically WEE has been implicated
as a cause of neurologic disease and mortality of turkeys. More
recently, WEE was reported in turkeys in California. The disease
was characterized by a sudden drop in egg quantity and quality (4).
EEE and WEE viral infections have been reported in ratites,
primarily emus (2,21,26). Emus of all ages have developed illness
following infections and clinical signs may include hemorrhagic
enteritis.
Avian viruses in the WEE serogroup isolated in the eastern United
States have been determined to be HJ and some prior reports of
WEE are now presumed to be HJ based on geographic location of
the affected birds. Chukar partridges infected with HJ virus can
exhibit somnolence, ruffled feathers and recumbency (20).
Mortality of 35% has been reported (6). During an outbreak of HJ
in turkeys, decreased egg production was the predominant sign (28).
HJ was serologically linked to mortality in young turkeys (8).
Epomitics of TME generally occur in turkeys older than 8 wk of
age and are characterized by drowsiness, incoordination, torticollis,
tremors, progressive paresis and paralysis (11,17). In some cases,
the disease may be very acute, with only prostration and death being
observed. Mortality is usually 15-30% but may be up to 80%. In
laying flocks, egg production declines precipitously but there is no
effect on egg quality, fertility or hatchability.
Geese naturally infected with West Nile virus display neurologic
sings of incoordination, paralysis and recumbency. Juvenile birds
experience a higher mortality than adults. Mortality rates of 25-40%
have been reported in goslings (1,18). Clinical West Nile infections
have not been identified in other domestic poultry breeds under
natural conditions. Natural and experimental infections of avian
species with West Nile virus have resulted in significant mortality
in some species. Examples are American crows, fish crows, blue
jays, ring-billed gulls, Muscovy ducks, and several members of the
owl family, Strigidae (7,15).
No pathognomonic gross or histopathologic lesions are associated
with infections by these arboviruses. A complete description of the
pathogenesis, epizootiology, and clinical diseases associated with
arboviruses is reported by Guy (10).
SAMPLE COLLECTION
The method of choice for diagnosis and identification of arbovirus
infection is identification of the causal agent, either by isolation of
the virus or by PCR. Although obtaining a virus isolate permits the
most extensive characterization, molecular methods have the
advantage of improved sensitivity for some agents. Virus isolation
should only be attempted in laboratories with sufficient
biocontainment and biosecurity. Necropsy of birds suspected of
being infected with an arbovirus should be performed in biological
safety cabinets. Whole birds should be sent to the laboratory in
sealed bags at 4 C. Because viremia may be of short duration, birds
selected for diagnostic purposes should be those that are just
starting to exhibit clinical signs. The virus titer in these birds can be
high, which enhances the possibility of virus isolation. Tissues to
collect include brain, Ever and spleen. Serum should be collected
from birds that have a subacute infection because antibodies can
often be detected in birds with clinical disease. If tissues cannot be
processed immediately, they should be stored at -70 C.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Arboviruses are typically isolated in the laboratory by inoculation
of samples into newborn mice, vertebrate cell cultures, insect cell
cultures, or embryonating eggs. Although primary isolation of some
arboviruses can be obtained in multiple systems, no single system is
maximally sensitive for all arboviruses. Newborn chicks are also
185
Chapter 40 Arbovirus Infection
highly susceptible to arbovirus infection. However, the potential of
aerosol transmission of virus shed by infected chicks precludes then-
use in routine virus isolation attempts. The laboratory’s choice of
isolation system depends on several factors including the
arboviruses of interest, laboratory facilities, availability of cell
cultures, newborn mice and/or embryonating eggs, and personnel
expertise. In addition, the vaccination status of laboratory personnel
and potential exposure to zoonotic pathogens during inoculation and
harvesting must be considered.
Many arboviruses were first isolated in suckling mice due to then-
broad sensitivity and worldwide availability. For isolation, a 10%
suspension of tissue is prepared in phosphate-buffered saline (pH
7.8) containing 0.75% bovine serum albumin (fraction V), 500
units/ml of penicillin, and 300 units/ml of streptomycin. The
suspension is clarified by centrifugation at 1400 x g for 20 min. One
to five day old mice (one or two litters) are inoculated intracranially
with 0.02 ml inoculum using a 26-gauge, 3/8-inch (9.3 mm) needle
attached to a 1 ml tuberculin syringe. The inoculation site is just
lateral to the midline into the midportion of one lateral hemisphere.
Mice are observed for 10 days. Dead mice are collected daily and
frozen at -70 C. Mouse brains are harvested for virus identification
by aspiration using a 20-gauge, 1-inch (2.5 cm) needle attached to a
1 ml or 3 ml syringe. A second passage is made only if virus cannot
be identified from mice that die following inoculation.
Arboviruses can also be isolated in several cell culture systems
including cells of vertebrate and insect origin. Tissue suspensions
for cell culture inoculation are prepared in the same diluent used for
mouse inoculation or cell culture media with antibiotics. The most
commonly used cells are primary chicken and duck embryo
fibroblasts and continuous lines of Vero, baby hamster kidney-231
(BHK-21), and rabbit kidney-13 (RK-13). Using multiple cell
culture systems is advantageous. Isolation is usually attempted in
25-cm2 cell-culture flasks. Confluent cell monolayers are inoculated
with 1 ml of tissue suspension. After a 1 hr adsorption period, cells
are washed and maintenance medium is added. Cultures are
incubated for 7 days and 1 blind passage is made. EEE, WEE, HJ,
WNV, and TME viruses produce a cytopathic effect (CPE) in
vertebrate cell culture. Cultures that show CPE are frozen. Infected
arthropod cells may not exhibit CPE. The fluid from the thawed
cultures is used for virus identification.
The chicken embryo is also appropriate for primaiy arbovirus
isolation attempts. Arbovirus infection should always be suspected
when an embryolethal virus is isolated from birds with neurotropic
disease. Tissue suspensions can be inoculated via the yolk sac route
into 6 to 8-day-old embryonating chicken eggs. Arboviruses are
typically embryolethal but the infected embryos usually lack
diagnostic lesions. However, embryos infected with TME virus are
often a cherry red color before death (11). Embryos should be
incubated for 7 days but deaths usually occur 2-4 days after
inoculation. Generally, only one passage is necessary, unless there
are dead embryos from which virus cannot be identified.
Following primary virus isolation in any system, arboviruses are
frequently propagated by passage in one or more of the vertebrate
cell cultures listed above.
AGENT IDENTIFICATION
Eastern equine encephalitis, WEE, and HJ viruses belong to the
genus Alphavirus of the family Togaviridae. WNV and TME
viruses belongs to the genus Flavivirus in the family Flaviviridae.
Chemical and Physical Characteristics
The alphaviruses and flaviviruses have a spherical appearance
when viewed by electron microscopy. Alphaviruses are 50-70 nm in
diameter while the flaviviruses are somewhat smaller, measuring
40-50 nm in diameter. Virions in both groups have a ribonucleic
acid (RNA) core surrounded by a lipid-containing envelope;
Eileen N. Ostlund and James E. Pearson
therefore, they are ether and chloroform-sensitive. The capsid
encloses a single-stranded, positive sense RNA genome.
Virus Identification
Eastern equine encephalitis or WEE viruses can be identified in
infected mouse brains, cell culture fluid, or amniotic-allantoic fluid
by the complement-fixation (CF) test. A 10% suspension of mouse
brain is prepared in veronal buffer; egg or cell culture fluid is used
undiluted or diluted 1:10 in veronal buffer. The fluid or suspension
is centrifuged at 9000 x g for 30 min, and the supernatant is tested
against hyperimmune serum or mouse ascites fluid prepared against
the suspected arboviruses using a standard CF procedure (23). The
CF test requires overnight incubation of serum-antigen mixture with
seven units of complement. EEE, WEE, HJ, WN, and TME viruses
can be identified in cell culture by indirect immunofluorescent
antibody staining. TME virus can also be identified by virus
neutralization or hemagglutination inhibition (HI) tests. The brains
from mice infected with TME virus will agglutinate goose red blood
cells (11). A less commonly used method for EEE and WEE virus
identification is the plaque-reduction neutralization (PRN) test as
outlined in a subsequent section.
Molecular Methods
Molecular methods to detect the presence of arbovirus nucleic acid
in avian tissues are now commonly used by diagnostic laboratories
where appropriate equipment and expertise are available.
Advantages of molecular detection methods include speed of these
diagnostic assays when compared to virus isolation procedures and
lowered risk of laboratory personnel exposure to zoonotic agents
since viruses are not propagated. Disadvantages include lack of
widespread experience and validation of these assays in diagnostic
settings. For the single stranded, positive sense RNA viruses,
reverse transcriptase polymerase chain reaction (RT-PCR) methods
are used most frequently (16,19,27,30). Initial PCR tests developed
for arboviruses generally were designed to detect RNA of a single
viral pathogen (e.g. EEE). Whole RNA is extracted from diagnostic
specimens followed by RT and PCR steps. In some assays, a nested
PCR approach is used to enhance sensitivity of detection of small
quantities of viral RNA. Reaction products or their restriction
fragments are analyzed on 2.0-2.6% agarose gels that have been
stained with 1 pg/ml of ethidium bromide. An alternate
identification procedure is by hybridization with an oligonucleotide
probe. Recent advances in PCR procedures include a plethora of
variations on the “standard” RT-PCR formats. These include real
time methods that avert the need for PCR product testing and
multiplex assays to detect and differentiate more than one pathogen
(12,13,16). An antigen capture assay developed for detection of WN
RNA in mosquito pools has been successfully applied to avian
samples (22).
SEROLOGIC DETECTION IN THE HOST
A presumptive diagnosis of arbovirus infection can be made using
a single sample of serum from recovered birds or birds that have
clinical signs. Confirmation can be made by testing paired sera
collected 1-2 wk apart. The PRN test or a combination of PRN and
HI tests are the procedures most commonly used to detect antibody
against EEE, WEE, WNV and HJ viruses. The use of the PRN test
allows differentiation of antibodies produced by antigenically
closely related EEE and WEE viruses. Similarly, PRN tests allow
differentiation of WN antibodies from antibodies to the related St.
Louis encephalitis virus. Differentiation between HJ and WEE viral
antibodies is very difficult because of the close antigenic
relationship. A presumptive differentiation can be made based on
the part of the country from which the birds originated. The HI test
alone can be used to identify antibody against TME virus (11,17).
The CF test is rarely used to detect arbovirus antibody in avian
186
serum. Enzyme-linked immunosorbent assays to detect
immunoglobulin M (IgM) or IgG antibodies to specific arboviruses
are used in some situations, such as sentinel chicken testing (29).
The species specificity of immunoglobulin “capture” ELISA
methods limits their application in diverse avian species. Blocking
or competitive ELISAs have greater utility in detecting virus­
specific antibodies from wide range of species (14).
PRN test
The PRN test is performed in duck embryo fibroblast or Vero cell
cultures. The sera can be tested at the 1:10 and 1:100 final dilutions.
Endpoints can be established on the PRN or HI test. Serum used in
the PRN assay is tested against 100 plaque-forming units of virus.
The virus-serum mixture is incubated at 37 C for 1 hr and 15 min
before inoculation onto confluent cell monlayers in 25-cm2 flasks.
The inoculum is adsorbed for 1 hr, followed by the addition of 6 ml
of overlay medium. The overlay medium consists of two solutions
that are prepared separately. Solution I contains 2x Earle’s basic salt
solution with 2x antimicrobials, 4% fetal bovine serum, 6% of a
7.5% solution of sodium bicarbonate and 3.3% of a 1:1500 dilution
of neutral red (1:80000). Solution Π consists of 2% Noble agar that
is sterilized and maintained at 47 C. Equal volumes of solutions I
and Π are mixed and the temperature is adjusted to 47 C just before
use. The test is incubated for 48-72 hr and endpoints are based on
90% reduction in the number of plaques, as compared with the
virus-control flasks which should have approximately 100 plaques.
Hemagglutination-Inhibition Test
A sucrose-acetone infected mouse brain extract is commonly used
as virus (positive) antigen and an uninfected mouse brain extract is
prepared in parallel as a control (negative) antigen. The virus
antigen is inactivated by treatment with β-propiolactone at a final
concentration of 0.1-0.3%. In the absence of an international
reference serum, the antigen should be titrated against a locally
prepared positive control serum. The antigen is diluted so that four
to eight hemagglutinating units are used in the HI test. The
hemagglutination titer and optimum pH for each antigen is
determined with goose red blood cells (RBCs) diluted in pH
solution ranging from pH 5.8 to pH 7.2 at 0.2 intervals. Sera are
diluted 1/10 in borate saline, pH 9.0, and then heat inactivated at 56
C for 30 min. Kaolin treatment is used to remove nonspecific serum
inhibitors. Sera should be adsorbed with a 0.05 ml volume of
washed packed goose RBCs for 20 min at 4 C to remove natural
serum agglutinins. Serum is added to a 96-well, round-bottom
microtiter plate in two-fold dilutions in borate saline, ph 9.0
containing 0.4% bovine serum albumin. Equal volumes of antigen
are added to the diluted serum and the plates are incubated at 4 C
overnight. RBCs are derived from normal white male geese and
washed three times in dextrose-gelatin-veronal buffer and a 7.0%
suspension is then diluted 1/24 in the appropriate pH solution
immediately before adding to the plates. Plates with RBCs are
covered and incubated for 30 min at 37C before recording results.
Positive and negative control sera are incorporated into each test. A
test is considered valid only if the control sera give the expected
results. Titers of 1/10 and 1/20 are suspects; titers of 1/40 and above
are antibody positive.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Although clinical signs, species affected, geographic location and
other factors contribute to the differential diagnosis among EEE,
WEE, HJ, WNV, and TME, laboratory tests are necessary to
confirm the causal agent. In addition, these arboviral infections
produce clinical signs in susceptible species that closely resemble
central nervous system disturbances caused by other neurotropic
agents, such as Newcastle disease virus, avian encephalomyelitis
virus and Clostridium botulinum. All the arboviruses can produce a

decrease in egg production similar to that caused by turkey
rhinotracheitis virus. These agents can be distinguished by isolation
and identification of the agent or by serologic tests. Vaccination of
poultry against arboviruses is not practiced routinely in North
America. No arbovirus vaccines for use in avian species are
licensed in the United States, however, EEE, WEE and WNV
equine vaccines have been used experimentally in birds. A live
attenuated vaccine for TME virus exists and can be differentiated
from virulent strains by the intramuscular pathogenicity index test
performed in 1-day-old-poults (11). If applicable, vaccination
history must be taken into account when interpreting laboratory
results.
REFERENCES
1. Austin, R. J., T. L. Whiting, R. A. Anderson, and M A. Drebot. An
outbreak of West Nile virus-associated disease in domestic geese (Anser
anser domesticus) upon initial introduction to a geographic region, with
evidence of bird to bird transmission. Can. Vet. J. 45:117-123. 2004.
2. Ayers, J. R., T. L. Lester, and A. B. Angulo. An epizootic attributable to
western equine encephalitis virus infection in emus in Texas. J. Am. Vet.
Med. Assoc. 205:600-601. 1994.
3. Centers for Disease Control and Prevention. Laboratory-acquired West
Nile virus infections—United States, 2002. Morb. Mortal. Wkly. Rep.
51:1133-1135. 2002.
4. Cooper, G. L. and H. A. Medina. Egg production drops in breeder
turkeys associated with western equine encephalitis virus infection. Avian
Dis. 43:136-141. 1999.
5. Eleazer, T. Η., H. G. Blalock, J. H. Warner, Jr., and J. E. Pearson. Eastern
equine encephalomyelitis outbreak in coturnix quail. Avian Dis. 22:522-525.
1978
6. Eleazer, T. H. and J. E. Hill. Highlands J virus-associated mortality in
chukar partridges. J. Vet. Diagn. Invest. 6:98-99. 1994.
7. Fitzgerald, S. D., J. S. Patterson, M Kiupel, H. A Simmons, S. D.
Grimes, C. F. Sarver, R. M Fulton, B. A. Steficek, T. M Cooley, J. P.
Massey, and. J. G. Sikarskie. Clinical and pathologic features of West Nile
virus infection in native North American owls (Family strigidae). Avian Dis.
47:602-610. 2003.
8. Flicken, M D., D. P. Wages, J. S. Guy, J. A. Quinn, and W. H. Emory.
High mortality of domestic turkeys associated with Highlands J virus and
eastern equine encephalitis virus infections. Avian Dis. 37:585-590. 1993.
9. Guy, J. S., H. J. Bames, M D. Flicken, L. G. Smith, W. H. Emory, and
D. P. Wages. Decreased egg production in turkeys experimentally infected
with eastern equine encephalitis virus or Highlands J virus. Avian Dis.
38:563-571. 1994.
10. Guy, J. S. and M Malkinson. Arbovirus infections. In: Diseases of
Poultry, 11th ed. Y. M. Saif, ed. Iowa State Press, Ames, Iowa. pp. 388-399.
2003.
11. Ianconescu, M Turkey meningoencephalitis. In: A laboratory manual
for the isolation and identification of avian pathogens, 3rd ed., H. G.
Purchase, L. H. Arp, C. H. Dommermuth, and J. E. Pearson, eds. American
Association of Avian Pathologists, Kennett Square, Pa. pp. 163-164. 1989.
12. Johnson, D. J., E. N. Ostlund, and B. J. Schmitt. Nested multiplex RT-
PCR for detection and differentiation of West Nile virus and eastern equine
encephalomyelitis virus in brain tissues. J. Vet. Diagn. Invest. 15:488-493.
2003.
13. Johnson, D. J., E. N. Ostlund, and B. J. Schmitt. Nested multiplex RT-
PCR for detection and differentiation of western equine encephalomyelitis
virus, eastern equine encephalomyelitis virus, and West Nile virus,
(abstract). North Central Conference of Veterinary Laboratory
187
Chapter 40 Arbovirus Infection
Diagnosticians 42nd Annual Meeting. Minneapolis-St Paul, MN. June , 2003.
p. 49.
14. Jozan, M, R. Evans, R. McLean, R. Hall, B. Tangredi, L. Reed, and J.
Scott. Detection of West Nile virus infection in birds in the United States by
blocking ELISA and immunohistochemistry. Vector Bome Zoonotic Dis.
3:99-110. 2003.
15. Komar, N., S. Langevin, S. Hinten, N. Nemeth, E. Edwards, D. Hettier,
B. Davis, R. Bowen, and M Bunning. Experimental infection of North
American birds with the New York 1999 strain of West Nile virus. Emerg.
Infect. Dis. 9:311-322. 2003.
16. Lanciotti, R. S., A. J. Kerst, R. S. Nasci, M S. Godsey, C. J. Mitchell,
Η. M Savage, N. Komar, N. A. Panella, B. C. Allen, K. E. Volpe, B. S.
Davis, and J. T. Roehrig. Rapid detection of West Nile virus from human
clinical specimens, field-collected mosquitoes, and avian samples by a
TaqMan reverse transcriptase-PCR assay. J. Clin. Microbiol. 38:4066-4071.
2000.
17. Malkinson, M Turkey meiningo-encephalitis. In: Virus infections of
birds. J. G. McFerran and M S. McNulty, eds. Elsevier Science Publishers
Β. V., Amsterdam, The Netherlands, pp. 243-245. 1993.
18. Malkinson, M, C. Banet, Y. Khinich, I. Samina, S. Pokamunski, and Y.
Weisman. Use of live and inactivated vaccines in the control of West Nile
fever in domestic geese. Ann. N. Y. Acad. Sci. 951:255-261. 2001.
19. Office International des Epizooties. West Nile encephalitis. In: Manual
of diagnostic tests and vaccines for terrestrial animals, 5th ed. Office
International des Epizooties, Paris, pp. 1064-1071. 2004.
20. Ranck, Jr, F. M, J. H. Gainer, J. E. Hanley, and S. L. Nelson. Natural
outbreak of eastern and western encephalitis in pen-raised chukars in
Florida. Avian Dis. 9:8-20. 1965.
21. Randolph, K. D., S. L. Vanhooser, and M Hoffman. Western equine
encephalitis virus in emus in Oklahoma. J. Vet. Diagn. Invest. 6:492-493.
1994.
22. Stone, W. B., J. C. Okoniewski, J. E Therrien, L. D. Kramer, E. B.
Kauffman, and M Eidson. VecTest as diagnostic and surveillance tool for
West Nile virus in dead birds. Emerg. Infect. Dis. 10:2175-2181. 2004.
23. United States Department of Health, Education, and Welfare. A guide to
the performance of the standardized complement fixation method and
adaptation to micro test. Centers for Disease Control, Atlanta, Ga. 1974.
24. United States Department of Health and Human Services. Biosafety in
microbiological and biomedical laboratories, 4th ed. U.S. Government
Printing Office, Washington, D.C., 1999.
25. van der Meulen, K. Μ, Μ B. Pensaert, and H. J. Nauwynck. West Nile
virus in the vertebrate world. Arch. Virol. 150:637-657. 2005.
26. Veazey, R. S., C. C. Vice, D.-Y. Cho, T. N. Tully, Jr., and S. M Shane.
Pathology of eastern equine encephalitis in emus (Dromaius
novaehollandiae). Vet. Pathol. 31:109-111. 1994.
27. Vodkin, Μ H., G. L. McLaughlin, J. F. Day, R. E. Shope, and R. J.
Novak. A rapid diagnostic assay for eastern equine encephalomyelitis viral
RNA. Am. J. Trop. Med. Hyg. 49(6):772-776. 1993.
28. Wages, D. P., M D. Flicken, J. S. Guy, T. S. Cummings, and S. R.
Jennings. Egg-production drop in turkeys associated with alphaviruses:
eastern equine encephalitis virus and Highlands J virus. Avian Dis. 37:1163-
1166. 1993.
29. Weingartl, Η. Μ, M A. Drebot, Z. Hubalek, J. Halouzka, M
Andonova, A. Dibemardo, C. Cottam-Birt, J. Larence, and P. Marszal.
Comparison of assays for the detection of West Nile virus antibodies in
chicken serum. Can. J. Vet. Res. 67:128-132. 2003.
30. Whitehouse, C. A., A. Guibeau, D. McGuire, T. Takeda, and T. N.
Mather. A reverse transcriptase-polymerase chain reaction assay for
detecting Highlands J virus. Avian Dis. 45:605-611. 2001.
 41
INFECTIOUS BURSAL DISEASE
John K. Rosenberger, Y. M. Saif, and Daral J. Jackwood

SUMMARY. Infectious bursal disease is an acute lymphocidal disease of young chickens that is caused by a double-stranded RNA virus
that is unusually resistant to inactivation by both heat and many common disinfectants. The virus can be found worldwide in all major
poultry-producing areas. Clinical and subclinical forms of the disease occur in young chickens and are followed by marked
immunosuppression. Very virulent infectious bursal disease viruses cause high morbidity and mortality.
Agent Identification. Reverse transcriptase polymerase chain reaction is the method of choice for virus identification. Virus isolation could
be done but it is not practical unless further studies are planned.
Serologic Detection in the Host. Serologic results from enzyme-linked immunosorbent assay can provide a presumptive diagnosis if
accompanied by clinical disease and gross lesions. Agar-gel precipitin or virus-neutralization tests could be used for serologic testing.

INTRODUCTION
Infectious bursal disease (IBD) is an acute, highly infectious
lymphocidal disease of young chickens caused by a double-stranded
RNA virus. The disease is frequently referred to as Gumboro,
named for the town in Delaware, USA where the disease was first
recognized (10). The condition has been recognized in virtually all
major poultry-producing areas worldwide and is considered
economically significant because of its ability to induce a profound
immunosuppression in chickens with increased susceptibility to
bacterial and viral infections and diminished vaccine responses. A
variety of infectious bursal disease viruses (IBDV) varying from the
very mild to the very virulent have been identified. Although IBDV
has been isolated from other avian species, most notably turkeys
and ratites, the disease is currently recognized in the chicken only.
CLINICAL DISEASE
The clinical form of the disease generally occurs in young birds
and is often concurrent with waning IBDV maternal antibodies.
Affected birds may be depressed and anorexic, have ruffled
feathers, and excrete a watery, green-tinged, urate-containing fecal
material. Mortality is variable but can be as high as 60% dependent
on the strain of the virus and concomitant infections and mortality is
usually higher in leghorn chickens compared to meat-type birds.
Two to 6 days postinfection, the cloacal bursa (bursa of Fabricius)
is swollen and occasionally hemorrhagic, and is frequently covered
with a yellowish gelatinous transudate. This is followed by bursal
atrophy, which occurs 7-10 days after infection.
Microscopic lesions include lymphoid necrosis in the bursa,
spleen, thymus, Harderian gland, and cecal tonsils. The bursa is
most severely affected and is characterized by a medullary
lymphoid cell necrosis followed by replacement with heterophils
and macrophages. Some IBDV variants produce only atrophy of the
bursa (15).
In the subclinical form of the disease lymphoid tissues are affected
but the only visible indication of infection may be a severely
atrophied bursa. However, subclinical IBD is considered important
because it results in immunosuppression similar to that induced by
more pathogenic strains.
SAMPLE COLLECTION
Virus Isolation. Infectious bursal disease virus can be readily
isolated from most lymphoid tissues during the early stages of the
disease (2-6 days postinfection). However, the bursa is the primary
target organ and generally contains greater concentrations of virus
for longer periods than other tissues and accordingly is considered
the tissue of choice for isolation attempts (10). If the bursa is
chosen, it should be recognized that it may frequently be
contaminated with adventitious agents, such as reovirus,
adenovirus, or chicken anemia virus, which could complicate the
identification process.
188
Because the disease is acute and the virus infection is transient,
bursae should be harvested from a minimum of five clinically
affected birds and stored frozen, at -20 C or colder, pending
isolation attempts. A 20% (w/v) suspension of bursal homogenate is
prepared in tryptose phosphate broth with antibiotics (10,000 IU/ml
of penicillin and 10,000 mg/ml of dihydrostreptomycin). The
suspension is centrifuged at 1500 x g for 20 min, and the supemate
is collected and stored frozen at -20 C or colder.
Molecular Identification
Samples from the bursa are preferred because they contain the
highest concentrations of the virus. Bursa should be harvested from
a minimum of five birds/house, pooled and submitted to a
molecular testing laboratory on ice or frozen. In cases where there
are no domestic testing laboratories, bursa samples can be treated to
inactivate the virus but preserve the viral genome prior to
international shipment (2). Bursa samples collected for international
shipment should be placed in a solution of phenol, chloroform and
isoamyl alcohol (25:24:1, pH 6.6) for a minimum of 7 days at room
temperature. The phenol:chloroform:isoamyl alcohol should be
removed before shipment with the appropriate import and
declaration documentation.
PREFERRED CULTURE MEDIA AND SUBSTRATES
Virulent and vaccine IBDV can be propagated in 9-to-l 1-day-old
embryonated eggs derived from hens free of IBDV maternal
antibodies. The chorioallantoic membrane (CAM) route of
inoculation is the most sensitive, although embryos inoculated via
the yolk sac are also infected by most isolates. Embryo lesions and
mortality rates may vary, depending on the type of IBDV assayed.
Classical IBDV isolates, when inoculated by the CAM route, will
kill embryos 3-5 days postinoculation. Hie dead embryos are
congested, with petechial and ecchymotic hemorrhages evident
along the feather tracts, toe joints, and cerebral area. Livers may be
necrotic, but usually have a pale appearance, whereas spleens are
most frequently pink or lacking in color, small to normal in size,
with occasional small necrotic foci. CAMs are usually unaffected,
although infrequent, isolated surface hemorrhages have been
observed.
Variant strains of IBDV can be isolated and grown in chicken
embryos with relative ease when introduced by the CAM route but
generally will not kill embryos. Live embryos must be examined 6-
7 days postinoculation for typical lesions, which externally consist
of cerebral and abdominal edema, stunting, and an off-white or
creamy color. Embryos are rarely, if ever, congested or
hemorrhagic. Livers are frequently bile-stained and necrotic,
whereas spleens are generally enlarged two to three times but are
normal in color. The highest concentrations of virus are found in the
CAM and embryo tissues, including viscera, 6-7 days after
inoculation with either the variant or classical form of the virus. Egg
fluids usually contain less virus than other parts of the embryo.

Although the initial isolation of IBDV is best accomplished by
embryo inoculation, the virus may be adapted to cell cultures (5, 10,
12). IBDV can be propagated in chicken embryo bursal cells,
kidney cells, and fibroblasts, producing a cytopathic effect. The
virus has also been isolated on a variety of established mammalian
cell lines including lymphoid and nonlymphoid cell lines (5, 9). The
very virulent wIBDVs are also propagated in embryonated chicken
eggs. They cause severe lesions in embryo and are highly lethal at
low virus doses. These viruses are difficult to adapt to tissue
culture.
AGENT IDENTIFICATION
Morphology and Physicochemical Properties
Infectious bursal disease virus is a nonenveloped icosahedral virus
in the family Bimaviridae, genus Bimavirus, that is approximately
60 nm in diameter. The genome is a double-stranded RNA that
consists of two segments with molecular weights of approximately
2.2 x 106 and 2.5 x 106. Five viral proteins (VP1-VP5) have been
identified. IBDV is heat-stable, remaining infectious after treatment
at 56 C for at least 5 hr. The virus is unaffected by ether,
chloroform, or pH 2 but is inactivated at pH 12. Virus infectivity
was markedly reduced following treatment with 0.5% formalin for 6
hr, whereas phenolic derivatives and quaternary ammonium
disinfectants were relatively ineffective in reducing virus titer (1).
The stability of the virus is the reason it remains on contaminated
farms for long periods in spite of rigorous cleaning and disinfection.
Virus Identification
The agar gel precipitin (AGP) test can be used to detect IBDV
group-specific antigen. Antigen is prepared from bursal
homogenates from birds in the acute stage of the disease. The bursal
homogenate is mixed 1:1 (w/v) with sterile saline, frozen and
thawed three times, and centrifuged at low speed (300 x g), and the
supernatant is retained as antigen and tested against known IBDV
antiserum. The virus-neutralization (VN) test could be used to
identify the virus in embryos or in tissue culture after adaptation to
these host systems.
An antigen-capture enzyme-linked immunosorbent assay (AC-
ELISA) has been described for detecting and characterizing IBDV
isolates (16, 17). Polyclonal antibodies can also be utilized in the
AC-ELISA and may be more effective for general screening of
tissue samples for IBDV (10).
Direct and indirect immunofluorescence assays have been shown
to be highly reliable for detection of viral antigens in infected
tissues. Likewise, immunocytochemistry is used for the same
purpose.
Strains of IBDV can be differentiated on the basis of pathotype
and antigenic configuration. There are at least two distinct serotypes
(5, 6, 10) that can be identified by cross-neutralization and cross
challenge tests. Serotype 1 viruses are classified into classic and
variant strains that differ antigenically. The variant isolates may
damage the bursa with no associated inflammation or edema (15).
Serotype 1 viruses vary in pathogenicity from being nonpathogenic
to very virulent. The wIBDV were identified in the 1980s and
spread to several parts of the world except North America,
Australia, and New Zealand. These viruses are capable of inducing
high mortality and causing extensive damage to lymphoid tissue.
Molecular Identification
Reverse transcriptase (RT) followed by the polymerase chain
reaction (PCR) is used to detect IBDV infection in chickens (3, 7,
18). When RT-PCR is followed by restriction enzyme fragment
length polymorphism (RFLP) assays the data can be used to place
IBDV strains into molecular groups (3, 8, 19). The RT-PCR-RFLP
procedures used to generate molecular groups of IBDV are
designed to assess the nucleotide similarity or diversity among
189
Chapter 41 Infectious Bursal Disease
viruses. This technique has also been used to identify molecular
markers present on many wIBDV strains (8).
Although widely accepted as the method of choice, RFLP assays
have some limitations. As a result, real-time RT-PCR is being used
by some laboratories to diagnose and differentiate IBDV strains (4,
11, 13, 14). Nucleotide sequencing of viruses is also gaining
popularity but this method is still relatively slow and expensive
compared to real-time RT-PCR.
SEROLOGIC DETECTION IN THE HOST
The AGP test can be used to detect and quantitate antibodies in
convalescent birds. To quantitate the antibodies, usually twofold
serum dilutions are made to obtain an endpoint. The antigen is
prepared from bursal homogenates of experimentally infected birds
collected 3-6 days postinfection. The test is performed as described
earlier.
The VN test is also used for antibody quantitation. The test is
routinely performed in microtiter systems using cell-culture-adapted
virus and chicken embryo fibroblasts. Twofold dilutions of serum
are prepared in medium 199 and added (0.025 ml/well) to
microplates containing 24-hr-old confluent monolayers of chicken
embryo fibroblasts. The cells are inoculated with 100 plaque­
forming units of virus per well and incubated for 5 days at 37 C.
Following incubation, the growth medium (medium 199 and 5%
fetal calf serum) is removed and cells are rinsed with 10% buffered
formalin for 5 min. The formalin is decanted, and the cells are
stained for 3 min with 1% crystal violet. Neutralization titers are
expressed as the reciprocal of the highest dilution of serum that
prevents cytopathic effect. The VN test is more sensitive than the
AGP test and accordingly should be utilized when antibody titers
are low or when quantitation of antibody is important.
The ELISA is widely used in quantitating LBDV antibodies. Test
kits can be purchased from commercial sources and have the
advantage of requiring small quantities of serum with improved
consistency of results. ELISA results do not always correlate with
VN test findings.
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Clinical IBD is readily diagnosed because of the pathognomonic
gross and microscopic bursal lesions observed during the acute
stage of the disease. However, bursal atrophy, which occurs
following clinical or subclinical IBD, may also be present with
other conditions, such as Marek’s disease, mycotoxicoses, and
infection with chicken anemia agent or selected reoviruses. The
histologic response with these conditions is generally different from
that found with IBD.
Hemorrhagic lesions seen occasionally with IBD may also be
observed with chicken anemia virus infections and chemical or drug
intoxications. Severe lymphoid cell destruction, massive
subcutaneous hemorrhages, and altered hematopoiesis are common
in birds coinfected with chicken anemia virus and IBDV at a young
age (<2 wk). Nephrosis and nephritis found occasionally in birds
that die from IBD are usually the result of water deprivation.
Nephrotoxic strains of infectious bronchitis virus may induce
similar lesions but can be differentiated because there are no
changes in the bursa and the condition is normally associated with
acute respiratory disease.
Because IBDV is capable of inducing immunosuppression, it may
serve as a predisposing factor to other conditions, such as
gangrenous dermatitis, hemorrhagic aplastic anemia syndrome,
inclusion body hepatitis, and respiratory disease. Involvement of
LBDV in disease complexes of these types is usually diagnosed
retrospectively by demonstrating persistent bursal lesions or
serologic evidence of previous IBDV infection.
John K Rosenberger, Y. M Saif, and Daral J. Jackwood
REFERENCES
1. Benton, W. J., M. S. Cover, J. K. Rosenberger, and R. S. Lake.
Physicochemical properties of the infectious bursal agent (IBA). Avian Dis.
11:438-445. 1967.
2. Jackwood, D. J., G. Hanes, and S. Heins-Miller. Infectious bursal disease
viral RNA can be amplified using RT/PCR from bursa tissue following
inactivation of the virus with phenol:chloroform Avian Dis. 40:457-460.
1996.
3. Jackwood D. J., and S. E. Sommer. Genetic heterogeneity in the VP2
gene of infectious bursal disease viruses detected in commercially reared
chickens. Avian Dis. 42: 321-339. 1998.
4. Jackwood D. J., B. D. Spalding, and S. E. Sommer. Real-time reverse
transcriptase-polymerase chain reaction detection and analysis of nucleotide
sequences coding for a neutralizing epitope on infectious bursal disease
viruses. Avian Dis. 47: 170-176. 2003.
5. Jackwood, D. H., and Y. M Saif. Antigenic diversity of infectious bursal
disease viruses. Avian Dis. 31:766-770. 1987.
6. Kibenge, F. S. B., A. S. Dhillon, and R. G. Russell. Biochemistry and
immunology of infectious bursal disease virus. J. Gen. Virol. 69:1757-1775.
1988.
7. Lee, L. H., S. L. Yu, and Η. K. Shien. Detection of infectious bursal
disease virus infection using the polymerase chain reaction. J. Virol.
Methods 40:243-254. 1992.
8. Lin Z., A. Kato, Y. Otaki, T. Nakamura, E. Sasmaz, and S. Ueda.
Sequence comparison of a highly virulent infectious bursal disease virus
prevalent in Japan. Avian Dis. 37: 315-323. 1993.
9. Liu, H.-J., J. J. Giambrone, and T. Dormitorio. Detection of genetic
variations in serotype I isolates of infectious bursal disease virus using
polymerase chain reaction and restriction endonuclease analysis. J. Virol.
Methods 48:281-291. 1994.
10. Lukert, P. D., and Y. M. Saif. Infectious bursal disease. In: Diseases of
poultry, 10th ed. B. W. Calnek, H. J. Bames, C. W. Beard, L. R.
McDougald, and Y. M. Saif., eds. Iowa State University Press, Ames, Iowa,
pp. 721-738. 1997.
190
11. Moody A., S. Sellers, and N. Bumstead. Measuring infectious bursal
disease virus RNA in blood by multiplex real-time quantitative RT-PCR. J.
Virol. Methods. 85: 55-64. 2000.
12. Okoye, J. O. A Infectious bursal disease of chickens. Vet. Bull.
54:425-436. 1984.
13. Raue R., and A. Mazaheri. Eine real-time RT-PCR zum nachweis des
virus der infektiosen bursitis auf der grundlage des genomsegments B. Arch
Geflugelk. 67: 22-27. 2003.
14. Raue R., and H. Muller. Detection and quantification of IBDV by real­
time RT-PCR. Proceedings, Π. International Symposium on Infectious
Bursal Disease and Chicken Infectious Anaemia, Rauischholzhausen,
Germany, pp. 271-277. 2001.
15. Rosenberger, J. K, S. S. Cloud, J. Gelb, E. Odor, and J. E. Dohms.
Sentinel bird survey of Delmarva broiler flocks. In: Proceedings of the 20th
National Meeting on Poultry Health and Condemnations, Ocean City, Md.
pp. 94-101. 1985.
16. Snyder, D. B., D. P. Lana, B. R. Cho, and W. W. Marquardt. Group and
strain-specific neutralization sites of infectious bursal disease virus defined
with monoclonal antibodies. Avian Dis. 32:527-534. 1988.
17. Snyder, D. B., D. P. Lana, P. D. Savage, F. S. Yancey, S. A. Mengel,
and W. W. Marquardt. Differentiation of infectious bursal disease viruses
directly from infected tissues with neutralizing monoclonal antibodies:
evidence of a major antigenic shift in recent field isolates. Avian Dis.
32:535-539. 1988.
18. Wu, C. C., T. L. Lin, H. G. Zhang, V. S. Davis, and J. A Boyle.
Molecular detection of infectious bursal disease virus by polymerase chain
reaction. Avian Dis. 36:221-226. 1992.
19. Zierenberg K., R. Raue and H. Muller. Rapid identification of very
virulent strains of infectious bursal disease virus by reverse transcriptase-
polymerase chain reaction combined with restriction enzyme analysis. Avian
Pathol. 30: 55-62. 2001.
 42
PARVOVIRUS OF WATERFOWL
Richard E. Gough

SUMMARY. Goose parvovirus or Derzsy’s disease is caused by an autonomous replicating parvovirus. The disease can result in 100%
mortality in goslings and Muscovy ducklings less than 10 days of age. A similar parvovirus is responsible for a serious disease of Muscovy
ducklings although goslings appear less susceptible to this virus. Significant differences between the genomes of goose and Muscovy duck
isolates have been reported.
Agent Identification. Diagnosis of goose parvovirus is made by isolating the virus in embryonating goose or Muscovy duck eggs, or in cell
cultures derived from these species. The identification of the isolated virus can be confirmed by electron microscopy or a virus-neutralization
test. Detection of viral antigen in host tissues or culture systems has also been used to confirm infection. Molecular methods such as PCR,
DNA probes and RFLP analysis have been applied to the detection and characterization of waterfowl parvoviruses.
Serologic Detection in the Host. Several serologic assays have been developed to confirm infection, including virus-neutralization, agar-gel
precipitin tests, ELISA and plaque reduction tests. In countries where vaccination is practiced, serological results should be interpreted with
caution. Ideally, both acute and convalescent serum samples should be tested in order to confirm infection.

INTRODUCTION
Goose parvovirus (GPV) infection, also known as Derzsy’s
disease, goose hepatitis, or gosling plague, is a highly contagious
disease affecting goslings and Muscovy ducklings. Apart from
these species, the disease has not been reported in other avian or
mammalian species. The first description of the disease was from
China in 1956, but goose parvovirus has now been reported from
most of the major goose and Muscovy duck farming countries in the
world (8). Outbreaks of the disease have frequently been attributed
to egg transmission of the virus from latently infected breeder geese
or Muscovy ducks, this results in infection passing to susceptible
birds at the time of hatching or soon thereafter. Birds that survive
infection may become life-long carriers of the virus. More recently
a parvovirus of Muscovy or Barbary ducks has been detected in
various countries throughout the world, the so-called Muscovy duck
parvovirus (MDPV). This virus was shown to be antigenically
distinct from GPV, and while causing up to 80% mortality in
Muscovy ducklings, was not particularly pathogenic for goslings
(6,12,14). Molecular studies using restriction enzyme fragment
length polymorphism and sequencing was able to show differences
between a selected strain of GPV and a MDPV (29). Both viruses
belong to the Parvoviridae family, although phylogenetic analysis
has suggested that, together with adeno-associated viruses, they
should be separated from other autonomous parvoviruses and
placed in the Dependovirus genus (20).
CLINICAL DISEASE
With GPV the clinical signs, morbidity, and mortality in
susceptible goslings and ducklings vary according to the age of the
birds when infected. Mortality may reach 100% in goslings
infected in the hatchery, with the appearance of clinical signs and
death 5-10 days later. In birds 2 to 3-wk old, the incubation period
and mortality may vary considerably (18). Initially, affected birds
exhibit anorexia, polydypsia, and weakness with a reluctance to
move. A nasal and ocular discharge occurs in many birds with
associated head shaking. The uropygial glands and eyelids are
often red and swollen, and a profuse white diarrhea is evident in
many of the birds. Examination of the birds, at this stage may,
reveal a fibrinous pseudomembrane covering the tongue and oral
cavity. Goslings that survive the acute phase may develop a more
prolonged disease characterized by profound growth retardation,
loss of down around the back and neck, and marked reddening of
the exposed skin. Ascitic fluid may accumulate in the abdomen,
which causes the goslings to stand in a “penguin-like” posture.
Goslings and ducklings over 4 wk of age rarely show clinical signs.
In acute cases, lesions are commonly found in the heart, which has a
pale myocardium characteristically rounded at its apex. The liver,
spleen, and pancreas may be swollen and congested. A variety of
other gross lesions may also be present in cases with a more
prolonged clinical course. Typically, a serofibrinous perihepatitis
and pericarditis is present with large volumes of straw-colored fluid
in the abdominal cavity. Pulmonary edema, liver dystrophy, and
catarrhal enteritis may also be present. Less frequently,
hemorrhages in the thigh and pectoral muscles may be seen.
Diphtheritic and ulcerative lesions may be observed in the mouth,
pharynx, and esophagus, depending on the presence of secondary
invaders. Histologically, the main lesions seen are pronounced
degenerative changes in the myocardial cells and hepatocytes with
vacuolation, fatty infiltration, and the presence of scattered Cowdry
type A intranuclear inclusions. Similar changes occur in the
pancreas, kidney, spleen, bursa, and thymus. MDPV in young
ducklings causes similar clinical signs and pathology to GPV and
these have been described in detail (4,13,27). It has been suggested
that GPV infection in susceptible breeding geese may result in
infertility and poor hatchability (11).
SAMPLE COLLECTION
Virus isolation and visualization by direct transmission electron
microscopy (TEM) can be attempted on fecal samples collected
during the acute phase of the disease. At postmortem, a selection of
tissues, including heart, liver, spleen, and kidneys should be
sampled. For virus isolation, the specimens should be shipped at 4
C in leak-proof containers with ice or other suitable coolant. Where
delays in shipping of more than 2 days are expected, the samples
should be frozen prior to shipping and sent frozen. As soon after
death as possible appropriate samples, particularly organs or tissues
showing specific lesions should be placed in 10% neutral buffered
formalin solution for histologic examination. As GPV can be
vertically transmitted, embryos that die during incubation or shortly
after hatching should be examined for the presence of virus.
Antibodies can be detected in blood samples from healthy ducks
and geese and their progeny. Samples of yolk from infertile eggs
can also be collected for antibody assay.
PREFERRED CULTURE MEDIA
For attempted virus isolation, 20% tissue suspensions are prepared
in a solution of antibiotic phosphate-buffered saline (PBS) and
inoculated into either embryonating goose or Muscovy duck eggs or

191
Richard E. Gough
cell cultures derived from them. It is essential that the embryonated
eggs are derived from unvaccinated flocks known to be free of GPV
and MDPV antibodies.
Culture in Embryonating Eggs
The virus can be isolated following inoculation in the allantoic
cavity of 10 to 15-day-old embryonating goose or Muscovy duck
eggs known to be free of goose parvovirus antibodies. Mortality,
with hemorrhages in the embryonic Ever and other tissues, usually
occurs 5-12 days after incubation at 37 C. After further passages,
consistent embryo mortality normally occurs between 4 and 6 days
post inoculation. A minimum of two passages should be carried out
before the attempted virus isolation is considered negative as virus
may not be detected on primary inoculation.
Cell Cultures
Primary cell cultures of 12 to 15-day-old goose or Muscovy duck
embryo fibroblasts are suitable for isolating GPV. In common with
mammalian parvoviruses, isolation is facilitated by inoculating cell
cultures before they form a confluent monolayer, preferably at the
time of seeding the cultures. Primary isolation may not always
result in a detectable cytopathic effect (CPE) and several passages
may be required before a CPE is observed. However, in the absence
of a CPE, examination of cell lysates by TEM often reveals the
presence of parvovirus virions (9). Following adaption the virus
produces a well-defined CPE 3-5 days after inoculation, consisting
of rounded refractile cells. The cytopathic effect progresses to
complete destruction of the cell monolayer after 6-7 days. Cell
cultures derived from Muscovy duck embryos are required in order
to isolate MDPV. As with GPV, virus replication may occur in the
absence of a detectable CPE and EM or molecular methods may be
required to confirm the presence of the isolate (27).
AGENT IDENTIFICATION
Morphology
Direct electron microscopy examination of feces from infected
birds or culture-derived material often reveals parvovirus particles.
The intact virions are 20-22 nm in diameter, non-enveloped, and
hexagonal in shape with an estimated 32 capsomeres (8).
Aggregates of virions have also been detected following EM
examination of ultrathin sections of heart and bursae from infected
goslings (3). An immune EM technique utilizing specific GPV
monoclonal antibodies has been developed to detect virions in the
organs of goslings and cells of infected goose and duck embryos
(1).
Physicochemical Properties
Goose parvovirus is very resistant to physical and chemical
inactivation. Following heating at 65 C for 30 min, no loss of
infectivity was reported (8). The virus is resistant to ether and
chloroform and was stable at pH 3.0 for 1 hr at 37 C. Under in vitro
conditions, infectivity is completely destroyed following treatment
with 0.5% formaldehyde (24).
Biological Properties
Unlike several mammalian parvoviruses haemagglutination
activity has not been reported for GPV or MDPV using a variety of
red blood cells under a variety of conditions (24)
Molecular Identification
Goose parvovirus has a single-stranded DNA genome of about
5600 bases in length. Three major proteins of 91, 78, and 58 kD and
a fourth lighter protein of 51 kD have been identified (8).
Infectious viral particles have a density of approximately 1.38 g/ml
in cesium chloride (17). Polymerase chain reaction (PCR) and
sequencing has been used to detect and identify both GPV and
192
MDPV in vitro and in tissues (8,26). A digoxigenin-labelled DNA
probe technique has been described for the detection and
characterization of MDPV isolates (19).
Antigen Detection
Viral antigen can be detected by immunofluorescence and
immunoperoxidase techniques in the viscera, particularly the liver
and spleen, of infected goslings and ducklings, and in infected cell
cultures and embryonated eggs (1,8,23). For primary antibody,
goose anti-goose parvovirus globulin is obtained by triple
precipitation of hyperimmune goose serum using 33% ammonium
sulfate. The concentration of protein is determined and the dialyzed
gammaglobulin fraction labeled with fluorescein isothiocyanate
(FITC). When applied to impression smears of liver or spleen from
infected goslings and infected cell cultures the nuclei of the cells
fluoresce brightly.
Antigen-capture enzyme-linked immunosorbent assays (ELISAs)
have also been developed for the detection of goose parvovirus
antigen in cell cultures and tissues from goslings (16). However,
these techniques have not yet been validated for routine laboratory
testing.
Agar-gel precipitin techniques have also been developed to detect
parvovirus antigen in the embryonic tissues and allantoic fluid of
infected embryos (7). Following inoculation of 10-to- 15-day-old
goose or Muscovy duck embryos with diagnostic samples, embryos
that subsequently die can be examined for goose parvovirus antigen.
The dead embryos and amniotic-allantoic fluids (AAFs) are
harvested, the embryos’ head and limbs removed, and a 20% (w/v)
suspension prepared in the AAF. After homogenization, the
suspension is mixed with an equal volume qf trichlorotrifluorethane
(Arcton 113, ICI, London, United Kingdom) for 30 min, followed
by centrifugation at 3000 x g for 15 min. The supernatant is
removed and further centrifuged at 46,000 x g for 2 hr at 4 C. The
resulting pellet is resuspended in a minimal volume of deionized
water and treated with 0.1% N-lauroylsarcosine (Sigma Chemical
Co., St. Louis, Mo.). Agar plates are prepared using 1% Ionager
No. 2 (Oxoid, distr. Unipath, Ogdensburg, N.Y.) in 8% sodium
chloride solution, buffered to pH 7.8. The gel pattern consists of a
central well 5 mm in diameter surrounded by six outer wells of the
same diameter spaced 3 mm apart. Aliquots of positive goose
parvovirus precipitating antisera are placed in the wells either side
of the test antigen with a known positive control antigen in the
central well. Diffusion of antiserum and antigen takes place at 20-
22 C and the plates are examined for precipitin lines after
approximately 24 hr. A positive result is recorded when the
precipitin line between the known positive control wells is
continuous with the line between the test antigen.
Immunologic Techniques
Neutralization tests in goose and Muscovy duck cell cultures or
embryonated eggs using monospecific GPV and MDPV antisera
can be used to identify the isolated virus. Cross neutralization tests
can be used to differentiate GPV from MDPV (2). Other methods
have been described, including a plaque reduction test and a sperm
agglutination-inhibition assay but these techniques have not been
fully validated elsewhere (8).
SEROLOGIC DETECTION IN THE HOST
Serologic tests are useful in evaluating the immune status of
breeding flocks of geese and Muscovy ducks and their progeny,
particularly in birds that have been vaccinated. The presence or
absence of parvovirus antibody in breeder geese will determine the
susceptibility of the progeny. Serology is also a useful diagnostic
tool in confirming recent outbreaks of the disease in goslings and
Muscovy ducklings. Ideally both acute and convalescent serum
samples should be tested. Demonstration of yolk-derived antibody

in eggs will also provide information on the levels of maternal-
derived antibody in the offspring.
Virus-Neutralization (VN) Test
The VN test can be performed in embryonating goose or Muscovy
duck eggs or primary cell cultures derived from them. A GPV
isolate adapted to growth in Pekin and Khaki Campbell duck eggs
has been developed for testing goose and Muscovy duck sera for
GPV antibodies by VN test (7). Preferably the test should be
conducted using constant virus and diluted serum (beta method).
Dilutions of heated (56 C for 30 min) sera are reacted with 60-600
median embryo or tissue culture infective doses of virus. After a
reaction time of 1 hr at 37 C, the culture systems are inoculated with
aliquots of the serum dilution-virus mixture. The tests are
completed after 7 days and the antibody titers are expressed as log2
of the reciprocal of the highest dilution of serum causing complete
neutralization of virus. Titers of 4 (1/16) or greater are considered
positive for GPV and MDPV antibody.
Agar-Gel Precipitin Test
Although less sensitive than the VN test, the agar-gel
immunodiffusion (AGID) test is a useful method for rapidly testing
large numbers of sera for the presence of GPV antibodies (7).
Antigen is extracted and concentrated from infected duck embryos
inoculated with a duck-embryo-adapted parvovirus. The tests are
performed in agar-gel plates containing 1% Ionagar No. 2 or
agarose in 8% sodium chloride solution buffered to pH 7.8 as
described previously. Diffusion of antigen and antisera takes place
at room temperature and the plates are examined for precipitin lines
after 24 hr. Positive sera can be diluted by twofold series to
ascertain the AGID antibody titer. The AGID test will not
differentiate between GPV and MDPV antibodies.
Other Serologic Tests
Enzyme-linked immunosorbent assays have been developed to
detect GPV and MDPV antibody in both geese and Muscovy ducks
(8). A blocking ELISA, incorporating anti-goose parvovirus-goose
IgG has been developed and compared to other serologic tests for
the detection of GPV antibodies (16). The results showed that the
method was rapid, reliable, easily standardized, and correlated well
with a virus-neutralization test. This type of ELISA has also been
used to detect MDPV antibodies and there was a good correlation
between antibody values and protection against challenge for at
least 7 days (15). Problems may arise with the ELISA test if the
anti-goose serum and IgG used are not obtained from GPV and
MDPV antibody negative birds. Indirect immunofluorescent
antibody assays have also been used to detect MDPV and GPV
antibodies (25,27).
DIFFERENTIATION FROM CLOSELY RELATED AGENTS
Various techniques have been developed to differentiate GPV
from MDPV, including; molecular sequencing of the virus genome,
restriction endonuclease analysis studies and VN tests (14,28). A
digoxigenin-labeled DNA probe has been developed for the
detection of MDPV. The assay proved sensitive for detecting strains
of parvovirus and differentiating isolates from vaccine-derived
strains (19).
Avian adenovirus-associated viruses are defective parvoviruses
that may be associated with adenovirus infections. In the absence
of a helper adenovirus, these parvoviruses are unable to replicate
under in vitro conditions. Early investigations into outbreaks of
Derzsy’s disease (GPV) frequently resulted in the isolation of
adenoviruses, which, at the time, were thought to be the etiological
agent of the disease (8). Some early reports also attributed the
disease to reoviruses, which were subsequently shown to be the
etiological agent of a different disease of goslings and Muscovy
193
Chapter 42 Parvovirus of Waterfowl
ducklings characterized by hepatitis, splenitis, arthritis and
tenosynovitis in 2 to 10 -wk-old birds (5,21).
There are very few other pathogens of goslings and Muscovy
ducklings that produce the strict age-specific disease pattern of
GPV and MDPV. The herpesvirus of duck viral enteritis (duck
plague) produces disease with high mortality in geese and ducks of
all ages. Isolation and identification of the causal virus will clearly
differentiate it from GPV and MDPV. Duck hepatitis viruses also
cause fatal diseases in ducks less than 6 wk of age. However, these
viruses are not pathogenic for geese or Muscovy ducks.
Hemorrhagic nephritis and enteritis of geese (HNEG) is associated
with a polyomavirus and affects geese from 4 to 20 wk of age
(10,22). The disease was first reported from particular regions of
France in the 1970s and was referred to as the late form of Derzsy’s
disease. HNEG has not been reported to occur in Muscovy ducks.
Pasteurella anatipestifer and Pasteurella multocida organisms
may also cause high mortality in goslings and Muscovy ducklings.
Treatment of birds with appropriate antibiotics and culture of the
etiologic agent in suitable media will enable differentiation from
GPV and MDPV.
REFERENCES
1. Alexandrov, M R. Alexandrov, I. Alexandrov, S. Zachareiva, S
Lasarova, L. Doumanova, R. Pesher and T. Donev. Flourescent and electron
microscopy immunoassays employing polyclonal and monoclonal
antibodies for detection of goose parvovirus infection. J Virol Methods, 79
21-32. 1999.
2. Bames, H. J. Muscovy Duck Parvovirus. In: Disease of Poultry, 10th ed
B. W. Calnek, H. J. Bames, C. W. Beard, L. R. McDougald and Y. M Saif.
Eds. Iowa State University Press, Ames, Iowa, USA. pp. 1032-1033. 1997.
3. Bergmann, V. Pathology and microscopical detection of virus in the
tissues of goslings with Derzsy’s disease (parvovirus infection). Arch Exp
VetMed, 41: 212-221. 1987.
4. Dalibard, V., G. Plassiart, Y.Cherel, M Hurtrel and M Wyers.
Caracterisation des lesions histologiques de la parvovirus spontanee du
canard de Barberie (Cairina moschata). Diagnostic histopathologique
differential avec la reovirose. Recuil de Medecine Veterinaire, 169:763-772.
1993.
5. Gaudrey, D., J. Tetkoff and J-M Charles. A propos d’un nouveau virus
isole chez le canard de Barberie. Bull. Soc. Sci. Vet. Med Lyon. 74: 137-
143. 1972.
6. Gaudrey, D. and D. Fournier. Latest discoveries on waterfowl pathology:
a new parvovirus of Muscovy ducks. Proceedings of the 9th International
Symposium on Waterfowl. Pisa, Italy, September 16-18. pp33-35.1992.
7. Gough, R. E. Application of the agar gel precipitin and virus
neutralization tests to the serological study of goose parvovirus. Avian
Pathol. 13: 501-509. 1984.
8. Gough, R.E. Goose Parvovirus. In: Diseases of Poultry, 11th ed. Y.M
Saif, H.J. Bames, J.R. Glisson, AMFadly, L.R. Mcdougald and
D.E.Swayne, eds. Iowa State University Press, Ames, Iowa, USA. Pp 367-
374. 2003.
9. Gough, R. E., V. Ceeraz, W. J. Cox, V. Palya and T Mato. Isolation and
identification of goose parvovirus in the UK. Vet Record, 151:424. 2005.
10. Guerin, J-L. Hemorragic nephritis of geese (HNEG). In: Disease of
Poultry, 11th ed. Y. M. Saif, H. J. Bames, J. R. Glisson, A. M Fadly, L. R.
McDougald and D. E. Swayne, eds. Iowa State University Press, Ames,
Iowa, USA. pp. 363-367. 2003.
11. Holmes, J. P., J. R. Jones, R. E. Gough, D. Welchman, Μ E. Wessels
and E. L. Jones. Goose parvovirus in England and Wales. Vet Record, 155:
127. 2004.
12. Jestin, V. Le point sur l’epizootie actuelle de maladie de Derzsy cher le
canard de Barberie. L’Aviculteur, 516:77-78. 1990.
13. Jestin, V., M Le Bras, and M Cherbonnel. Diagnostic de la maladie de
Derzsy. L’Aviculteur, 521. 49-51.199la.
14. Jestin, V., M-O. Le Bras, M Cherbonnel, G. Le-Gall Recule and G.
Bennejean. Demonstration of very pathogenic parvoviruses (Derzsy’s
disease virus) in Muscovy duck farms. Reel. Med. Vet. 167:849-857. 1991b.
15. Jestin, V., Μ O. Le-Bras and M Cherbonnel. Control of Muscovy duck
parvoviruses by vaccination. In: M S. McNulty and J. B. McFerran, eds.
New and Evolving Diseases of Poultry. Commission of the European
Communities, Brussels, pp. 167-181. 1994.
Richard E. Gough
16. Kardi, V and E. Szegletes. Use of ELISA procedures for the detection of
Derzsy’s disease virus of geese and of antibodies produced against it. Avian
Pathol. 25: 25-34. 1996.
17. Kisary, J. Buoyant density of goose parvovirus strain B. Acta Vet Acad
Sci. Hung, 23:205-207. 1976.
18. Kisary, J. Diagnosis and control of parvovirus infection of geese
(Derzsy’s disease). In: Acute virus infections of Poultry. J. B. McFerran and
M S. McNulty, eds. For the Commission of the European Communities
Marius Nijhoff Publishers, Dordrecht, The Netherlands. pp239-242. 1986.
19. Le Gall- Recule, G and V. Jestin. Biochemical and genomic
characterisation of Muscovy duck parvovirus. Arch Virology, 139: 121-131.
1994.
20. Lukashov, V. V. and J. Goudsmit. Evolutionary relationships among
parvoviruses: virus-host coevolution among autonomous primate
parvoviruses and links between adeno-associated and avian parvoviruses. J
of Virol, 75:2729-2740. 2001.
21. Palya, V., R. Glavits, M Dobos-Kovacs, E. Ivanics, E. Nagy, K.
Banyai, G. Reuter, G. Szucs, A. Dan and M Benko. Reovirus identified as
cause of disease in young geese. Avian Pathol. 32: 129-138. 2003.
22. Palya, V., E. Ivanics, R. Glavits, A. Dan, T. Mato and P. Zarka.
Epizootic occurrence of haemorragic nephritis enteritis virus infection of
geese. Avian Pathol. 33: 244-250. 2004.
23. Roszkowski, J., P. Gazdzinski, W. Kozaczynski and M Bartoszcze.
Application of the immunoperoxidase technique for the detection of
Derzsy’s disease virus antigen in cell cultures and goslings. Avian Pathol,
11: 571-578. 1982.
194
24. Schettler, C. H. Virus hepatitis of geese. 111. Properties of the causal
agent. Avian Pathol, 2: 179-193. 1973.
25. Takehara, K., T. Nakata., K. Takizawa, C. K. Limn, K. Mutoh and M
Nakamura. Expression of goose parvovirus VP1 capsid protein by a
baculovirus expression system and establishment of a fluorescent antibody
test to diagnose goose parvovirus infection. Arch Virol. 144: 1639-1645.
1999.
26. Tatar-Kis, T., T. Mato, B. Markos and V. Palya. Phylogenetic analysis
of Hungarian goose parvovirus isolates and vaccine strains. Avian Pathol,
33: 438-444. 2004.
27. Wool cock, P. R, V. Jestin, H. L. Shivaprasad, F. Zwingelstein, C.
Amauld, M D. McFarland, J. C. Pedersen and D. A. Senne. Evidence of
Muscovy duck parvovirus in Muscovy ducklings in California. The Vet
Record, 146: 68-72. 2000.
28. Zadori, Z., J. Erdei, J. Nagy and J. Kisary. Characteristics of the genome
of goose parvovirus. Avian Pathol. 23: 359-364. 1994.
29. Zadori, Z., R. Sefancsik, T. Rauch and J. Kisary. Analysis of the
complete nucleotide genome sequences of goose and Muscovy duck
parvoviruses indicate common ancestral origin with Adeno-associated virus
2. Virology. 212: 562-573. 1995.
 43
CELL-CULTURE METHODS
Karel A. Schat and Holly S. Sellers
SUMMARY. Cell cultures are routinely used for the isolation, identification, and propagation of viruses. Successful use of cell cultures
requires proper techniques for the preparation and sterilization of glassware. Several types of media formulations are used for the in vitro
propagation of cells. The compositions of some of the commonly used media are presented. Techniques for the preparation and storage of
primary and secondary cultures using chick embryo fibroblasts, chicken kidney cells, chick embryo kidney cells, and lymphocytes are
described in detail. In addition, brief descriptions are given for the preparation of chick embryo tendon cells and intestinal epithelial cells.
The application of cell cultures for virology is discussed.
INTRODUCTION
Cell cultures are routinely used in diagnostic laboratories for the
isolation, identification, and propagation of viruses, coccidia, and
for the detection of virus-neutralizing antibodies. Cell cultures have
many advantages over animals or embryonated eggs for such uses.
Cell cultures are economical, and they are a relatively homogentOUS
population of cells, free of immunologic and hormonal influences
that might affect replication of the virus. Many types of cells can be
stored in liquid nitrogen and thus be readily available. In addition,
recent advances in the cloning, sequencing, and expression of avian
cytokines and growth factors will allow the development of cell
cultures using specialized cell types, which cannot be grown using
conventional approaches. The use of specific-pathogen-free (SPF)
material is essential for the successful propagation of cells and
subsequent use for virus isolation. Occasionally, non-SPF eggs may
be used for cell culture as a means of directly isolating virus.
The large number of sequential operations involved in cell culture
means that aseptic techniques are of the utmost importance even in
the presence of antibiotics. Contamination risks can be greatly
reduced using laminar-flow hoods (horizontal flow for medium
preparation and vertical flow for pathogenic and nonpathogenic
viruses). Even so, cell culture can be performed satisfactorily in a
clean, well-lighted room where dust and traffic are kept to a
minimum. Aseptic techniques and the speed and dexterity of the
operator are very important factors under such conditions. Freshney
(6) and Versteeg (12) provide additional information on cell
cultures.
LABORATORY EQUIPMENT
If the culture media and solutions are to be prepared in the
laboratory in reusable glassware, a large supply of pure water must
be available. The water must be deionized, double-distilled, or both,
to remove all traces of cytotoxic organic and inorganic materials.
Reverse osmosis (RO) (Bamstead International, Dubuque, Iowa,
and other companies) followed by glass distillation is often used.
Pure water must be stored and transported in glass or glass-lined
containers.
Cell attachment and proliferation on the surface of a culture vessel
is critical for the growth of anchorage-dependent cells, which
require a nontoxic, biologically inert, and optically transparent
surface that will allow cells to attach and allow movement for
growth. Cells attach and grow well on glass and since it is clear, it is
ideal for direct examination of attached cells by microscope. Glass
was the primary material of choice until the 1960s when plastic
culture vessels became available. In most laboratories glass has
been replaced by plastic, which has greater consistency, superior
optical properties, is supplied sterile and is disposable. Although
several plastic substrates are available for this purpose, polystyrene
is the most common, and most economical. Through chemical,
electric ion discharge or gamma irradiation, the surface of the
polystyrene is modified such that it becomes hydrophilic and
negatively charged thus allowing attachment of most anchorage
195
dependent cells (3, 5, 8, 11). Plastic dishes for bacteriology use
cannot be used for cell cultures.
Depending on the application, cell monolayer cultures can be
propagated in a variety of plastic culture vessels including multi­
well plates, petri dishes, flasks and roller bottles. For monolayer
cultures, the cell yield is directly proportional to the available
Surface area of the flask. Virus neutralizations and titrations can
easily be scaled down to a 96-well microplate format requiring
smaller reagent volumes and easily enabling multiple sample
replicates. Petri dishes and flasks are available in a variety of sizes
accommodating a couple of milliliters to several hundred milliliters
of media and cells.
Plastic vessels are routinely sterilized after use by autoclaving and
discarded. It is possible, however, to recycle used plastics by the
following method:
1) Disinfect the used plastics for 16 hr in 2% sodium hypochlorite
or in a household microwave oven (2.45 gHZ) for 10 min.
2) Wash at least six times in tap water.
3) Drain and rinse six times in distilled wafer.
4) Drain and dry in an incubator at 48 C.
5) Sterilize the plastic materials in a household microwave oven
(2.45 gHz) for 3-6 min with the power selection on high. Place a
beaker with 250-500 ml of water in the oven as a heat sink. It is
important to cool down the oven between runs and to keep the
plastics dry. Petri dishes can be stacked three high, and flasks
should be placed upright with the caps loose. Caps may have to be
sterilized separately depending on the manufacturer of the flasks.
This procedure will allow the use of plastic tissue-culture material
for 10-30 cycles before it starts to deteriorate.
Although glassware has been largely replaced by plastics,
glassware can be used for growing cells, but careful washing is
essential. The following general procedure is recommended for the
preparation of all glassware used in tissue culture:
1) Disinfect all contaminated material by autoclaving at 20 pounds
per square inch (psi) for 20 min.
2) Rinse in tap water to wash away all solid matter; if necessary,
brush. New glassware (optional) or badly soiled glassware must be
immersed for 12 hr in a sulfuric acid-dichromate cleaning solution.
(Dissolve 120 g Na2Cr207.2H20 in 1000 ml tap water and add 1600
ml concentrated sulfuric acid, technical grade. Place the container in
ice-cold water during the preparation, and use safety glasses and
heavy gloves.) Rubber stoppers can be treated in 0.5 N sodium
hydroxide.
3) Soak small items in hot water with 75 ml Micro-90® cleaning
solution (Cole Parmer Instrument Company, Vernon Hills, IL) per 4
liters of water for at least 1 hr. Place bottles, flasks, and other larger
items in warm water (52 C) with Micro-90® in the ultrasonic
glassware washer. Put pipettes in holders after removal of the cotton
plugs and place them in the glassware washer as is done with other
glassware. Micro-90® can be replaced by other alkaline
disinfectants that do not adsorb to glass.
4) Rinse at least twice with tap water and twice in RO or double­
distilled water. Wash pipettes in cold water rinsers for at least eight
rinses with tap water, and then immerse them in RO water.
5) Drain all glassware on draining racks or in a drying oven.
Karel A. Schat and Holly S. Sellers

Table 43.1. Compositions of commonly used cell culture media.A

No. Name medium Components Amount
M199,10x 90.0 ml
Tryptose phosphate broth 100.0 ml
1 M20b NaHCO3,10% 6.3 ml
Antibiotic mixture 10.0 ml
Deionized water, qs 1000.0 ml
Ml 99 powder 4.5 g
Ham’s F10 powder 5-5 g
2 F10-199c Tryptose phosphate broth 7.5 ml
NaHCOa 0.85 g
Antibiotic mixture 10.0 ml

Leibovitz’s L-15 powder 8.76 g

McCoy’s 5A (modified) powder 5.0 g
3 Leib-McCoyc NaHCOa 0.94 g
Antibiotic mixture 10.0 ml
Deionized water, qs 1000.0 ml

Lactalbumin hydrolysate, 10
* 100.0 ml
Hanks’ BSS, Ιθχ 90.0 ml
4 LH° Antibiotic mixture 10.0 ml
Deionized water 800.0 ml
NaHCO3 solution, qs to adjust pH to 7.3-7.5

BME powder 9.18g

Tryptose phosphate broth 3.54 ml
5 BMEe NaHCOa 1.04 g
Antibiotic mixture 10.0 ml
Deionized water, qs 1000.0 ml

Leibovitz’sL-15, lx 385.0 ml
McCoy’s 5a, modified, 1 χ 385.0 ml
NaHCOa, 10% 2.0 ml
Tryptose phosphate broth 50.0 ml
2-Mercaptoethanol, 1 mM 10.0 ml
6 LMHf
Sodium pyruvate, 100χ 10.0 ml
Glutamine solution, 200 mM 10.0 ml
Antibiotic mixture 10.0 ml
Chicken serum 100.0 ml
FBS 80.0 ml
Aqs = sufficient quantity; BSS = balanced salt solution; BME = basal medium, Eagle; FBS = fetal bovine serum; CK = chicken kidney; CEl· = chick embryo fibroblast.
bM20 supplemented with 5% FBS (M25) is used as growth medium for CK cells. M20 supplemented with 2% FBS (M22) is used as growth medium for CEFs. Maintenance medium contains
0.25% FBS (M20.25).
c F10-199 and Leib-McCoy supplemented with 4% calf serum are used as growth medium for duck embryo fibroblasts and CEFs. For maintenance medium add 1% calf serum We currently
use Fl0-199 with 0.25% FBS as maintenance medium for CK cells..
dLH supplemented with 10% calf serum is used as growth medium for CEFs. Maintenance medium contains 2% calf serum
eBME supplemented with 5% FBS is used as growth medium for CK cells. Maintenance medium contains 1% FBS.
fLMH is used for cultivation of lymphocytes and lymphoblastoid cell lines. RPMI-1640 can be used to substitute McCoy and Leibovitz. Certain cell fines require considerably less serum.

6) Plug pipettes, place in canisters, and sterilize with dry heat at 160
C for 2 hr after the oven gets up to temperature. Wrap small items
and package these items. Materials that will melt or bum can be
sterilized by autoclaving (20 psi for 20 min). The use of indicator
tape or ampoules is recommended to ensure that proper
temperatures are reached.
In addition to the usual glassware and equipment found in a
bacteriologic laboratory, necessary equipment includes an inverted
microscope, and if cells are cultured in dishes or tubes open to the
atmosphere, an incubator in which the atmosphere can be
maintained with 85% relative humidity and 3-5% carbon dioxide.
Incubator cleanliness is important to prevent gross contamination of
the working area, thereby inadvertently contaminating the cultures.
Because the high level of humidity in the incubator favors growth
of molds, routine disinfection of the incubator is recommended.
Mouth pipetting is not acceptable. Use either a rubber pipette filler
or an electric apparatus (e.g., Pipet-aid, Drummond Scientific Co.,
Broomall, PA).
CELL-CULTURE MEDIA AND STOCK SOLUTIONS
Culture Media
Cell-culture media must provide the cells with necessary nutrients
and adequate conditions for a normal metabolism. Some media,
such as Ml99 and RPMI-1640, are complex, containing 50-100
ingredients, and are probably better purchased (either aslOx
concentrate or in powdered form). Simpler media, such as Earle’s
BSS with lactalbumin hydrolysate, are easily prepared in the
laboratory.
The choice of medium and the amount and source of serum added
to the medium will depend on a number of factors, such as cell
requirements, intended use of the cell cultures, and price and
availability of the media components and sera. Additional vitamins,
amino acids (particularly L-glutamine), and chicken embryo extract
are frequently added to improve growth. The addition of 10% TPB
facilitates transformation of cells by Rous sarcoma viruses. Table
43.1 gives examples of media formulations used in several research
laboratories.

196
 Chapter 43 Cell-Culture Methods

Table 43 2. Ingredients for preparation of 1 χ concentration of balanced salt solutions (BSSs) and phosphate-buffered saline (PBS).
SolutionA Component Amount®
Hanks’ BSS Earle’s BSS Dulbecco’s BSS PBS
Water 800 800 800 1000
A NaCl 8.0 6.8 8.0 8.0
KC1 0.4 0.4 0.2 0.2
MgSO4.7H2O 0.2 0.2 — —
KH2PO4 0.06 — 0.2 0.26
Na2HPO4.2H2O 0.06 — 0.14 0.57
NaH2PO4.H2O — 0.14 — —
Glucose 1.0 1.0 — —
Phenol red, Na 0.017 0.017 0.017 0.017
B Water 100 100 100 —
CaCl2 0.14 0.2 0.1 —
C Water 100 100 100 —
MgCl2.6H2O — — 1.0 1.8C
NaHCO3 0.35 2.2 — —
A Add solution A to solution B. Sterilize solutions A-B and C by autoclaving at 10 psi for 10 min. Solution C can be sterilized by pressure filtration. After
cooling, solutions A-B and C can be mixed. Omit solutions B and C if these components are not needed. In that case, add 200 ml of water to solution A.
B All quantities are given in g, except water, which is in ml. Use less water than indicated; after all components are in solution, add water to the required
amount. For 10* solutions, use 10* the amounts except for water; solution C is omitted from Hanks' BSS 10χ and Earle's BBS 10*.
c Added directly to solution A.

All media have the following basic composition:
1) A balanced salt solution.
2) A protein supplement such as serum or amniotic fluid, or protein
derivatives such as lactalbumin hydrolysate or tryptose-phosphate
broth, or amino acids.3) An antibiotic mixture to control accidental
microbial contamination. However, the use of antibiotics is
controversial in permanent cell lines because it may mask low-level
bacterial contaminations.
Although many of the media components can be bought
commercially, it is sometimes easier or necessary to prepare these
components in the laboratory. It is imperative to use pure water and
reagents of a tissue culture grade.
Balanced Salt Solutions (BSSs) and Phosphate-Buffered Saline
(PBS)
Hanks’ BSS (HBSS) and Earle's BSS are frequently used as bases
for growth media (Table 43.2). Their function is to maintain a
physiologic pH (7.2-7.6) and osmotic pressure and to provide
water, glucose, and inorganic ions needed for a normal cell
metabolism. BSSs usually contain a pH indicator (e.g., phenol red).
BSSs and PBS are also frequently used to wash inocula and dead
cells from cultures, to remove serum-containing media before
trypsinization, and to dilute trypsin solutions. However, when
versene (ethylenediaminetetraacetic acid [EDTA]) is used as the
cell dispersant, Dulbecco's BBS without calcium and magnesium
salts (solution A [Table 43.2] made up to 1000 ml of water) should
be used for washing cells and diluting the versene.
When the solutions are being prepared, each salt must be
completely dissolved before the next one is added. For convenience,
Hanks' and Earle's stock solutions A and B (Table 43.2) can be
prepared at 10* concentration. In this case, it is advisable to add
NaHC03 separately to the lx solution. The stock solutions can be
autoclaved separately and, after cooling, mixed slowly with
constant stirring. Alternatively, they can be mixed as above,
sterilized by filtration, and stored frozen or at 4 C. For use, one part
of the 10x solution is added to nine parts of water, and the solution
is finally sterilized either by filtration or by autoclaving. It is
advisable to omit phenol red when the BSSs or PBS solutions are
used in the preparation of materials for immunohistochemical
staining or for molecular biology.
Trypsin and Versene (TV) Solution
Stock solutions of up to 2.5% trypsin can be prepared or obtained
commercially. The following 10x stock solution of trypsin and
versene (TV) is often used for avian cell cultures and is prepared as
follows. Dissolve in 1000 ml of glass-distilled water in order as
listed: 85 g NaCl, 4.0 g KC1,10 g glucose, 3.5 g NaHC03, 106 units
of penicillin G sodium, 1 g streptomycin sulfate (see below), 5 g
trypsin 1:250 (Invitrogen, Carlsbad, CA and other companies), 2.5 g
EDTA, and 20 ml of 0.5% phenol red solution (Invitrogen). Stir for
2-3 hr at room temperature or overnight at 4 C. Not all of
the trypsin will go into the solution. The insoluble parts can be
removed by centrifugation at 180 x g for 20 min or by prefiltration
through 1-2.5 cm of Celite filter aid on a Buchner funnel. Sterilize
TV solution by filtration. Dispense in 50-100 ml quantities and
freeze at -20 C. Use as lx TV solution (final concentrations: 0.05%
trypsin and 0.025% versene) by mixing 100 ml 10x TV solution
with 900 ml of sterile glass-distilled water. Warm the TV solution
to 37 C before use.
Sodium Bicarbonate Solution
To simplify control of pH, sodium bicarbonate is often omitted
from salt solutions and media. Sodium bicarbonate is added to the
medium just before use. Various concentrations from 1.4 to 10%
have been used. The authors use a 10% solution in double distilled
or RO water sterilized by filtration under positive pressure.
Autoclaving (see Table 43.2) or negative-pressure filtration will
convert the sodium bicarbonate to sodium carbonate. An alternative
approach is the use of equimolar concentrations of sodium
carbonate and bicarbonate. Store at room temperature in small
aliquots in tightly capped tubes.
Neutral Red Solution
A 1% solution of neutral red (Invitrogen) is prepared in water,
sterilized by filtration, and stored at room temperature. A 0.33%
solution is available commercially (Invitrogen).
Antibiotic Solution
Antibiotic-antimycotic solutions are commercially available
(e.g., from Invitrogen). These solutions contain penicillin G
sodium (10,000 IU/ml), streptomycin sulfate (10,000 pg/ml),
and amphotericin B (Fungizone®, Invitrogen) (25 pg/ml) in
sterile saline. Add 1 ml of this solution to 100 ml of medium. If it is

197
Karel A. Schat and Holly S. Sellers
Table 43.3. Composition of agar overlay media.
No. Name Composition"41
1 2- M20® Ml 99,10x
NaHCO3,10%
Tryptose phosphate broth
Antibiotic mixture
Deionized water
Agar 2%
2 2* LHb Earle’s balanced salt solution 2* containing 1.3% lactalbumin hydrolysate
1% neutral red solutionc
Antibiotic mixture
Agar, 1.6%—3%
3 2x F10-199 M199, 2χ
Ham’s medium F10,2χ
Tryptose phosphate broth
Calf serum
Antibiotic mixture
NaHCO3, 7.5%, sufficient quantity to adjust pH to7.3-7.5
Agar 1.6%
A The agar is melted and cooled to 42-45 C; the 2* medium is warmed to 42 C, and the two parts are mixed.
B Can be used with or without serum.
c Neutral red is used for staining cultures infected with cytopathic agents. Live cells stain red and dead cells (plaques) are not stained.
difficult to obtain the commercially available solutions, it is
possible to prepare these solutions in the laboratory. In that case
vials of penicillin G sodium and dihydrostreptomycin sulfate are
opened aseptically and dissolved in sterile glass-distilled water (or
PBS) to give 10,000 IU and 10,000 pg, respectively, per ml of stock
solution. If not treated aseptically, the solution can be sterilized by
filtration. Amphotericin B (Fungizone®) can be added at 25 pg/ml.
Amphotericin B is insoluble and must be added aseptically. The
mixture should be stored frozen in convenient volumes. For use, it
is thawed and added to all media and solutions in cell culture at a
rate of 1 ml of the antibiotic stock to 100 ml of medium. This will
give a final concentration of 100 IU of penicillin, 100 pg of
dihydrostreptomycin sulfate, and 0.25 pg of amphothericin B per
milliliter of medium. Higher concentrations are occasionally used.
Stock solutions should not be repeatedly frozen and thawed. An
alternative to penicillin-streptomycin is gentamicin sulfate at 10
mg/ml; use 0.1 ml/100 ml of medium. The use of antibiotics is not
recommended for the control of Mycoplasma. Proper testing of
serum (see below), use of SPF material to establish cell cultures,
and the use of a Pipet-aid will prevent contamination with
mammalian, avian, and human Mycoplasma.
Lactalbumin Hydrolysate
This powder is available commercially (Sigma-Aldrich Chemical
Co., St. Louis, MO). The hydrolysate solution is commonly
* solution (2.5%, w/v) in HBSS or Earle’s BSS
prepared as a 10
without sodium bicarbonate. The solution is sterilized by
autoclaving and stored at room temperature. The final concentration
in the medium is 10% of the stock solution, or 0.25% (w/v).
Tryptose Phosphate Broth (TPB)
Tryptose phosphate broth (TPB) (BD, Franklin Lakes, NJ) is
prepared by dissolving 29.5 g in 1000 ml of water. TPB is
dispensed, sterilized by autoclaving, and stored at 4 C or room
temperature. It is used as a constituent of media, particularly for
focus formation by Rous sarcoma virus. TPB is also a good
substrate for bacteriologic sterility control: add 1-2 ml of test media
to 5 ml of TPB and incubate at 37 C for up to 1 wk.
Agar
Depending on the use, 1.6-3% solutions of bactoagar (BD) are
prepared in water. The agar is dissolved and sterilized by
198
Amount (ml)
90.0
6.3
50.0
10.0
400.0
400.0
500.0
10.0
10.0
480.0
225.0 225.0
50.0
50.0
10.0
—
450.0
autoclaving at 20 psi for 20 min. After cooling, the agar can be
stored at room temperature in tightly capped bottles. Just before use,
the agar is melted in a microwave oven or in a boiling water bath
and then brought to 45 C in a water bath. The agar solution should
not be repeatedly melted and solidified. Bactoagar will be
satisfactory for most uses, but the replication of some viruses is
inhibited by the presence of anionic, sulfated polysaccharides.
Addition of 100 pg diethylaminoethyl-dextran per milliliter of agar
medium or the use of Noble agar or agarose will reduce this
problem.
Formulations for agar overlays can be found in Table 43.3. A final
concentration of 0.8-1.0% agar produces a firm gel and can be used
for virus assays and long-term cultures. For cloning or visualization
of virus plaques with neutral red, a 1.5% agar overlay is
recommended. When coverslips are to be removed from beneath the
agar, a soft agar containing 0.4-0.6% agar can be used. Note that
the ingredients cannot be mixed and then melted, because the serum
will coagulate. Melt the agar in a microwave oven, and cool to 42-
45 C in a water bath. Prepare the 2* medium and warm to 37-42 C,
mix both parts as recommended, and add to the cultures. The final
temperature of the agar medium will fall fairly rapidly and will not
cause damage to the cells.
Sera
Fetal bovine serum (FBS), calf serum, and chicken serum are most
commonly used in media preparations for avian cell cultures.
However, sera from other species can be used successfully. FBS
and calf serum are best bought commercially, whereas chicken
serum can be bought commercially, but testing for the absence of
avian viruses is not always satisfactory. Due to the increased risk of
spreading bovine spongiform encephalitis (BSE) among cattle, the
country of origin and batch numbers are tracked on all bovine
serum shipped to the U.S. and Australia. The following procedure is
suggested if serum must be prepared from blood: 1) collect blood
from different individuals from the same species individually and
allow it to clot spontaneously; 2) incubate the clotted blood at 37 C
for 2 hr (afterwards it can be stored overnight at 4 C); 3) remove the
serum and centrifuge at 2000 * g for 30 min to remove the
erythrocytes; 4) individual sera can be pooled, but keep pools
separate, and 5) serum can be collected aseptically or sterilized by
filtration, although it clogs most filters rapidly (see section on
sterilization).

All batches of sera including those purchased from commercial
sources should be tested for support of cell growth and for the
presence of Mycoplasma. Most suppliers of sera will supply one
100-ml bottle of serum of a given lot to allow testing before
purchasing. The following procedure is recommended for testing to
support cell growth: 1) set up cultures using lx and 0.5x the regular
number of cells, and 2) make a passage (subculture) when the
cultures are confluent, preferably followed by a second subculture.
Subtle differences between batches of serum may not be evident
until after the second subculture. It is important to test the batches
of serum on all cell types in use.
The medium of the first test cycle can be used for Mycoplasma
testing (cell culture is an excellent enrichment method for
Mycoplasma). The following method will allow detection of most
common contaminating Mycoplasma species: 1) prepare liquid
medium (Fabricant’s medium Π) using heart-infusion broth (BD)
supplemented with 10% swine serum, 10% fresh yeast extract (see
below), 1000 IU/ml penicillin G sodium, and 0.1% thallium acetate;
2) plates are made as above but with heart-infusion agar (BD)
instead of broth; 3) inoculate 0.2 ml of the sample in a tube with 2
ml Equid medium; 4) incubate for 3 days at 37 C, plate a loopful on
a quadrant of a plate, and incubate in a candle jar with moist
atmosphere; and 5) examine the plate after 6 days for Mycoplasma
colonies. Proper preparation of yeast extract is essential and is done
as follows: 1) warm 1000 ml of water to 45 C, add 250 g live
bakers' yeast, simmer for 15 min, and cool the suspension; 2)
centrifuge at 16,500 x g for 30 min; 3) filter the supernatant through
filter paper and autoclave in bottles or tubes; and 4) store the extract
at -20 C if desired. Instead of using this method it is also possible
to test the supernatant fluid by polymerase chain reaction (PCR)
using appropriate primers, but this approach may miss some
Mycoplasma species.
Chicken Embryo Extract
Eight-to-10-day-old SPF chicken embryos are recommended.
After discarding the eyes, macerate the embryos by forcing them
through a syringe and an 18-20 gauge needle into a flask containing
an equal volume of PBS. Store this cell suspension overnight at -20
C, then thaw it, centrifuge it for 15 min at 500 x g, and save the
supernatant. This process can be repeated twice more. After the
final centrifugation, store the supernatant at -20 C.
Sterilization
Many of the constituents and sometimes the complete media can
be purchased sterile. Some solutions can be sterilized by
autoclaving, for example, PBS, agar solution, versene solution,
neutral red solution, TPB, lactalbumin hydrolysate, and distilled
water. However, media containing thermolabile compounds, such as
amino acids, antibiotics, serum, or trypsin, cannot be autoclaved
and must be sterilized by filtration. Pressure filtration through
membrane filters following procedures recommended by the
manufacturers (Millipore Corp., Billerica MA. or Pall Corporation,
Ann Arbor, MI) is highly recommended. Usually, a single sterile
filter is satisfactory for filtering solutions other than serum or
trypsin. Special filters and filter holders recommended for the
filtration of serum products are available (Millipore, Pall).
199
Chapter 43 Cell-Culture Methods
PREPARATION OF CELL CULTURES
Preparation of cell cultures involves removing organs aseptically
from freshly killed animals or from embryonating eggs. The organs
are mechanically cut up into small pieces, washed to remove
erythrocytes, and then dispersed into a suspension of single cells by
enzymatic digestion with trypsin. The cells are washed free of the
trypsin, suspended in a growth medium, counted, and placed in
appropriate tissue-culture vessels. These are placed in an incubator,
and the cells are allowed to grow. Of the innumerable procedures
used, the following are recommended.
Chick Embryo Fibroblast (CEF) Cultures
This procedure can be used for embryo cell cultures of many
different species. Embryos are used at about the midpoint in the
incubation period (9-11 days for chicken embryos).
1) Candle a group of 9 to 11 day-old embryonated chicken eggs for
viability.
2) Clean the shell surface by immersing in alcohol for 5 min or by
swabbing with tincture of iodine. Do not use soiled eggs.
3) Holding the egg in a gloved hand, allow any excess alcohol to
drip off, cut around the shell just below the air cell, and flip away
the piece of the shell. Remove the embryo by placing the forceps
under its neck and lifting the embryo out with care so that it breaks
loose from its yolk sac. Do not use embryos soiled with yolk; the
yolk is toxic for cells.
4) Hold the embryo over a sterile trypsinization flask (Bellco
Biotechnology, Vineland, NJ) in such a way that when the head is
cut off, the head falls outside the flask and the body falls inside. The
embryos can also be placed in a beaker and minced with scissors.
The eyes, limbs, and viscera can be removed before mincing. This
will yield more homogeneous primary cultures, but it is more
laborious.
5) Transfer the minced tissues to a trypsinization or Erlenmeyer
flask, or a prescription bottle. Wash the pieces by adding 3 ml
sterile PBS per embryo, swirl, allow the pieces to settle, and decant
the supernatant fluids. Repeat the wash until the PBS is clear and
free of blood, and then pour out as much PBS as possible.
6) Add 40-50 ml prewarmed (37 C) TV solution, shake vigorously,
and incubate at 37 C with intermittent shaking, or use a magnetic
stirrer. After 5 min, allow the pieces to settle and carefully pour the
supernatant suspension through two layers of sterile cheesecloth
into a beaker. Transfer the suspension into large centrifuge flasks
containing 5% (v/v) calf serum or FBS and place on ice for at least
5 min. If the embryos were not minced with scissors, break the
embryos up in PBS by allowing the stirring bar to rotate moderately
fast and wash once with TV solution before trypsinization.
7) Repeat the procedure three or four times until only the white
fibrous tissues are left and no more cells disperse, that is, the trypsin
is nearly clear. Mix the cellular suspensions collected from all the
trypsinizations. Alternatively to trypsinizing three to four times,
trypsinization is possible once for 1 hr; use 20 ml of TV solution
per embryo and incubate for 1 hr at 25 C or 37 C with constant
stirring. Harvest the cells as described above.
8) Centrifuge for 10 min at about 350 x g. Refrigeration is optional.
Remove and discard the trypsin.
9) Add 100 ml of growth medium (Table 44.1) for each milliliter of
packed cells, and break up the cell pellets by gentle repeated
pipetting or by gently using a vortex mixer.
Chick Embryo Kidney (CEK) or Chicken Kidney (CK) Cell
Cultures
These cultures can be prepared from kidneys of 19-to-20-day-old
SPF chick embryos or 1 to 3 wk-old SPF chicks. The general
procedure is as follows:
1) For embryo kidneys, remove embryos from the eggs aseptically.
Remove kidneys and collect them in a petri dish containing PBS.
Karel A. Schat and Holly S. Sellers
For CK, euthanatize chicks by cervical dislocation or CO2
inhalation (consult your Institutional Animal Care and Use
Committee policies for the approved method) and dip in
disinfectant. Peel back the skin and open the abdominal cavity.
Remove kidneys aseptically and place them into a prescription
bottle with PBS.
2) Wash the CK two or three times with PBS by shaking the bottle
very vigorously. Allow the kidney pieces to settle and discard the
supernatant fluid. Washing is not necessary with CEKs.
3) Wash one time as above with 50 ml of prewarmed TV solution
Allow the suspension to settle for 2 min before discarding the
supernatant fluid.
4) Trypsinize as follows: Add 40-50 ml of fresh, warm TV
solution. Shake vigorously and place the bottle at 37 C for 5 min.
Carefully decant off the supernatant suspension, passing it through
two layers of cheesecloth or monofilament screening fabric
(SEFAR America, Depew, NY; cat. no. 03-94/46) into a beaker or
flask containing 5% (v/v) calf serum. Keep these cells at 4 C. Care
must be taken to retain the kidney pieces in the bottle for further
trypsinizations.
5) Repeat step 4, each time adding the harvest to the same vessel
until enough cells are collected or until the kidney tissue is
exhausted.
6) Pour the cells into centrifuge tubes, centrifuge (10 min at 350 x
g) and resuspend the pellet in an appropriate growth medium (Table
43.1). Count the cells as outlined for CEFs; count small cell clumps
as one cell. Seed 0.5 χ 106 to 1 χ 106 cells/ml for stationaiy
cultures; double the cell numbers for roller cultures. A complete
monolayer will form in 48 hr. CK cells can easily be
overtrypsinized; the best results will be obtained when numerous
small clumps of three to five cells are present in the suspension.
7) Calculate the cell yield. A 1% suspension of packed cells as
described above contains about 2 χ 106 cells per milliliter. A more
accurate determination of the number of viable cells requires use of
a hemocytometer and a microscope. The latter method includes
transferring 1 ml of the cell suspension to a tube, adding 1 drop of
1% trypan blue dye, and mixing well. For best results, incubate the
cells with trypan blue for 5 min at room temperature. Cells stained
blue are dead and unstained cells are alive. Count all unstained
cells; doublets, triplets, and clumps are counted as one cell.
Suspensions should have more than 95% Eve cells. If fewer than
80% are live by this test, the cells are not suitable for culture. Seed
cells at 1 χ 106 to 2 χ 106 cells/ml for stationaiy cultures and at 4 χ
106 ml for roller bottles. These cell concentrations will give a
monolayer in 24 hr; lower cell numbers can be used if confluent
monolayers are not required within 24 hr.
Preparation of Other Cell Types
Lymphocyte Cultures. Many viruses will replicate in
lymphocytes. Short-term cultures can be prepared from splenic
lymphocytes as follows:
1) Remove spleens from chickens as described for kidneys and
place the spleens in PBS.
2) Force the spleens gently through a 60-nm nylon bolting screen
(Sefar America, Depew, NY; cat. no. 3-95/39) using a sterile
syringe plunger and PBS. The nylon screen can be placed over a
small glass beaker, covered with aluminum foil, and autoclaved.
Alternatively, individually wrapped, sterile cell strainers can be
obtained from BD (Falcon catalog # 352350).
3) Pour the cell suspension into tubes and centrifuge for 10 min at
350 χ g, resuspend the cells in PBS, and layer the suspension
carefully on top of 2-4 ml of Ficoll-Paque (GE Healthcare,
Piscataway, NJ). Centrifuge at 400 χ g for 15 min and harvest the
cells in the interface.
200
4) Wash the cells in PBS and resuspend in a lymphocyte medium
(e.g., LMH in Table 43.1). Count the cells and adjust to 1 χ 106 to 5
χ 106 cells/ml. Incubate the cells at 41 C in a CO2 incubator.
Viability decreases rapidly within 24—72 hr. The addition of
conditioned medium (CM) (see below) or stimulation with mitogens
for 72 hr followed by the addition of CM can prolong the viability
of the lymphocytes. Cloned avian cytokines are becoming
increasingly available as commercial products or can be prepared in
research laboratories using molecular techniques. The use of these
interleukines is expected to facilitate the culture of lymphocytes,
especially after stimulation with mitogens.
Conditioned medium containing interleukins can be prepared as
follows: Prepare spleen lymphocytes as above and resuspend at 2 χ
107 cells/ml in LMH without serum (LM-base) or with 2% chicken
serum (LM-2). Stimulate the cells with concanavalin A bound to
sepharose beads (GE Healthcare). Wash the beads several times
with a wash buffer (0.5 M NaCl, 20 mM Tris, pH 7.4) and
equilibrate the beads overnight in three volumes of LM-base. Mix
equal volumes of lymphocytes and beads at a ratio of 107
lymphocytes/ml and 0.3% (v/v) beads. Incubate the mixture for 48
hr and harvest the supernatant fluid. This method is far superior to
the use of concanavalin A bound to red blood cells (B. W. Calnek
and K. A. Schat, unpubl. data). The supernatant fluid can be used as
a source of CM or can be further purified, if desired. Freeze at -70
C for long-term storage.
Chick Embryo Liver Cells. Use 14 to 16 day-old embryos.
Harvest the livers and mince finely. Liver cells are fragile, so
trypsinize with care. Do not shake or stir vigorously.
Chick Embryo Lung, Heart, and Gonadal Cells. Use 14 to 16
day-old embryos for lung cells and 20-day-old embryos for heart
and gonadal cells. Prepare the cells in the same way as CEFs.
Chick embryo tendon (CET) cells. Harvest the flexor tendons
from the feet of 17 to 18-day-old embryos. Incubate the tendons
overnight in Ham’s F10 medium supplemented with 50 pg/ml Na
ascorbate and antibiotics, followed by digestion with 0.25% trypsin
and 0.2% collagenase for 2-3 hr in Dulbecco’s modified Eagle
medium supplemented with Na ascorbate and antibiotics. Culture
the CET cells in Ham’s F10 medium supplemented with 50 pg/ml
Na ascorbate, antibiotics, and 5% FBS. CET cells have been used
for studies of avian reoviruses (7).
Avian Intestinal Cells. Recently, avian intestinal cell cultures have
been developed and may provide useful tools for the isolation of
avian intestinal pathogens and the study of coccidia replication.
Procedures have been reported using turkey neonatal cecal cells and
turkey neonatal intestinal cells (2, 4). Ceca are excised, flushed
several times with HBSS containing antibiotics, slit longitudinally,
and minced into small fragments. Wash the fragments vigorously
several times with HBSS, mince the pieces further with scalpels,
resuspend the minced pieces in HBSS containing 300 U/ml
collagenase and 0.1 g/ml dispase, and incubate for 30 min with
stirring. Vigorously pipet the pieces and harvest the cells.
Resuspend the cells at 1 χ 106 to 2 χ 106 cells/ml growth medium
consisting of M199 supplemented with 4.5 mg/ml glucose, 5% FBS,
5 pg/ml heparin, 2.5 μg/ml insulin, 10 ng/ml epidermal growth
factor, standard antibiotics, and 0.2% gentamycin. These cells can
be passed several times. An avian cell line has been established (4).
Turkey neonatal intestinal cells can also be obtained from
longitudinally opened fragments of the total intestinal tract (2).
Incubation of the fragments in 0.15% TV-acetyl cysteine for 20 min
at room temperature with gentle swirling will remove the mucus.
Cells are obtained by gently shaking 2-3 cm fragments in Joklik’s
modified minimum essential medium (Invitrogen) supplemented
with 25 mM HEPES, 2.5 mg/ml glucose, 1% bovine serum
albumin, 50 pg/ml gentamicin, and 1 mM EDTA. Discard the cells
harvested after the first 5 min. Harvest cells after 25 min incubation
and wash several times to remove EDTA. Resuspend the cell pellet

in 30% Percoll® (GE Healthcare), layer the cell suspension on top
of 60% Percoll®, and centrifuge for 20 min at 500 x g. Harvest the
epithelial cells from the top layer, wash several times, and
resuspend in growth medium. The growth medium consists of either
CMRL-1066 or minimal essential medium supplemented with 25
mM HEPES, 5% FBS, 5% chicken serum, antibiotics, 2 mg
glucose/ml, 38 pg/ml ascorbic acid, 1.5 pg/ml transferrin, 4 mM L-
glutamine, 10‘8M Na selenite, 20 ng/ml epidermal growth factor, 5
pg/ml pentagastrin, IO'8 M deoxycholic acid, 0.2 pM progesterone,
25 ng/ml triiodothyronine, 10 pg/ml insulin, and 5 pM putrescine
(pH 6.9). Optimal results are obtained by plating the epidermal cells
on feeder layers of primary fibroblasts when they reach 40-50%
confluency.
GROWTH AND MAINTENANCE OF CELL CULTURES
Dispersed cells prepared by the above procedures can be grown in
many different kinds of containers, depending on the main
objectives. Cultures are usually grown in glass or plastic bottles,
petri dishes or cluster plates containing 4-96 wells. The desired
number of cells depends on several factors, including:
1) The type of cell and passage level of the cells. In general,
primary cultures are seeded with more cells per milliliter than
secondary cultures. Established cell lines can often be set up at 5 x
104 to 1 x 105 cells/ml.
2) The use of the cell cultures. Certain viruses will replicate better
in actively dividing cells, whereas other viruses can replicate in
stationary cultures. The optimum level may vary among different
laboratories and is often determined by trial and error. Containers
that are open to the atmosphere (e.g., petri dishes, cluster plates, and
flasks or tubes with loose caps) should be incubated at 37.5-39 C in
an atmosphere of 3-5% CO2 and 80-85% humidity to avoid loss of
CO2, rendering the cultures alkaline, and to prevent evaporation of
water from the media. Cultures in sealed tubes do not require CO2
or a humidified incubator. If the number of cells and culture
conditions are correct, a full monolayer should form in 18-24 hr for
fibroblastic cells and 2-3 days for epithelial cells.
Monolayers on Coverslips
Cells can be grown on glass coverslips placed in petri dishes, or in
Leighton tubes. Coverslips must be prepared as described for other
glassware. Place sterile coverslips in the dishes or tubes, and add
the cell suspensions on top of the coverslips. Make sure that the
coverslips are on the bottom of the dish; air bubbles can be removed
gently with the tip of a pipette. Other procedures are as described
above. Coverslips can be harvested aseptically after a suitable
period. Use a soft (0.5%) agar medium if monolayers are to be
overlaid with an agar-containing medium, so that the monolayer is
not pulled off the coverslip during harvesting. Alternatively,
Chamber-slide™ (Lab-Tek®, Nalge Nunc International, Naperville,
IL) can be used for this purpose.
Maintenance of Cell Cultures
Replace the growth medium with a medium with a lower
percentage of serum (maintenance medium) when the cultures have
become confluent. Replace the maintenance medium every 2-3
days, depending on pH changes. An agar-overlay medium is often
used to maintain CK cells (Table 43.3), although CK cell cultures
are routinely maintained for 6-8 days in Fl0-199 medium (Table
44.1) supplemented with 0.2% FBS. If an agar-overlay medium is
used, it is important to add a small amount of fresh agar medium
every 2-3 days to prevent the agar from drying out.
Cell Lines and Secondary Cultures
A cell line is a population of cells derived from animal tissue and
grown in vitro for at least 6 mo and more than 50 successive
passages. A cloned cell line is a cell line derived from one single
cell containing only one nucleus. Cell lines and cloned cell lines are
201
Chapter 43 Cell-Culture Methods
used extensively in mammalian cell cultures but not in avian cell
cultures, with a few exceptions. The QT-35 cell line was established
from a methylcholanthrene-induced fibrosarcoma in a Japanese
quail (10), but this cell lines is latently infected with Marek’s
disease virus (MDV) (13). Several other quail cell lines free of
contaminating viruses are available (9). The virus-free chick
fibroblast cell line CHCC-OU2 has recently been used for the
cultivation of MDV (1). Apparently, MDV can remain latent in
these cells if cells are not allowed to reach confluency. Several
other fibroblast cell lines have been reported, but these are probably
positive for avian retroviruses. Many lymphoblastoid cell lines have
been developed from tumors induced by MDV, avian leukosis
virus, and reticuloendotheliosis virus.
Primary CEFs and some other primary cell cultures can be
expanded by making a limited number of passages without
establishing a cell line. Large batches of primary CEFs can be
harvested at 48 hr (see below) and stored in liquid nitrogen (see
below) for future use. This technique has several advantages over
frequent preparation of primary cells. SPF eggs and the preparation
of primary cells are expensive. Batches of frozen cells can be
titrated for optimum growth, which facilitates the use of CEF at a
moment’s notice.
In general, CEF cannot be subcultured satisfactorily for more than
four passages. However, the addition of 1% chicken serum to the
growth medium and incubation at 41 C will facilitate additional
passages.
Passage of Cell Cultures
Use the following procedure to prepare secondary cultures or to
passage a cell line:
1) Discard the supernatant medium.
2) Wash the cells briefly with PBS (which must be free of Ca and
Mg if versene is to be used as dispersant) to remove residual serum
(which would inactivate trypsin) and residual bivalent ions (which
would inactivate versene). Sometimes, this is followed by a brief
wash with TV solution.
3) Add just enough TV solution to cover the culture, and incubate
at room temperature or 37 C until the cells round up and start
detaching from the surface. Initially, the time taken for the cells to
round up is determined by frequent microscopic examination,
although with experience the microscopic examination is not
necessary.
4) Shake or pipette the cells loose, and place the cells and TV
solution into a centrifuge tube with 5% serum. Keep the tube on ice
until centrifugation. Rinse the vessels with PBS to collect additional
cells. The optional step of washing with PBS is important if all cells
must be harvested.
5) Centrifuge at 350 x g for 15 min, discard the supernatant, and
resuspend cells in growth medium.
6) If desired, count the cells as described for primary cultures.
7) Dilute the cells, if necessary, and seed them in new culture
vessels. In general, a primary culture will yield two secondary
cultures of the same size, whereas established cell lines can be
divided into five or more subcultures.
In general, lymphoblastoid cell lines do not attach to the culture
vessels and can be simply subcultured by counting and readjustment
to 0.5 x 106 cells/ml. Centrifugation over Ficoll-Paque (15 min, at
400 x g) is occasionally needed to remove dead cells.
Freezing of Cells Many cell lines, as well as primary and
secondary cells, can be frozen for later use. The only equipment
needed, in addition to that found in most laboratories, is a suitable
low-temperature freezer. Cells can be stored indefinitely in liquid
nitrogen (-196 C) or for weeks to months at -70 C, although
viability does decline. Actively growing cells between 2-5 days
after plating will give the best results, although others can be used,
including cells dispersed directly from organs and blood cells. The
procedure is as follows:
Karel A Schat and Holly S. Sellers
1) Prepare the cells as outlined in the section on passage of cell
cultures.
2) Centrifuge the cells at 350 x g for 10 min, and discard the
supernatant fluid.
3) Resuspend the cells in cold freeze medium at a concentration of
up to 5 x 107 cells/ml. Freeze medium consists of growth medium
(e.g. M20 [Table 43.1] supplemented with 7.5% dimethylsulfoxide
and 10-15% serum.
4) Fill the storage vials and seal without delay.
5) Place the vials in an insulated container in the vapor phase of a
liquid nitrogen container for a minimum of 45 min or in a freezer at
-70 C for 3-24 hr. Optimum freezing requires a gradual lowering of
the temperature at about 1 C/min. Programmable freezers are
available for this purpose, but they are expensive and cumbersome
for freezing small batches of cells.
6) Transfer the vials into the liquid phase of the liquid nitrogen
container.
Insulated containers can be made of cardboard, plastic foam,
wood, metal, or pipette canisters. They must contain enough
insulation to allow the gradual decrease in temperature (e.g., when
vials with distilled water at room temperature are placed in the
container, the water will take at least 30 min to freeze after the
container is placed at -70 C).
Just before use, cells should be removed from the liquid nitrogen
storage and placed into water at room temperature. It is advisable to
add 10% (v/v) of a disinfectant such as 5.25% sodium hypochlorite
(e.g., Clorox, Clorox Company, Oakland, CA) to the water, because
viruses can be present in the liquid nitrogen as a result of broken
ampoules. It is important to use a facemask and heavy gloves while
removing the vial from the liquid nitrogen for protection from glass
fragments should the ampoule explode. The ampoule should be
agitated constantly until the last piece of ice thaws, and then the
contents should be immediately removed aseptically and diluted
slowly in growth medium. Typically, 1 ml of cell suspension from
the ampoule can be diluted in 10 ml of medium and then further
diluted to the final concentration based on the number of viable
cells or prior titration of the batch of frozen cells.
APPLICATION OF CELL-CULTURE TECHNIQUES IN
VIROLOGY
The most important factors to be considered in studies involving
viruses are a cell-culture method susceptible to virus infection,
proper growth medium free of antibodies and nonspecific virus or
cell inhibitors, and environmental conditions best suited to maintain
the cells during the entire period of the experiment. Virus
multiplication can be detected in the following ways:
1) Morphologic alteration of the cells, called cytopathic effect
(CPE), caused by degenerative changes, or, as with some tumor
viruses, transformation. Under suitable culture conditions in which
agar overlays and low doses of virus are used, CPE can be seen as
plaques and transformation as foci. Plaques can be made visible by
adding 1.0 ml of neutral red (1%) to 100 ml of agar-overlay
medium. Alternately, the neutral red may be added with the feed
agar at a later time. Use 2.0 ml of 1% neutral red per 100 ml of feed
agar. Keep the cultures in the dark after the addition of neutral red.
Live cells will stain with neutral red, whereas dead cells will be
visible as clear plaques.
2) The formation of giant cells and syncytia.
3) The appearance of cytoplasmic or nuclear inclusion bodies
shown by using polychrome dyes.
4) The induction of pH changes in the medium due to changes in
cell metabolism.
5) Changes in the hemadsorption properties of the cell membrane.
6) The ability of some noncytopathogenic viruses to interfere with
or enhance the CPEs of other viruses.
202
7) Serologic procedures that detect viral antigens in or on cells,
such as immunofluorescence, enzyme-linked immunosorbent assay,
or complement fixation.
8) Assay of cell-culture materials in another host system.
9) Detection of viral DNA or RNA by Southern or northern
hybridization or by PCR or reverse transcriptase-PCR.
See Figure 43.1 for pictures of uninfected cell monolayers and
various CPE.
Virus Isolation
Procedures will depend greatly on the virus suspected to be present
and the type of sample used; however, the following procedures are
generally suitable:
1) Collect organs or tissues such as lung, liver, and brain
aseptically, cut them into small fragments, and homogenize by
mechanical means. Prepare a 10% (w/v) suspension using PBS or
BSS with 5x antibiotics in cases of heavy contamination. Swabs
should be placed in tubes containing BSS or growth medium with
antibiotics. For shipment, samples should be properly packaged to
prevent leakage (consult shippers for current regulations) and
shipped frozen. If cell-associated viruses are suspected, heparinized
blood or single cell suspensions need to be obtained. Cell
suspensions should be prepared from organs without disrupting the
cells using a bolted nylon screen, or in a Tenbroeck homogenizer
(Fisher Scientific, Pittsburgh, PA) on ice, or by passing minced
pieces through a syringe with a 18-gauge needle. If necessary,
freeze cell suspensions as outlined in the section on freezing of cells
and ship on dry ice.
2) Use cell-free suspensions directly as inocula, or freeze and thaw
several times, or treat with ultrasonic vibration to liberate the
highest amount of virus. The suspensions can be clarified by
centrifugation for 15 min at 1000 x g. Blood or cell suspensions
should not be frozen and thawed or centrifuged.
3) For cell-free inocula, remove the growth medium from the
cultures and add a part of the supernatant fluid from step 2 above.
Sufficient fluid should be present to just cover the monolayer. It is
advisable to inoculate undiluted material as well as 10- and 100-fold
dilutions of the material, because toxic materials in undiluted
samples often cause nonspecific damage to the cells. Change the
culture medium to maintenance medium when cellular inocula are
used. Add the cells directly to the cell cultures. The virus-containing
inoculum cells will settle on the monolayer.
4) Incubate cultures for 1 hr at 38-39 C.
5) Wash the monolayer twice with abundant BSS to eliminate
excess contamination and toxic materials from the sample
(optional). If this step proves necessary, wash the monolayer
carefully so as not to dislodge cells that are loosely attached. Do not
wash the monolayer when a cellular inoculum is used.
6) Add fresh maintenance medium and incubate at 38-39 C.
7) Inspect the infected monolayer and controls daily for at least 7
days. If cell degeneration is not seen or is unclear, collect the cells
and the fluids from the containers and make a blind passage onto a
fresh monolayer. Sometimes two or three blind passages must be
made to obtain evidence of CPEs. Some viruses do not produce
CPE in culture and must be examined for other changes. For stocks
of virus, supernatant fluid and cells should usually be harvested
when CPEs are at a maximum but before all cells die. The
suspension can be frozen and thawed or treated with ultrasonic
vibration, clarified by low-speed centrifugation, and stored frozen.
Cell-associated viruses are frozen as outlined in the section on
freezing of cells and stored in liquid nitrogen. It is advisable to
harvest the cell-associated virus before maximum CPE, when the
cells have a better viability.

ACKNOWLEDGEMENT
The authors are greatly indebted to H. Graham Purchase for his
contributions to earlier editions of this chapter.
REFERENCES
1. Abajoub, A., and P. M Coussens. Development of a sustainable chick
cell line infected with Marek’s disease virus. Virology 214:541-549. 1995.
2. Ali, A., and D. L. Reynolds. Primary cell culture of turkey intestinal
epthelial cells. Avian Dis. 40:103-108. 1996.
3. Amstein, C. F., and P. A. Hartman. Adaption of plastic surfaces for tissue
culture by glow discharge. J. Clin. Microbiol. 2:46 -54. 1975.
4. Augustine, P. C. Establishment of a turkey cecal cell line and
development of turkey coccidia within the cells. Proc. Soc. Exp. Biol. Med.
206:152-156. 1994.
5. Curtis, A. S. G., J. V. Forrester, C. Mclnnes, and F. Lawrie. Adhesion of
cells to polystyrene surfaces. J. Cell. Biol. 97:1500-1506. 1983.
6. Freshney, R. A. Culture of animal cells. A manual of basic technique, 4th
ed. John Wiley and Sons, Inc. New York, 2000.
203
Chapter 43 Cell-Culture Methods
7. Huang, D. D. Restriction of avian reovirus in primary chicken embryo
tendon cells. Virology 207:117-126. 1995.
8. Hudis, M Plasma treatment of solid materials. In: J. R. Hollahan, and A.
T. Bell, Eds. Techniques and applications of plasma chemistry. John Wiley
and Sons, New York. Pp. 113 - 147. 1974.
9. Li, X., and K. A. Schat. Quail cell lines supporting replication of Marek’s
disease virus serotype 1 and 2 and herpesvirus of turkeys. Avian Dis.
48:803-812. 2004.
10 Moscovici, C., M G. Moscovici, H. Jiminez, Μ M C. Lai, M J.
Hayman, and P. K. Vogt. Continuous tissue culture cell lines derived from
chemically induced tumours of Japanese quail. Cell 11:95-103. 1977.
11. Ramsey, W. S., W. Hertl, E. D. Nowlan, and N. J. Binkowski. Surface
treatments and cell attachment. In Vitro 20:802-808. 1984.
12. Versteeg, J. Color atlas of virology. Year Book Medical Publications
Ltd., London, UK 1985.
13. Yamaguchi, T., S. L. Kaplan, P. Wakenell, and K. A. Schat.
Transactivation of latent Marek’s disease herpesvirus genes in QT35, a quail
fibroblast cell line, by herpesvirus of turkeys. J. Virol. 74:10176-10186.
2000.
 I)

E F
20\ *

•
*><
f i

• ♦ • ***
* 4 ' ·
« ·
*
' · r
Λ
gure 43.1
A. Uninfected primary chicken embryo liver cells at 48 hours post seeding.
B. Reovirus cytopathic effect in primary chicken embryo liver cells at 48 hours post-inoculation.
C. Adenovirus cytopathic effect in primary chicken embryo liver cells at 48 hours post-inoculation.
D. Infectious laryngotracheitis virus cytopathic effect in primary chicken embryo liver cells at 72 hours post-inc
E. Uninfected Vero cells
F. Avian metapneumovirus (aMPV) subtype C-infected Vero cells stained with an aMPV specific monoclonal z
courtesy of D.R. Kapczynski, USDA/ARS/SEPRL).
 44
VIRUS PROPAGATION IN EMBRYONATING EGGS
Dennis A. Senne
SUMMARY. The embryonating egg is one of the most versatile and widely used host systems for the isolation and propagation of
several avian viruses. Many variables can affect the success, or failure, of the embryonating egg to support virus growth. Some variables
that are covered in this chapter include the source and species of fertile eggs, age of the embryo, route of inoculation, and conditions for
incubation. This chapter also provides detailed accounts on sample preparation: inoculation of eggs via the allantoic sac, yolk sac,
chorioallantoic membrane, and amniotic sac routes: collection of specimens from inoculated embryos; and methods for serial egg passage.
INTRODUCTION
The embryonating chicken egg has long been one of the most
widely used host systems for the isolation, propagation, and
characterization of avian viruses and for the production of viral
vaccines. The embryo and its supporting membranes provide the
diversity of cell types necessary to culture many different types of
viruses. However, the success or failure of this system for
propagating and isolating viruses depends upon several conditions
(1): route of inoculation, age of embryo, incubation temperature,
length of incubation time following inoculation, volume and
dilution of the inoculum used, and the immune status of the flock
from which the eggs were obtained. To optimize the conditions for
virus isolation and propagation in embryonating eggs, each of these
parameters should be considered for the particular virus in question.
As with any system used for virus isolation, detection of virus
infection must be possible. The growth of viruses in the
embryonating chicken egg can be detected, in most cases, by one or
more of the following (3): embryo death: lesions in the
chorioallantoic membrane (CAM) such as edema or the formation
of plaques; lesions in the embryo such as stunting, cutaneous
hemorrhage, and abnormal development of muscles and feathers;
and abnormalities in the Visceral organs, including enlargement of
the liver and spleen, greenish discoloration of the liver, necrotic foci
on the liver or heart, and formation of urate deposits in the
mesonephros. Special care should be taken to differentiate lesions
that may be caused by the presence of bacterial agents.
More direct and definitive method for detection of virus infection
of chicken embryos include: ability of the allantoic amniotic fluid
(AAF) to cause hemagglutination (HA) of washed chicken
erythrocytes, use of serologic and molecular techniques, such as
immunoassays cDNA probes, polymerase chain reaction (PCR),
and electron microscopy (1,3).
STRUCTURE OF THE EMBRYONATING EGG
Directly beneath the shell of the egg lies a tough fibrinous eggshell
membrane. This membrane lines the entire inner surface of the egg,
and forms the air cell at the blunt end of the egg (Fig. 44.1). The
eggshell membrane, along with the eggshell, helps maintain the
microbiological integrity of the egg, while allowing diffusion of
gases in and out of the egg. The distribution of gases within the egg
is facilitated by the formation of the highly vascular CAM. which
serves as the respiratory organ of the embryo. The formation of this
membrane occurs adjacent to the shell membrane throughout the
egg. During development, this membrane forms a relatively large
cavity known as the allantoic sac, which contains between 5 and 10
ml of allantoic fluid at 10-14 days of incubation (Fig. 44.1). The
embryo is directly surrounded by the amniotic membrane forming
the amniotic sac, which contains 1-2 ml of amniotic fluid. The
embryo is attached to the yolk sac, which is located approximately
in the center of the egg and supplies the nutrients necessary for
embryo development (2).
204
SOURCE OF EGGS AND PRELIMINARY INCUBATION
PROCEDURES
Fertile eggs less than 1 wk old should be obtained from vigorous,
healthy, specific-pathogen-free (SPF) breeder flocks that are
regularly monitored for most common avian viral and bacterial
pathogens (Sources: Hy-Vac, Adel, Iowa; Charles River-SPAFAS,
Norwich, CT; Sunrise Farms, Catskills, NY ). Most suppliers will
provide testing summaries upon request. The validity of any
isolation may be compromised by the presence of egg-transmitted
agents such as avian adenovirus, avian encephalomyelitis virus,
Newcastle disease virus, avian leukosis virus, infectious bronchitis
virus, infectious bursal disease virus, avian reovirus, chicken
anemia virus. Mycoplasma, and Salmonella (1). Embryonating eggs
from other species, (e. g., quail, duck, and turkey) may also be used
(1). However, some adjustments in the age at which the embryos
are inoculated may be necessary to allow for differences in
embryonic development. Duck eggs, for example, require 28 days
of incubation to hatch, compared to 21 days for chicken eggs.
Antibodies may also be found in the yolk of eggs laid by
specifically immune hens. Eggs from antibody-positive hens may
be used for virus isolation or propagation if routes of inoculation
other than the yolk sac route are employed and the isolation
procedure will be completed before the embryo reaches the 15th
day of incubation, the time when the embryo begins to absorb
antibodies from the yolk. Antibody-positive eggs should be used
only when a satisfactory alternate source is not available.
When working with some viruses, such as avian leukosis, the
genetic constitution of the breeder flock may play an important role
in determining the suitability of some eggs used for virus isolation
or propagation; some breeds of chickens are naturally resistant to
certain strains of leukosis virus.
Initially, eggs should be incubated in a suitable incubator at a
temperature of 38-39 C and relative humidity of 60-70%. If
possible, the eggs should be turned several times daily to promote
proper development and prevent adhesions of embryonic
membranes (2). Eggs are usually incubated 6-11 days before being
inoculated; the length of incubation is determined by the route of
inoculation to be used.
Eggs should be candled after 5-6 days of incubation to determine
which are fertile and which are unfertile or not viable. Eggs with
weak embryos or abnormal air cell size or position should be
discarded. Candling is performed in a darkened room using a
universal microscope illuminator or other suitable candling device.
The portable microscope illuminator permits the eggs to be candled
while positioned on the egg flat, thus eliminating the need for
handling each egg.
SAMPLE PREPARATION
The type of specimens submitted for virus isolation will differ
depending on the disease suspected but will usually consist of
tissues, feces, or swabs. Suspensions of these specimens should be
 Chapter 44 Virus Propagation in Embryonating Eggs

Fig. 44. 1^14.6. Inoculation routes for embryonating eggs.

Fig. 1. Structure of the embryonating

egg (After Hawkes [2]).

Fig. 4. Yolk sac route of

inoculation (After Hawkes [2]).

Fig. 2. Allantoic route of inoculation, Fig. 5. Chorioallantoic membrane

Method A (After Hawkes [2]). (CAM) route of inoculation
(After Hawkes [2]).

Fig. 3. Allantoic route of inoculation, Fig. 6. Amniotic route of inoculation

Method δ (After Hawkes [2]). (After Hawkes [2]).

205
Dennis A. Senne
prepared in Tris-buffered fryptose broth (1. 21 g Tris per liter of
tryptose broth), nutrient broth, brain-heart infusion broth, or other
suitable medium containing antibiotics. The concentration of
antibiotics used may depend on the type of sample being processed
but could contain, as an upper limit, penicillin (10,000 IU/ml),
streptomycin sulfate (2. 0 mg/ml), gentamicin sulfate (1.0 mg/ml),
kanamycin sulfate (0. 65 mg/ml), and amphotericin B (0. 02
mg/ml). The antibiotics may vary with local conditions and
applications. It is important that the pH of the antibiotic diluent be
adjusted to a range of 7. 0-7. 4. For convenience, a stock solution of
concentrated antibiotics, adjusted to the appropriate pH for the
diluent being used, can be prepared in advance and stored at 20 C.
Tissues can be prepared as 10%—15% suspensions by grinding
with a mortar and pestle, Tenbrock tissue homogenizer, electric
homogenizer, or stomacher. Tissue suspensions should be prepared
in a biosafety cabinet. Swabs should be diluted in as small a volume
as required for testing (usually 3-4 ml), then vortexed to expel as
much sample material as possible from the swab fibers. Swabs and
tissue suspensions should be centrifuged at 1000-1500 χ g for 20
min in a refrigerated centrifuge (4-10 C) to sediment tissue debris
and most bacteria. The supernatant should then be aseptically
removed and placed in an appropriately sized vial for egg
inoculation and storage. Specimens should be kept at room
temperature with antibiotics for 1-2 hr before being inoculated into
eggs to reduce problems with bacteria.
Specimens heavily contaminated with bacteria that cannot be
removed by centrifugation or controlled with antibiotics can be
filtered through a sterile 450-nm membrane filter. Filtering should
be used only as a last resort because aggregates of virus could be
retained by the filter and reduce the chance for successful isolation.
Following inoculation, specimens should be stored at -70 C for
future use.
ROUTES OF INOCULATION
The four most common routes for the inoculation of embryonating
eggs are via the allantoic sac, yolk sac, CAM, and amniotic sac. In
diagnostic situations where no particular agent is suspected, it is
advisable to use as many routes as possible. The CAM route is
preferred because of its sensitivity to a large number of viruses and
because it is less likely to be affected by bacterial contamination
(3). Yolk and allantoic sac routes commonly are used and have
similar sensitivities for isolation of many agents. For initial passage,
a minimum of four embryos should be used for each specimen and
each route of inoculation.
Before inoculation, all embryos should be candled for viability,
and the site of inoculation marked and disinfected with a solution of
70% ethyl alcohol (ETOH) containing 3.5% iodine and 1.5%
sodium iodide. The disinfectant can be applied with a cotton swab
or with a sponge that has been cut to fit a plastic screw cap
(approximately 40 mm in diameter). A hole is made in the shell
using a vibrating engraving tool or rotating drill equipped with a
pointed tip. The drill tip should be disinfected with ETOH-iodine
disinfectant before each use to avoid contaminating the inoculation
site. Following inoculation, the hole is sealed with type Π (for
plastics) glue or melted paraffin. The eggs are then returned to the
incubator. If the inoculated eggs are to be incubated to allow the
chicks to hatch, the eggs should be turned several times daily to
promote proper embryo development. However, continued turning
of the eggs is generally not required for most routine virus isolation
procedures. The procedures described below are similar to
previously described procedures (1,2,3).
206
Allantoic Sac Inoculations
Method A. The following procedure is the most commonly used.
1) Candle 9 to 11-day-old embryonating eggs and mark the position
of the air cell.
2) Place eggs on an egg flat, air cell up, and disinfect the area
marked in step 1 above. Drill a small hole through the eggshell just
above the marked location of the air cell (Fig. 43. 3).
3) Using a syringe fitted with a 25-gauge 5/8-inch (16-mm) needle,
inoculate 0. 1-0. 3 ml of inoculum per egg by inserting the needle,
to its full length, vertically through the hole or at a slight angle
away from the center of the egg and injecting the desired amount.
4) Seal hole and return the eggs to the incubator. Eggs inoculated by
the allantoic route are normally incubated 3-7 days postinoculation.
Method B. The following procedure may also be used.
1) Candle 9 to 11 day-old embryonating eggs, making sure that all
air cells are in the normal position.
2) Place eggs on an egg flat, air cell up, and disinfect the area
directly at the top of the egg (the area over the air cell). Drill a small
hole through the eggshell along the center axis at the top of the egg.
3) Using a syringe fitted with a 25-gauge 5/8-inch (16-mm) needle,
inoculate 0. 1-0. 3 ml of inoculum per egg by inserting the needle
vertically through the hole the entire length of the needle and
injecting the desired amount (Fig. 44.2). Avoid moving the syringe
sideways once the needle is inserted to prevent tearing of the CAM,
which could cause bleeding and death of the embryo.
4) Seal hole and return the eggs to the incubator. Eggs inoculated
by the allantoic route are normally incubated 3-7 days
postinoculation.
Yolk Sac Inoculation
1) Candle 6-to-8-day-old embryonating eggs and mark the center of
the air cell.
2) Place eggs on an egg flat, air cell up, and disinfect the top of the
egg (the area over the air cell).
3) Drill a small hole through the eggshell along the center axis at
the top of the egg (Fig. 44.4).
4) Using a syringe fitted with a 22-gauge 1-inch needle inoculate 0.
1-0. 5 ml of inoculum per egg by inserting the needle vertically to
its full length and injecting the desired amount. To verify the
position of the needle as being in the yolk sac, gently withdraw the
plunger of the syringe; yolk will be aspirated if the needle has
entered the yolk sac.
5) Seal hole and return the eggs to the incubator. Eggs inoculated by
this route are generally incubated from 3 to 10 days, or in some
instances, until the eggs hatch.
Chorioallantoic Membrane Inoculation
1) Candle 10 to 11-day-old embryonating eggs and mark the side of
the egg approximately midway along the long axis where the vein
structure is well developed.
2) Place eggs horizontally on an egg flat and disinfect both the air
cell end and the side of the egg that has been marked in step 1
above (Fig. 44.5).
3) Drill a small hole through the shell and eggshell membrane at the
center of the air cell. Drill a second hole on the side of the egg,
being careful not to perforate the eggshell membrane.
4) At this point eggs should be taken into a darkened room to
perform and observe the dropping of the CAM. Supplies needed
include a 1-ml tuberculin syringe containing sterile phosphate-
buffered saline (PBS) and fitted with a 25-gauge needle 5/8-inch
(16-mm), and a piece of rubber tubing attached to a vacuum source
or suction bulb. While holding the egg against the egg candler apply
gentle vacuum to the hole at the air cell. At the hole on the side of
the egg insert the point of a 25-gauge needle just under the shell at a
very shallow angle, perforating the eggshell membrane but not the
CAM. Withdrawing the air from the air cell will cause the CAM to
drop, thus forming a new false air cell directly over the CAM.

Deposition of a very small drop of sterile saline on the hole created
on the side of the shell is sometimes helpful in facilitating the
dropping process. The PBS acts like a lubricant to help separate the
CAM from the eggshell membrane. Once the CAM is dropped seal
the hole at the air cell and keep eggs positioned horizontally.
5) Using a syringe fitted with a 25-gauge 5/8-inch (16-mm) needle
inoculate 0. 1-0. 3 ml of inoculum per egg by inserting the needle
vertically just inside the eggshell and injecting the desired amount.
6) Seal the hole, rock the egg gently to distribute the inoculum
evenly over the CAM surface, and return eggs to the incubator.
Eggs should be incubated horizontally throughout the incubation
period to prevent the false air cell from shifting, as this may cause
excessive nonspecific mortality. Eggs inoculated by this route are
usually incubated for 5-7 days.
Amniotic Sac Inoculation
1) Candle 10 to 11-day-old embryonating eggs and mark the general
location of the embryo at the base of the air cell.
2) Position eggs air cell up and disinfect the area directly at the top
of the egg. Drill a small hole through the eggshell along the
longitudinal axis at the top of the egg. (Fig. 44.6).
3) Take eggs to a darkened room because this procedure requires
illumination of the egg with an egg candler while being inoculated.
Use a syringe with a 22-gauge P/z-inch (38-mm) needle and aim the
needle toward the shadow of the embryo. When the end of the
needle approaches the amniotic sac, give a gentle but quick stab
toward the embryo to permit the needle to penetrate the amniotic
membrane, then inject 0. 1-0. 2 ml of inoculum. To verify that the
needle is in the amniotic sac, carefully move the needle sideways; if
the needles have entered the amniotic sac, the embryo should reflect
the same movement as the tip of the needle.
4) Seal the hole and return the eggs to the incubator. Eggs
inoculated by this route are generally incubated from 2 to 4 days at
a temperature appropriate for the virus being propagated.
COLLECTION OF SPECIMENS FROM EMBRYONATING
EGGS
Inoculated eggs should be candled at least once a day to identify
eggs with dead embryos. Such eggs are removed from the
incubator. Continued incubation of eggs with dead embryos may
result in decreased virus titer due to thermal inactivation and could
cause changes in the embryonic tissues making it difficult to
interpret lesions in the embryo or on the supporting membranes (1).
Embryos that die within the first 24 hr should be discarded as
nonspecific deaths caused by injury or bacterial contamination. All
embryo deaths beyond 24 hr should be considered suspect. If the
inoculated eggs have live embryos following the specified
incubation period, eggs should be refrigerated for a minimum of 4
hr (preferably overnight) to kill the embryo and allow the blood to
clot before harvesting egg contents. The presence of erythrocytes in
the allantoic or amniotic fluids can significantly reduce the titer of
some viruses, such as paramyxoviruses and orthomyxoviruses,
which agglutinate erythrocytes.
When working with virus-infected embryonating eggs major
consideration should be given to procedures used to collect
specimens to prevent cross-contamination of samples or
contamination of the laboratory environment. It is recommended
that all procedures for harvesting or working with infectious
embryonic tissues and fluids be performed in a class Π (or higher)
microbiological safety cabinet.
Equipment and supplies needed for harvesting include two 250-ml
beakers filled with disinfectant (one for eggshells and one for used
forceps), sterile curve tipped forceps, sterile 5-ml pipettes or 5 10-
ml syringes with l/2-inch (38-mm) 18 or 20-gauge needles for
harvesting egg fluids, plastic 12 * 75-mm sterile snap-cap tubes or
other suitable vials, a large container double-lined with plastic bags
207
Chapter 44 Virus Propagation in Embryonating Eggs
for discarding eggs, a container for discarded pipettes, and a pipette­
filling device if pipettes are to be used.
All eggs from which specimens are to be collected should be
surface-disinfected with 70% ETOH or other suitable disinfectant.
The alcohol can be easily and rapidly applied using a gun-type
mist/spray bottle. The disinfectant should be allowed to dry before
harvesting specimens.
Collection of AAF
From Eggs with Dead Embryos.
1) Crack the shell over the air cell by tapping with the blunt end of a
sterile forceps. Remove the portion of the shell that forms the air
cell and discard pieces in disinfectant. Discard the forceps in a
beaker of disinfectant.
2) Use a different forceps to tear the eggshell membrane, the CAM,
and the amniotic membrane to release the AAF. Depress the
membranes over the yolk sac with the forceps and allow the AAF to
collect and pool above the forceps. Using a 5-ml pipette or syringe
and needle, aspirate the fluid and place into a sterile 12 * 75-mm
snap-cap tube or other suitable vial. Note: amniotic fluid and
allantoic fluid can be harvested separately using a syringe and
needle and aspirating the fluid from each cavity before the
membranes are tom. Carefully peeling back the eggshell membrane
from the CAM may be necessary to permit a better view of the
membranes.
3) Culture a loopful of the AAF for bacteria using blood agar or
nutrient agar. Incubate plates at 37 C overnight and record results.
4) Clarify the AAF by centrifugation at 1500 x g for 10 min and test
the AAF for HA activity using a standard microtiter procedure for
Newcastle disease virus or avian influenza virus.
5) Store AAF at 70 C for passage or other use.
6) This method can also be used to collect AAF from eggs with
embryos surviving the incubation period; eggs should be
refrigerated to kill the embryo before collecting the AAF.
From Eggs with Live Embryos.
Allantoic-amniotic fluid can be sampled from eggs with five
embryos 24-72 hr post inoculation without taking the eggs off test.
This would be important in situations where a diagnosis is urgently
needed. If done carefully, eggs can be returned to the incubator for
continued incubation. Use the following procedure.
1) Drill a hole through the shell at the top of the air cell. Using a
syringe fitted with a 22-gauge V/2-inch (38-mm) needle, insert the
needle toward the shell at an approximate 45- to 60-degree angle
from the vertical axis.
2) Aspirate 0. 1-0. 5 ml of AAF and evaluate for evidence of virus
infection using HA, electron microscopy, or other appropriate
methods.
3) Seal hole and return to incubator.
4) This technique can also be use to collect AAF from eggs with
embryos surviving the incubation period; eggs should be
refrigerated to kill to embryo before collecting the AAF.
Harvesting the CAM
Method A. The following procedure is most commonly used.
1) Crack the eggshell over the false air cell by tapping the eggshell
with the blunt end of sterile forceps. Remove the eggshell as close
to the edge of the false air cell as possible and discard pieces of
eggshell in disinfectant. Discard the forceps in a beaker of
disinfectant.
2) Observe the CAM for signs of thickening (edema) and plaque
formation.
3) Harvest the CAM by grasping it with sterile forceps, stripping
away excess fluids with a second set of forceps. Place harvested
CAM in a sterile petri plate for further examination or in a 12 x 75-
mm snap-cap tube or other suitable vial for storage.
Dennis A. Senne
4) For storage, place CAM in a sterile 12 x 75-mm snap-cap tube or
other suitable storage vial and freeze at 70 C.
Method B. The following procedure may also be used.
1) Open egg the same way as for harvesting AAF, as described
above.
2) Using sterile forceps, carefully remove the embryo and yolk sac
being careful not to dislodge the CAM from the eggshell.
3) Pour out remaining fluids.
4) Observe the CAM for lesions before removing it from the
eggshell or, for closer examination, remove the CAM from the
eggshell and place in a sterile petri plate and look for thickening of
the membrane and/or plaque formation.
5) For storage, place the CAM in a sterile 12 x 75-mm snap-cap
tube or other suitable storage vial and freeze at 70 C.
Harvesting the Yolk Sac Membrane
1) Open the egg in the same way as described above for harvesting
AAF.
2) Rupture the CAM to allow access to the yolk-sac membrane.
3) Grasp the yolk sac membrane with forceps and carefully lift it to
separate it from the embryo and other membranes. Using a second
set of forceps, strip off the excess yolk and place the yolk sac in a
sterile 12 x 75-mm snap-cap tube or other suitable vial for storage.
4) Store the yolk sac at 70 C.
Harvesting Embryo/Bird Tissues or Organs
Tissues and/or organs from inoculated embryos may be a valuable
source of virus-infected material and should not be overlooked. In
addition, waiting until the inoculated embryo has hatched and the·
collecting specimens from the newly hatched bird is sometimes
advantageous. Tissues and organs from embryos and birds should
be collected aseptically using standard necropsy procedures and
assayed for evidence of virus infection using appropriate methods.
Passage of Egg Material
In most instances where a virus is not detected on the first passage,
additional blind passages may be required. If AAF is used as the
inoculum for passage, it should be centrifuged for 10-20 min at
1500 x g and diluted 1:10 or greater in antibiotic diluent prior to
inoculation. The CAM, yolk sac, and embryo/bird tissues and
organs should be prepared as a 10% suspension in antibiotic diluent
and centrifuged at 1500 x g for 20 min prior to inoculation.
REFERENCES
1. Cottral, G. E. , ed. Manual of standardized methods for veterinary
microbiology. Cornell University Press, Ithaca, N. Y. pp. 47-52. 1978.
2. Hawkes, R. A. General principles underlying laboratory diagnosis of
viral infections. In: Diagnostic procedures for viral, rikettsial and chlamydial
infections, 5th ed E. H. Lennette, and N. J. Schmidt, eds. American
Public Health Association, Washington, D. C. pp. 1-48. 1979.
3. Hitchner, S. B. Virus propagation in embryonating eggs. In: Isolation
and identification of avian pathogens. S. B. Hitchner, C. H. Domermuth,
H. G. Purchase, J. E. Williams, eds. Creative Printing Company, Endwell,
N. Y.pp. 120-121.1980.
 45
VIRUS IDENTIFICATION AND CLASSIFICATION
Pedro Villegas and Ivan Alvarado

Summary. Since the first observation of the presence of a pathogenic agent smaller than any known bacteria causative of tobacco mosaic
disease by Ivanowsky in 1892 and Beijerink in 1898, virus identification and classification has continuously evolved. The continuous
evolution has been achieved by the constant implementation of new technologies that have contributed to new knowledge, allowing the
classification of previously unclassified viruses or the further reclassification of previously classified viruses. In poultry virology, a clear
example of such evolution is the recent inclusion of two new genera (Atadenovirus and Siadenovirus) in the Adenoviridae family, in addition
to the previously present Aviadenovirus genus (17). Also, the avian encephalomyelitis virus, formerly unassigned to a genus in the
Picomaviridae family, has been included in the new Hepatovirus genus within the same family (17).
Avian viruses have been isolated and identified by techniques now referred to as “classical”. Classical viral detection techniques include the
identification of cytophatic effect (CPE) on cell cultures, complement fixation, hemagglutination-inhibition, enzyme immunoassays and the
use of fluorescent antibodies directly on specimen material or after virus propagation. Specific information about viral morphology,
symmetry, size, shape and the presence or absence of envelope has been obtained by transmission electron microscopy. With the availability
of newer molecular techniques, such as polymerase chain reaction (PCR) and reverse transcriptase (RT) - PCR, many viruses can be detected
without previous isolation. Molecular techniques allow a rapid, novel and more sensitive detection and identification of viruses. Other
techniques, such as crystal X-ray technology have increased our understanding about the structural conformation of particular viral proteins,
such as the structural conformation of the VP2 protein of infectious bursal disease virus (24).

INTRODUCTION • Syncitial formation in primary epithelial cell monolayers, and

Virus isolation and detection
The presence of a virus in a host is initially suspected by the
occurrence of specific clinical signs and characteristic macroscopic
and/or microscopic lesions present in affected organs. Once a
particular virus is suspected, the virus can be isolated by inoculating
infectious material in susceptible birds or in susceptible systems,
such as specific pathogen free (SPF) chicken embryos or cell
culture (18). Chicken embryos remain as the most convenient
method for growing high titer stocks of some viruses for research
and diagnostic laboratories, and vaccine production (18). Some
particular viruses, such as coronavirus, orthomyxovirus,
paramyxovirus, herpesvirus and poxvirus, have been replicated in
one or several tissues in the chicken embryo (18). Three main cell
culture systems, primary cell culture, cell strains and cell lines, are
used for virus isolation. Recognition of viral growth in cell cultures
is achieved by the presence of cytophatic effect, formation of
inclusion bodies or hemoadsorption (18). Cytophatic effect can be
observed under the light microscope, with the presence of
morphologic changes induced by the virus in individual cells or a
group of cells. Inclusion bodies are subtle alterations of the
intracellular architecture of individual cells. Hemadsorption
indirectly measures the synthesis of viral protein in infected cells,
detected by the adsorption of erythrocytes to the surface of infected
cells. Once the virus is isolated, the size, shape, surface structure
and symmetry of the virions can be determined by transmission
electron microscope after negative staining of concentrated viral
particles with uranyl acetate or phosphotungstic acid (18).
The following “classical” observations have been used to identify
the presence of particular viruses in biological samples:
• The ability to spontaneously hemagglutinate chicken red blood
cells is used to identify Newcastle disease virus, influenza virus
and egg drop syndrome. Differential characterization of these
viruses can be achieved by viral neutralization using specific
polyclonal or monoclonal antibodies.
• The presence of round and refractive cells detaching from liver
cell monolayers with the presence of intranuclear inclusion bodies
by adenovirus strains.
• Pock formation on the chorioallantoic membrane of embryonating
eggs with the presence of intracytoplasmic inclusion bodies,
characteristic of fowl pox viruses.
hemorrhages and congestion in chicken embiyos produced by
avian reovirus. However, syncytial formation might also be
produced by other viruses and should not be used as a single
criterium to identify reoviruses.
• Embryo stunting is normally observed after inoculation of
infectious bronchitis virus (IBV) and adenoviruses. A more severe
stunting, lack of feather development and strong embryo
attachment to the chorioallantoic membrane is usually observed
when embryo-adapted strains of IBV are isolated.
• Formation of plaques in monolayers of primary cells by Marek’s
disease and other herpesviruses. Once adapted to grow in primary
cells, plaques can be observed in chicken fibroblast monolayers.
Once the virus has been isolated, further quantification can be
achieved by classic biologic or physical assays, as described (18).
Biologic assays, such as plaque assay, endpoint method and pock
formation, allows the detection of only infective particles in
propagation systems. Physical methods, such as optical density
measurements, immunologic methods or electron microscopy
particle counts, quantify the presence of all viral particles without
differentiating their infectivity capacity.
With the availability of molecular techniques, such as nucleic acid
hybridization, RNA fingerprinting and viral genome amplification
by PCR or RT-PCR, many viruses can be detected without previous
isolation (5). Current restrictions and regulations on the importation
and use of infectious materials have further increased the use of
molecular techniques. Infectious clinical samples, previously
inactivated with formalin, phenol or stamped in Flinders
Technology Associates (FTA®) cards, can be imported with minor
restrictions, allowing the molecular detection and characterization
of avian viruses (19, 26, 27, 29). Although important information
about a particular isolate can be obtained by molecular techniques,
it is important to emphasize that detection of viral nucleic acid is
not equivalent to virus isolation. Only after isolating the virus, can
valuable information such as pathogenicity be obtained, cross­
neutralization and protection studies, can be performed with an
isolate and it can also be determined whether there are more than
one type of virus in clinical samples. Virus isolation in association
with molecular techniques will give a better understanding of both
the phenotype and genotype of a particular avian virus.
Virus classification
The classical system of virus classification, developed by Lwoff,
Home and Tournier in 1962, groups the viruses according to viral

209
Pedro Villegas and Ivan Alvarado

shared properties rather than the properties of the cells or organisms
they infect (18). The classical Linnaean hierarchical system has
been partially adopted by the International Committee on
Taxonomy Viruses (ICTV) (17). The ICTV, a committee of the
Virology Division of the International Union of Microbiological
Societies, classifies the viruses according to their order, family,
subfamily, genus and species. Levels higher than the order, such as
class and phylum, and lower than species, such as strains and
variants, are not considered in the ICTV classification. In the ICTV
classification, the family is the highest consistently used taxonomic
grouping, bearing the most generalized description of a particular
characteristic shared by its members (18).
The main characteristics that delineate the ICTV classification of
viruses are:
• Nature of the nucleic acid in the virion.
• Type of nucleic acid: DNA or RNA, single stranded (ss)
or double stranded (ds), linear or circular.
• Orientation: Positive, negative, ambisense.
• Number of segments, size of the genome, nucleotide
sequence.
• Gene organization.
• Virion morphology: Size, shape, capsid symmetry, and
the presence or absence of envelope.
• Physical properties such as stability against different pH,
temperature, detergents, cations and solvents
• Characteristics of viral proteins, lipids and carbohydrates.
• Antigenic properties.
• Biologic properties such as replication strategy,
transmission, pathogenicity and host range.
The major characteristics used to classify a virus in a particular
family include the nature of the nucleic acid in the virion, the
presence or absence of envelope, the symmetry of the capsid and
the size of the virion and capsid (18). Table 45.1 summarizes the
specific characteristics of each family with important avian viruses.

Table 45.1 Major characteristics for the classification of avian viruses, according to the guidelines established by the International Committee on Taxonomy
Viruses (ICTV),
Nucleic Acid Symmetry Enveloped/Naked Family Diameter (nm)
Retroviridae 80-130
Enveloped Circoviridae 14-24
Togaviridae 70
Icosahedral
Reoviridae 60-80
RNA Naked Birnaviridae 60
Caliciviridae 35-40
Picornaviridae 28-30
Coronaviridae 80-160
Helical Enveloped Orthomyxoviridae 90-120
Paramyxoviridae 150-300
Polyhedral Enveloped Flaviviridae 25-30
Parvoviridae 18-26
Naked
Adenoviridae 70-90
Icosahedral
DNA Polyomaviridae 40-55
Circoviridae 17-24
Enveloped Hepadnaviridae 42
Herpesviridae 150-200
Complex Enveloped Poxviridae 170 to 200-300 to 456

Viruses are divided in two major groups: DNA and RNA containing viruses. DNA containing viruses are divided in 8 families, six of which contain viruses
causing disease in avian species. RNA containing viruses are divided in approximately 38 families, with 11 families containing recognized avian pathogens.
Table 44.2 lists the ICTV classification of DNA and RNA avian viruses (17).

210
 Chapter 45 Virus Identification and Classification

Table 45.2. Families of DNA and RNA viruses with important avian viruses

Type Family Genus Avian Viruses

Poxviridae Avipoxvirus Fowlpox virus, canarypox virus, jucopox virus, pigeonpox virus, psitaccinepox virus,
quailpox virus, sparrowpox virus, starlingpox virus, turkeypox virus.
Fowl adenovirus A (FAV-1)
Fowl adenovirus B (FAV-5)
Fowl adenovirus C (FAV-4, FAV-10)
Fowl adenovirus D (FAV-2, FAV-3, FAV-9, FAV-11)
Aviadenovirus Fowl adenovirus E (FAV-6, FAV-7, FAV-8a, FAV-8b)
Goose adenovirus (GAV-1, GAV-2, GAV-3)
Adenoviridae Pigeon adenovirus
Tentative: Duck and turkey adenovirus
Siadenovirus Turkey hemorrhagic enteritis virus, marble spleen disease virus (pheasant adenovirus
dsDNA 1)
Atadenovirus Egg drop syndrome virus (duck adenovirus A)
Polyomaviridae Polyomavirus Budgerigar fledgling disease virus, French molt in psittacines
Mardivirus Marek’s disease virus (gallid herpesvirus 2 and 3), turkey herpesvirus (meleagrid
herpesvirus 1)
Herpesviridae Iltovirus Infectious laringotracheitis virus (gallid herpesvirus 1)
(Subfamily Unassigned Pacheco’s disease virus (anatid herpesvirus 1)
alphaherpesvirinae) Duck enteritis virus (duck plague)
Pigeon herpesvirus (columbid herpesvirus 1)
Gyro virus Chicken anemia virus
Circoviridae Psittacine beak and feather disease virus
Circovirus Canary, duck, finch, goose and pigeon circovirus
ssDNA Parvovirus Chicken parvovirus
Parvoviridae Dependovirus Avian adeno-associated virus, goose parvovirus, Muscovy duck parvovirus

Orthoreovirus Avian reovirus (viral arthritis)

Reoviridae Tentative: duck reovirus
dsRNA
Rotavirus Chicken rotavirus D, F and G (Rotavirus enteritis)
Birnaviridae Avibirnavirus Infectious bursal disease virus
Avulavirus Newcastle disease virus (APMV-1), APMV 2 - APMV 9
Paramyxoviridae
ssRNA (-)
Metapneumovirus Turkey rhinotracheitis virus
Orthomyxoviridae Influenzavirus A Avian influenza virus
Coronaviridae Coronavirus Infectious bronchitis virus, turkey enteric coronavirus, pheasant coronavirus

Caliciviridae Unassigned Fowl calicivirus

Astroviridae Avastrovirus Turkey, duck and chicken (avian nephritis virus 1 and 2) astrovirus
Hepatovirus Avian encephalomyelitis-like virus
Avian entero-like virus, avian nephritis virus 3, cockatoo entero-like virus, duck
Picornaviridae hepatitis virus I and ΠΊ, guineafowl transmissible enteritis virus, turkey entero-like
ssRNA (+) Unassigned virus, turkey hepatitis virus, turkey pseudoenterovirus 1 and 2
Togaviridae Alphavirus Highlands J virus
Flaviviridae Flavivirus Israel turkey meningoencephalomyelitis virus, West Nile virus
Avian leukosis virus, Rous sarcoma virus, avian myeloblastosis virus, avian sarcoma
Alpharetrovirus virus, avian carcinoma Mill Hill virus 2
Retroviridae Gammaretrovirus Reticuloendotheliosis virus, chick syncytial virus, tragger duck spleen necrosis virus
Circular Hepadnaviridae A vihepadnavirus Duck hepatitis B virus
dsDNA Unassigned Ross’ goose hepatitis B virus
ds = double-stranded; ss = single-stranded; - = negative sense; + = positive sense; RT = reverse transcriptase.

Determining the type of nucleic acid
Direct Methods. Direct methods involve the concentration and
purification of the virus, followed by extraction and characterization
of the nucleic acid with nucleases or differential chemical
hydrolysis. After a large quantity of virus is cultivated, cells or
tissues are disrupted by homogenization and/or freezing-thawing,
releasing the viral particles. Initially, cellular debris is removed by
centrifugation (1,000 x g for 10-12 min). The supernatant
containing the viral particles is deposited on top of a 45% (w/v)
sucrose cushion. After centrifugation (140,000 x g for 2 hr at 4 C),
pelleted virus particles are resuspended in Tris buffer (pH 7.6).
Viral purification may be performed by adjusting the density of the
Tris-resuspended virus to 1.40g/ml with cesium chloride followed
by centrifugation (270,000 x g for 16 hr at 20 C). Viral purification
in sucrose gradients can be achieved by depositing the Tris­
resuspended virus onto a 20% to 60% (w/v) sucrose gradient.
Purified viruses are collected by side puncture of the plastic
centrifuge tube with a 21-gauge hypodermic needle.
Once purified, virus particles are disrupted with a lysis buffer
containing 0.01M Tris-Cl (pH 7.8), 0.05M EDTA, 0.5% SDS and
proteinase K (50pg/ml). Since proteinase K digests native proteins,
DNAses or RNAses present in the lysates are rapidly inactivated,
preserving the viral genetic material. Additional buffers used to
disrupt cell or viral membranes are described elsewhere (31). After
membrane disruption, the viral nucleic acid is extracted by adding a
volume of phenol:chloroform:isoamyl alcohol (24:24:1 v/v)
equivalent to the volume of the aqueous sample. Nucleic acid in the
aqueous phase is precipitated with ethanol and sodium acetate
(0.3M final concentration). Other commonly used cations to

211
Pedro Villegas and Ivan Alvarado
precipitate nucleic acids in association with ethanol are described
elsewhere (31). Finally, the viral genome is washed with 70%
ethanol, pelleted and resuspended in RNase/DNase free water.
Procedures for the extraction of DNA or RNA from tissues and cell
cultures are fully described elsewhere (31).
The following nucleases allow the differentiation of DNA and
RNA viruses:
• DNase I (RNase free -Pancreatic Deoxyribonuclease I): DNase I
nonspecifically cleaves DNA to release 5’-phosphorylated
dinucleotides, trinucleotides and oligonucleotides. DNase I also
degrades ssDNA and the DNA present in RNA-DNA hybrids,
however, the activity for these substrates is reduced . One unit of
DNase I corresponds to the amount of enzyme able to degrade 1
pg of DNA in 10 min at 37 C.
• Nuclease SI: under conditions of high ionic strength (0.1 - 0.4 M
NaCl), low pH (pH 4.2), and the presence of ImM Zn2+ degrades
ssDNA or RNA molecules to yield 5’-phosphate mono or
oligonucleotides. One unit is able to digest 0.5 g of single
stranded DNA in 30 min at 37 C.
• RNase A: at low NaCl (ImM) concentrations, specifically attacks
single or double stranded RNA 3’ to pyrimidine residues and
cleaves the phosphate linkage to the adjacent nucleotide. At high
NaCl (150mM) concentrations, only attacks ssRNA molecules.
One unit is the amount of enzyme required to yield an increase in
absorbance at 286 nm of 0.0146 absorbance unit per min in a 1 ml
volume at specific conditions.
• RNase Tl: cleaves ssRNA molecules by specifically attacking the
3’ phosphate groups of guanine nucleotides and cleaves the 5’
phosphate linkage to the adjacent nucleotide.
After digestion with a particular nuclease, the nucleic acid can be
electrophoresed on agarose or polyacrylamide gels. Different stains
that can be used to selectively visualize nucleic acids are (31,35):
• Ethidium bromide: intercalates between base pairs of dsDNA (1
molecule every 2.5 bases approx). When exposed to ultraviolet
light (302 nm), it will fluoresce within the red-orange range of the
visible spectrum. ssRNA when folded back into itself, or
• dsRNA can also be detected. Ethidium bromide is incorporated in
the gel or the electrophoresis buffer at a concentration of 0.5
pg/ml.
• Methylene blue: used to stain bands of DNA in agarose gels in
replacement of ethidium bromide. Its use minimizes the exposure
of DNA molecules to UV irradiation, avoiding the generation of
pyrimidine dimmers. After electrophoresis, the gel is immersed in
a solution containing 0.001 to 0.0025% methylene blue in ImM
Tris-acetate (pH 7.4), 0.1 mM EDTA (pH 8.0).
• Acridine orange: intercalates with both DNA and RNA
molecules. Acridine orange produces fluorescense green at a
wavelength of 525 nm and orange at wavelengths higher than 630
when incorporated in DNA and RNA molecules, respectively.
• Silver stain: characterized by its high sensitivity, detecting
dsDNA molecules in polyacrylamide gels. Bands appear brown
against a yellow background.
• SYBR® dyes: display enhanced fluorescence upon binding
nucleic acids, showing higher affinity for nucleic acids and higher
sensitivity than ethidium bromide. SYBR® dyes are stimulated at
a wavelength (254 nm), causing the maximum DNA damage.
Three main SYBR® dyes are available:
• SYBR® Green I: stains DNA, detecting as little as 60 pg of
dsDNA per band. It has been commonly used in real time PCR
reactions for viral quantitation.
• SYBR® Green Π: used to detect RNA with a greater sensitivity
than ethidium bromide. It is able to detect 100 pg of ribosomal
RNA on 1% agarose gels and 1 ng of ribosomal RNA on 5%
acrylamide gels.
• SYBR® Gold: detects DNA and RNA molecules after light
stimulation at a 300 nm wavelength. It penetrates gels faster than
212
SYBR Green I and Π stains, generating bright gold fluorescent
signals. It can detect 25 pg of dsDNA or 1 ng of RNA per band.
• GelStar®: very stable stain at room temperature. It can detect as
little as 20 pg dsDNA, 25 pg ssDNA and 10 ng of RNA. Like
ethidium bromide, GelStar® stain is a potential mutagen.
• Radiant Red®: highly sensitive stain that specifically detects
RNA, emitting a red-orange signal with approximately 300 nm
transillumination.
DNA and RNA viruses can also be differentiated by treating the
nucleic acid with sodium hydroxide (0.3M NaOH), which destroys
RNA but not DNA molecules.
Indirect methods. Metabolic inhibitors of nucleic acid replication
can be used to determine if an isolated virus contains a DNA or
RNA genome. These methods would be especially valuable in those
cases in which concentration, purification and direct
characterization of nucleic acids by direct methods are not possible
due to low viral titers during replication.
Thymidine analogs are the simplest antiviral agents used to
evaluate if a virus contains DNA (30, 31). Thymidine analogs, such
as 5-bromo-2N-deoxyuridme (BDU) and 5-iodo-2N-deoxyuridine
(IDU), inhibit DNA replication and transcription. A cell-culture
system for virus propagation is preferred to evaluate the presence of
DNA viruses using thymidine analogs. Briefly, the presence of a
DNA virus in cell cultures is evaluated by comparing the viral titer
of cell cultures treated with 50 pg/ml of BDU or IDU with the viral
titer of non-treated cell cultures. DNA containing viruses will
exhibit a lower viral titer (1 log]0) in cell culture plates treated with
the thymidine analogs when compared with non treated cell culture
plates. Controls should be run with known RNA and DNA
containing viruses. When treated like the unknown virus, the
control DNA virus should be inhibited by the thymidine analog,
while the RNA virus is not inhibited.
The sensitivity of a virus to actinomycin D is of value in
differentiating some RNA viruses. Actinomycin D is a polypeptide
antibiotic that interferes with the replication of viruses with dsRNA
or dsDNA genomes. By binding to double stranded molecules,
Actinomycin D inhibits the synthesis of mRNA, blocking the
translation of viral and host proteins (28, 31). Influenza virus
requires the transcription of some host messenger RNA as an early
event in the replicative cycle and is inhibited by actinomycin D.
Members of the Reoviridae and Bimaviridae families are also
sensitive to actinomycin D because of their double-stranded
genomes. The lack of cell culture toxicity by the concentration of
actinomycin D used in the cell culture medium must be previously
evaluated. Briefly, cell culture medium containing lpg/ml of
actinomycin D is added to the cell culture for 2 hr before virus
inoculation. After 24 or 48 hr of virus inoculation, the virus is
harvested and assayed for infectivity. A significant reduction in titer
in the cultures treated with actinomycin D when compared with
titers in the untreated cultures indicates a sensitive virus (28).
Table 45.3 summarizes the identification of the type of nucleic
acid by direct and indirect methods.
Table 45.3 Comparison of direct and indirect methods for the
characterization of the nucleic acid genome of viruses.
DNA RNA
Treatment SS DS SS DS
DNase I + + - -
SI nuclease + - - -
RNase A (ImM NaCl) - - + +
RNase A (150 mM NaCl) - - + -
0.3 M NaOH - - + +
Thymidine analogs + + - -
Actinomycin D - + - +
Acridine Orange Red Green Red Green
SS = single stranded, DS = double stranded; + = digestion or inhibition, - =
no digestion or no inhibition.

Sensitivity to lipid solvents
Many viruses are surrounded by a lipid bilayer or envelope,
acquired from host cells during the nucleocapsid budding. Viral
envelopes contain virus encoded proteins essential for infectivity.
By using lipid solvents such as ether and chloroform, the presence
or absence of viral envelope can be evaluated (30). After treatment,
enveloped viruses lose their capacity to infect and replicate in
propagation systems.
Sensitivity to Ether
Add ethyl ether, 20% by volume, to a measured amount of virus in
a screw-cap tube. Seal the tube with tape. Prepare a control with
virus and 20% by volume of 0.85% NaCl. Place the tubes at 4 C for
18-24 hr, shaking the tubes manually several times during this
period. Pour the contents of each tube into a sterile Petri dish,
preferably in a chemical cabinet, and allow the ether to evaporate.
Assay each virus. A loss of infectivity in the ether-treated virus of 1
log10 or greater is indicative of an enveloped virus.
Sensitivity to Chloroform
Dilute the sample to be tested 1:10 and deposit 2 ml aliquots in
two 15 ml glass centrifuge tubes. Add 0.2 ml of chloroform
(CHC13) to one of the aliquot and 0.2 ml of 0.85% NaCl to the other
aliquot. Vortex the centrifuge tubes for 10 min, keeping the tubes in
an ice bath between mixes. Allow CHC13 to sediment overnight in a
refrigerator or by centrifuging (1500 rpm for 30 min). Collect the
clear layer on the top and allow the remaining CHC13 to evaporate
in the hood for 10 - 15 min. Use the clear top layer for assay of
virus infectivity. A loss of infectivity of 1 logio or greater indicates
the presence of an enveloped virus (30).
Diameter of the virion
Virus size and shape is highly dependent on the amount and
arrangement of the proteins and the size and conformation of the
nucleic acid. Transmission electron microscopy is the most useful
way to determine the general morphology and size of a virus
particle. Detailed images of isolated and purified viral particles are
obtained by the formation of a cast after negative staining of the
virus with uranyl acetate or potassium phosphotungstate (23).
Techniques such as cryoelectron microscopy, in which virus
isolates are preserved by rapid freezing in liquid nitrogen or liquid
helium, have permitted a more detailed visualization of electron­
scattering contrast from the particle itself and not just from the cast.
With the use of cryoelectron microscopy, the study of unstable or
relative impure preparations can be achieved (23). Further atomic
resolution of viral structures or particular viral proteins can be
achieved by X-ray crystallography after virus crystalization. Large
and more complex viral particles that cannot be crystallized must be
dissected into well defined subunits or substructures (23). The size
of a virus may also be estimated with fair accuracy by the use of
nitrocellulose, polycarbonate or polyester membranes with
relatively uniform pores. Virus suspensions are mainly filtrated by
stereohindrance; i.e., large particles are not able to pass through
smaller holes (25). Membrane filters with pore diameters of 50 nm,
100 nm, 200 nm, 300 nm and 450 nm are available. The most
commonly filters used to determine the diameter of the viruses are
those of 50 nm, 100 nm and 200 nm. Several factors may affect the
results of filtration of a virus, including clumping, pleomorphism,
occlusion of the pores with cellular debris, and electrostatic charges
on the filter membrane. Initial filtration of viral suspensions through
a series of membranes for clarification and/or a 450 nm filter will
preclude the clogging of membranes by clumping and the presence
of cellular debris. Pretreatment of filters by soaking in calf serum or
213
Chapter 45 Virus Identification and Classification
by passing a small quantity (5 ml) of 10% calf serum in saline
through the filter will neutralize electrostatic charges on the
membrane. Viral adsorption to filter membranes can be also be
prevented by resuspending the virus in a Dulbecco’s phosphate
buffered saline solution with 0.1% Tween 80 without Ca2+ or Mg2+
(25). The technique should be aseptic throughout. The steps for
sizing a virus through serum-treated filters are as follows:
A. Clarify the virus suspension by centrifugation (9200 x g for 10
min) for 10 min and/or by passing the virus suspension through a
prefilter membrane. Save a sample for assay.
B. Filter the clarified virus suspension through a 200 nm filter.
Sterilized filters can be inserted into sterile filter holders or attached
to the syringes. Filters that are purchased unsterilized can be
sterilized by autoclaving. Save a sample for assay.
C. Pass the 200-nm filtrate through a 100-nm filter, save a sample
for assay, and then pass the remainder through a 50-nm filter. The
filtrates of all filters are then assayed, and the titers are compared
with those of the original clarified suspension.
D. The size of the virus may be up to 1.2 times the average pore
diameter of the filter through which no virus passed.
E. The integrity of each filter membrane must be evaluated by
passing a bacterial culture through the filter immediately after
passing the virus through the different filters, testing the filtrate for
sterility.
Capsid symmetry
Protective protein structures, known as capsids or nucleocapsids,
encase and protect the viral genomes. Depending on the number of
protein subunits and their structure, capsids can have a helical or
icosahedral symmetry (18). Helical capsids are organized around a
single axis and are described by the number of units per turn and the
axial rise per unit. Icosahedral capsids are formed by nonsymmetric
protein molecules arranged in identical equilateral triangular
structures joined to form an icosahedron. Most of the avian viruses
present helical or icosahedral capsids. However, some viruses such
as poxviruses form complex capsids with structures still not well
understood. The symmetry of the nucleocapsid, obtained by
transmission electron microscope, is not essential to determine the
initial classification of a virus. All the same, many newly
discovered viruses have been detected by the electron microscopy
before they have been cultivated. An example is the rotavirus or the
family Reoviridae. The transmission electron microscope is a
valuable tool in virology and can give nearly all the information
required to identify and classify a virus: lipoprotein envelope, size,
and morphology. An electron microscopy guide of viruses has been
published by Doane and Anderson (15). The basic procedure entails
concentration of the virus by ultracentrifugation and resuspension of
the virus in low-salt or salt-free distilled water. A drop of virus is
then placed on a plastic-coated grid and mixed with a drop of 2%
phosphotungstic acid in distilled water (adjust to pH 6.5 with 1 N
KOH). Viral concentrations of 106/ml or greater must be present to
detect virions with the electron microscope.
The main characteristics used to distinguish between the families
of viruses of greatest importance to avian species are summarized in
table 45.4. Serological tests, such as virus-neutralization, gel­
precipitation, hemagglutination-inhibition, complement-fixation,
and enzyme-linked immunosorbent are of great value for the
identification of viruses. Once the virus is assigned to a particular
family, further classification at the strain level can be achieved by
nucleic acid based techniques. The techniques are discussed
elsewhere in this manual.
Pedro Villegas and Ivan Alvarado
Table 45.4 Properties of DNA and RNA used to differentiate families of avian viruses.
Differential Properties
I. Sensitive to thymidine analogs
A. Ether sensitive
• 1. Passes 200 nm filter
• 2. Retained by 200 nm filter
B. Ether resistant
• 1. Retained by 50 nm filter
• 2. Passes 50 nm filter
• 3. Retained by 200 nm filter
Π. Resistant to thymidine analogs
A. Ether sensitive
• 1. Hemagglutination positive
o Sensitive to actinomycin D
o Resists actinomycin D
• 2. Hemmaglutination negative
o Sensitive to actinomycin D
o Resists actinomycin D
B. Ether resistant
• 1. Sensitive to actinomycin D
• 3. Resists actinomycin D
A The poxviruses may or may not be destroyed by ether and/or chloroform.
B Passes 50 nm filter.
c Titer greatly reduced by 50 nm filter.
Nucleic acid based viral detection and characterization
Several molecular methods are currently used not only for the
detection and characterization of avian viruses but also for
evolutionary and epidemiological studies (12). PCR-based
approaches have been crucial in the ability to characterize and
compare the genomes of viruses and to detect viruses that have been
difficult to isolate using classical culture methods. Additional
advantages of PCR-based approaches include the high sensitivity
and specificity and the capacity to distinguish individual isolates
within a serotype by amplification of a small segment of the viral
genome containing hypervariable regions. The presence of changes
at the nucleotide level, which may or may not result in amino acid
changes, is the basis of subtype classification of viruses (5).
The following are the molecular techniques routinely used to
characterize avian viruses:
• Nucleotide sequencing. Obtained after genomic amplification
by PCR (DNA viruses) or RT-PCR (RNA viruses), nucleotide
sequencing has the potential to detect even one single mutation
(5). Commonly used for epidemiological and classification
studies at low levels such as strains within a particular serotype
or variants. Usually genome segments codifying major
antigenic epitopes located at the surface of the virion are
amplified and sequenced. However, for evolution studies,
conserved regions, such as untranslated regions may be
sequenced.
• Restriction Fragment Length Polymorphism analysis (RFLP).
Double stranded DNA is cleaved by specific restriction
enzymes in a sequence dependent fashion to produce different
length fragments. Presence of nucleotide mutations in specific
214
DNA virus
Herpesviridae
PoxviridaeA
Adenoviridae
Parvoviridae
Papovaviridae
PoxviridaeA
RNA virus
Orthomyxoviridae
Paramyxoviridae
Retroviridae
Coronaviridae
Flaviviridae®
•
Reoviridaec
Bimaviridaec
Picomaviridae®
locations lead to different patterns of fragments after separation by
electrophoresis in agarose or polyacrylamide gels. A limitation of
this technique is the lack of detection of mutations present outside
of the recognition sites for the specific restriction enzymes chosen
for analysis. Also, identical restriction patterns between two
different isolates may require the use of additional restriction
enzymes to show differences (31).
• Southern blot analysis. Viral DNA, PCR or RT-PCR amplified
product, is digested with a restriction enzyme, and the
fragments are electrophoresed in agarose or polyacrylamide
gels, transferred onto a nitrocellulose paper and then hybridized
with labeled probes from the entire or specific regions of the
genome (31). This technique can be used to determine
similarities and differences between two closely related viruses.
• Heteroduplex mobility assay. Following PCR or RT-PCR
reactions, an amplified segment of an isolated virus is denatured
and reannealed in the presence of DNA segments from a know
virus strain. After re-annealing, three types of bands will be
observed, one band consisting of homoduplexes and two other
bands consisting of heteroduplexes. Nucleotide mistmatches
present in the heteroduplexes will form bulges, retarding the
movement of the band during electrophoresis in polyacrylamide
gels. The relative retardation of the heteroduplexes is
proportional to the DNA distance (percent of nucleotide
difference) between the strains being compared (6, 8).
The application of the previously described techniques in the
detection and characterization of avian viruses is summarized in
table 45.5.
 Chapter 45 Virus Identification and Classification

Table 45.5 Nucleic acid-based methods currently used to detect and characterize avian viruses

Virus Gene(s) of Interest Molecular Technique(s) Objective

RT-PCR (27)
Nucleotide sequencing
Southern blot analysis Pathotyping based on the sequence of cleavage site.
Fusion (F)
Immunosorbent ELISA Epidemiological studies
TaqMan fluorogenic probes
Heteroduplex mobility assay
Newcastle Disease Virus (1,2, 36) Hemagglutinin/
Neuraminidase Epidemiological and evolution studies
Nucleotide sequencing
Epidemiological studies
(H/N)
Viral detection and characterization
Matrix
Epidemiological studies
Nucleocapsid RT-PCR Group specific detection
Membrane RT-PCR Group specific detection
Infectious Bronchitis Virus (4, 10, 14,
RT-PCR
22) Viral detection
SI Nucleotide sequencing
Genetic characterization
Slot blot hybridization
Virus characterization (HA subtyping)
RT-PCR
Hemagglutinin Epidemiological studies
Nucleotide secuencing
Avian Influenza (9)
RT-PCR Virus characterization (NA subtyping)
Neuraminidase
Nucleotide sequencing
Matrix RT-PCR Viral detection
RT-PCR
Nucleotide sequencing Viral detection
RFLP Differentiation of classical (standard and very
Infectious bursal disease (7, 33) VP2
In situ RT-PCR virulent) from variants strains
In situ hybridization
TaqMan fluorogenic probes
Genetic characterization
Chicken infectious anemia/other
VP1 PCR / sequencing Epidemiological studies
circovirus (32, 34)
RT-PCR / sequencing Detection of exogenous and endogenous RNA or
P27, Envelope and PCR / sequencing proviral DNA
Avian Leukosis Virus (16)
LTR In situ hybridization with RNA and Subgroup detection
DNA probes Tropism studies
Avian Adenoviruses (3,21) Hexon PCR/RFLP Virus classification in 5 molecular groups
ICP4 andUS3 PCR Serotype 1 and 3 detection
gD TaqManPCR Viral detection
Marek’s disease virus (13,20)
Meq, gB and Tandem
PCR Serotype 1 identification
repeat
F Southern blot RT-PCR Molecular characterization
Avian Metapneumovirus (11) Matrix RT-PCR Viral detection

8. Berinstein, A., H. Sellers, D. J. King, and B. S. Seal. Use of a

REFERENCES
1. Aldous, E. W., and D. J. Alexander. Detection and differentiation of
Newcastle disease virus (avian paramyxovirus type 1). Avian Path. 30:117-
128. 2001.
2. Aldous, E. W., J. K. Mynn, J. Banks, and D. J. Alexander. A molecular
epidemiological study of avian paramyxovirus type 1 (Newcastle disease
virus) isolates by phylogenetic analysis of a partial nucleotide sequence of
the fiision protein gene. Avian Path. 32:239-257. 2003.
3. Alvarado, I., P. Villegas, J. El-Attrache, E. Jensen, G. Rosales, F. Perozo,
and L. Purvis. Genetic characterization, pathogenicity and protection studies
with an avian adenovirus isolate associated with inclusion body hepatitis.
Avian Dis. In Press. 2007.
4. Alvarado, I., P. Villegas, N. Mossos, and M W. Jackwood. Molecular
characterization of avian infectious bronchitis virus strains isolated in
Colombia during 2003. Avian Dis. 49:494-499. 2005.
5. Arens, M Methods for subtyping and molecular comparison of human
viral genomes. Clin. Microb. Rev. 12:612-626. 1999.
6. Banda, A., P. Villegas, and J. El-Attrache. Heteroduplex mobility assay
for genotyping of infectious bursal disease virus. Avian Dis. 48:851-862.
2004.
7. Banda, A., P. Villegas, and J. El-Attrache. Molecular characterization of
infectious bursal disease virus from commercial poultry in the United States
and Latin America. Avian Dis. 47:87-95. 2003.
heteroduplex mobility assay to detect differences in the fusion protein
cleavage site coding sequence among Newcastle disease virus isolates. J.
Clin. Microb. 39:3171-3178. 2001.
9. Brown, I. H. Advances in molecular diagnosis for avian influenza. Dev.
Biol. 124:93-97. 2006.
10. Callison, S. A., M. W. Jackwood, and D. A. Hilt. Molecular
characterization of infectious bronchitis virus isolates foreign to the United
States and comparison with United States isolates. Avian Dis. 45:492-499.
2001.
11. Casey, J. L. Specific detection of avian pneumovirus (APV) US isolates
by RT-PCR. Arch. Virol. 145:1239-1246. 2000.
12. Cavanagh, D. Innovation and discovery: the application of nucleic acid­
based technology to avian virus detection and characterization. Avian Path.
30:581-598. 2001.
13. Davidson, I., R. Borenshtain, and Y. Weisman. Molecular identification
of the Marek's disease virus vaccine strain CVI988 in vaccinated chickens. J.
Vet. Medicine. 49:83-87. 2002.
14. De Wit, J. J. Detection of infectious bronchitis virus. Avian Path. 29:71-
93. 2000.
15. Doane, F. W., and N. Anderson. Electron microscopy in diagnostic
virology. Cambridge University Press, New York. 1987.
16. Fadly, A. M Isolation and identification of avian leukosis viruses: A
review. Avian Path. 29:529-535. 2000.
17. Fauquet, C. Μ, M A. Mayo, J. Maniloff, U. Desselberger, and L. A.
Ball. Virus taxonomy, 8th ed. Springer-Verlag Wien, New York. 2005.

215
Pedro Villegas and Ivan Alvarado
18. Flint, S. J., L. W. Enquist, R. M Krug, V. R. Racaniello, and A. M
Skalka. Principles of Virology: molecular biology, pathogenesis and
control., 1 ed. American Society of Microbiology Press., Washington, DC.
2000.
19. Hamoud, Μ Μ, P. Villegas, and S. M. Williams. Detection of
infectious bursal disease virus in formalin-fixed paraffin-embedded tissue by
immunohistochemistry and real-time reverse transcription-polymerase chain
reaction. J. Vet. Diag. Invest. 19:35-42. 2007.
20. Handberg, K. J., O. L. Nielsen, and P. H. Jorgensen. The use of serotype
1- and serotype 3-specific polymerase chain reaction for the detection of
Marek's disease virus in chickens. Avian Path. 30:243-249. 2001.
21. Hess, M Detection and differentiation of avian adenoviruses: A review.
Avian Path. 29:195-206. 2000.
22. Jackwood, M W., D. A. Hilt, C. W. Lee, Η. M Kwon, S. A. Callison,
K. M Moore, H. Moscoso, H. Sellers, and S. Thayer. Data from 11 years of
molecular typing infectious bronchitis virus field isolates. Avian Dis.
49:614-618. 2005.
23. Knipe, D. Μ, P. M Howley, D. E. Griffin, R. A. Lamb, M A. Martin,
B. Roizman, and S. E. Straus. Fields Virology. Lippincot Williams &
Williams, Philadelphia, PA. 2001.
24. Lee, C. C., T. P. Ko, C. C. Chou, M Yoshimura, S. R. Doong, Μ Y.
Wang, and A. H. Wang. Crystal structure of infectious bursal disease virus
VP2 subviral particle at 2.6A resolution: Implications in virion assembly and
immunogenicity. J. Struct. Biol. 155:74-86. 2006.
25. Lytle, C. D., L. B. Routson, N. B. Jain, M R. Myers, and B. L. Green.
Virus passage through track-etch membranes modified by salinity and a
nonionic surfactant. Appl. Environ. Microbiol. 65:2773-2775. 1999.
26. Moscoso, Η., I. Alvarado, and C. Hofacre. Molecular analysis of
infectious bursal disease virus from bursal tissues collected on FTA filter
paper. Avian Dis. 50:391-396. 2006.
216
27. Perozo, F., P. Villegas, C. Estevez, I. Alvarado, and L. Purvis. Use of
FTA filter paper for the molecular detection of Newcastle disease virus.
Avian Dis. 35:93-98. 2006.
28. Puissant, C., and L. M. Houdebine. An improvement of the single-step
method of RNA isolation by acid guanidinium thiocyanate-phenol-
chloroform extraction. Bio Techniques 8:148-149. 1990.
29. Purvis, L., P. Villegas, and F. Perozo. Evaluation of FTA paper and
phenol for storage, extraction and molecular characterization of infectious
bursal disease virus. J. Virol. Methods. 138:66-69. 2006.
30. Rovozzo, G. C., and C. N. Burke. A manual of basic virological
techniques. Prentice-Hall, Englewood Cliffs, N. J. 1973.
31. Sambrook, J., and D. W. Russell. Molecular cloning: A laboratory
manual., 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY. 2001.
32. Todd, D. Circoviruses: Immunosuppressive threats to avian species: A
review. Avian Path. 29:373-394. 2000.
33. Van den Berg, T. P. Acute infectious bursal disease in poultry: A
review. Avian Path. 29:175-194. 2000.
34. Van Santen, V. L., F. J. Hoerr, and L. H. Lauerman. Genetic
characterization of chicken anemia virus from commercial broiler chickens
in Alabama. Avian Dis. 45:373-388. 2001.
35. Williams, L. R. Staining nucleic acids and proteins in electrophoresis
gels. Biotechnic & Histochemistry 76:127-132. 2001.
36. Wise, M G., D. L. Suarez, B. S. Seal, J. C. Pedersen, D. A. Senne, D. J.
King, D. R Kapczynski, and E. Spackman. Development of a real-time
reverse-transcription PCR for detection of Newcastle disease virus RNA in
clinical samples. J. Clin. Microb. 42:329-338. 2004.
 46
TITRATION OF BIOLOGICAL SUSPENSIONS
Pedro Villegas
SUMMARY. Methods for titration of biological suspensions (viruses) include the procedures devised by Reed and Muench and by
Spearman-Karber. Appropriate selection of the host to be inoculated as well as dilution range are important considerations to guarantee
reliable results. The methodology to calculate geometric mean titers is described.
INTRODUCTION
The activity of a biological suspension, such as a virus, is
measured quantitatively by procedures that consist of preparing
dilutions of the suspension and determining the dilution at which a
particular biological activity is still detectable. In the preparation of
dilutions to test the infectivity of a biological suspension or virus,
the following principles should be considered.
Diluents
When the virus is being diluted, the diluent must preserve
infectivity and be nontoxic for the host. For most viruses, a
balanced salt solution or a cell-culture medium can be used for cell­
culture systems and a nutrient or tryptose broth can be used for
embryos. With extremely labile viruses, it is often advantageous to
include 2-5% serum, although the serum must be pretested and
found to be free of antiviral activity.
Preparation of Dilutions
Separate sterile pipettes must be used for each dilution of the
Table 46.1. Example of estimating the 50% endpoint by the method of Reed and Muench
Embryos Accumulated Numbers
Virus Dilution
Number Dead Number Alive
Inoculated
IO’3 5 0
io-4 4 1
IO'5 2 3
W6 1 4
suspension, although the same pipette can be used for mixing and
transferring a single dilution. After the required volume of mixture
is transferred to the next tube, the pipette is changed. While
dilutions are being prepared, all reagents and the sterile dilution
tubes should be kept on ice.
Performing the Test
Begin with the least concentrated preparation (highest dilution)
and inoculate the volume desired into each susceptible host by the
route specified. The same instrument (syringe and needle or pipette)
can be used to inoculate several dilutions in a series when the least
concentrated suspension is inoculated first and the most
concentrated is inoculated last.
Nonspecific deaths resulting from manipulation of birds or
embryonated chicken eggs during inoculation occur most frequently
within a few hours of inoculation. Deaths up to 18-24 hr
postinoculation are generally considered to be nonspecific and are
eliminated from the calculations.
Each group of subjects inoculated should be examined regularly
(daily unless stated otherwise), and relevant observations should be
recorded. At the end of the specified time, which will vary with the
agent, each individual is examined and recorded as unaffected,
affected, or dead by the appropriate criteria.
TYPES OF INFECTIVITY ASSAYS
Two types of infectivity assays are used to quantify viruses:
quantal and enumerative (also known as quantitative or focal). In
the quantal assay, the response is either positive or negative; the
measurement is based on an “all or none” approach: the host
survived or died, cytopathic effect (CPE) is present or absent, signs
or lesions of the infection are observed or not present, and so on. In
the enumerative response, the number of infectious virus particles
present in the suspension can be quantified.
Quantal Assays
To perform quantal assays, serial dilutions of the virus are
inoculated in the appropriate host. After variable incubation times,
at each dilution, the hosts are evaluated and determined to be either
positive or negative to the effect of the virus. The proportion of the
positive hosts is recorded and used to calculate concentration or titer
of the viral suspension.
A unit of infectivity used to express the results for the quantal
response is the mean infective dose (Π)50), which represents the
Proportion
Dead Alive Percent Dead
Dead/Total
12 i 0 12/12 100
7 1 7/8 88
3 4 3/7 43
1 8 r 1/9 11
amount of agent capable of infecting 50% of the hosts. When the
effect is based on lethality, the term mean lethal dose (LD50) is
used. Both the Π)50 and the LD50 represent the titer of a biological
suspension, which is usually expressed as the number of infectious
units per unit volume (usually 1 ml). The Π)50 is the recommended
procedure used to express agent infectivity. Other units of
infectivity are also used (mean embryo infective dose [EID50], mean
tissue culture infective dose [TCID5o]).
Calculation of Titers. After performing the titration and
determining the number of individual hosts that respond to each
dilution, the endpoint dilution must be determined. The endpoint is
defined as the highest dilution of virus that will produce a
detectable effect in 50% of the inoculated hosts. An endpoint
usually cannot be determined by visual examination of the data, so
endpoints are determined mathematically. Several mathematical
methods have been described (1,3,4,5,6,7).
Method of Reed and Muench. A formula devised by Reed and
Muench (7) permits interpretation of the 50% endpoint from the
data derived from a quantal response and groups of test subjects.
Table 46.1 gives an example of the application of this formula on
information obtained from inoculation of a lethal virus into
embryonated eggs. The formula can be applied similarly to rates of
infection in any host system.
The first column in the table lists the dilutions inoculated. The
second column lists the number of embryos that died, and the third
217
Pedro Villegas
column lists the number of live embryos. The next two columns are
the accumulated numbers obtained from columns two and three.
The accumulated numbers for the dead embryos are calculated on
the assumption that if the host or system was affected at a particular
dilution, it should also be affected at the next lowest dilution, which
has a greater virus concentration. Similarly, the accumulated
numbers for the unaffected embryos are calculated on the
assumption that if the host was not affected at a particular dilution,
it should not be affected at the next highest dilution, which has a
lower virus concentration. Because of this assumption, the numbers
of affected embryos are added beginning at the highest dilution, and
the numbers of unaffected embryos are added beginning at the
lowest dilution.
Once the accumulated numbers are calculated, the ratio of the
number of dead to the total number of inoculated hosts is calculated
for each dilution. A percentage is then obtained, and the two
dilutions that bracket the 50% endpoint are found. In the above
example, the 50% endpoint is between the IO'4 (88%) and 10‘5
(43%) dilutions. We use the following formula to calculate the
proportionate distance between 10‘4 and 10‘5:
Percentage infected at
dilution next above 50% - 50%
PD = ------------------------------------------------------------------
Percentage infected at Percentage infected
dilution next - at dilution next
above 50% below 50%
88 - 50 38
PD = ____ =___ = 0.84 -0.8.
88 - 43 45
The 50% endpoint can now be calculated using the following
formula:
log of the = (log dilution - (PD x log
50% endpoint above 50%) dilution factor)
= -4-(0.8 x 1.0)
= -4.8.
Therefore, the 50% endpoint dilution is IO’4 8 and has no units.
The titer is defined as the number of infectious units per unit
volume. Therefore, the titer of the preparation is the negative
exponential of the endpoint dilution and is expressed as LD50/dose.
If the dose were 0.1 ml, the titer would be 105 8/ml.
It is usual to include in the expression of log titers only one figure
to the right of the decimal point (1058 LD5o/ml, not 105 8433).
Extension of additional figures in the mantissa implies a degree of
accuracy that is not real.
If dilutions are other than 10-fold, the proportionate distance must
be multiplied by the logi0 of the factor; for example, for fivefold
dilutions such as 101, IO"1'7, and IO’24, multiply the proportionate
distance by 0.6990. For twofold dilutions, multiply the PD by 0.3;
for fourfold dilutions multiply by 0.6. For 10-fold dilutions, the log
of the dilution factor (which is 10) is 1.0.
Protective doses (PD) can also be calculated using this procedure,
as for the PDqq, frequently used to calculate the potency of
inactivated vaccines in chickens. To calculate a PD90, the
proportional distance will be calculated using the following
formula:
PD = Percentage of birds protected at the dilution next above 90% -
90%, divided by
Percentage of birds protected at the dilution next above 90% -
Percentage of birds protected at the dilution next below 90%
218
Method of Spearman-Karber. Many researchers prefer the
Spearman-Karber (1) method of calculating the ID50. In most
instances, this method does not involve a great number of
calculations and the results are as accurate as those obtained with
the method of Reed and Muench. The Spearman-Karber method
can be used only with data including a 100% response or when one
can reasonably expect a 100% response at the next higher dose
level. To calculate the ID50 by this method, we use the following
condensed formula:
dZri
ED50 = x + /2d - n
where
x = the highest dilution level tested,
d = the interval between successive logarithmic doses
(dilution factor),
Ση = the total number of uninfected hosts, and
n = the number of hosts used at each dilution level
(constant).
When the data given for the calculation of the fD50 by the
method of Reed and Muench are used in the above formula, the
formula becomes:
1.0(1+ 3+ 4)
ID50= 6.0 + ^(1.0) - 5
8X)
= 6.0+ 0.5- 5
= 6.0+ 0.5- 1.6
= 4.9
= 104 9 per 0.1 ml or 105 9 per ml.
When 10-fold dilution series are used to inoculate the appropriate
hosts, the formula can be reduced to facilitate the calculations:
Στι
ID50 = x + 0.5 - n
The reason that this is done is that the interval between dilutions (d)
is log 10 or 1.0.
ENUMERATIVE RESPONSE
Depending on the host system used (e.g., chorioallantoic
membranes of embryonated eggs, or cell culture) and the type of
response obtained, titers are expressed as pock-forming units,
plaque-forming units (both of these are abbreviated PFU), or focus­
forming units (FFU) per milliliter. For this method, the average
number of plaques from duplicate plates or tests (two per dilution)
has to be correlated with the amount of virus added or injected
initially, as follows:
virus dilution = IO'5,
volume inoculated = 0.1 ml,
plaque counts = 145,138,
average plaque count = 141, and
titer = 1.4x 108PFU/ml.
Cell cultures can be used in a quantal or an enumerative response.
Under liquid medium, viruses that spread extracellularly eventually
will infect the whole culture and produce CPE or viral antigens. In a
quantal response, replicate cultures can be scored for the presence
or absence of virus effect. The enumerative response takes
advantage of the fact that an infectious virus particle can infect a
single cell, multiply, and give rise to a circumscribed change in the
cell monolayer under semisolid medium, producing an enumerative
response or plaque assay. Spread of virus through the supernatant
medium must be curtailed by solidifying the medium with agar or
methyl cellulose. Agar and other constituents of the medium are
sometimes helpful in maintaining the integrity or health of the
monolayer of normal cells while the virus-infected cells are

changing. With some viruses in cell culture, it may be helpful to add
a vital stain such as neutral red to the solid medium or to add the
stain on top of the medium after the virus has had a chance to
replicate. With other viruses or cultures, the solid medium can be
removed, and the cells can be fixed and then stained with
hematoxylin and eosin or other stains. For some assays, direct gross
or microscopic observation without staining may be satisfactory.
Many viruses inoculated on the chorioallantoic membrane of
embryonated eggs produce circumscribed lesions (pocks) that can
be counted.
DILUTIONS
For biological suspensions, the dilutions used are those in which
two liquids are mixed in different proportions, that is,
volume:volume (or volume/volume, v/v). In serologic and virologic
dilutions, a 1:2 (or a 1/2 dilution) is considered to be that dilution
composed of one volume of the substance in a total of 2 volumes of
the mixture, that is, one volume of each substance. For the rest of
this chapter, we use the proportional (e.g., 1:2) rather than the
traditional (e.g., 1/2) form. A 1:10 dilution is that composed of one
volume of the biological reagent and nine volumes of diluent.
Serial dilutions are used to accurately determine the titer of virus
preparations. These serial dilutions are commonly done using
factors of 2, 5, or 10. The most commonly used serial dilution in
avian virology is the 10-fold dilution, although it is well recognized
that the smaller the factor, the more precise the titer will be.
Depending on the final volume needed, the 10-fold dilution series
can be prepared using constant volumes of 9.0, 4.5, or 0.9 ml of
diluent.
CONVERSION OF TITER TO DILUTION
For conversion of a more concentrated solution of known titer or
concentration to a more diluted solution, the following formula can
be used:
C x V = C’ x V’
where
C = original titer or concentration,
V = original volume,
C’ = required or final titer, concentration, and
V’ = required or final volume.
For example: a virus preparation with a titer of ΙΟ50 EID50/ml is
needed to inoculate 600 chickens with ΙΟ30 EID50 in 0.1
ml/chicken.
The first step is to have the virus titers expressed in the same unit
volume. Therefore, the titer of the virus preparation should be
calculated per 0.1 ml, which will be 104 0 ΕΠ)50 per 0.1 ml. Now the
formula can be applied as follows:
IO40 x V = 1030 x (600 x 0.1)
103 0 x 60
V= IO40
V = 6.
A total of 6 ml of the original virus preparation should be taken to a
final volume of 60 ml. It is always advisable to prepare additional
amounts of virus. The above formula can also be used when the
concentrations are expressed as proportions (1:8; 1:15), although it
is easier to convert the fraction to a percentage and then apply the
formula.
Determining Number of Infectious Units
When the titer of a virus preparation is known and a determined
number of infectious units must be obtained, several methods can
219
Chapter 46 Titration of Biological
be used to find the correct dilution of the preparation. In the
following example, the method using logarithms and the stepwise
method will be used to find the correct dilution. A host system in
the laboratory must be inoculated with 1000 IDso/ml from a virus
preparation that has a titer of 105 4 ID50 per ml.
Method Using Logarithms. The number of ID50S needed is to be
divided into the titer of the preparation:
105 4 titer of the virus preparation per milliliter
-ί- 103 0 amount of virus needed in 1.0 ml
= 102 4 or 2.5 (antilog of 0.4) x 102.
This figure with a negative exponent would represent the dilution at
which the original preparation must be diluted to obtain the 1000
ID50. The 10‘2 dilution can be prepared and 1 ml of it taken up to a
final volume of 2.5 ml to obtain the correct ID50. If the decimal
fraction in the titer is to be eliminated, the antilog of 0.4 should be
found. This antilog corresponds to 2.5; therefore,
105 4 = 2.5 x 105 ID5()/ml.
Stepwise Method. The following step-by-step procedure can be
used to find the dilution containing the 1000 ID50 in 1.0 ml of
inoculum:
1 ml of 10° dilution contains 105 4 or 2.5 x ΙΟ5 Π)50,
1 ml of 101 dilution contains 104 4 or 2.5 x 104 Π)50,
1 ml of IO'2 dilution contains 103 4 or 2.5 x 103 tD50 or 2500 ID50.
At this point, the formula C x V = CN x VN can be used as follows:
when
C = 2500ID5Q,
V = 1 ml (assuming that only 1 ml is to be taken from the final
suspension),
C’ = 1000ID50, and
V’ = unknown,
using the above formula:
2500 x 1 = 1000 x V, and
V’ = 2.5
Therefore, 1 ml of the IO’2 dilution of the virus preparation has to
be taken up at a final volume of 2.5 ml, that is, 1.5 ml of diluent and
1.0 ml of the IO'2 dilution of virus.
CALCULATION OF GEOMETRIC MEAN TITERS
Individual serologic results are usually expressed as the reciprocal
of the endpoint serum dilution. This system is used for twofold
dilution series that begin with either a 10-fold or a twofold dilution.
Examples of these results are 10, 20,40,..., 320; or 2, 4, 8,..., 256.
These results are usually expressed in arithmetic terms, which can
be useful when the results of a few serum samples are to be
interpreted. When a large number of results from individual serum
samples are to be analyzed, however, the arithmetic system of
individual titer expression becomes very time consuming. Also, a
few samples with very high or low titers will give an unreasonable
arithmetic mean, which can be misleading when the results are
interpreted. Most of the serologic results found in the literature are
presented as geometric mean titers (GMTs), although they are
usually expressed in arithmetic terms. Therefore, knowing the
procedure for calculating the GMT is important. The general
formula for calculating a geometric mean (GM) is:
GM="y^IX2X3...Xn
where:
X = value of the observation, and
n = number of observations.
The GMT can be determined by a number of methods, including
those that follow.
Pedro Villegas

Method Using Logio Titers
The base-10 logarithm (logio) of the reciprocal of the titer of each
sample is added, and the sum is divided by the total number of
samples. The resulting number represents the logarithm of the GM.
The GMT will be the antilogarithm (10x) of this resulting number;
for example, results of a hemagglutination-inhibition (HI) test
obtained from 20 serum samples were as follows (titers expressed
as the reciprocal of the serum dilution): six samples with a titer of 5,
seven samples with a titer of 20, five samples with a titer of 40, and
two samples with a titer of 80. To find the GMT log10:
1) Calculate the log10 of each of the titers and multiply by the
number of samples with that titer:
log10 5 = 0.698 x 6 = 4.193,
log1020= 1.301 x 7 = 9.107,
log10 40 = 1.602 χ 5 = 8.010, and
log10 80= 1.903 x 2 = 3.806.
2) Add all of the partial results and divide by the total number of
samples:
4.193 + 9.107 + 8.010 + 3.806 = 25.116
25.115 - 20 = 1.2558, which is the log of the GM.
3) Find the antilog of this amount, and that will be the GMT:
antilog of 1.2558 = 18.02
GMT =18.02.
Method Using Tube Number (Modified Log2) and Tables
When the end dilution points of serologic tests are recorded by
tube number and any twofold dilution series is used, the GMT can
be easily calculated by referring to a table developed by Brugh (2),
reproduced here by permission (Table 46.2). The GMT can be
calculated when the original dilution is either 1:2, 1:5, 1:10, or 1:20.

Table 46.2. Conversion of base-two logarithmic mean titers to geometric mean titers (GMTs) (source, M. Brugh [2]).

Mean titei^Reciprocal of GMT at proportionate distance between dilutions.

1:5 1:10 1:20 0.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9

1 - - 5 5 6 6 7 7 8 8 9 9
2 1 - 10 11 12 12 13 14 15 16 17 19
3 2 1 20 21 23 25 26 28 30 32 35 37
4 3 2 40 43 46 49 53 57 61 65 70 75
5 4 3 80 86 92 98 106 113 121 130 139 149
6 5 4 160 171 184 197 211 226 243 260 279 299
7 6 5 320 343 368 394 422 453 485 520 557 597
8 7 6 640 686 733 788 844 905 970 1040 1114 1194
9 8 7 1280 1372 1470 1576 1689 1810 1940 2079 2229 2389
10 9 8 2560 2744 2941 3152 3378 3620 3880 4159 4457 4777
11 10 9 5120 5487 5881 6303 6756 7241 7760 8317 8914 9554
12 11 10 10,240 10,975 11,763 12,607 13,512 14,482 15,521 16,635 17,289 19,109
13 12 11 20,480 21,950 23,525 25,214 27,024 28,963 31,042 33,270 35,658 38,217
14 13 12 40,960 43,900 47,051 50,428 54,047 57,926 62,084 66,540 71,316 76,434
15 14 13 81,920 87,800 94,101 100,856 108,094 115,852 124,168 133,079 142,631 152,868
16 15 14 163,840 175,599 188,203 201,711 216,188 231,705 248,335 266,159 285,262 305,736
A Mean of titration endpoints expressed by dilution or tube number. Dilution of test material (for example, serum) in first tube of twofold series.
For assays with an initial dilution of 1:2, use the 1:20 column and divide results by 10.

Depending upon which original dilution was used, the whole Arithmetic Method for Any Dilution Factor
number (integer) obtained from the average of the tube numbers is The titer can be calculated mathematically for a twofold dilution or
found in one of the three columns on the left side of Table 46.2. The for any other dilutions with the following formula:
decimal fraction is then found in the column heads of the rest of the GMT = antilog (average endpoint tube number - 1) x (log of the
table. For example, if the original dilution used in an HI test for 10 factor) + (log of reciprocal of first dilution).
serum samples was 1:5, the results were recorded by tube number as In the example from above:
follows: two samples with endpoint in tube 3, three samples with GMT = antilog (4.4 - 1) x (0.30102) + (log 5)
endpoint in tube 4, four samples with endpoint in tube 5, and one = antilog 1.0234 + 0.6990
sample with endpoint in tube 6. = antilog 1.7224
The average of the tube number is calculated: = 52.77 = 53.
(2 χ 3) + (3 x 4) + (4 χ 5) + (1 x 6) = 44
44 - 10 = 4.40
The whole number 4 is found in the column under 1:5 dilution and
the decimal fraction 0.4 is found on the right side of the table. The
GMT from the table is 53. This method is very useful, especially
when automatic equipment is used and large numbers of samples
are tested.

220

REFERENCES
1. Brian W. J., and Η. O. Kangro. Virology methods manual. Academic
Press, Inc., San Diego, California, 1996.
2. Brugh, M A., Jr. A simple method for recording and analyzing
serological data. Avian Dis. 22:362-365. 1978.
3. Burleson, F. G., T. M Chambers, and D. L. Wiedbrauk. Virology—a
laboratory manual. Academic Press, Inc., San Diego, California 1992.
4. Campbell, J. M, and J. B. Campbell. Laboratory mathematics: medical
and biological applications, 3rd ed. The C. V. Mosby Co., St. Louis, Mo.
1984.
221
Chapter 46 Titration of Biological Suspensions
5. Cottral, G. E., ed. Manual of standardized methods for veterinary
microbiology. National Academy of Sciences, National Research Council,
Washington, D.C. p. 731. 1978.
6. Hsiung, G. D. Diagnostic virology. Yale University Press, New Haven,
Conn. 1982.
7. Reed, L. J., and H. Muench. A simple method for estimating fifty percent
endpoints. Am. J. Hyg. 27:493-497. 1938.
8. Villegas, P., and H. G. Purchase. Titration of biological suspensions. In:
A laboratory manual for the isolation and identification of avian pathogens,
3rd ed. H. G. Purchase, L. H. Arp., C. H. Domermuth, and J. E. Pearson,
eds. American Association of Avian Pathologists, Kennett Square, Penn. pp.
186-191. 1989.
 47
SEROLOGIC PROCEDURES
Stephan G. Thayer and Charles W. Beard

SUMMARY. Avian serology consists of a combination of classical test methods, such as the agar-gel precipitin (AGP) test, the plate
agglutination test, the virus-neutralization (VN) test, and the hemagglutination-inhibition (HI), and the enzyme-linked immunosorbent assay
(ELISA). Most of the tests are relatively easy to perform, but quality control is essential.
The AGP test, also known as the agar-gel immunodiffusion test (AGID) or double immunodiffusion test (DID), is the simplest to set up,
requiring only positive and negative control sera, concentrated antigen, and appropriate agar. Antibodies to disease agents such as avian
influenza virus, hemorrhagic enteritis virus, and adenoviruses can be detected by this method.
Plate agglutination tests are used as screening tests for Salmonella pullorum, Salmonella gallinarum, other Salmonella spp., and
Mycoplasma spp. These tests use stained or unstained antigen mixed with either whole blood or serum. It is important to run confirmatory
tests because plate agglutination tests can give false positive and false negative reactions.
The VN test is more labor intensive and requires expertise in handling Eve viruses, cell culture techniques or embryo inoculation methods.
Expertise evaluating cytopathology or pathologic effects in developing embryos is required. Antibodies to viral diseases such as infectious
bursal disease, viral arthritis, some adenoviruses, infectious bronchitis, and avian encephalomyelitis virus can be assessed by these methods.
VN tests are often preferred as they tend to more closely reflect the in vivo neutralization of virus.
The HI test is used to titrate antibodies to avian diseases agents such as Newcastle disease virus, avian influenza virus (subtype-specific),
infectious bronchitis virus, adenovirus 127, and Mycoplasma. Hemagglutination is a naturally occurring activity with avian influenza viruses,
Newcastle disease viruses, and adenoviruses 127. Hemagglutination can be induced with infectious bronchitis viruses by pretreatment with
neuraminidase.
The ELISA can be used to perform titration of antibodies to a large number of avian viral and bacterial disease agents. Kits are available
commercially and offer the advantage of a single protocol to perform multiple tests on the same sample. The format is the 96-well
microplate, and the test can be semi automated using plate washers and computer-controlled microplate readers.

INTRODUCTION antibodies is the basis of the HI test. It is a convenient and

This chapter discusses the more commonly used serologic
procedures applied to avian medicine. The discussion does not
provide a precise outline to follow for all diseases, because the tests
vary considerably with the disease and with the laboratory system
(macro or micro) utilized. This chapter will provide information that
can be used along with other specific serologic recommendations in
the disease chapters and in other publications to perform the desired
procedures in an accurate and reproducible manner.
The following suggestions may be helpful in obtaining clean serum
in adequate amounts:
1) Use 1.5 ml snap-cap microfuge tubes collecting about 1.0 ml of
blood. The clot does not stick to the walls and yields about 0.5 ml of
clear serum after holding overnight at room temperature. The tubes
can be microcentrifuged for about 30 seconds to help squeeze the
clot and the serum be poured off into a separate clean microfuge
tubes for storage at 4 C. The yield of 0.5 ml will be sufficient for
most testing.
2) Use silicone-treated glass tubes. They can be purchased or
treated with silicone in the laboratory (33).
3) Never fill a tube to more than one fourth to one third of its
capacity.
4) After the tube is stoppered, lay it down at about a 5 degree angle
and allow the blood to clot.
5) Place samples horizontally in a 37 C incubator for several hours.
6) Leave samples upright at room temperature or in the refrigerator
(4 C) overnight.
Serum can then be carefully poured off into vials or pipetted into
microliter serum storage plates (31). A modification of a filter-paper
blood-sampling method (10) makes that technique particularly
suited to micro serology for poultry.
HEMAGGLUTINATION-INHIBITION (HI) TEST
Avian viruses that agglutinate erythrocytes include Newcastle
disease (NDV) virus, avian influenza (Al) virus, infectious
bronchitis (IBV) virus (after concentration and enzyme treatment),
and adenovirus 127. Several Mycoplasma species are also capable
of hemagglutination. The inhibition of hemagglutination by specific
222
economical serologic tool that has been applied extensively to the
control of several avian diseases
* such as ND, IB, and
mycoplasmosis by measuring antibody response to vaccines and as
evidence of past infection.
The basic components of the HI test are the hemagglutinating
(HA) antigen, the serum serially diluted in decreasing
concentrations, and the erythrocyte suspension. The tests may be
done in tubes or in micro test plates. The constant-antigen diluted-
serum (β technique) is used much more than is the constant-serum
diluted-antigen (a technique).
The preparation of the HA antigen varies depending upon the
laboratory and the disease agent. It can be as simple as
concentration of virus from NDV-laden egg fluids 48-72 hr after
inoculation or a concentrated suspension of Mycoplasma
microorganisms. A very satisfactory ND-antigen-preparation
technique has been described (6). When egg fluid is to be harvested,
the eggs should be chilled at 4 C for several hr to reduce the chance
of erythrocyte contamination of the fluid. The amount of antigen
used in each well of the HI test varies from 8-10 HA units for ND,
to 4 HA units for influenza, to 2-4 HA units for Mycoplasma. The
dilution of the antigen suspension is needed to adjust the HA
activity to the desired number of HA units per volume used in the
test. If an antigen suspension is diluted by twofold transfers (0.5 ml
into 0.5 ml in tubes or 50 microliters into 50 microliters in a
microplate), resulting in dilutions of 1:2, 1:4, 1:8, and so on, and
complete agglutination occurs at the 1:512 dilution but not at the
1:1024 dilution, the suspension has an HA titer of 512 (a 1:512
dilution of the antigen theoretically contains 1 HA unit). That
means that a 1:51 dilution of the suspension would result in 10 HA
units, a 1:256 dilution in 2 HA units, and so on. If more precision is
desired in determining the HA activity of an antigen suspension,
two sets of twofold dilutions can be made simultaneously: one
beginning with 1:10 and one with 1:15. The HA titer will be the
reciprocal of the highest dilution that exhibits HA activity in either
row of dilutions. It is always advisable to back-titrate the antigen
suspension with the erythrocyte suspension used in the HI test to be
certain that the HA activity was actually as calculated. If 8 HA units
were calculated to be in the final-use antigen suspension, a twofold
(1 into 1) dilution (1:2) should contain 4 HA units; the next twofold

dilution (1:4) should contain 2 HA units; the next (1:8) should
contain 1 HA unit; and the next (1:16) should be HA negative. If 10
HA units were used, the 1:8 dilution should be HA-positive and the
1:16 dilution HA negative.
Two basic variations exist in HI test procedures related to HA
antigen. In NDV and Mycoplasma Hi tests, the serum dilutions are
usually made in an antigen-saline mixture. In the influenza HI tests,
the HA antigen is usually added to the diluted serum in an
additional step. If the antigen-added method is used, the antigen
should be diluted so that the desired number of HA units occurs in
the final volume of the diluted serum together with the added
antigen before erythrocytes are added.
The concentration of HA antigen used in the HI test undoubtedly
has an influence on the final test results, but slight differences in the
number of HA units may induce minimal effects on the HI titer of
the serum tested. Generally, increasing the antigen concentration
results in decreased sensitivity, and decreasing the antigen
concentration results in increased sensitivity.
Many variables other than the concentration of HA antigen used
can influence HI test results. These variables include the
concentration of the erythrocyte suspension, the time between
mixing the serum and antigen and the addition of erythrocytes, the
temperature at which those mixtures are held, and the criteria used
in reading the test. Brugh et al. (11) examined several of the
variables for the NDV HI test and recommended a standard holding
period before adding erythrocytes. When the holding temperature is
37 C, the HA activity of the antigen must be stable at that
temperature because antigen degradation could falsely increase HI
titers.
Erythrocyte Suspension
Erythrocytes can be taken from a single chicken if experience has
shown that the donor is satisfactory; otherwise, a pool from a
minimum of three chickens is recommended (1). Chickens
vaccinated against NDV can be used as donors, if necessary,
provided that careful attention is given to the erythrocyte-washing
procedure. Turkeys are often used as donors when turkey serum is
tested for HI activity, so that nonspecific reactions are reduced.
When turkey sera are tested, both hemagglutination and HI should
be performed using turkey erythrocytes.
An anticoagulant such as 4% sodium citrate (one part to four parts
blood) or Alsever’s solution (equal volumes) should be in the
syringe into which the blood is drawn. After it is mixed gently, the
blood is transferred slowly to a large, conical centrifuge tube for
washing. An equal amount of phosphate-buffered saline (PBS) at
pH 7.0-7.2 is added and the suspension is centrifuged at 500 x g for
5 min. The supernatant is poured off, and 20-30 volumes of PBS
are added to the packed cells. The cells are resuspended gently and
the centrifugation step repeated once more, again pouring off the
supernatant. The cells can then be used to prepare the 0.5%
suspension based on volume by adding 0.5 ml of the packed cells to
100 ml of PBS at pH 7.0-7.2. Alternatively, once the erythrocytes
have been washed 3-4 times they can be adjusted to a 25%
suspension in PBS and held for up to 4 days at 4 C.
Erythrocytes can also be stored in Alsever’s solution at a ratio of 1
ml of packed cells to 15 ml of Alsever’s solution by resuspending
the cells in the solution and then holding them at 4 C. The cells can
be used for up to 6 days if no hemolysis is observed. The cells are
centrifuged out of the Alsever’s solution, washed 3-4 times in PBS
and diluted as described as needed for a test.
Test Procedures
Microtechniques are widely used and recommended for HI tests.
The techniques are convenient, economical, and reliable with a 10-
fold reduction in the quantity of reagents used.
β Procedure (Diluted-Serum Constant-Virus)
A typical β procedure NDV HI test can be performed as follows:
223
Chapter 47 Serologic Procedures
1) Dilute the HA antigen in PBS (pH 7-7.2) based on the HA
activity of the antigen to yield 10 HA units in 50 microliters; for
example. If the antigen titer is 1:2560, dilute 1:256. The inactivated
antigen described by Beard et al. (6) is stable and non-infectious.
2) Dispense the antigen-saline into round-bottomed microplates
using an 8 channel multichannel micropipette with disposable tips.
Add 100 microliters to the first column and 50 microliters to the
other columns except column 12. Column 12 receives 50 microliters
of PBS and serves as an erythrocyte control. Automated pipetters
are available to dispense reagents and to make dilutions in
microplates.
3) If the sera are stored in microplates (28), 8 or 12 sera can be
transferred at one time using 8 or 12-channel micropipettes. Add 25
microliters of sera to the first row of wells and mix resulting in a 1:5
dilution of serum in the first column of each plate. The sera are
diluted across each plate using the micropipette set at 50 microliter
volumes for mixing in the well and making transfers in the serial
dilutions. This results in dilutions of 1:5, 1:10, 1:20, etc. ending
with a final dilution of 1:2560 in well 10. Well 11 serves as an
antigen control. It is always a good practice to place positive control
sera of known HI titer in specific locations on the test plates to
indicate the amount of variation between tests. This positive control
serum should be from a pool that will provide a long term supply to
provide a consistent long term control that can be monitored versus
time. Highly automated micropipettes and liquid-handling robotics
are available for diluting of sera and addition of reagents.
An alternative dilution scheme can be used to provide 1:2, 1:4, 1:8
etc dilution series. Simply add 50 microliters of pre-titered antigen­
saline to each well except row 12. Fifty microliters of test serum is
added to each well in the first column resulting in a 1:2 dilution.
After the test serum is mixed, 50 microliters is passed to the next
row, and so on, resulting in dilutions of 1:4, 1:8, and so on. It is not
unusual to get some nonspecific HI results at the first one or two
dilutions when this alternative method is used. The highest dilution
achievable testing 8 sera per plate is 1:1024.
4) Incubate all plates at room temperature for 20-30 min.
Microplates may be covered with individual lids or with plate
sealing tape to avoid evaporation.
5) After the incubation, add 50 microliters of a 0.5% chicken
erythrocyte suspension to each well using a manual or automated
multi-channel pipet. Gentle swirling of the cell suspension should
be done during this step to aid in maintaining a uniform suspension
of erythrocytes.
6) The plates are left at room temperature for 45 min. Negative
serum and antigen controls should exhibit a matt of agglutinated
erythrocytes. Erythrocyte controls should exhibit a distinct button of
non-agglutinated erythrocytes. A reading mirror aids in reading the
results. Results should be recorded as soon as possible. Some
workers suggest tilting the plates and observing for “tear dropping”
or "running buttons" to show that the erythrocytes are not
agglutinated.
7) Results are numerically reported as the reciprocal of the highest
dilution of serum at which there was complete inhibition of
hemagglutination. This value (160 if 1:160 was the highest
inhibitory dilution) is not multiplied by the number of HA units
used in the test, as was once suggested. A convenient method for
reporting HI results and calculating geometric mean titers has been
reported by Brugh (9).
In laboratories where microtest equipment is not available, the HI
tests can be satisfactorily performed in tubes by using the same
dilutions but passing 0.5 ml instead of 50 microliters. The basic
principles and the results between the macro- and micromethods are
comparable.
The elution of the antigen from the agglutinated erythrocytes may
be erroneously interpreted as HI. The elution problem is often
encountered when viable or rapidly eluting ND viruses are used as
HA antigen in laboratories that have high ambient temperatures.
Stephan G. Thayer and Charles W. Beard
Rapidly eluting viruses should not be utilized as the HA antigen.
Unnecessary hazards of inadvertent cross-contamination in a
multipurpose laboratory can be avoided by inactivating all HA
antigens. Adding formalin to achieve a final concentration of 0.1%
and incubating for 24 hr at 37 C is a satisfactory procedure for
NDV. Beta-propriolactone (BPL) at 0.1% can also be used. Careful
initial handling of BPL is necessary as it is carcinogenic but
hydrolyzes rapidly during the inactivation and becomes inactive.
Other instructions for performing the HI test with minor and major
differences are available from other sources (1, 2, 3, 7, 19). For
Infectious bronchitis virus HTs the principle differences are
Incubations are done at 4 C and serum dilutions are performed in
plain HI buffer instead of diluted antigen. Regardless of the
procedure used, the use of control sera of known titer is absolutely
necessary to facilitate quality control and give assurance of
consistent performance. If those positive sera are provided by a
reference laboratory, the sera will make possible comparisons
between the different laboratories performing the tests. A
comparison of wide-ranging HI results obtained by different
laboratories varied markedly even when all used the same antigen
suspension, which emphasized the need to include control sera of
known titers (8).
a Procedure (Constant-Serum Diluted-Virus)
The a procedure employs dilutions of the antigen and a constant
amount of serum. The serum to be tested is diluted 1:5 or to some
other suitable dilution and substituted for the saline in the
hemagglutination test. This requires a large volume of serum
compared to the β procedure and therefore is not practical in most
diagnostic situations. The virus dilutions and serum are mixed and
incubated at room temperature for 10 min before the erythrocytes
are added. Incubation and reading of the tests are the same as in the
hemagglutination test. A hemagglutination test must be performed
concurrently for the virus-only titer and serum-virus titer to be
compared.
Because the β procedure gives a better evaluation of the HI titer of
sera, the a procedure has been discontinued by most laboratories.
For a more detailed description of the a procedure, see Methods for
Examining Poultry Biologies and for Identifying and Quantifying
Avian Pathogens (4).
HEMAGGLUTINATION (HA) TEST
A useful application of the hemagglutination (HA) tests can be
made during the isolation procedure for NDV or other
hemagglutinating viruses. The suspected material is injected into
the allantoic cavity of embryonated eggs and incubated. A small
amount of the allantoic fluid is removed after the desired period of
incubation. Prechilling of the egg reduces chances of erythrocyte
contamination during the fluid-sampling procedure. A rapid check
for HA activity can be done by placing a drop of the allantoic fluid
on a slide along with a drop of 5% washed chicken erythrocytes.
Mix by light stirring or by gently rocking the slide. AA positive test
is indicated by hemagglutination and will have a granular
appearance. Quantitation of HA activity can be done by pipetting
0.1 microliters of the allantoic fluid into a microtiter plate or in a
glass tube. After making twofold serial dilutions in saline, 0.1 ml of
a 0.5% suspension of washed chicken erythrocytes is added.
Allantoic fluid from an uninoculated egg serves as a negative
control. No hemagglutination should occur in this sample. If HA
activity is observed with the fluid from the injected egg, HI tests
can be done in microtest plates using known ND-positive and ND-
negative chicken sera (preferably from specific-pathogen-free [SPF]
chickens) to determine if NDV is the cause of the hemagglutination.
After the dilutions of allantoic fluid are mixed with normal and
immune sera, an equal quantity of 0.5% erythrocytes is added. If the
suspect HA agent is NDV, the NDV antiserum will prevent
224
hemagglutination in the fluids containing the known-positive NDV
antiserum. This is a rapid and reliable method of screening injected
embryos while they are still on the laboratory bench. If it is positive,
all of the remaining fluid can be harvested for additional testing,
should that be desirable. This procedure can be used for influenza
viruses with polyvalent avian influenza positive antisera and known
negative sera. HA typing must be done using type-specific antisera.
IMMUNODIFFUSION
Immunodiffusion techniques are frequently used in avian medicine
to demonstrate and analyze antigen-antibody reactions. The
techniques permit visualization of the antigen-antibody complexes
as precipitates form when these two reactants co-mingle while
diffusing in a semisolid medium such as agar. Immunodiffusion is a
precise immunological technique, yet costs are minimal and the
procedures are simple.
The technique used most commonly in poultry diagnostic
laboratories is the two-dimensional double-diffusion procedure, in
which both antigen and antibodies diffuse toward each other from
separate wells in a layer of solidified agar in a petri dish or on a
glass slide. This double-diffusion test is known by several names,
such as the agar-gel precipitin (AGP) test, the agar-gel
immunodiffusion (AGID) test, the double Immunodiffusion (DID)
test, and the Ouchterlony test.
The DID test has been described for various poultry diseases,
including Marek’s disease (29), infectious bursa disease (TBD) (16),
infectious bronchitis (36, 37), viral arthritis (23), avian
encephalomyelitis (AE) (20), avian influenza (Al) (5), ND (14),
fowl pox (17), mycoplasmosis (22), and others (21). Each particular
application requires appropriate techniques of antigen preparation,
buffer selection, and gel formulation. Therefore, one should first
become familiar with the principles of the reaction and specific
methodology for each (13, 18, 32).
The advantage of such a test system is simplicity and speed. With
known reference reagents, a laboratory worker can identify either
infectious agents or antibodies. The visualization of precipitin lines
that fuse with lines of identity from known reactants is a reliable
diagnostic procedure that requires little effort and expense.
Several methods are used for containing the gel medium. Plastic or
glass petri dishes are frequently used. Wells are cut with
commercial or homemade cutters and the agar plugs aspirated (24).
The usual pattern is six wells around a center well. Wells are 5.3
mm in diameter and spaced 2.4 mm apart. Approximately 15-17 ml
of agar in a 100-mm petri dish or 6 ml in a 60-mm petri dish or 2 ml
in a 35-mm petri dish will result in the correct agar thickness (2.8
mm). The plug is aspirated with a small pipette attached to a
vacuum flask. Sometimes the bottom of the wells must be sealed
with a small drop of melted medium to prevent the reagents from
leaking under the gel instead of diffusing through it. Some workers
use a commercially available triangular plastic plate for DID tests
with built-in molds that result in either 5-mm or 7-mm well
distances (Alpha Gamma Laboratories, Inc., Sierra Madre, Calif.).
The plates should be placed in a moisture chamber, such as a plastic
bag or storage container with a snap-on lid that contains a wet paper
towel to avoid drying of the agar.
A simple DID system can be prepared on ordinary frosted end
glass microscope slides. The wells can be labeled on the frosted end
of the slide. The slides should be placed in a humidity chamber for
incubation. If the temperature in the laboratory is below 21 C, the
plates or slides should be held in a 26 C incubator.
The pattern of wells must place each test serum or antigen adjacent
to a known-positive reagent. This will make the observation of a
continuous line of identity possible and will reveal weak positive
reactions by the slight bending of the end of the precipitin line near
the suspect well.
The most commonly used semisolid medium for immunodiffusion
is prepared with 0.7-1.0% pure or partially purified agar and 8.0%

NaCl. Such purity is an important consideration, because it can
influence free diffusion of the reactants. Some bacteriologic-grade
agars have strongly charged chemical groupings that will bind
certain antigens, which interferes with the formation of a visible
precipitin band. Special agar noble has proven to perform well for a
several test antigens. Agar may be pre-prepared and stored in 30-40
ml aliquots in glass screw-capped centrifuge tubes at 4C. To
prepare the agar the tubes are placed in a boiling water bath until
molten. Plates must be prepared fresh on the day of the testing.
Punching and aspiration of the wells must always be done just prior
to loading. Any drying of the agar or wells will compromise the
test.
The last important factor is reactant concentration. The location of
the precipitin band between the antigen and antibody wells is
determined by the relative concentrations and diffusion rates of the
reactants. For practical purposes, the diffusion rates cannot be
manipulated, although the reactant concentration must sometimes
be adjusted before the precipitin bands will become visible. The
reason for this is that if there is considerably more of one reactant
than the other, the precipitin reaction may occur within or
immediately adjacent to the well that has the lower concentration,
which gives apparently negative results.
In addition to detecting antibodies in serum, the immunodiffusion
test can be used to detect antibodies in yolk. Yolk is diluted with
equal parts of PBS, shaken or mixed on a Vortex mixer for 30-40
sec, and centrifuged at 1000 x g for 30 min. The yellow, translucent
supernatant is used in the test.
Immunodiffusion test results can be read after several hours or
several days, depending primarily on the concentrations of antigen
and antibody. Precipitin bands are best seen against a dark
background with the gel illuminated obliquely from the bottom.
Illumination devices are usually homemade (15) but are also
available commercially. A Model 653 microscope illuminator
(American Optical, Leica, Inc. Deerfield, Π1.) is very satisfactory
for this purpose.
A specific, positive result is recorded when the precipitin line
between the known-positive control wells is continuous with the
line between the antigen and the test well. It is important that each
test well be positioned adjacent to a positive control well. Slight
reactions are observed when the precipitin line is bent at the test
well end and partial identity is seen as spurs. Crossed lines are
interpreted as non-identity or negative.
The immunodiffusion procedure offers many advantages, but it
lacks the level of sensitivity offered by many other tests. Semi­
quantitation may be achieved by testing serial dilutions of a known
positive sample.
VIRUS-NEUTRALIZATION (VN) TEST
Serologic tests using the neutralization of virus for quantitative
measurement of antibody are used frequently in diagnostic and
research laboratories. Used in conjunction with known antisera,
they are useful in identifying unknown viruses and differentiating
between viruses. The test has two parts. In the neutralization part,
the virus (at the correct dilution) is mixed with the serum (also at
the correct dilution) in a test tube. The virus and serum are mixed
and incubated together at a standard temperature for a given length
of time. In the second part, the residual unneutralized virus is
assayed in a suitable indicator system (see Chapter 46 on Titration
of Biological Suspensions). The general procedure of the test is as
follows (modifications are given where necessary for different host
systems).
Sera. Sera for neutralization tests should be sterile (they may be
membrane-filtered), free of any chemical preservatives (phenol,
formalin, and so on), and heated at 56 C for 30 min to destroy heat-
labile nonspecific virus-inhibitory substances. Antiserum to be used
as a standard or for the identification of unknown viruses should
225
Chapter 47 Serologic Procedures
preferably be produced in SPF chickens from a plaque-purified
virus culture. Stocks of normal serum from SPF birds should be
kept available as control serum during test procedures.
Virus. Virus strains used for neutralization tests should have a high
titer, should not have clumps of virus, and should be well adapted to
the host system used. The virus strains should be pure cultures,
preferably clone-purified, and free from bacteria, fungi, or
Mycoplasma. Stock viruses are best maintained in small aliquots in
glass-sealed ampules, screw-cap vials, or plastic cryovials stored at
-60 C or below.
Diluents. The diluent used can be cell-culture medium or other
diluents known to be compatible with both the virus and host
system to be used.
β - Neutralization Procedure (Constant-Virus Diluted-Serum)
In this method, serial dilutions of the serum are tested against a
standard concentration of virus. This technique has certain
advantages in that it uses small amounts of serum, is the preferred
test for low-titered viruses, and is more useful for demonstrating
significant differences in neutralizing antibodies between acute and
convalescent serum specimens collected from suspect flocks.
A quantal response in cell culture grown in 96 well microplates is
selected as the indicator system in the following example. The 96-
well cell-culture system can be utilized with the same automated
dispenser system used for HI tests. Although the principle is the
same for all systems, reagent volumes differ among systems and
procedures.
1) For the neutralization part of the test, make serial twofold or
fourfold serum dilutions in cell-culture medium in a microtest plate.
2) Dilute the virus in cell-culture medium to contain the desired
tissue-culture infective dose (TdD50) in 0.1 ml (100 TCID5o is
frequently used). The working dilution of virus is determined from
a previous titration where serial dilution of the stock virus is
performed in a microplate. The last well showing destruction of the
cell monolayer is the endpoint . Back-titration the virus with each
batch of neutralization tests is used to confirm that 100 TCID50 of
virus was used (see Chapter 46 on titration of biological
suspensions).
3) In a series of tubes or in a microtest plate, thoroughly mix 0.1 ml
of each of the serum dilutions with the pre-diluted virus containing
100 TCID50 in 0.1 ml. For a virus control, mix the virus dilution
with known normal serum or cell-culture medium.
4) Incubate the test set of tubes and the virus control tube for 1 hr at
25 C, unless another time or temperature is specified.
5) For assay of residual virus, inoculate 0.2 ml of each serum-virus
mixture into each of five monolayer cultures containing fresh
medium and incubate them at 37 C. Use separate pipettes for each
dilution or inoculate the lowest serum dilution first. In the β
procedure, this is necessary because active virus is in highest
concentration at the highest serum dilution and may be carried
forward to the next lower serum dilution in the pipette.
6) Examine the cultures at an appropriate reading time for the test
virus and score the cultures for cytopathic effect as positive or
negative.
When the indicator system is based on an enumerative response in
cell culture or a quantal response in chicken embryos, the
neutralization parts (steps 1^4) are the same. The assay of residual
virus will vary with the system and the response, but it will be the
same as that used to determine the titer of the virus (see Chapter 46
on Titration of Biological Suspensions).
Calculation of Neutralizing Titer for β Method
When the residual virus is assayed with a quantal response, the
50% endpoint of neutralization is calculated by the method of Reed
and Muench (25) (Table 46.1) or Spearman-Karber (12) as
explained in Chapter 46. The neutralizing titer or mean protective
dose (PD50) is calculated from this endpoint.
Stephan G. Thayer and Charles W. Beard
For an enumerative response, the endpoint is the dilution of serum
that neutralizes 50% (80% or 90% in some systems) of the virus.
The endpoint can be interpolated in the same way that the
proportionate distance is obtained. Interpolation can also be done
graphically, or by other statistical methods.
a Neutralization Procedure (Constant-Serum Diluted-Virus)
In this method, serial dilutions of virus are mixed with a standard
dilution of serum (ideally, undiluted serum is used). The serum­
virus mixtures are incubated and then assayed for residual virus as
above, in any host, usually by quantal response.
A quantal response in chicken embryos is selected as the indicator
system in the following example.
1) For the neutralization part, prepare decimal dilutions of the virus
and arrange them in a rack as shown in Table 47.2, row 1.
2) Set up rows of small sterile test tubes for negative (row 2) and
positive (row 3) control sera, and a row for each unknown serum
(rows 4 and 5).
3) Into each of the tubes in row 2, pipette 0.4 ml of sterile serum
known to be free of antibody against the agent being studied. In the
absence of such serum, sterile diluent can be used. This row will
serve as the negative serum or virus control. Into each of the tubes
in row 3, pipette 0.4 ml of sterile serum known to have antibody
against the agent being studied. This row will serve as the positive
control. To each of the tubes in the other rows, add 0.4 ml of the
serum being tested.
4) Transfer 0.4 ml of the virus dilution from row 1, tube 8, to the
eighth tube in rows 2, 3, 4, and 5, and discard any virus remaining
in the pipette. With the same pipette, transfer 0.4 ml of the virus
dilution from row 1, tube 7, to the seventh tube in the other rows.
Continue until all tubes have virus. When the titer of the virus is
known, three to five dilutions in the control group usually suffice to
bracket the endpoint in subsequent tests. Frequently, the unknown
serum must be tested over a broad range of virus dilutions to ensure
detection of the endpoint.
5) Mix virus and serum thoroughly by swirling each tube
individually or by shaking the tube rack vigorously. Allow the
mixture to stand at 25 C for 1 hr unless another time or temperature
is specified.
6) For the assay of residual virus, start inoculating with the least­
concentrated dilution of virus in the unknown serum group and
inoculate each of at least five embryonating eggs with 0.1 ml by the
appropriate route. Proceed to the next dilution, using the same
needle and syringe. Repeat this until all virus-serum mixtures have
been inoculated. If more than one serum is being tested, use a
separate needle and syringe for each serum, and inoculate each of
these mixtures as above. The virus control mixture should be
inoculated last, using a separate needle and syringe. For very critical
work, use a separate needle and syringe for each serum-virus
mixture.
7) Seal the eggs by appropriate means and return them to the
incubator for the time specified for the virus in use. Candle the eggs
18-24 hr later and discard all eggs containing dead embryos.
Candle eggs daily and examine dead embryos for lesions, if desired.
At the end of the experimental period, the remaining live eggs can
be examined for lesions, if desired. Record the results.
The PD50 can be calculated from the example given in Table 47.1
by the following formulas:
Percent infected at dilution next above
Proportionate =
distance 50%________ -__________ 50%_______
percent infected percent infected
at dilution next - at next dilution
above 50% below 50%
226
86-50
86-33
36
53
= 0.67.
Calculate the log 10 exponent that is the 50% neutralization
endpoint or the PD50: reciprocal of 50% neutralization endpoint =
proportionate distance x log of the serum dilution factor + log of the
lower dilution used to calculate the proportionate distance
= (0.67x0.6) = (1.2)
= 0.4+1.2
= 1.6
= 40 (antilog of 101.6)
50% neutralization endpoint or PD50 = 1:40.
Calculation of Neutralizing Index for a Method
When the residual virus is assayed by a quantal response, the
endpoint for each serum can be calculated by the method of Reed
and Muench or of Spearman-Karber. A hypothetical test result is
given in Table 47.3. The neutralization index (NI) of the serum is
the difference between the log titer of the virus control (negative
serum) and the log titer of the serum-virus mixture. It has no units.
Thus, in the example in Table 47.3:
titer of virus control (or negative serum-virus mixture) = 6.5,
titer of positive serum-virus mixture = 2.5, and
difference (NI) = 4.0.
The NI is sometimes expressed arithmetically (i.e., in the above
example, 10,000). In this instance, the NI represents the ratio of
arithmetic endpoint titers of the virus control and positive serum­
virus control. It is very important to distinguish between the log and
the arithmetic figures, particularly when the NI is low.
It is common practice for laboratories to receive a pooled serum
sample for antibody assay that is composed of equal parts of sera
from several chickens. Such pooled samples can lead to false
conclusions on the antibody status of the chickens represented by
the pooled sample. In the above example in which the NI was 4.0,
supposing that the pooled sample came from 10 chickens, it is
possible that 9 of the 10 chickens had no antibody levels whereas 1
of the 10 had an NI of 5.0.
The result of the pool would be an NI of approximately 4.0. The
limited information from pooled samples should be weighed against
the practicality of testing individual sera.
AGGLUTINATION
The clumping or agglutination of bacteria by specific antibodies in
whole blood and in serum was one of the first serologic procedures
to be used widely in the control of poultry diseases.
Agglutination tests are relied on for diseases such as infectious
coryza, salmonellosis (including pullorum and fowl typhoid), and
mycoplasmosis. The tests may be done on glass or porcelain plates
(serum plate test), in test tubes (tube test), or in microplates. Refer
to the chapters on the bacterial diseases in this manual for details of
procedures and antigens used for the specific tests for a particular
disease.
The serum plate test is frequently used as an initial screening test.
If a serum agglutinates the specific stained antigen in the plate test,
the serum may then be serially diluted and tested at decreasing
concentrations for its ability to agglutinate the antigen in tubes or in
microplates. The agglutination titer is reported as the reciprocal of

the highest dilution of serum at which complete agglutination
occurs. For a small number of serum samples, the samples are
sometimes diluted and tested by only the serum plate method. The
application of microtest methodology to the agglutination test for
salmonellae (35) and for Mycoplasma has drastically reduced the
expense and time associated with the agglutination test.
ENZYME-LINKED IMMUNOSORBENT ASSAY (ELISA)
The ELISA has become the principle serologic assay used by most
laboratories for serologic testing. The ELISA is based upon the
single dilution antibody titer determination method of Snyder and
Marquardt (26, 27, 28). This method permits the development of
flock profiles both on a single bleed approach or on one based on
sampling over time. The use of a common protocol for most of the
tests streamlines laboratory throughput. The application of the
microcomputer to drive the plate reader and process the data
simplifies information management. Additional benefit can be
gained through interfacing the microcomputer for direct input into a
laboratory information management system or company data
warehouse.
Ready to use kits for antibody tests to most of the common avian
bacterial and viral pathogens are commercially available. These
include but are not limited to NDV, IBV, IBD virus, avian reovirus,
Fig 47.1
Mycoplasma gallisepticum, Mycoplasma synoviae, Pasteurella
multocida, AE virus, lymphoid leukosis viral antigen and antibody,
infectious laryngotracheitis virus, avian influenza virus, chicken
anemia virus, hemorrhagic enteritis virus, Bordetella avium, and
Salmonella enteritidis.
Titer Calculation
Titer calculations can be based simply on corrected absorbance
value where the mean negative control is subtracted from the test
sample absorbance. A second method is to take the calculations one
step further in the calculation of the sample-positive ratio (S/P).
The sample absorbance and the mean positive control absorbance
are both corrected for background by subtracting the mean negative
control absorbance from each, thus:
Sample absorbance - NCx
S/P^_____________________
PCx - NCx
where
NCx = Mean absorbance of negative control serum, and
PCx = Mean absorbance of positive control serum.
Commercial ELISA systems for poultry serology typically take the
titer calculations to the next step by using the double regression
approach. The second and final step in this method is the
application of a linear regression formula to calculate the ELISA
titer using the single sample method rather than calculating the titer
based upon a serial dilution. The linear regression formula defines
the relationship between log 10 of the S/P ratio of a single serum
dilution and the log 10 of the observed antibody titers. This typically
takes the form:
log 10 titer = slope x [loglO(S/P)] + y intercept
titer = antilog (slope x [loglO(S/P)] + y intercept).
The S/P ratio is central to this calculation. The actual values used
for the slope and the y intercept are unique to the specific system.
227
Chapter 47 Serologic Procedures
Once titers for individual serum samples are calculated the titers
are placed into titer groups according to a range of titers assigned to
that group, that is, titer group 0 could be all titers between 0 and
1500, titer group 1 would be all titers between 1501 and 2000, and
so on. Histograms are created based on the number of sera in each
titer group. The histogram is then used to visualize the distribution
of titers within the group of sera tested.
Sample Size
The sample size required for adequate representation of the
serologic status of a flock increases with the size of the flock.
However, a point of diminishing benefit exists for this approach
when testing broiler flocks. A minimum of 20 samples per flock
should be tested. Thirty sera per flock is suggested for breeder and
ELISA PROFILE
10 sera 30 sera
I lb
jIjuuuijj 1
β K A A k b * A * *.$> «V A t »A « ♦ >6*
liter group Titer group
Fig. 47.1
layer flocks. Sample sizes less than 10 are inadequate, as the
histogram representing these groups lacks the data points necessary
for even marginal representation and interpretation. This is
demonstrated in Fig. 47.1. Profile 1 represents a select group of 10
sera from the group of 30 sera seen in profile 2. The character of
profile 1 is very different from that of profile 2 even though the sera
were from the same flock.
T roubleshooting
Pipetting. The ELISA is a very sensitive test and is susceptible to
pipetting errors. The most common pipetting errors are due to
improper filling because of loose-fitting pipette tips. This is
especially true when using multichannel pipettes. The practice of
loading those tips directly from the tip rack without checking fit
will cause gross volumetric delivery errors. Additionally, pipettes
should be periodically calibrated for proper delivery.
Plate Washing. Improper washing of the plates can cause
variability that can be difficult to assess. Contamination of the
upper portions of wells, which may not be washed efficiently, can
also introduce variability into the test. Careful attention to proper
delivery and aspiration of wash material is essential for consistency.
Check pipettes and automatic plate washers frequently for proper
volume, rate of aspiration, and thorough aspiration of reagents and
wash solutions. Tapping plates on absorbent material after each
wash step is practiced by many labs as a means of eliminating any
residual wash. Four to five washes after aspiration of each reagent is
recommended. Some manufacturers recommend soaking steps as
part of the wash procedure. These help to elute reagents that might
not be thoroughly washed out of the system using rapid sequential
washes. The manufacturer’s recommendations should always be
followed.
Bubbles and Plate Surface Contamination. Processing can
sometimes induce small bubbles, which can be easily overlooked.
Be sure to check wells for bubbles and eliminate them prior to
reading the plates. Make it a practice to carefully wipe the bottom
of the plate with a clean tissue before reading. Any moisture or
contamination on the bottom of the wells will affect absorbance
values.
Stephan G. Thayer and Charles W. Beard

Commercial Kit Reagents and Quality Control. Kits and
reagents should always be stored at 4 C or according to the
manufacturer’s recommendations. Always allow reagents to warm
to room temperature prior to use. Reagents from different lots of the
same test should not be used interchangeably. For the purpose of
quality control it is always helpful to maintain records of kit lot
numbers and positive and negative control values for each test type.
In addition, in-house positive controls can be developed and used to
give another measure of quality control. It is also a good quality
control practice to periodically submit groups of previously titered
sera through the lab to monitor general performance. This can be
especially helpful when training new technicians.
Correlation with HI and VN Tests
Correlation of ELISA serology with conventional HI and VN
serology can be done with adequate sample sizes comparing ELISA
geometric mean titers with geometric mean titers of the HI or VN
test. There is veiy poor if any correlation based on single sample
comparisons.
General Comments.
Interpretation of ELISA titers should only be done on a flock basis
with sample sizes of at least 20 sera per broiler flock. Thirty
samples per flock are preferred on breeder and layer flocks (30).
Mycoplasma ELISA tests should only be used for screening, and the
results must be confirmed or ruled out by HI serology, culture, or
polymerase chain reaction (PCR).

Table 47.1. Data for the calculation of the 50% endpoint of a neutralization test by the method of Reed and Muench (25).

Dilution of serum Response Accumulated values

Infectivity Ratio Percent
Numerical Log Infected Not infected Infected Not infected
ratioA infected/Total infected
1:4 10-0.6 5/5 5 0 11 4 0 11/11 100
1:16 10-1.2 4/5 4 1 6 1 6/7 86
1:64 10-1/8 2/5 2 3 2 4 2/6 33
1:256 10-2.4 0/5 0 5 0 9 1 r 0/9 0
A Number infected/number inoculated (experimental number).

Table 47.2. Test procedure using the constant-serum diluted-virus (a) method.

Tuhenn
Row no. Contents 1 2 3 4 5 6 7 8
1 Virus dilution 10-1 10-2 10-3 10-4 10-5 10-6 10-7 10-8
Amount (ml) 2.0 2.0 2.0 2.0 2.0 2.0 2.0 2.0
2 Negative Serum (ml) 0.4A 0.4A 0.4A 0.4A 0.4 0.4 0.4 0.4
3 Positive Serum (ml) 0.4 0.4 0.4 0.4 0.4B 0.4B 0.4B 0.4B
4 Unknown serumC (ml) 0.4 0.4 0.4 0.4 0.4B 0.4B 0.4B 0.4B
5 Unknown serumC
A Assuming the virus has an endpoint of 10-6 or 10-7, these can be omitted to conserve serum and embryos.
B Assuming the serum neutralizes 4 logs of virus and the virus has an endpoint of 10-6 or 10-7, these can
be omitted to conserve serum and embryos.
C An example of unknown serum might be acute and convalescent serum.

Table 47.3. Example of virus-neutralization results. A

Virus dilution (loglO) B

-1 -2 -3 -4 -5 -6 -7 -8 ID50C NI
Negative serum (virus control) 5/5 2 4/5 1/5 0/5 6.5 C

Positive serum 5/5 5/5 0/5 2.5 4.0

Unknown serum 5/5 3/5 0/5 0/5 4.2 2.3
Unknown serum 2/5 0/5 0/5 0/5 <2.8 >3.7
Unknown serum 5/5 5/5 5/5 4/5 >6.0 <0.5

A Abbreviations: ID50 = mean infectious dose, NI = neutralization index.

B Values in body of table are number dead/number inoculated.
C Titer calculated by method of Reed and Muench

228

REFERENCES
1. Alexander, D. J., W. H. Allan, P. M Biggs, C. D. Bracewell, J. H.
Darbyshire, P. S. Dawson, A. H. Harris, F. T. W. Jordan, I. MacPherson, J.
B. McFerran, C. J. Randall, J. C. Stuart, O. Swarbrick, and G. P. Wilding. A
standard technique for hemagglutination inhibition tests for antibodies to
avian infectious bronchitis virus. Vet. Rec. 113:64. 1983.
2. Allan, W. H., and R. E. Gough. A standard hemagglutination inhibition
test for Newcastle disease. 1. A comparison of macro and micro methods.
Vet. Rec. 95:120-123. 1974.
3. Allen, W. H., J. E. Lancaster, and B. Toth. Newcastle disease vaccines.
Their production and use. FAO Animal Production and Health Series, No.
10. Food and Agriculture Organization of the United Nations, Rome. 1978.
4. Anonymous. Methods for examining poultry biologies and for
identifying and quantifying avian pathogens. National Academy of Sciences,
Washington, D C. pp. 83-87. 1971.
5. Beard, C. W. Demonstration of type-specific influenza antibody in
mammalian and avian sera by immuno-diffusion. Bull. W.H.O. 42:779-785.
1970.
6. Beard, C. W., S. R. Hopkins, and J. Hammond. Preparation of Newcastle
disease virus hemagglutination-inhibition test antigen. Avian Dis. 19:692-
699. 1975.
7. Beard, C. W., and W. J. Wilkes. A simple and rapid Micro-test procedure
for determining Newcastle hemagglutination-inhibition (HI) antibody titers.
In: Proceedings of the 77th Annual Meeting U.S. Animal Health
Association, St. Louis, Mo. pp. 596-600. 1973.
8. Beard, C. W., and W. J. Wilkes. A comparison of Newcastle disease
hemagglutination-inhibition test results from diagnostic laboratories in the
southeastern United States. Avian Dis. 29:1048-1056. 1985.
9. Brugh, M A., Jr. A simple method for recording and analyzing
serological data. Avian Dis. 22:362-365. 1978.
10. Brugh, M A., Jr., and C. W. Beard. Collection and processing of blood
samples dried on paper for microassay of Newcastle disease virus and avian
influenza virus antibodies. Am. J. Vet. Res. 41:1495-1498. 1980.
11. Brugh, M A., Jr., C. W. Beard, and W. J. Wilkes. The influence of test
conditions on Newcastle disease hemagglutination-inhibition titers. Avian
Dis. 22:320-328. 1978.
12. Cottral, G. E., ed. Serology. In: Manual of standardized methods for
veterinary microbiology. Cornell University Press, Ithaca, N.Y. pp. 60-93.
1978.
13. Crowle, A. J. Immunodiffusion. Academic Press, New York. 1973.
14. Gelb, J., Jr., and C. G. Cianci. Detergent-treated Newcastle disease virus
as an agar gel precipitin test antigen. Poult. Sci. 66:845-853. 1987.
15. Glazier, R. M A simple apparatus for dark ground illumination of
precipitin lines. J. Biol. Photogr. Assoc. 34:51-52. 1966.
16. Hirai, K., S. Shimakura, and M Hirose. Immunodiffusion reaction to
avian infectious bursal virus. Avian Dis. 16:961-964. 1972.
17. Jordan, F. T. W., and R. Chubb. The agar gel diffusion technique in the
diagnosis of infectious laryngotracheitis (ILT) and its differentiation from
fowl pox. Res. Vet. Sci. 3:245-255. 1962.
18. Kabat, E. A., and Μ M Mayer. Experimental immunochemistry.
Charles C. Thomas, Springfield, Π1. 1964.
229
Chapter 47 Serologic Procedures
19. King, D. J. A comparison of infectious bronchitis virus
hemagglutination-inhibition test procedures. Avian Dis. 32:335-341. 1988.
20. Lukert, P. D., and R. B. Davis. An antigen used in the agar-gel
precipitin reaction to detect avian encephalomyelitis virus antibodies. Avian
Dis. 15:935-938. 1971.
21. McFerran, J. Β., B. Adair, and T. J. Connor. Adenoviral antigens
(CELO, QBV, GAL). Am. J. Vet. Res. 36(2):527-529. 1975.
22. Nonomura, I., and H. W. Yoder, Jr. Identification of avian Mycoplasma
isolates by the agar-gel precipitin test. Avian Dis. 21:370-381. 1977.
23. Olson, N. O., and R. Weiss. Similarity between arthritis virus and
Fahey-Crawley virus. Avian Dis. 16:535-540. 1972.
24. Ranck, F. M., Jr. An easy method for making cutters to use in the agar­
gel diffusion technique. Avian Dis. 17:870-873. 1973.
25. Reed, L. J., and H. Muench. A simple method for estimating fifty
percent endpoints. Am. J. Hyg. 27:493-497. 1938.
26. Snyder, D. B., W. W. Marquardt, and E. Russek. Rapid serological
profiling by enzymelinked immunosorbent assay. Π. Comparison of
computational methods for measuring antibody titer in a single serum
dilution. Avian Dis. 27:474-484. 1983.
27. Snyder, D. B., W. W. Marquardt, E. T. Mallinson, and E. Russek. Rapid
serological profiling by enzymelinked immunosorbent assay. I.
Measurement of antibody activity titer against Newcastle disease virus in a
single serum dilution. Avian Dis. 27:161-170. 1983.
28. Snyder, D. B., W. W. Marquardt, E. T. Mallinson, P. K. Savage, and D.
C. Allen. Rapid serological profiling using enzyme linked immunosorbent
assay. ΙΠ. Simultaneous measurements of antibody titers to infectious
bronchitis, infectious bursal disease, and Newcastle disease viruses in a
single serum dilution. Avian Dis. 28:12-24. 1984.
29. Stone, H. A., and E. A. Holly. Reliability of the agar-gel precipitin test
in Marek’s disease studies. Avian Dis. 15:939-945. 1971.
30. Thayer, S. G., P. Villegas, and O. J. Fletcher. Comparison of two
commercial enzyme-linked immunosorbent assays and conventional
methods for avian serology. Avian Dis. 31:120-124. 1987.
31. Whittemore, A. D., and J. E. Williams. Microsystem for collecting and
shipping diagnostic sera. Appl. Microbiol. 24:671-672. 1972.
32. Williams, C. A., and M W. Chase. Methods in immunology and
immunochemistry. Academic Press, New York. 3:103-374. 1971.
33. Williams, J. E. Collection of avian blood samples in microtest plates.
Avian Dis. 17:445-449. 1973.
34. Williams, J. E. Microtest methodology. In: Isolation and identification
of avian pathogens, 2nd ed. S. B. Hitchner, C. H. Domermuth, H. G.
Purchase, and J. E. Williams, eds. American Association of Avian
Pathologists, College Station, Tex. pp. 136-140. 1980.
35. Williams, J. E., and A. D. Whittemore. Serological diagnosis of
pullorum disease with the microagglutination system. Appl. Microbiol.
21:394-399. 1971.
36. Witter, R. L. The diagnosis of infectious bronchitis of chickens by the
agar gel precipitin test. Avian Dis. 6:478-492. 1962.
37. Woemle, H. The use of the agar gel diffusion technique in the
identification of certain avian virus diseases. Veterinarian 4:17-28. 1966.
 48
MOLECULAR IDENTIFICATION PROCEDURES
Daral J. Jackwood and Mark W. Jackwood

SUMMARY. Molecular identification of avian pathogens relies on the detection of nucleic acid (either RNA or DNA) unique to that
pathogen. In addition, analysis of nucleic acid sequences is being used to identify the species, subspecies, type, subtype, serotype, pathotype,
and in some cases individual strains of the disease-causing agent. Molecular diagnostic tests are based on techniques such as restriction
fragment length polymorphism, hybridization with nucleic acid probes, the polymerase chain reaction, random amplified polymorphic DNA,
and nucleic acid sequencing. Knowledge of these techniques is necessary to understand and interpret the results of molecular diagnostic tests
that are based on that technology. The information presented here is general in nature and the reader is referred to individual chapters for
agent specific molecular identification and typing tests.

INTRODUCTION also available. Most kits use a phenol-based extraction followed by

DNA consists of adenine (A), guanine (G), cytosine (C) and
thymine (T) bases, the order of which makes up the genetic code.
The bases are linked together by a sugar (deoxyribose) and
phosphate backbone, which makes up the structure of a single
strand of DNA. Hydrogen bonds between bases (A pairs with T and
G pairs with C) hold two strands of DNA together (5).
Like DNA, RNA contains bases, except that instead of T RNA
contains uracil (U). RNA is usually single stranded and is not as
stable as DNA. RNA has a ribose and phosphate backbone whereas
DNA contains a deoxyribose sugar. Messenger RNA acts as a
carrier of genetic information from DNA for the synthesis of
proteins (5).
The genetic code, or the actual sequence of bases in an organism’s
genome, is unique for all living things. Thus, once the genetic code
is ascertained, that information can be used to specifically identify a
poultry pathogen by the presence of its genome.
SAMPLE COLLECTION AND STORAGE
precipitation of the nucleic acid or a lysis procedure followed by
binding of nucleic acids to a silica-based support, usually in a
column or membrane format. After washing, the nucleic acid is
eluted from the silica-based support in the appropriate buffer.
Some of the DNA extraction methods described for identification
of avian pathogens include QIAamp DNA extraction kit (Qiagen
Inc., Valencia, CA) and DNAzol reagent (Invitrogen, Carlsbad,
CA). The most common reagent used to extract RNA from cells,
tissues and infectious agents is TRIzol (Invitrogen, Carlsbad, CA).
TRIzol is a phenol and guanidine isothiocyanate solution that
preserves RNA during lysis of cells and infectious agents. The RNA
is extracted from the TRIzol mixture with chloroform and purified
by precipitation with isopropyl alcohol according to the
manufacturer’s recommendation. Finally, some kits offer
purification of both DNA and RNA (QIAamp MinElute kits,
Qiagen, Valencia, CA).
RESTRICTION FRAGMENT LENGTH POLYMORPHISM
(RFLP)

DNA and especially RNA are extremely labile and care must be
taken to preserve the nucleic acid when collecting clinical samples
for molecular diagnostic procedures. Most clinical samples
containing infectious agents, including tissues, blood, swabs from
the upper-respiratory tract and intestinal tract, and even bone, can
be used for molecular diagnostic procedures. Fresh samples should
be kept cold or frozen to prevent lysis of the sample and subsequent
destruction of the nucleic acids by RNases and DNases.
Alternatively, clinical samples can be mixed with buffered phenol
(pH 7.4 for DNA, and pH 4.5 for RNA), which inactivates RNases
and DNases and preserves the nucleic acids. An easy method of
preserving and transporting clinical samples for molecular
diagnostic procedures is the use of Finders Technology Associates
(FTA) cards (Whatman, Middlesex, UK). The FTA cards are filter
paper cards that inactivate infectious agents and stabilize nucleic
acids. Clinical samples are applied directly to the card and allowed
to dry. The cards are easily transported without refrigeration using
the appropriate permits for transportation of biological samples.
Nucleic acid is purified from a punch taken from the FTA card.
NUCLEIC ACID EXTRACTION AND PURIFICATION
Nucleic acids (DNA and RNA) can be extracted from almost any
clinical or laboratory sample. DNA is extracted by a variety of
methods. One of the easiest methods of extracting DNA from whole
cells and bacteria (including Mycoplasma) is the boiling method.
Briefly, cells are pelleted by centrifugation, resuspended in a Tris-
EDTA buffer (pH 7.4) and heated to 100 C for 10 min to lyse the
cells. The material can be used directly in the PCR test or DNA can
be further purified by precipitation using sodium acetate (0.3M, pH
5.2 final concentration) and an equal volume of cold 100% ethanol
(E1OH). The DNA is then resuspended in the appropriate buffer.
Numerous kits for extraction of DNA from a variety of sources are
230
This technique uses restriction enzymes (REs) to determine if two
pieces of DNA are similar. REs cut double-stranded DNA at
specific sequences called recognition sites. The DNA is digested
(cut) with a particular enzyme and the resulting strands are
separated by electrophoresis according to their size. If the sizes of
the DNA strands are not identical, the pattern of bands on the gel
will not match and it can be concluded that the sequences of the two
DNA strands are different at the recognition sites. If the patterns of
the bands do match, the sequences are considered to be similar but
additional testing is needed to verify that the two pieces of DNA are
identical because REs only recognize relatively short nucleotide
sequences.
Genomic DNA isolated from an unknown disease-causing agent
can be used to identify a specific bacterium, Mycoplasma or virus,
by comparing the RFLP pattern with reference standards. If the
disease-causing agent to be detected contains an RNA genome,
which is the case with many viruses, the RNA can be converted to
DNA using the technique of reverse transcription (RT). When RT
is followed by amplification of the DNA by the polymerase chain
reaction (PCR), sufficient DNA can be obtained to generate RFLP
data (see the section on PCR). This technique is commonly referred
to as RTZPCR-RFLP.
In some cases, identification of a disease-causing agent is possible
by simply looking for the presence or absence of an RE recognition
site or a combination of RE recognition sites. The assay is
conducted exactly like an RFLP except that the sizes of the
resulting DNA fragments are insignificant. The result is positive if
the DNA is cut at any location. Thus, any reduction in size of the
original DNA molecule is indicative of the presence of an RE
recognition site. The technique is usually conducted on short pieces
of DNA that were generated using RT/PCR and has been commonly
called RT/PCR-RE.

HYBRIDIZATION AND NUCLEIC ACID PROBES
The basic mechanism behind nucleic acid probe-based diagnostic
tests is hybridization. It involves base pairing (hydrogen bonding)
of complementary sequences (G with C and A with T, or U) of
DNA or RNA (3).
In a hybridization assay, the nucleic acid must be single stranded.
Denaturation of the nucleic acid into single strands is usually
accomplished by heating or chemical treatment of the sample. Then
the denatured nucleic acid is bound to a solid support (nitrocellulose
or nylon filter). Next, a single-stranded nucleic acid probe is mixed
with the nucleic acid bound to the filter, utilizing conditions that
favor hybridization (3).
Conditions that can influence whether two strands of nucleic acid
will hybridize, are known as stringency (3). High stringency
conditions require that the base pairing between two complementary
sequences be an exact match. Low stringency conditions will allow
for some base pair mismatches between the two nucleic acid
sequences. The reaction conditions that affect hybridization are the
type of nucleic acid involved in the hybridization (base pairing
between two strands of DNA is not as strong as DNA-RNA base
pairing), the length of the nucleic acid sequence (a greater number
of complementary base pairs will hybridize more strongly than a
lesser number), and the base composition of the nucleic acids (G-C
base pairing is stronger than A-T or A-U base pairing). The
temperature of the reaction mixture and the ionic strength of the
hybridization buffer (both affect hydrogen bonding between bases)
also affect hybridization.
Nucleic acid probes exist for almost all pathogens important in
veterinary medicine. They are available from research laboratories,
where they are used as experimental tools, or from commercial
sources. In some cases, these commercial sources have
incorporated probes into diagnostic tests. A nucleic acid probe is a
single-stranded fragment of DNA or RNA that has been labeled so
that it can be detected following a hybridization reaction. Because
unique regions exist in the sequence of bases in all organisms, a
complementary nucleic acid probe can be prepared such that it
hybridizes only to that unique region and specifically detects the
disease-causing agent (6).
There are many ways to obtain and label nucleic acid probes (3).
Typically a gene from the organism that is to be detected must be
isolated then labeled with either a radioisotope or with
nonradioactive substances. Nonradioactive labels are more
attractive than radioisotopes for use in diagnostic tests because they
are not as hazardous to handle and can be stored for long time
periods. Two of the most frequently used labels are biotin and
digoxigenin. Probes labeled with biotin are detected by a
streptavidin-alkaline phosphatase (or other enzyme) conjugate and
the appropriate substrate to produce a color reaction similar to an
enzyme-linked immunosorbent assay (ELISA) reaction. For
digoxigenin-labeled probes, an anti-digoxigenin antibody
conjugated with various enzymes can be used with the appropriate
substrate to produce a color reaction. When anti-digoxigenin
antibodies are conjugated to enzymes such as alkaline phosphatase,
a chemiluminescent substrate can be used, which emits light that
when exposed to X-ray film provides a very sensitive detection
method.
Oligonucleotides, which are short (usually 30-40 nucleotides long)
synthetically manufactured single-stranded DNA fragments, can be
labeled and used as probes. RNA can also be labeled and used as a
probe.
231
Chapter 48 Molecular Identification Procedures
POLYMERASE CHAIN REACTION (PCR)
One of the most significant developments in molecular biology,
and the basis of numerous new diagnostic tests for poultry disease­
causing agents is PCR. Stated simply, PCR amplifies very small
quantities of DNA to detectable levels (1). The reaction uses Taq
polymerase, a DNA polymerase that is stable at high temperatures,
to amplify the genome of the disease-causing agent. DNA
polymerase is the enzyme that synthesizes new strands of DNA. It
is important that it survive high temperatures because the first step
in the PCR is heating the reaction to 95 C. Typically, there are
three steps in the PCR, which are repeated 30-40 times. These steps
are denaturation at 95 C, primer hybridization at 37-56 C, and
polymerization at 72 C. A computer-controlled temperature block
can be programmed to cycle repeatedly between these different
temperatures, making the PCR automated.
Generally, the DNA to be amplified is flanked by a pair of
synthetic primers (short pieces of DNA) that are specific
(complementary) for the template DNA to be amplified. The target
DNA is denatured by heating, and the primers are allowed to
hybridize to the DNA by lowering the temperature of the sample.
When the polymerization step is completed, the sequence between
the primers is copied, producing twice as much DNA as was
originally present in the sample. By repeating the denaturation,
hybridization, and polymerization steps many times, large amounts
of the target DNA are obtained. When reverse transcriptase, which
synthesizes DNA from an RNA template, is used in the first step of
the reaction, messenger RNA, ribosomal RNA, and the genome of
RNA viruses can also be amplified by PCR.
Diagnostic tests utilize PCR to amplify the nucleic acid of disease­
causing agents that are present in small numbers, thereby increasing
the sensitivity of the test. Then, the amplified DNA can be further
analyzed with a specific nucleic acid probe, or by RE analysis,
RFLP analysis, or DNA sequencing.
REAL TIME PCR
Real time PCR utilizes a thermocycler that contains a
spectrophotometer to measure amplification of the PCR product
during the PCR run. Fluorescent dyes that bind to the amplified
DNA are included in the reaction mixture and fluorescent
monitoring occurs at each of the PCR cycles allowing detection of
the amplified product in real time. Several methods of monitoring
fluorescence have been reported but the most commonly used are
SYBR green, TaqMan® probes, and fluorescence resonance energy
transfer (FRET). SYBR green is a chemical that fluoresces when it
interacts with double stranded DNA. During each PCR cycle, new
DNA is synthesized and is available to bind the SYBR green
molecule. Thus, as the amount of DNA increases, so does the
amount of SYBR green fluorescence. Fluorescence readings are
taken at the end of each PCR cycle.
TaqMan® probes and FRET utilize fluorescently labeled DNA
probes specific for the target-amplified sequence. TaqMan® probes
have a fluorophore and a quencher attached to either end of a probe.
When the probe is intact, the quencher molecule prevents
fluorescence from the fluorophore molecule. During PCR the probe
hybridizes to the template. Then the 5’ exonuclease activity of the
Taq polymerase destroys the probe as it synthesizes a new
complementary strand of DNA. This releases the fluorophore from
the quencher and fluorescence is detected by the spectrophotometer.
Increasing amounts of DNA made during each PCR cycle, are
detected by the hybridization of more probes and their subsequent
destruction which leads to an increase in fluorescence.
The FRET technology uses two probes a donor probe conjugated
to fluorescein isothiocyanate (FITC) and an acceptor probe
conjugated to a red dye. Several red dyes are available including
red 610nm, 640nm, 670nm and 705nm, Because the FITC and red
Deral J. Jackwood and Mark W. Jackwood
dye must be physically close to each other for FRET to occur, when
the donor and acceptor probes are present in solution and not
hybridized to a template, no signal is detected. The probes are
designed to hybridize to the amplified PCR product such that the
FITC and red dyes come into close proximity to each other. A
470nm light source excites FITC on the donor probe, which emits
energy that is transferred to the red dye on the acceptor probe. The
red dye then emits light at a specific wavelength that is detected by
the spectrophotometer. Since four different red dyes are available,
four probe pairs could be used in a multiplex real-time PCR
reaction. During the annealing phase of each PCR cycle the probes
are annealed to the denatured product and fluorescence is measured.
These probes are not destroyed during the polymerization phase of
the PCR cycle as they are in the TaqMan® method. Increasing
amounts of DNA produced during each PCR cycle, allows more
probes to hybridize and consequently more FRET signal. This
fluorescence signal is detected at the end of each annealing phase of
the PCR cycle.
Real time PCR data is generally plotted as fluorescent units per
PCR cycle number. A threshold value of fluorescence is set to
indicate when the sample is considered positive and the number of
cycles needed for a sample to cross the threshold is reported as the
cycle threshold or CT value.
After PCR amplification, reactions that utilize SYBR green or
FRET can be analyzed by melting curve analysis. Melting curve
analysis determines when the double stranded amplified product
denatures into single strands or when the probe dissociates from the
amplified product. Melting curve analysis can be added to the end
of the PCR run and, since it is sequence dependent, can be used to
verify the PCR product.
Real time PCR can also be quantitative. Measuring the increase in
fluorescence over time provides a mechanism to determine the
efficiency of the reaction, which in turn can be used to quantify the
starting template. Quantitative real-time PCR and quantitative real­
time RT-PCR are important because they can be used to determine
the quantity of nucleic acid present, which gives an indication of the
amount of infectious agent in the sample.
RANDOM AMPLIFIED POLYMORPHIC DNA (RAPD)
The RAPD technique, also known as arbitrarily primed
polymerase chain reaction (AP-PCR), was developed by Williams
et al. (9) and Welsh and McClelland (7). This PCR technique uses
short primers with arbitrary sequence to randomly amplify regions
of DNA. These randomly amplified DNA fragments are separated
by electrophoresis and the resulting patterns are markers for regions
of the target DNA.
To conduct the RAPD technique, the target genomic DNA is
amplified using a single oligonucleotide primer that has an arbitrary
sequence. This primer is usually 10-12 nucleotides in length, but
longer primers have been used. The PCR used to generate the
RAPD is conducted under typical conditions. The reaction products
are dependent on the primer sequence, primer length, and reaction
conditions of the PCR. When the primer and PCR reaction
conditions are held constant, RAPD markers are very reproducible
and characteristic of the target DNA.
The RAPD technique was initially used to generate markers for
genetic mapping of quantitative trait loci and genetic diagnosis in
plants and animals (8). More recently, RAPD markers have been
used to identify poultry pathogens. The RAPD technique has great
potential for identification of poultry pathogens with complex DNA
genomes because it does not require knowledge of the target DNA
sequence (8, 9). A comprehensive review of the RAPD analysis has
been published (8).
NUCLEIC ACID SEQUENCING
Nucleic acid sequencing is a method whereby the order of the
nucleotides (A, C, G, and T) in a nucleic acid segment is
determined. Sanger dideoxynucleotide chain termination
sequencing is the standard sequencing method used in most
laboratories (4). Nucleic acid sequencing has been automated.
Although the equipment is expensive and a certain level of expertise
is required, nucleic acid sequencing is available through numerous
commercial companies.
Sequencing provides a method of specifically identifying
microorganisms based on the actual sequence of their genome.
Nucleic acid sequencing coupled to PCR or RT-PCR can be an
extremely sensitive as well as a specific diagnostic technique.
Sequence data can be compared against the National Center for
Biotechnology Information sequence database (GenBank,
http://www.ncbi.nlm.nih.gov/) using the BLAST (Basic Local
Alignment Search Tool) program. The BLAST program compares
nucleotide or protein sequences to the sequences in the databases
and calculates a statistical similarity, which can be used to identify
the infectious agent.
Sequence data can also be used to generate phylogenetic trees,
which show the relationship between two or more closely related
organisms presented as a percent similarity between the nucleotides
or amino acids. There are rooted and unrooted trees and several
different methods used to identify evolutionary distance
relationships among sequences. Several of the more commonly
used methods include the unweighted pair-group method using
arithmetic averages (UPGMA), Neighbor joining method, minimum
evolution method and maximum parsimony methods (2). Because
these methods are statistical estimates of evolutionary relationships,
confidence intervals are often calculated using bootstrap variances
and covariances.
REFERENCES
1. Erlich, H. PCR technology. Stockton Press, New York, N.Y. 1989.
2. Nei, M, S. Kumar. Molecular evolution and phylogenetics. Oxford
University Press. New York, N.Y. 2000.
3. Sambrook, J., E. F. Fritsch, and T. Maniatis. Molecular cloning a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, New
York, N.Y. 1989.
4. Sanger, F., S. Nicklen, and A R. Coulson. DNA sequencing with chain­
terminating inhibitors. Proc. Natl. Acad Sci. 74:5463-5467. 1977.
5. Stryer, L. Biochemistry, 2nd ed W. H. Freeman and Co., San Francisco,
Calif. 1981.
6. Tenover, F. C. Diagnostic deoxyribonucleic acid probes for infectious
diseases. Clin. Microbiol. Rev. 1:82-101. 1988.
7. Welsh, J., and M McClelland Genomic fingerprinting using arbitrarily
primed PCR and a matrix of pairwise combinations of primers. Nucleic
Acids Res. 19:5275-5279. 1991.
8. Williams, J. G. K., Μ K. Hanafey, J. A. Rafalski, and S. V. Tingey.
Genetic analysis using random amplified polymorphic DNA markers.
Methods Enzymol. 218:704-740. 1993.
9. Williams, J. G. K., A. R. Kubelik, K. J. Livak, J. A. Rafaiski, and S. V.
Tingey. DNA polymorphisms amplified by arbitrary primers are useful as
genetic markers. Nucleic Acids Res. 18:6531-6535. 1990.
 49
ANTIGEN DETECTION SYSTEMS
Mary J. Pantin-Jackwood and Sandra S. Rosenberger

SUMMARY. Infectious agents or their constituent parts (antigens or nucleic acids) can be detected in fresh, frozen, or fixed tissue using a
variety of direct or indirect assays. The assays can be modified to yield the greatest sensitivity and specificity but in most cases a particular
methodology is chosen based on the nature of the sample, availability of equipment, quality of reagents, time, cost, and technical expertise.
Whole virions or bacteria can be visualized directly using electron microscopy. Although this procedure can be performed quickly, it is
insensitive and requires specialized equipment and technical support. Some tests such as agglutination reactions or immunodiffusion assays
are simple and inexpensive but they can only be used to identify a particular etiologic agent possessing agglutinating or soluble antigens,
respectively. The more cumbersome techniques such as antigen-capture enzyme-linked immunosorbent assay, immunohistochemical
staining, or in situ hybridization offer increased sensitivity and specificity but may require better quality reagents, additional pretreatment
procedural steps prior to testing, and a higher level of technical training. To optimize antigen detection systems for diagnostic and research
purposes it is as important to become familiar with the limitations of the assays as it is to understand the pathogenesis of the suspected
etiologic agent in selecting the timing and type of tissue samples for testing.

INTRODUCTION
The detection of infectious agent antigens directly in clinical
specimens has become an important component of the diagnostic
methodology. Antigen detection methods can provide diagnostic
information within a few hours of the receipt of die specimen in the
laboratory; this, and the lack of requirement of the infectious agent
viability, is an important advantage over viral or bacterial culture,
especially when the specimen transport time is prolonged or
otherwise suboptimal (82). A variety of antigen detection systems
for avian pathogens have been developed or modified over the past
years. The best antigen detection system should be both sensitive
and specific. Sensitivity is measured by the ability to detect very
small amounts of antigen. Increasing the sensitivity of a test system
will decrease the number of false negative samples. Specificity is
measured by the ability to detect a particular antigen while limiting
nonspecific reactions or cross reactions with related antigens.
Increasing the specificity of a test system will decrease the number
of false positive samples. However, many antigen detection systems
are chosen based on technical reasons such as reagent or equipment
availability, length of time for test procedure, cost per test,
automation, environmental or safety requirements, and technical
difficulty.
This chapter will discuss several common techniques used to
detect antigens to various pathogens that infect birds. A general
overview of each protocol will be presented, along with some
current references giving various technical options that may be
useful in developing the appropriate test system for an individual
laboratory.
ELECTRON MICROSCOPY
Electron microscopy (EM) is a valuable tool especially in the
diagnosis of viral infections when applied judiciously and used in
conjunction with other diagnostic tests (48). EM has several
advantages as a viral diagnostic procedure; in some cases, such as
for diagnosis of enteric viruses, is the method of choice. It is
relatively simple and rapid. It can be applied to the diagnosis of any
productive viral infection without prior knowledge of which agent
is present to guide the reagent selection, and it does not require the
presence of viable virions (48). In contrast, culturing techniques
may be unsuccessful because improper specimen handling may
have rendered the sample inviable or because some viruses are
difficult or impossible to grow in cell culture. Similarly, diagnostic
tests that use immunological reagents detect only the agent which
they are directed and will miss unsuspected viruses. Furthermore,
antibodies are not available for all viruses. EM also has several
useful applications in the examination of virus-infected cell culture.
If a distinctive cytopathic effect (CPE) is present, EM can be used
233
to confirm the presence of the expected virus, but is of even greater
use in situations in which a virus infection is suspected but no CPE
is produced. Also, EM is very useful for monitoring all cell culture
stocks for adventitious viruses and mycoplasmas that can
contaminate cultures (48).
The disadvantage of using EM is the availability of the microscope
and support staff. EM also has drawbacks in sensitivity and
specificity that limit application. A fairly high concentration of
virus is necessary for visualization by negative staining of fluids,
although immune electron microscopy (IEM) can increase
sensitivity. In thin sections, if the infection is not widespread,
virions may be missed because of sampling error. Analysis based
solely on morphology cannot differentiate between viruses in the
same family, although IEM can sometimes overcome this problem
as well (48).
Sample transport between the clinician and the electron
microscopist is important to assure that the specimens arrive in
optimal condition. Liquids should not be frozen and tissues should
be fixed in 2-5% glutaraldehyde in buffer immediately and stored
cold during transport (48). If no samples have been properly
collected for EM, formalin fixed, paraffin-embedded tissues can
still be used.
Negative staining
Simplicity and rapidity, coupled with high resolution, have
ensured that the negative staining technique is of major importance
in virus diagnosis. However direct EM is relatively insensitive with
a critical lower detection limit of approximately ΙΟ6-107 virus
particles per milliliter. The development of airfuge
ultracentrifugation of samples directly onto transmission EM grids
has greatly improved antigen detection (30). Negative staining
techniques using phosphotungstic acid and uranyl acetate are used
to increase contrast, but in some cases viruses or bacteria may lose
identifying projections and may be too widely spaced on the grids
or among debris to make positive identification. Tissue samples
should be fixed, embedded and sectioned for visualization of
viruses (48). The best method for virus detection in cultured cells is
thin sectioning, although negative staining can be used to examine
the supernatant from the cell culture.
Immune Electron Microscopy
The sensitivity of direct EM can be increased by the addition of
highly specific polyclonal or monoclonal antisera following
clarification but prior to centrifugation (see Chapter 34 on Enteric
viruses). This procedure has been termed immune EM (IEM). The
antigen-antibody complexes formed require only low-speed
centrifugation for placement on grids. Alternatively, antibody may
be bound directly to the film coating of the grids forming a surface
to capture antigen (22). An indirect protein A-gold IEM test has
Mary J. Pantin-Jackwood and Sandra S. Rosenberger
proven to be a rapid sensitive method for detection of enteric
coronaviruses (20). IEM has been used to identify unknown viruses
by the use of convalescent sera, or to specifically serotype viruses
(5,48).
HEMAGGLUTINATION (HA) TEST
Hemagglutinins are glycoproteins expressed on the surface of
many disease-causing agents. Hemagglutinins can easily be
detected by addition of red blood cells from a species that carries
complementary receptors (22). However, some infectious agents,
such as infectious bronchitis virus (IBV), may require pretreatment
with enzymes to expose surface hemagglutinins (71) (see Chapter
32 on infectious bronchitis virus).
If materials from tracheal swabs are inoculated into specific-
pathogen-free embryos the presence of a hemagglutinating agent
may be quickly detected by mixing approximately 0.05 ml of 10%
washed chicken red blood cells with approximately 0.5 ml of
harvested allantoic fluid on a glass plate (spot HA test). If
agglutination occurs, it can be verified and the particular agent may
be identified by the hemagglutination-inhibition (HI) test described
in detail in Chapter 47 on serologic procedures. Because some
bacteria may agglutinate red blood cells, bacterial contamination
should be examined by streaking the sample on microbiological
media or repeating the agglutination reaction on the fluids following
filtration through a 0.2-pm syringe-type filter prior to performing
the HA/HI tests.
IMMUNODIFFUSION
Soluble viral antigens present in tissue homogenates, egg fluids,
and tissue culture fluids, can be detected using immunodiffusion in
an agar-gel immunodiffusion (AGID) test. This test, described in
Chapter 47 on serologic procedures relies on the ability of antigen
and antibody to move through an agar matrix forming a precipitin
line. The AGID test is very simple and inexpensive. For example,
infectious bursal disease virus (IBDV)-infected bursae or
chorioallantoic membranes from reovirus-infected embryos can be
prepared as 50% (w/v) homogenates in phosphate-buffered saline
using a tissue grinder or mortar and pestle. After three freeze-thaw
cycles, the homogenate is centrifuged at low speed and the
supernatant used as a test antigen for immunodiffusion. Supernatant
fluids from infected cell cultures can also be used in this antigen
detection system. However, some antigens may not be soluble and
will not diffuse through the agar matrix or the concentration of
antigen will be below the detection limit of the test. Treatments with
detergents or concentration of antigen, respectively, may allow use
of the immunodiffusion assay, but another antigen detection method
may be more appropriate in these cases. AGID has been used for
detection of several avian viruses including adenovirus, IBDV, ATV
and reovirus. (4, 65, 70) (Chapter 29 on ATV).
ANTIGEN CAPTURE ENZYME-LINKED
IMMUNOSORBENT ASSAY (AC-ELISA)
Pathogen antigens may be detected in tissue preparations using an
adaptation of the ELISA technology discussed in Chapter 47 on
serologic procedures. This adaptation, termed antigen-capture
ELISA (AC-ELISA), has been used to detect numerous avian
pathogens including: avian influenza virus (ATV), IBDV,
enteroviruses, IBV, avian encephalomyelitis virus (AEV), West
Nile virus, adenoviruses, reticuloendotheliosis virus (REV),
reovirus, turkey coronavirus (ToCV), avian leukosis virus,
Mycoplasma, and Clostridia, (3, 8, 12, 17-19, 21, 26, 32, 33, 45, 50,
52, 54, 73, 74, 77, 85, 88, 91). AC-ELISA is a relatively simple and
quick assay providing an alternative to laboratories where histologic
samples for immunohistologic staining are not readily available.
The assay can measure live, infectious or noninfectious antigens or
234
inactivated antigens (32). AC-ELISA has been shown to be more
sensitive than the AGID test (77), but less sensitive than
conventional methods such as virus isolation in embryonating eggs
unless some initial enrichment of antigen is performed (3, 52).
Advantages of AC-ELISA include applicability to diverse
specimens and potential for automation. Laboratory instruments are
now available that can perform AC-ELISA for the detection of
antigens. The sensitivity and specificity of this antigen detection
system is directly dependent on the choice of reagents and
procedures.
Primary Capture Antibody
The basic procedure involves binding primary capture antibody to
specially designed ELISA plates through a series of steps. Coating
plates with protein A of Staphylococcus aureus (79) or an avidin­
biotin complex (32) prior to the addition of capture antibody has
been suggested to increase the antigen capture capability. The
capture antibody may be polyclonal or monoclonal antibody
depending on the purpose of die particular test system. High quality
polyclonal antiserum is more sensitive in screening samples for
antigen (33), whereas monoclonal antibody is more useful in
identifying the presence of a particular serotypic antigen (52).
However, very specific polyclonal antiserum can be prepared by
preabsorbing with low concentrations of related heterologous
antigens (3).
Antigen Binding
Following various washing steps, freshly collected tissue
homogenates or samples previously inoculated into an appropriate
culture media for enrichment (3, 52), are added to the test wells and
incubated with the appropriate capture antibody bound to the plate
surface. If the antigen is recognized by the antibody it will be
captured on the plate. Unbound antigen will be washed away.
Additional steps may be required in antigen preparation because
some antigens may need to be exposed by enzyme or detergent
treatment or precultured prior to screening (52).
Detector Antibody
After additional washing steps a secondary or detector antibody is
added. The detector antibody may be labeled directly with enzyme
such as horseradish peroxidase (89) or biotin (79), but is usually left
unlabeled in most procedures. Following incubation with unlabeled
detector antibody, enzyme-conjugated antibody is added. Once the
appropriate substrate is supplied to the test system, captured antigen
is detected by a color change recorded as optical density or
absorbance values compared to the controls. Specific antigenic
types can be detected by using monoclonal antibody in the AC-
ELISA (52, 79) or the ELISA may be altered into a competition or
inhibition assay (85).
Membrane Immunoassays
Membrane immunoassay or dot ELISA’s are variants of AC-
ELISA in which antigens or antigen-antibody complexes are
captured directly on membranes (43, 49, 82). Membrane
immunoassays are also manufactured as self-contained cassettes
that are convenient for testing single specimens. These assays are
simple enough to be used in the field and are routinely used for
diagnosis of avian influenza (14, 19, 72, 82, 90). Large amounts of
antibody can be bound to nitrocellulose, nylon membranes, or other
modified membranes greatly increasing the sensitivity and reducing
total assay time to minutes. Alternatively, the reaction of the
antibody and the sample can take place on microparticles in a tube
or cuvette. These microparticles or beads coated with antibody
serve as the solid-phase support.
Western blot analysis is another antigen detection method where
pathogen proteins are separated by electrophoresis in a
polyacrylamide gel and the transferred to a thin, synthetic

membrane that has a strong affinity for proteins. Proteins bound to
the membrane are detected by immunostaining. Because proteins
bound to the membrane are denatured, antibodies that recognize
non-linear epitopes are usually not suitable for their detection. The
main advantage of this technique is that it does not require labeling
of proteins and therefore can be applied to tissues and organs as
well as cultured cells (82). This method has been used for detection
of IBDV and Mycoplasma gallisepticum (61, 85).
IMMUNOHISTOCHEMISTRY
Immunohistochemistry (IHC) is the localization of antigens in
tissue sections by the use of labeled antibodies as specific reagents
through antigen-antibody interactions that are visualized by a
marker such as fluorescent dye, enzyme, radioactive element or
colloidal gold (1). This antigen detection system has been used to
visualize antigen in cells or tissues infected with several avian
pathogens including infectious laryngotracheitis virus (ILTV), IBV,
IBDV, adenoviruses, AIV, duck viral enteritis, Newcastle disease
virus (NDV), AEV, chicken anemia virus (CAV), reovirus, AE
virus, fowlpox virus, ToCV, ALV, Marek’s disease virus (MDV),
REV, Mycoplasma, avian pneumovirus, HEV, and others (9, 11,
15, 16, 23-25, 27, 28, 34-39, 41, 42, 46, 51, 57-60, 64, 67, 75, 78,
80, 83, 84, 86, 87, 92). A review on the use of
immunohistochemical detection of avian infectious agents can be
found in Ramos-Vara et al. (69). IHC allows for the direct
morphologic localization of an infectious agent and the correlation
with corresponding pathologic cellular changes or lesion
development if tissue samples are collected at the appropriate time
during infection. For this reason IHC is frequently used in
pathogenesis studies. With proper controls, positive findings can be
used in diagnosis of specific avian diseases. However, negative
findings should be interpreted with caution (13). A good IHC test
should be technically simple to minimize errors, inexpensive, and
allow sufficient signal amplification for easy visualization. Most
importantly, the system must be able to immunogenically detect
antigen that has been structurally altered by fixation. An advantage
of antigen detection on formalin-fixed tissues is that the same
specimen may be used for both routine histological and IHC
examination. The ability to detect antigens in fixed specimens also
enables retrospective diagnosis in cases when no longer fresh
tissues are available (29). The sensitivity and specificity of the IHC
test system may be quite variable depending on the procedures,
reagents, and so on. Consulting several text and review articles on
IHC before attempting this assay may be useful (1, 13, 29, 62).
Tissue Processing
Cell or Tissue Fixation To ensure the preservation of tissue
architecture and cell morphology, prompt and adequate fixation is
essential. However, inappropriate or prolonged fixation may
significantly diminish the antibody binding capability (1). Unfixed
cells or tissue cultures can be used for IHC but this requires that
preparations be examined quickly (9). Cells or whole tissue samples
are usually fixed in one of several ways to perform IHC. For
example, the freshly cut surface of a thymus, a sample of bone
marrow, or tracheal mucosal scrapings, may be pressed onto a
clean, degreased glass slide with a scalpel blade and removed. The
thin layer of cells left on the slide is air dried and then fixed in
acetone for 10 min (46). These slides can be stored at -20 C until
staining. Infected cells grown in tissue culture may be spotted onto
a glass slide and fixed in a similar way (89).
Certain cell antigens do not survive routine fixation and paraffin
embedding. So the use of frozen sections still remains essential for
the demonstration of many antigens. However, the disadvantage of
frozen sections includes poor morphology, poor resolution at higher
magnifications, special storage, limited retrospective studies and
tissue section cutting difficulty over paraffin sections (1).
235
Chapter 49 Antigen Detection Systems
Frozen histological sections can be used by quick freezing tissue in
isopentane pre-cooled with liquid nitrogen and then cutting on a
cryostat.
In most cases, tissues are fixed at room temperature in 10% neutral
buffered formalin for routine histological examination. If IHC is to
be done, tissues should not be kept in formalin fixatives for more
than 24—48 hr prior to processing because antigenicity can be
diminished to varying degrees (29). Formalin cross-links
polypeptides by the formation of methylene bridges, which can
mask or alter antigens. Other fixatives containing various
combinations of ethanol, formaldehyde, and glacial acetic acid or
zinc, which supposedly inhibits formaldehyde-induced cross
linking, have been used. Because certain fixatives or length of
fixation may produce variable results for a particular antigen,
procedures should be standardized for each agent to have reliable
and accurate detection systems.
Following fixation, tissues are embedded in paraffin and cut into
sections. To avoid further tissue damage, the paraffin infiltration
temperatures should not exceed 60 C (29). Tissue sections should
be mounted on slides coated with adhesive compounds such as
poly-L- or poly-D-lysine or 3-aminopropyltriethoxysilane.
Following standard deparaffinization, the slides are rehydrated and
prepared for staining.
Tissue Pretreatments Antigen Retrieval. The demonstration of
many antigens can be significantly improved by the pretreatment
with antigen retrieval (AR) reagents and procedures that break the
protein cross-links formed by formalin fixation and thereby uncover
hidden antigenic sites (1). The techniques involve the application of
heat or enzyme digestion. Sometimes, multiple antigen retrieval
methods are needed to optimize the immunodetection of antigens
(68). The majority of antibodies to bacteria, fungi, and protozoa do
not require this treatment (6).
Protease-induced antigen retrieval. The use of proteolytic
enzymes, such as proteinase K, trypsin, chymotrypsin, pepsin,
pronase and various other proteases, has been reported for restoring
immunoreactivity to antigens in tissues (1, 29, 68). The effect of the
protease-induced AR depends on the concentration and type of
enzyme, incubation parameters (time, temperature, and pH), and the
duration of fixation (68). The enzyme digestion time is inversely
related to the fixation time (68). The disadvantages of protease-
induced antigen retrieval are the rather low number of antigens for
which it is the optimal AR method, possible alteration of tissue
morphology, and possible destruction of epitopes (68). Therefore
the optimal enzyme concentration and incubation time needs to be
determined.
Heat-induced antigen retrieval. The chemical reaction between
proteins and formalin can be reversed in part by high temperature
coupled to a slightly acidic solution to enhance antigen delectability
(10). Microwave oven, pressure cooker and steamer are the most
commonly used heating methods. Other tools also include the use of
an autoclave or a water bath. A heating time of 20 min appears to be
the most satisfactoiy and cooling usually takes about 20 min (1).
Citrate buffer at pH6.0 is the most popularly used retrieval solution
and is suitable for most antibody applications. The TRIS-EDTA
buffer at pH9.0 and EDTA at pH8.0 are the second most used
retrieval solutions (1).
Blocking
Background staining. Background is one of the most common
problems in immunohistochemistry, and it can seriously affect the
interpretation of the immunologic reaction (68). Background
staining may be specific or non-specific. Inadequate or delayed
fixation may give rise to false positive results due to the passive
uptake of serum protein and diffusion of the antigen. Antibodies,
especially polyclonal antibodies, are sometimes contaminated with
other antibodies due to impure antigen used to immunize the host
Mary J. Pantin-Jackwood and Sandra S. Rosenberger
animal (1). The main cause of non-specific background staining is
non-immunological binding of the specific immune sera by
hydrophobic and electrostatic forces to certain sites within tissue
sections. This form of background staining is usually uniform and
can be reduced by blocking those sites with normal serum (1). The
increased hydrophobicity of proteins during fixation increases the
background staining in IHC procedures; therefore, prolonged
fixation in formalin or other aldehyde-based fixatives should be
avoided. Background staining from over fixation can be remedied
by post-fixation with Bouin's, Zenker's, or B5 fixatives (68). In
order to prevent non-specific biding, prior to incubation with the
primary antibody the slides should be treated with 2-5% normal
non-immune serum from an unrelated species, bovine serum
albumen, nonfat dry milk, or casein, or, if indirect staining will be
used, serum from the species in which the secondary antibody is
prepared. Polyclonal antibodies should be used as highly diluted as
possible to reduce the concentration of proteins that might bind non-
specifically (62).
Endogenous enzyme activity. Peroxidase activity naturally
present in red blood cells, granulocytes, and neurons can react with
the peroxidase staining method to produce a brown product
indistinguishable from specific immunostaining (68). Although
endogenous peroxidase activity is destroyed almost completely
during formalin fixation, pretreatment of tissues with a diluted
solution (0.003-3%) of H202 in methanol will further reduce or
completely abolish endogenous peroxidase activity (68).
Inactivation of endogenous tissue enzymes should be performed
prior to proteolytic digestion to minimize the effect of H2O2 on
tissue antigens (29). Many tissues also contain endogenous alkaline
phosphatase (AP) activity and should be blocked by the
pretreatment of the tissue section with levamisole if using AP as a
label (1). Some tissues such as liver and kidney have endogenous
biotin. To avoid unwanted avidin binding to endogenous biotin if
using biotin-avidin detection system, a blocking step is necessary
for these tissues by the pretreatment of unconjugated avidin which
is then saturated with biotin (1).
Fc receptors. False positives can occur due to cross-reactions of
secondary antibody with endogenous antibody or binding of
secondary antibody especially to inflammatory cells that have Fc
receptors on their surface (29). Fc receptors of mononuclear blood
cells can bind IgG, but this is not usually a problem with routinely
fixed paraffin-embedded tissues because Fc receptors are destroyed
during this process. The use of F(ab')2 fragments of the Igs instead
of the whole Ig molecule eliminates nonspecific background from
Fc receptors or the Fc portion of Igs (62, 68).
Autofluorescence. Autofluorescence or natural fluorescence exists
in some tissues and can cause a background problem when
fluorescent labels are used in the experiments (62). The simplest
test is to examine the tissue sections with a fluorescence microscope
prior to conducting the assay. If autofluorescence is detected in the
tissue sections, the best solution is to use enzyme or other labeling
methods (1).
Detection systems
The antigen-antibody reaction cannot be seen with the light
microscope unless it is labeled. Labels are attached to the primary,
secondary, or tertiary antibodies of a detection system to allow
visualization of the immune reaction. A variety of labels have been
used, including fluorescent compounds, enzymes, and metals (68).
The most commonly used labels are enzymes (e.g., peroxidase,
alkaline phosphatase, glucose oxidase). Enzymes in the presence of
a specific substrate and a chromogen will produce a colored
precipitate at the site of the antigen-antibody reaction. Selection of a
detection system is very important, considering that the sensitivity
of cm immune reaction will depend mostly on the detection system
used (68). Detection systems are classified as direct or indirect
methods.
236
Direct Staining. Direct staining is a one step method that involves
a labeled antibody reacting directly with the antigen in tissue
sections. This technique is short and quick. However, it is
insensitive due to little signal amplification (1). Different labels
have been used, including fluorochromes, enzymes, colloidal gold,
and biotin (68). Although for diagnostic purposes fluorochromes are
preferred, enzyme conjugates are favored because slides can be
stored for several years without loss of staining intensity. Direct
IHC requires that the primary antigen-specific antibody be labeled
with fluorescein dye or an enzyme and incubated with the tissue
sample. The primary antibody must be a high-quality polyclonal or
monoclonal antibody to minimize nonspecific binding and the
highest possible dilution that gives specific staining should be used
(29). Direct fluorescein assays (FA) have been used successfully for
many years on fresh or frozen tissues (9, 47). In the direct format, a
fluorescent label, usually fluorescein isothiocyanate (FITC) is
conjugated to the antibody that recognizes the antigen. After
staining, the specimen is viewed with epiilumination using
ultraviolet light of the wavelength needed to excite the fluorescent
label (82).
Indirect Staining. Indirect LHC is used more often than direct
IHC. Unlabeled antigen-specific primary antibody is incubated with
the tissue sample and after several washing steps, a secondary
antibody labeled with fluorescein dye, an enzyme, or biotin is
applied. The secondary antibody is usually a commercially
available antibody prepared against immunoglobulin G (IgG) of the
animal used to prepare the primary antibody (13, 29). The indirect
staining method is more complex than the direct method, but the
indirect method does not require conjugation of primary antibody
and commercially available fluorescein- or enzyme-conjugated
secondary antibodies may be used with numerous primary
antibodies. More importantly, because several secondary antibody
molecules may bind with a single primary antibody, the sensitivity
of this test is enhanced by intensifying the detection signal (29).
Avidin-biotin methods. The sensitivity of the indirect IHC test
may be further increased by using the avidin-biotin-peroxidase
complex (ABC Methods) or streptavidin-biotin-peroxidase
complex (LSAB methods). The avidin-biotin-peroxidase complex
immunostain increases sensitivity by utilizing the high binding
affinity of the B vitamin biotin for avidin, an egg white
glycoprotein. Streptavidin also binds biotin, but is produced by
bacteria and may be more suitable for detecting avian disease­
causing agents. In this detection system, unlabeled primary antibody
is incubated with the tissue sample. After washing, a biotin-labeled
secondary antibody directed against IgG of the animal used to
prepare the primary antibody is allowed to incubate on the tissue
sample. After washing, an avidin-biotin or streptavidin-biotin
complex labeled with the enzyme peroxidase is added and
following a third wash, substrate is added. This system is much
more time consuming and expensive, but it offers greater
amplification of scarce antigens. The avidin-biotin-peroxidase
complex system in conjunction with monoclonal antibody has been
shown to yield the best results for detection of some antigens (16,
57, 84).
Peroxidase anti-peroxidase (PAP) method. This method is a
further development of the indirect technique and it involves a third
layer, which is a rabbit antibody to peroxidase, coupled with
peroxidase to make a very stable peroxidase anti-peroxidase
complex (1). The sensitivity is higher and also allows for much
higher dilution of the primary antibody, thus eliminating many of
the unwanted antibodies and reducing non-specific background
staining (1).
Polymeric labeling two-step method. This method consists of a
compact polymer to which multiple molecules of enzyme and the
secondary antibody (specific for the primary antibody) are attached.
The advantages are: simplicity compared to the three-step methods,
equal or higher sensitivity than ABC or LSAB methods, and lack of

background staining because of endogenous biotin or avidin (68).
One disadvantage is that this method is usually more expensive than
ABC or LSAB methods. Numerous companies have
commercialized polymer-based detection systems (1, 68).
Tyramine amplification method. This method is more complex
and laborious and it involves an initial avidin-biotin procedure
followed by a tyramine reaction. However, the sensitivity of the
reaction is increased allowing the detection of antigens present in
very low amounts in the tissue (1).
Color of the antigen-antibody reaction. The antigen-antibody
reaction is not visible with the light microscope unless a label is
used. The most commonly used enzymes are horseradish peroxidase
(HRP) and alkaline phosphatase (AP). Each enzyme has specific
substrates and chromogens to produce a colored precipitate. Most
common chromogens impart a brown, red, or blue color to the
reaction. The choice of enzyme and chromogen will depend on
several factors (e.g., intensity of reaction, location of the antigen,
presence or absence of endogenous pigments, mounting media
used) but often is a matter of personal preference. For HRP, 3,3’
diaminobenzidine tetrachloride (DAB) is the most commonly used
chromogen, giving a brown color, and its insoluble in organic
solvents. 3-amino-9-ethylcarbazole (AEC), another chromogen for
peroxidase, produces a red color, but coversliping should be made
with a water soluble medium (the precipitate will wash out with
organic solvents). For AP, 5-bromo-4-chloro-3-
indolylphosphate/nitro blue tetrazoliumchloride (BCIP/NBT; blue
permanent media), fast red (red, aqueous mounting media), and new
fuchsin (fuchsia, permanent media) are the chromogens most
commonly used. The choice of counterstain will depend on the
color of the immune reaction. The most frequently used
counterstains are hematoxylin (blue), methyl green (green), and
nuclear fast red (red) (68).
Controls
Special controls must be included in order to test the protocols and
the specificity of the antibody. A positive control tissue is needed to
verify the protocol or procedure used (1). Ideally, tissues of a
known positive should be used as a control. A negative control
tissue is also needed to test for the specificity of the antibody
involved. Additional controls should include omission of the
primary antibody or the replacement of the specific primary
antibody by a normal serum (must be the same species as primary
antibody)(l).
IN SITU HYBRIDIZATION (ISH)
In situ hybridization (ISH) is a method of localizing unique nucleic
acid sequences within a formalin-fixed tissue section or in samples
that have been transferred to a nitrocellulose membrane (dot-blot
hybridization). Such detection is made possible by hybridization of
DNA and/or RNA targets with nucleic acid probes tagged with a
signal generating system such as fluorochrome or enzyme (53). This
nucleic acid detection system combines immunohistological
staining procedures and some basic molecular biological principles.
Detailed molecular detection procedures can be located in Chapter
48 on molecular identification procedures.
ISH is used in some diagnostic and research laboratories to
identify avian viruses (2, 6, 7, 39-41, 55, 56, 66, 76, 81). The
application of ISH techniques can be limited by their inability to
detect viral targets with low copies of DNA or RNA. However,
during the last few years, several strategies have been developed to
improve the sensitivity of ISH by amplification of either target
nucleic acid sequences before ISH by in situ PCR, or signal
detection after hybridization has been completed (e.g. signal
amplification by the use of tyramine)(63).
The availability of non-radioactive-labeled probes and
commercially available hybridization kits and reagents has
237
Chapter 49 Antigen Detection Systems
facilitated the use of ISH. Compared to immunohistochemistry, this
system can more easily detect latent infectious and antigenic
subtypes by using highly specific probes, but the required technical
expertise and cost may be prohibitive in many laboratories. The
sensitivity of ISH compared to other systems such as IHS for some
avian antigens may be questionable (2).
Tissue Preparation
Paraffin-embedded sections, frozen sections, or tissue smears are
prepared in the same way as for IHC. Fixation is critical to preserve
cellular morphology for optimal probe localization and
identification of labeled cells (6, 44). Prompt fixation or rapid
freezing will aid in retaining nucleic acids. Aldehyde fixatives, such
as formalin, cross-link DNA with histone proteins that will prevent
hybridization in a time-dependent manner.
Paraformaldehyde-based fixatives may retain more of the
histomorphologic structures. Slides that have been treated with 3-
aminopropyl-triethoxysilane have been suggested for tissue sections
used with ISH because the high temperatures and enzyme
treatments usually detach tissue from untreated slides (6, 44). As
described previously, tissues must be pretreated to increase cell
permeability and decrease background staining. Proteolytic
digestion also aids in separating proteins bound to DNA or RNA to
allow the probe access for binding. All proteolytic digestions must
be done with nuclease-free enzymes.
Probe Selection
The probe is a specific sequence of cloned or synthesized
nucleotides prepared to identify and bind a particular region of
DNA or RNA. The probes are double-stranded DNA, single­
stranded complementary RNA, often'referred to as "riboprobes",
synthetic oligonucleotides or peptide nucleic acids (62). Labeled
nucleotides are incorporated into the probe sequence or added as a
tail. Longer probes will have more incorporated labeled nucleotides
for better detection. However, the length of the probe affects the
rate of cell penetration. The use of radioactive probes, although
viewed as more sensitive, is impractical for most laboratories
because of safety and disposal problems. Non-radioactive probes
are preferred and are produced by conjugating nucleotides to
reporter molecules such as biotin, digoxigenin, or fluorescein. The
choice of any particular probe is highly dependent upon the desired
application. Regardless of the steps taken towards optimizing probe
design and performance, specimen processing and sample
pretreatment remain two of the largest sources of variability in
assay performance (31).
Hybridization
In preparation for hybridization, proteolytic enzyme reactions are
stopped by extensive wash cycles. The probe and its target must be
single-stranded for successful hybridization. Denaturation of
double-stranded DNA is usually accomplished by heating in the
presence of formamide at 92-96 C for 6-10 min. However, each
laboratory will need to assess the proper temperature that will
produce the best signal without changing the cell morphology.
Some protocols may include procedures to further permeabilize the
tissue for increased accessibility of probes. This is usually achieved
by addition of detergents (Triton X-100 or Tween-20, Sigma, St.
Louis, Mo.) to the various wash solutions (44).
For developing successful in situ hybridization procedures, the
melting temperature of the double-stranded hybrids, which is based
on the nucleotide com position, must be known and incubation
temperature controlled. Once hybridization has occurred the
unbound probe must be removed. The sensitivity and specificity of
the test is a function of how many probe molecules hybridize to the
actual target vs. nonspecific sites and how strongly the probe binds.
The set of experimental conditions such as salt concentrations and
temperature that can affect the binding properties of a related, but
Mary J. Pantin-Jackwood and Sandra S. Rosenberger
not homologous, probe is termed stringency. Under low stringency
some mismatch of nucleotides between the target and probe is
allowed, whereas under high stringency very few mismatched pairs
will form (44).
Immunohistologic Staining
Once hybridization occurs and all unbound probe is washed away,
the antigen is detected by visualizing the labeled probe. This can be
done directly or indirectly as described in ISH. In the direct method,
biotin-labeled probes are detected by adding streptavidin conjugated
to an enzyme and then incubation with appropriate substrate. More
amplification of the signal can be obtained by using the indirect
method and a monoclonal anti-biotin antibody in the first step (6).
This is followed by biotinylated anti-mouse IgG, which increases
the amount of biotin associated with the probe. Streptavidin
conjugated to an enzyme is then added, which binds to all available
biotin amplifying the antigen detection signal. Probes labeled with
digoxigenin and detected by anti digoxigenin-alkaline-phosphatase
conjugate have also been used in the indirect detection system (66).
Another type of probe has been developed using fluorescein that is
detected by anti-fluorescein-alkaline-phosphatase conjugate. It is
thought that the latter method may further reduce nonspecific
reactions because fluorescein is not a naturally occurring
component of the host system (44).
Controls
ISH has several trouble spots; therefore, several issues must be
addresses in adopting a protocol (53). The design and use of
positive and negative controls specific for a particular ISH protocol
is very important. Some controls relate primarily to the staining and
signal generating system and others to the hybridization (53).
REFERENCES
1. IHC World. Online Information Center for Immunohistochemistry.
http://www.ih cworld. com
2. Abbas, F., J. R. Andreasen, Jr., and M W. Jackwood. Development of a
polymerase chain reaction and a nonradioactive DNA probe for infectious
laryngotracheitis virus. Avian Dis. 40:56-62. 1996.
3. Abdelmoumen, Β. B., and R. S. Roy. An enzyme-linked immunosorbent
assay for detection of avian mycoplasmas in culture. Avian Dis. 39:85-93.
1995.
4. Adair, Β. Μ, K. Bums, and E. R. McKillop. Serological studies with
reoviruses in chickens, turkeys and ducks. J Comp Pathol 97:495-501. 1987.
5. Alexandrov, M, R. Alexandrova, I. Alexandrov, S. Zacharieva, S.
Lasarova, L. Doumanova, R. Peshev, and T. Donev. Fluorescent and
electron-microscopy immunoassays employing polyclonal and monoclonal
antibodies for detection of goose parvovirus infection. J. Virol. Methods
79:21-32. 1999.
6. Allan, G. M, D. Todd, J. A. Smyth, D. P. Mackie, J. Bums, and M S.
McNulty. In situ hybridization: an optimized detection protocol for a
biotinylated DNA probe renders it more sensitive than a comparable 35S-
labelled probe. J. Virol. Methods 24:181-190. 1989.
7. Arshad, S. S., L.M Smith, K. Howes, P.H.Russell, K. Venugopal, L.N.
Payne. Tropism of subgroup J avian leukosis virus as detected by in situ
hybridization. Avian Pathol. 28. 1999.
8. Balamurugan, V., J. M Katari, A. K. Tiwari, K. C. Verma, R. Toroghi,
and S. J. Jadhao. Development of sandwich ELISA for the detection of fowl
adenovirus 4 associated with hydropericardium syndrome in experimentally
infected chicken. Acta Virol. 45:95-100. 2001.
9. Bhattachaijee, P. S., C.S. Naylor,and RC. Jones. A simple method for
immunofluorescence staining of tracheal organ cultures for the rapid
identification of infectious bronchitis virus. Avian Pathol. 23:471-480. 1994.
10. Bratthauer, G. L. Processing of Tissue Specimens. In: Methods in
Molecular Biology: Immunocytochemical Methods and Protocols. L. C.
Javois, ed. Humana Press, Totowa, NJ. pp 77-86. 1999.
11. Breslin, J. J., L. G. Smith, H. J. Barnes, and J. S. Guy. Comparison of
virus isolation, immunohistochemistry, and reverse transcriptase-polymerase
chain reaction procedures for detection of turkey coronavirus. Avian Dis.
44:624-631.2000.
238
12. Burkhalter, K. L., R Lindsay, R. Anderson, A. Dibemardo, W. Fong,
and R. S. Nasci. Evaluation of commercial assays for detecting West Nile
virus antigen. J. Am. Mosq. Control Assoc. 22:64-69. 2006.
13. Cartum, R. C. Immunohistochemistry of infectious diseases. J
Histotechnology 18:195-202. 1995.
14. Cattoli, G., A. Drago, S. Maneiro, A Toffan, E. Bertoli, S. Fassina, C.
Terregino, C. Robbi, G. Vicenzoni and I. Capua. Comparison of three rapid
detection systems for type A influenza virus on tracheal swabs of
experimentally and naturally infected birds. Avian Pathol. 33(4):432-437.
2004.
15. Chen, Β. Y, S. Hosi, T. Nunoya, and C.Itakura. Histopathology and
immunohistochemistry of renal lesions due to infectious bronchitis virus in
chicks. Avian Pathol. 25:269-283. 1996.
16. Cruz-Coy, J. S., J. J. Giambrone, and F. J. Hoerr. Immunohistochemical
detection of infectious bursal disease virus in formalin-fixed, paraffin-
embedded chicken tissues using monoclonal antibody. Avian Dis. 37:577-
581. 1993.
17. Cui, Z. Z., L. F. Lee, E. J. Smith, R. L. Witter, and T. S. Chang.
Monoclonal-antibody-mediated enzyme-linked immunosorbent assay for
detection of reticuloendotheliosis viruses. Avian Dis. 32:32-40. 1988.
18. Davidson, I., M Malkinson, C. Strenger, and Y. Becker. An improved
ELISA method, using a streptavidin-biotin complex, for detecting Marek's
disease virus antigens in feather-tips of infected chickens. J. Virol. Methods
14:237-241. 1986.
19. Davison, S., A. F. Ziegler, and R. J. Eckroade. Comparison of an
antigen-capture enzyme immunoassay with virus isolation for avian
influenza from field samples. Avian Dis. 42:791-795. 1998.
20. Dea, S., and S. Garzon. Identification of coronaviruses by the use of
indirect protein A-gold immunoelectron microscopy. J. Vet. Diagn. Invest
3:297-305. 1991.
21. Dhinakar Raj, G., S. Sivakumar, K. Matheswaran, M Chandrasekhar,
V. Thiagarajan, and K. Nachimuthu. Detection of egg drop syndrome virus
antigen or genome by enzyme-linked immunbsorbent assay or polymerase
chain reaction. Avian Pathol. 32:545-550. 2003.
22. Fenner, F., P. Bachmann, E. Gibbs, F. Murphy, M Studdert, and D.
White. Laboratory Diagnosis of Viral Diseases. In: Veterinary Virology.
Academic Press, Inc., San Diego,CA. pp 237-264. 1987.
23. Fitzgerald, S. D., W. M Reed, and T. Bumstein. Detection of type Π
avian adenoviral antigen in tissue sections using immunohistochemical
staining Avian Dis. 36:341-347. 1992.
24. Fitzgerald, S. D., W. M Reed, K. A. Langheinrich, A. S. Porter, and L.
A. Lumbert. A retrospective immunohistochemical study of type Π avian
adenoviral infection in turkey, pheasant, and chicken tissues. Avian Dis.
38:78-85. 1994.
25. Fitzgerald, S. D., and A. Richard. Comparison of four fixatives for
routine splenic histology and immunohistochemical staining for group Π
avian adenovirus. Avian Dis. 39:425-431. 1995.
26. Gancz, A Y, D. G. Campbell, I. K. Barker, R. Lindsay, and B. Hunter.
Detecting West Nile virus in owls and raptors by an antigen-capture assay.
Emerg. Infect. Dis. 10:2204-2206. 2004.
27. Gilka, F., and J. L. Spencer. Immunohistochemical identification of
group specific antigen in avian leukosis virus infected chickens. Can. J.
Comp. Med. 48:322-326. 1984.
28. Guy, J. S., H.J. Barnes, A.L.G. Smith. Rapid diagnosis of infectious
laryngotracheitis using a monoclonal antibody-based immunoperoxisase
procedure. Avian Pathol. 21:77-86. 1992.
29. Haines, D. M and B. J. Chelack. Technical considerations for
developing enzyme immunohistochemical staining procedures on formalin-
fixed paraffin-embedded tissues for diagnostic pathology. J. Vet. Diagn.
Invest. 3:101-112. 1991.
30. Hammond, G. W., P. R. Hazelton, I. Chuang, and B. Klisko. Improved
detection of viruses by electron microscopy after direct ultracentrifuge
preparation of specimens. J. Clin. Microbiol. 14:210-221. 1981.
31. Harvey, R. In situ hybridization. In: Handbook of Immunochemical
staining methods. 3rd edition. M S. Boenisch, ed. DakoCytomation,
Carpinteria, CA. pp 41-43. 2001.
32. Hassan, Μ K., Y. M Saif, and S. Shawky. Comparison between
antigen-capture ELISA and conventional methods used for titration of
infectious bursal disease virus. Avian Dis. 40:562-566. 1996.
33. Hayhow, C. S., and Y. M Saif. Development of an antigen-capture
enzyme-linked immunosorbent assay for detection of enterovirus in
commercial turkeys. Avian Dis. 37:375-379. 1993.
34. Holland, M S., C. D. Mackenzie, R. W. Bull, and R. F. Silva A
comparative study of histological conditions suitable for both
immunofluorescence and in situ hybridization in the detection of

Herpesvirus and its antigens in chicken tissues. J. Histochem. Cytochem.
44:259-265. 1996.
35. Hooper, P. T., G. W. Russell, P. W. Selleck, and W. L. Stanislawek.
Observations on the relationship in chickens between the virulence of some
avian influenza viruses and their pathogenicity for various organs. Avian
Dis. 39:458-464. 1995.
36. Hussain, I., and K. V. Nagaraja. A monoclonal antibody-based
immunoperoxidase method for rapid detection of haemorrhagic enteritis
virus of turkeys. Res. Vet. Sci. 55:98-103. 1993.
37. Islam, M R., and M Khan. An immunocytochemical study on the
sequential tissue distribution of duck plague virus. Avian Pathol. 24:189-
194. 1995.
38. Jiijis, F. E., S. L. Noll, D. A. Halvorson, K. V. Nagaraja, and D. P.
Shaw. Immunohistochemical detection of avian pneumovirus in formalin-
fixed tissues. J. Vet. Diagn. Invest. 13:13-16. 2001.
39. Kapczynski, D. R., H. S. Sellers, G. N. Rowland, and M W. Jackwood.
Detection of in ovo-inoculated infectious bronchitis virus by
immunohistochemistry and in situ hybridization with a riboprobe in
epithelial cells of the lung and cloacal bursa. Avian Dis. 46:679-685. 2002.
40. Keam, L., J. J. York, M Sheppard, and K. J. Fahey. Detection of
infectious laryngotracheitis virus in chickens using a non-radioactive DNA
probe. Avian Dis. 35:257-262. 1991.
41. Liu, X., J. J. Giambrone, and E. J. Hoerr. In situ hybridization,
immunohistochemistry, and in situ reverse transcription-polymerase chain
reaction for detection of infectious bursal disease virus. Avian Dis. 44:161-
169. 2000.
42. Lockaby, S. B., F. J. Hoerr, A. C. Ellis, and M S. Yu.
Immunohistochemical detection of Newcastle disease virus in chickens.
Avian Dis. 37:433-437. 1993.
43. Lu, H. A longitudinal study of a novel dot-enzyme-linked
immunosorbent assay for detection of avian influenza virus. Avian Dis.
47:361-369. 2003.
44. Magraff, L. R., and D. Jennings-Siena. In-situ hybridization and
molecular pathology for the histotechnician. In: Proceedings of the National
Society for Histotechnology. Workshop 71. Albuquerque, NM pp 1-30.
1996.
45. McCourt, Μ T., D. A. Finlay, C. Laird, J. A. Smyth, C. Bell, and H. J.
Ball. Sandwich ELISA detection of Clostridium perfringens cells and alpha­
toxin from field cases of necrotic enteritis of poultry. Vet. Microbiol.
106:259-264. 2005.
46. McNeilly, F., G.M Allan, D.A. Moffett, and MS. McNulty. Detection
of chicken anemia agent in chickens by imunofluorescence and
immunoperoxidase staining. Avian Pathol. 20:125-132. 1991.
47. McNulty, M S., and G.M Allan. Application of immunofluorescence in
veterinary viral diagnosis. In: Recent advances in virus diagnosis. M S.
McNulty and J.B. McFerran, eds. Martinus Nijhoff, Dovdrecht, The
Netherlands, pp 15-26. 1986.
48. Miller, S. E. Diagnosis of Viral Infections by Electron Microscopy. In:
Diagnostic Procedures for Viral, Rickettsial and Chlamydial Infections. 7th
Edition. Lennette. E.H., D. A. Lennette and E. T. Lennette., eds. American
Public Health Association, Washington, DC. pp 37-93. 1995.
49. Muneer, M A., J. A. Newman, V. Sivanandan, and D. A. Halvorson. A
dot-immunobinding assay for infectious bronchitis virus. Avian Dis. 32:137-
139. 1988.
50. Nagano, Η., M Tsuchimoto, T. Hohdatsu, T. Yamagami, S. Ide, Y.
Eiguchi, Y. Tanaka, and H. Yamagishi. Enzyme-linked immunosorbent
assay for the detection of infectious bronchitis virus (IBV) antigen with
monoclonal antibody. Nippon Juigaku Zasshi 52:657-659. 1990.
51. Naqi, S. A. A monoclonal antibody-based immunoperoxidase procedure
for rapid detection of infectious bronchitis virus in infected tissues. Avian
Dis. 34:893-898. 1990.
52. Naqi, S. A., K. Karaca, and B.Bauman. A monoclonal base antigen
capture enzyme-linked immunosorbent assay for identification of infectious
bronchitis virus serotypes. Avian Pathol. 22:555-564. 1993.
53. Nardone, R. M Overview of In Situ Hybridization. In:
Immunocytochemical Methods and Protocols. L. C. Javois, ed. Humana
Press, Totowa, NJ. pp 357-414. 1999.
54. Nazerian, K., L. F. Lee, and W. S. Payne. A double-antibody enzyme-
linked immunosorbent assay for the detection of turkey hemorrhagic
enteritis virus antibody and antigen. Avian Dis. 34:425-432. 1990.
55. Nielsen, O. L., P.H. Jorgensen, M Bisgaard, and S. Alexandersen. In
situ hybridization for the detection of chicken anemia virus in
experimentally-induced infections and field outbreaks. Avian Pathol.
24:149-155. 1995.
239
Chapter 49 Antigen Detection Systems
56. Oldoni, I., C. C. Brown, D. J. King, S. Samal, and B. S. Seal. The use of
in situ hybridization and immunohistochemistry to study the pathogenesis of
various Newcastle disease virus strains and recombinants in embryonated
chicken eggs. Microb. Pathog. 39:69-75. 2005.
57. Oltishi, K., M Senda, H. Yamamoto, H. Nagai, M Norimatsu, and H.
Sasaki. Detection of avian encephalomyelitis viral antigen with monoclonal
antibody. Avian Pathol. 23:49-59. 1994.
58. Pantin-Jackwood, M J., and T. P. Brown. Infectious bursal disease
virus and proventriculitis in broiler chickens. Avian Dis 47:681-690. 2003.
59. Pantin-Jackwood, M J., E. Spackman, and J. M Day. Pathology and
virus tissue distribution of Turkey origin reoviruses in experimentally
infected Turkey poults. Vet Pathol. 44:185-195. 2007.
60. Patel, B. L., E. Gonder, and B. S. Pomeroy. Detection of turkey
coronaviral enteritis (bluecomb) in field epiomithics, using the direct and
indirect fluorescent antibody tests. Am. J. Vet. Res. 38:1407-1411. 1977.
61. Pereira, S. R., C. E. Travassos, A. Huguenim, A. C. Guimaraes, A. G.
Silva, and M. A. Guimaraes. Western blot detection of infectious bursal
disease virus infection. Braz J Med Biol Res 31:671-674. 1998.
62. Polak, J.M and S. Van Noorden. Introduction to Immunocytochemistry.
3rd. edition. Bios Scientific Publishers Limited, Oxford, UK. 2003.
63. Qian, X., L. Jin, and R. V. Lloyd. In situ hybridization: Basic approaches
and recent developments. J. of Histotechnology 21(l):53-67. 2004.
64. Radi, Z. A., D. W. Trampel, B. S. Smith, R. F. Rosenbusch, and F. Goll.
Immunohistochemical detection of Mycoplasma gallisepticum antigens in
turkey respiratory tissues. Avian Dis. 44:399-407. 2000.
65. Raj, G. D., V. Jayakumar, A. Thangavelu, A. Koteeswaran, and A. T.
Venugopalan. Immunorrheophoresis for the diagnosis of infectious bursal
disease. Avian Dis. 42:388-392. 1998.
66. Ramis, A., K.S.Latimer, F.D. Niagro, R.P. Campagnoli, B.W. Ritchie,
and D. Pesti. Diagnosis of psittacine beak and feather disease (PBFD) viral
infection, avian polyiomavirus infection, adenovirus infection and
herpesvirus infection in psittacine tissues using DNA in situ hybridization.
Avian Pathol. 23:643-657. 1994.
67. Ramis, A., J. Tarres, D. Fondevila, and L. Ferrer. Immunocytochemical
study of the pathogenesis of Pacheco's parrot disease in budgerigars. Vet.
Microbiol. 52:49-61. 1996.
68. Ramos-Vara, J. A. Technical aspects of immunohistochemistry. Vet.
Pathol. 42:405-426. 2005.
69. Ramos-Vara, J. A., F. De Piero, M Kiupel, S.D. Fitzgerald, A.J.
Bermudez,G.C. Johnson, M.A. Miller. Diagnostic immunohistochemistry of
equine and avian infectiuos diseases. Journal of Histotechnology 25 (4): 185-
198. 2002.
70. Roy, P., and A. T. Venugopalan. Agar-gel-immunodiffusion and
counter immunoelectrophoresis for diagnosis of Newcastle disease. Trop.
Anim. Health Prod. 29:231-234. 1997.
71. Ruano, M, J. El-Attrache, and P. Villegas. A rapid-plate
hemagglutination assay for the detection of infectious bronchitis virus.
Avian Dis. 44:99-104. 2000.
72. Ryan-Poirier, K. A., J. M Katz, R. G. Webster, and Y. Kawaoka.
Application of Directigen FLU-A for the detection of influenza A virus in
human and nonhuman specimens. J. Clin. Microbiol. 30:1072-1075. 1992.
73. Sapats S., G. G., L. Trinidad, L.H. Parede, C. David, J Ignjatovic. An
ELISA for detection of infectious bursal disease virus and differentiation of
very virulent strains based on single chain recombinant chicken antibodies.
Avian Pathol. 34(6):449-455. 2005.
74. Saravanan, P., Satishkumar, J. M Kataria, and T. J. Rasool. Detection
of Infectious bursal disease virus by ELISA using an antipeptide antibody
raised against VP3 region. Acta Virol. 48:39-45. 2004.
75. Selleck, P. W., S. L. Lowther, G. M Russell, and P. T. Hooper. Rapid
diagnosis of highly pathogenic avian influenza using pancreatic impression
smears. Avian Dis. 47:1190-1195. 2003.
76. Sellers, H. S., P. N. Villegas, J. El-Attrache, D. R. Kapczynski, and C.
C. Brown. Detection of infectious bursal disease virus in experimentally
infected chickens by in situ hybridization. Avian Dis. 45:26-33. 2001.
77. Shafren, D. R., and G. A. Tannock An enzyme-linked immunosorbent
assay for the detection of avian encephalomyelitis virus antigens. Avian Dis.
32:209-214. 1988.
78. Smyth, J. A., D. A. Moffett, M S. McNulty, D. Todd, and D. P.
Mackie. A sequential histopathologic and immunocytochemical study of
chicken anemia virus infection at one day of age. Avian Dis. 37:324-338.
1993.
79. Snyder, D. B., D. P. Lana, P. K. Savage, F. S. Yancey, S. A. Mengel,
and W. W. Marquardt. Differentiation of infectious bursal disease viruses
directly from infected tissues with neutralizing monoclonal antibodies:
Mary J. Pantin-Jackwood and Sandra S. Rosenberger
evidence of a major antigenic shift in recent field isolates. Avian Dis.
32:535-539. 1988.
80. Spencer, J. L., and F. Gilka. Lymphoid leukosis: detection of group
specific viral antigen in chicken spleens by immunofluorescence and
complement fixation. Can. J. Comp. Med. 46:370-375. 1982.
81. Stedman, N. L., T. P. Brown, and C. C. Brown. Localization of avian
leukosis virus subgroup J in naturally infected chickens by RNA in situ
hybridization. Vet. Pathol. 38:649-656. 2001.
82. Storch, G. A. Diagnostic Virology. In: Fields Virology. D. A. a. P. M
H. Knipe, ed., Philadelphia, PA. pp 501-505. 2001.
83. Swayne, D. E., MD. Ficken, and J.S. Guy. Immunohistochemical
demonstration of influenza A nucleoprotein in lungs of turkeys with natural
and experimental influenza respiratory disease. Avian Pathol. 21:547-557.
1992.
84. Tanimura, N., K. Tsukamoto, K. Nakamura, M Narita, and M Maeda.
Association between pathogenicity of infectious bursal disease virus and
viral antigen distribution detected by immunohistochemistry. Avian Dis.
39:9-20. 1995.
85. Thomas, C. B., and P. Sharp. Detection of antigenic variation among
strains of Mycoplasma gallisepticum by enzyme-linked immunosorbent
inhibition assay (ELISA) and Western blot analysis. Avian Dis. 32:748-756.
1988.
86. Toro, Η., V. Godoy, J. Larenas, E. Reyes, and E. F. Kaleta. Avian
infectious bronchitis: viral persistence in the harderian gland and
240
histological changes after eyedrop vaccination. Avian Dis. 40:114-1201
1996.
87. Tripathy, D. N., L. E. Hanson, and A. H. Killinger. Immunoperoxidee
technique for detection of fowlpox antigen. Avian Dis. 17:274-278. 1973.
88. Tsukamoto, K., H. Hihara, and Y. Kono. Detection of avian leukosis
virus antigens by the ELISA and its use for detecting infectious virus after
cultivation of samples and partial characterization of specific pathogen-free
chicken lines maintained in this laboratory. J. Vet. Med. Sci. 53:399-4O&.
1991.
89. Tsukamoto, K., T. Matsumura, M. Mase, and K. Imai. A highly
sensitive, broad-spectrum infectivity assay for infectious bursal disease
virus. Avian Dis. 39:575-586. 1995.
90. Wool cock, P. R, and C. J. Cardona. Commercial immunoassay kits for
the detection of influenza virus type A: evaluation of their use with poultry.
Avian Dis. 49:477-481. 2005.
91. Yagyu, K., and S. Ohta. Enzyme-linked immunosorbent assay for die
detection of infectious bronchitis virus antigens. Nippon Juigaku Zasshi
49:757-763. 1987.
92. Yilmaz, F., N. Timurkaan, and H. Bulut. Detection of infectious
laryngotracheitis virus in trigeminal ganglia by avidin-biotin complex
method in chickens: short communication. Acta Vet. Hung. 52:167-171.
2004.
 APPENDIX OF ABBREVIATIONS AND ACRONYMS USED IN THE TEXT

A/A Acid slant/acid butt in media tube (avian adenovirus)

AAF Amniotic-allantoic fluid CEO Chicken embryo Origin
AAS Avian adenovirus group Π splenomegaly CET Chick embryo tendon (cells)
AAVLD American Association of Veterinary CE-YS Chick embryo-Yolk sac route
Laboratory Diagnosticians CF Complement fixation
ABC Avidin-biotin-peroxidase complex CGD Cold Gelatin Diluent
AC Anticomplement CK Chicken kidney (cells)
AC-ELISA Antigen-capture ELISA CKC Chicken kidney cell
AE Avian encephalomyelitis CKN Chicken
AEC 3-Amino-9-ethylcarbazole CM Conditioned medium
AEV Avian encephalomyelitis virus CMGS Chopped meat-glucose-starch (media)
AFLP Amplified Fragment Length Polymorphism CNA Colistin Nalidixic Acid
AGID Agar-gel immunodiffusion (test) C/E CELLS CEF resistant to subgroup E ALV
AGP Agar-gel precipitin C/O cells CEFs susceptible to avian leukosis
Al Avian influenza viruses in subtypes A,B,C,D,E,J
AIS Avian intestinal spirochetosis COFAL Complement fixation for avian leukosis
AIV Avian influenza virus COFAR Complement fixation for avian
ALV Avian leukosis virus reticuloendotheliosis
AOAC Association of Official Analytical Chemists CPE Cytopathic effect
AP Alkaline phosphatase CRBC Chicken red blood cell
APEC Avian Pathogenic Escherichia coli CSM Charcoal-selective medium (agar)
APHIS Animal & Plant Health Inspection Service CVA Cefoperazone, vancomycin,
AP-PCR Arbitrarily primed PCR Amphotericin (agar)
APMV-1 Avian paramyxovirus serotype 1 DAB 3,3’ diaminobenzidine tetrachloride
AR Antigen retrieval DAS Diacetoxy scirpenol
ART Avian rhinotracheitis DBH Dot Blot Hybridization
BA Bordetella avium DEAE Diethylaminoethyl
BAM Bacteriological Analytical Manual DEF Duck embryo fibroblast (cells)
BCIP/NBT 5 -bromo-4-chloro-3 -indolylphosphate/ DEK Duck embryo kidney (cells)
Nitro blue tetrazoliumchloride DEL Duck embryo liver (cells)
BD Bactoagar DEPC Dethylpyrocarbonate
BDU 5'-bromo-2'-deoxyuridine DFA Direct fluorescent antibody (test)
BEF Budgerigar embryo fibroblast (cells) DHV Duck hepatitis virus
BEM Broth enrichment medium DID Double immunodiffusion (test)
BG Brilliant green (agar) DMEM Dulbecco’s modified Eagle’s medium
BGN Brilliant green supplemented with DMSO Dimethyl sulfoxide
novobiocin (agar) DNA Deoxyribonucleic acid
BGS Brilliant green supplemented with DON Deoxynivalenol
sulfapyridine or sulfadiazine (agar) DS Double stranded (DNA)
BLAST Basic Local Alignment Search Tool DSA Dextrose starch agar
BLS-3 Biosafety level 3 DSE Delayed secondary enrichment
BPL Beta Propriolactone DSSM Double-strength skim milk
BME Basal medium, Eagle’s DVE Duck virus enteritis
BPW Buffered peptone water EBA Elementary body agglutination (test)
BSA Bovine serum Albumin EDTA Ethylene diaminetetraacetic acid
BSE Bovine Spongiform Encephalopathy EDS Egg drop syndrome
BSK B arbour-Stoenner-Kelly medium EDS 76 Egg drop syndrome 76
BSS Balanced salt solution EEE Eastern equine encephalitis
C Cytosine EEEV Eastern equine encephalitis virus
CAV Chicken anemia virus EFSA European Food safety Authority
CAM Chorioallantoic membrane EID50 Mean embryo infectious dose
CAMP Christie, Atkins, and Muench-Peterson ELD50 Mean embryo lethal dose
(media) ELISA Enzyme-linked immunosorbent assay
CAT Cefoperazone, Amphotericin, ELISA-ALV ELISA for ALV
Teicoplanin agar EM Electron microscopy
CDC Center for Disease Control EMEM Eagle’s minimum essential medium
CE Chick embryo EMJH Ellinghausen-McCullaugh-Johnson-
CE-CAM Chick embryo-Chorioallantoic membrane route Harris (Medium)
CED Chick embryo dermal (cells) ERIC Enterobacterial Repetitive Intergenic
CEF Chick embryo fibroblast (cells) Consensus-based
CEK Chick embryo kidney (cells) ESB Erysipelothrix selective broth
CEL Chick embryo liver (cells) ETOH Ethyl alcohol
CELC Chick embryo liver cells EU European Union
CELO Chick embryo lethal orphan F Fusion protein
241
Appendix of abbreviations and acronyms

FA Fluorescent antibody (test) LL Lymphoid leukosis

FAdV Fowl Adenovirus L/S Leukosis/sarcoma
FBS Fetal bovine serum LPD Lymphoproliferative disease
FC Flow cytometry LPM Lithium chloride-phenyl
FCS Fetal calf serum ethanol-moxalactan (agar)
FDA Food and Drug Administration LPS Lipopolysaccharide
FFU Focus-forming unit LTR Long terminal repeat
FITC Fluorescein isothiocyanate LSAB Streptavidin-Biotin-Peroxidase complex
FRET Fluorescence Resonance Energy Transfer M Matrix protein
G Guanine MA Micro agglutination
GC-MS Mass spectral Gas Chromatography mAbs Monoclonal antibodies
GDPT Gel-diffusion precipitin test MAC MacConkey agar
GMS Gomori mehenamine silver MAC Mycobacterium avium Complex (2 species)
GMT Geometric mean titer MAC-X M. avium Complex (3 species)
GPV Goose parvovirus mCCDA Modified Charcoal Cefoperazone
GS Group-specific Deoxycholate agar
GTS Gene targeted sequencinng MD Marek’s disease
H Hemagglutinin MDEF Muscovy duck embryo fibroblast (cells)
H Flagellar antigens (chapter 10 only) MDPV Muscovy duck parvovirus
H&E Hematoxylin and Eosin MDT Mean death time
HA Hemagglutination MDV Marek’s disease virus
HBSS Hanks’ balanced salt solution MEE Multilocus enzyme electrophoresis
HE Hemorrhagic enteritis MEM Mnimum essential medium
HEV Hemorrhagic enteritis virus MG Mycoplasma gallisepticum
HI Hemagglutination inhibition MLEE Multi locus Enzyme Electrophoresis
HJ Highlands J (virus) MM Miller Mallinson media
HMN Haemophilus maintenance medium MS Mycoplasma synoviae
HNEG Hemorrhagic nephritis and enteritis of geese MSDV Marble Spleen Disease Virus
HN protein Protein with hemagglutination and mMDV Mildly virulent MDV
neuraminidase activities MLIA Modified lysine iron agar
HPAl Highly pathogenic avian influenza MOX Modified Oxford (agar)
HPLC High Pressure Liquid Chromatography MSD Marble spleen disease
HPS Hydropericardium syndrome MW Molecular weight
HRP Horseradish peroxidase N Neuraminidase
HVT Herpes virus of turkey NAD Nicotinamide adenine dinucleotide
HV Herpes virus NBT Nitroblue tetrazolium
IB Infectious bronchitis ND Newcastle disease
IBD Infectious bursal disease NDV Newcastle disease virus
IBH Inclusion body hepatitis N Neuraminidase inhibition (test)
IBDV Infectious bursal disease virus N Neutralization index (chapter 46 only)
IBV Infectious bronchitis virus NGFIS Netherlands Government Food
ICPI Intracerebral pathogenicity index Inspection Service
ICTV International Committee on the NP Non-producer
Taxonomy of Viruses NPIP National Poultry Improvement Plan
ID50 Mean infective dose NVSL National Veterinary Services Laboratory
IDU 5’-iodo-2’-deoxyuridine O Somatic antigens (chapter 10 only)
IEM Immune electron microscopy OIE Office International des Epizooties
IF Immunofluorescence ONPG OrrAo-Nitrophenyl-p-galactoside
IFA Indirect fluorescent antibody (test) PALCAM Polymyxin-acriflavin-lithium chloride-
IgG Immunoglobulin G ceftazidime-esculin-mannitol (agar)
IgM Immunoglobulin M PAS Periodic Acid Schiff
HIS Immunohistochemical staining PBFD Psittacine beak and feather disease
IIF Indirect immunofluorescence PBS Phosphate-buffered saline
ILT Infectious laryngotracheitis PBS-B-G PBS with BSA and gelatin
ILTV Infectious laryngotracheitis virus PCR Polymerase chain reaction
IM Intramuscular PD Proportionate distance
π* Immunoperoxidase PD Protective Dose (Chapter 46)
ISH in situ hybridization pd50 Mean protective dose
ISHH in situ hybridization histochemistry PEA Phenylethyl alcohol agar
ISO International Standards Organization PEMS Poult enteritis mortality syndrome
IV Intravenous PFGE Pulse Field Gel Electrophoresis
IVPI Intravenous pathogenicity index PFU Plaque or pock forming unit
LA Latex agglutination (test) PI Post inoculation
LD50 Mean lethal dose PID50 Mean poultry infectivity dose
LH Lactalbumin hydrolysate PLB Pagano Levin Base media
LI Lysine iron PM Phenotypic mixing (chapter 35 only)
LJ Lowenstein-Jensen agar PM Pasteurella multocida
242
 Appendix of abbreviations and acronyms

PRN Plaque reduction neutralization (test) RNP Ribonucleic protein

PSI Pounds per square inch RO Reverse osmosis
PTA Phosphotungstic acid RIF Resistance inducing factor (test)
PVK Pierce-Van Der Kamp (stain) RSV Rous sarcoma virus
QBV Quail Bronchitis Virus RT Reverse transcriptase
RAPD Random amplified polymorphic DNA RT-PCR Reverse transcriptase-polymerase chain
RAV-O Rous-associated virus reaction
RBC Red blood cell RV Rappaport-Vassiliadis (broth)
REs Restriction enzymes SC Subcutaneous
REA Restriction enzyme analysis SDS Sodium dodecyl sulfate
RFLP Restriction fragment length polymorphism SE Salmonella enteritidis
REO Avian reovirus SHS Swollen head syndrome
REV Reticuloendotheliosis virus SIM Sulfide-indole-motility (medium)
RNA Ribonucleic acid SP Sample-positive ratio
rRNA Ribosomal RNA SPA Serum plate agglutination
SPF Specific-pathogen-free
SPG Sucrose-phosphate-glutamate
SPGA Sucrose-phosphate-glutamine albumin
SSA Stunting syndrome agent
T Thymine
TBE Tris borate Buffer
TBS Tri-buffered saline
TBTB Tris-buffered tryptose broth
TC Tissue culture
TCoV Turkey coronavirus
TCID Tissue culture infective doses
TCID50 Mean tissue culture infective dose
TEys Turkey embryo yolk sac
TEM Transmission electron microscopy
TME Turkey meningoencephalitis *
THEV Turkey Hemorrhagic enteritis virus
TLC Thin layer chromatography
TM/S Supplemental test medium without NAD
TM/SN TM/S supplemented with NAD
TPB Tryptone phosphate broth
TSA Tryptic soy agar
TS Triple sugar iron
TT Tetrathionate (broth)
TTC 2,3,5-triphenylterazolium chloride
TOC Tracheal organ culture
TV Trypsin and versene
TVH Turkey viral hepatitis
U Uracil
UPGMA Unweighed paired group method
Using arithmetic averages
USDA United States Department of Agriculture
UV Ultraviolet (light)
UVM University of Vermont
vMDV Very virulent MDV
VN Virus neutralization (test)
wMDV Very, very virulent MDV
w+MDV Greater virulence than wMDV
WBP Whole blood plate
WEE Western equine encephalitis
WN West Nile
XLD Xylose-lysine-desoxycholate (agar)
XLDN XLD supplemented with novobiocin
XLT4 Xylose-lysine-tergitol 4 (agar)

243
 QUICK REFERENCE DIAGNOSTIC CHART: BACTERIAL and FUNGAL DISEASES, MYCOTOXINS

Molecular Serogrouping, serotyping,

Pathogen CH Preferred Isolation method or diagnostic test Host Serology
Diagnosis speciation, pathogenicity
A. gallinarum 4 Isol. BA, DSA not useful
Serotyping: PAGE (Aggl. or
A. para­ Isol. BA (with Staph nurse culture), CE-YS, HI), KUME (HI using
6 HP2-PCR HI
gallinarum Ckn inoc. treated bacterial cells and
rbcs), ERIC PCR
B. avium 5 Isol. MAC ELISA and MA
1. Wet smears and microscopy
Borrelia anserina 8 Aggl., FA
2. Isol. BSK, Ckn inoc, CE-YS, TE-YS
AGID, ELISA,
Brachyspira sp. 8 Isol. BA, anaerb. 2S-N-D-PCR
MA, IFA
1. mouse bioassay
C. botulinum 13 PCR not useful
2. Isol. CMGS, CGD
1 Isol. TPA with glucose and yeast (anaerb)
C. colinum 13 CF
2 FA, AGID
1. Isol. BA (anaerb), PEA Toxin typing: Multiplex
C. perfringens 13 not useful
2. FA PCR
PCR, DNA Phenotypic and molecular
Campylobacter 7 Isol. Campy-cefex, CVA, mCCDA not useful
probes based typing
1. Isol. CC confirmed FA;
Chlamydophila 16 2. Isol. CE-YS; confirmed PCR CF, LA, EBA
3. Histo staining
Serogrouping (0 antigen)
E. coli 3 Isol. MAC, and TSI, SIM, BA and serotyping (0 and not useful
Flagellar &/or capsular Ag)
Antigenic typing by mouse
E. rhusopathiae 9 Isol. BA, MAC or TSI (CO2) PCR not useful
protection test
G. anatis b.
4 Isol. BA, DSA not useful
haemolytica
1. Isol. BA, 35 C.
2. USDA method: UVM sei. Enrichment, MOX
DNA probes, Speciation by DNA-DNA
Listeria mono­ and LTM plating. NGFIS method: prim,
10 Real time- hybridization, MLEE, not useful
cytogenes enrichment: PALCAM broth, Sec. Enrichment:
PCR RFLP, PFGE
PALCAM plate, microaerobic.
3. FA
1. Isol. LJ media
Molecular Typing: Aggl. ELISA,
Mycobacterium 14 2. Stained smears: Acid Fast Tuberculin
probes, PCR PFGE, RFLP
3. Fluorochrome stain
PCR, Gene
Mycoplasma 15 Isol. Frey, PPLO medium, plate on Agar, targeted FA, IFA SPA, ELISA, HI
sequencing
Ornithobacterium 17 Isol. BA Serotyping by AGID ELISA
Somatic serotyping: GDPT,
Pasteurella 4 Isol. BA, DSA capsular serogrouping: ELISA
passive hemAggl.
R. anatipestifer 4 Isol. BA or TSB with yeast (CO2) Serotyping: plate Aggl. ELISA
Serogrouping: somatic O-
1. Isol, using selective enrichment (eg TT), non DNA probes,
group antigen Aggl., WBPT, tube
selective pre-enrichment (eg BPW), selective PCR,
Salmonella 2 followed by single factor Aggl., micro
plating (BGN, XLT4, Rambach), and DSE (7 d) magnetic bead
Aggl.; Serotyping: Aggl., ELISA
2. AC-ELISA systems, etc.
microtube Aggl. test
Staphylococcus 11 Isol BA not useful
Streptococcus,
12 Isol BA, MAC FA, Aggl. not useful
Enterococcus
Y pseudo­
4 Isol. TSA or BA serotyping by Aggl. not useful
tuberculosis
Mycotoxins 18 TLC, HPLC, GC-MS, ELISA
1. Isol. SDA or PDA, direct microscopy
Aspergillus 18 not useful
2. Histo (PAS)
Dactylaria 18 Isol. SDA, direct microscopy not useful
Candida 18 Isol. PLB, micropscopic exam not useful
Favus 18 Isol. SDA, microsc. Exam not useful

244
 QUICK REFERENCE DIAGNOSTIC CHART: VIRAL DISEASES

Molecular Serogrouping, serotyping,

Pathogen CH Preferred Isolation technique/Diagnostic test Host Serology
Diagnosis speciation, pathogenicity

1. Isol. CEK, TEK, CKC, followed by FA or EM HI (EDS),

Adenovirus 19 2. DEK for EDS, followed by HA, and HI ISH Sub-typing: REA, PCR, SN ELISA, IFA,
3. TCEM or ELISA for Ag detection in tissues AGID

1. Isol, by inoc newborn mice IC

Arbovirus (EEE,
40 2. Isol CEF, DEF, Vero, BHK21, RK13 cells; CF, PCR PRN, HI, ELISA
WEE, HJ, TME)
IFA, PRN, VN

1. See 1. under DHV 1

Astrovirus
37 2. Isol. CE-YS or DE-YS; death, neutralization
(DHVII)
3. TEM
RT-PCR,
multiplex RT-
Astrovirus (enteric) 34 1. Isol. CEL, followed by EM, FA, AGID VN, ELISA
PCR, ISH,
rRT-PCR
Avian
1. Isol. CE-AS, HA activity, VN
Paramyxovirus 30 Serotype ID: HI ELISA
2. Isol. CE-YS for PMV5
2-9

Avian Pathogenicity: IC test in day

RT-PCR,
Paramyxovirus-1 30 1. Inoc CE-AS, HA activity, VN old chicks; Strain variability ELISA, HI
rRT-PCR
(NDV) using Mab, sequencing

RFLP; Cross neutralization in

Bimavirus (IBD) 41 1. Isol. CE-CAM; AGP, FA, AC-ELISA RT-PCR embryos, cross challenge in ELISA, AGP, VN
chickens

DNA Probe,
Circovirus (PBFD) 27 PCR HI
PCR, ISH

IFA, AC-ELISA,
Coronavirus 1. Isol. TE-AS or CE-AS RT-PCR,
34 IFA, sequencing Competitive
(enteric) 2. EM, IEM, IFA, EHC, HA multiplex PCR ELISA, VN, HI

Serotype ID: VN, HI, RRT-

Coronavirus (IBV) 32 1. Isol. CE-AS, VN, HI, IHC PCR ELISA, HI, VN
PCR, RFLP

Coronavirus (TCV) 33 1. Isol. CE-AS, EM, FA, IHC, ELISA RT-PCR ELISA

Entervirus-like 1. Isol. TEF, EM IHC, IFA,

34 not recommended
(enteric) 2. EM on intestinal contents ELISA

1. Isol. MDCC-MSB1, MDCC-CU147, VN ISH, DBH,

Gyrovirus (CAV) 28 ELISA
2. Inoc suscb. Chicks, anemia PCR

1. Isol. MDEF, DEF, or DEL,death, lesions; FA ;

protection in DAZE vaccinated ducks following
challenge with virulent DVE virus
Herpesvirus (DVE) 23 PCR VN
2. Isol in 1 d old Muscovy ducks, FA
3. Isol. DE-CAM, FA
4. Neg. stain TEM (not specific to DVE)

1. Isol. In CEL, CEK, TOC, CE-CAM, CKN inoc.

2. Smears stained with Giemsa PCR/RFLP, reciprocal AGID, ELISA,
Herpesvirus (ILT) 21 PCR
3. EM DNA: DNA hybridization VN
4. Antigen detection: FA, IP, AGID

Herpesvirus PCR, ISH, AGID, VN, IFA,

22 1. Isol in cell culture, FA
(MDV) DBH IHC, ELISA

Herpesvirus of free 1. Isol. CEF, CEK, CEL, VN with known + antisera Pathogenicity in Emb. Ckn
24 PCR VN, ELISA
flying birds 2. Direct IF on tissue/impression smears eggs

245
 QUICK REFERENCE DIAGNOSTIC CHART: VIRAL DISEASES

Molecular Serogrouping, serotyping,

Pathogen CH Preferred Isolation technique/Diagnostic test Host Serology
Diagnosis speciation, pathogenicity

1. Isol. CKN or TKY TOC, CE-YS, TE-YS, CEF,

Metapneumovirus 31 VERO, QT-35 PCR VN using monoclonals, ED ELISA, FA, VN
2. IP, IF, Ag detection

Subgroup by VN or flow ELISA, VN or

1. Isol. SPF CEFs resistant to subgroup E ALV and
Oncornavirus PCR cytometry, Pathogenicity in flow cytometry
35 lack endogenous viral genes; Demonstrate ALV gs
(ALV) (Exogenous) SPF genetically susceptible for subgroup
(p27) by ELISA
chicks determination

1. Isol. SPF CEFs and assay for virus by ELISA, IFA,

Subtype determination using
Oncornavirus IP, FC, AGID ELISA, VN, IFA,
35 PCR, RT-PCR Mab, Pathogenicity in SPF
(REV) 2. Direct ELISA or CF for gs (p30) in albumin and AGID
chicks
cloacal and vaginal swabs
Subtyping (HI, NI),
pathogenicity (IV in 4-8w old
Orthomyxovirus RT-PCR, ELISA, HI, NI,
29 1. Inoc. CE-AS, HA activity, AGID chicks), PCR for aminoacid
(Al) rRT-PCR AGID
sequence at the Hemagglutinin
cleavage site for H5 and H7

Parvovirus of 1. Isol. Muscovy DE-AS, EM PCR and

42 VN, AGP, ELISA
waterfowl 2. Isol. Muscovy DEF, EM, IF, IP, AC-ELISA, VN sequencing

AGID, VN,
Picomavirus
36 1. Isol. CE-YS, FA ELISA, Embryo
(AE)
susceptibility
1. Isol. SQ or IM 1-7 d old DVH type 1 susceptible
ducks; death with lesions; isol v from liver; No death
in challenged ducks known to have passive or active
Picomavirus immunity to DVH type 1
37 RT-PCR
(DHV I) 2. Isol. DE-AS, lesions; Hyperimmune serum inhibits
pathogenic effects in embryos.
3. Isol. Ckn Emb
4. Isol. DEL, DVH 1 antisera inhibits CPE
1. Isol. IV or IM 1 day old susceptible ducks;
mortality
Picomavirus
37 2. Isol. DE-CAM; CAM lesions; neutralization by
(DHVni)
antisera;
3. FA DEL cells.

1. Isol. CE-YS; Neg. stain EM

Picomavirus-like
38 2. Isol. By inoc of 1-7 day old poult with liver
(TVH)
suspension or yolk from inf. Embryos

Polyomavirus
26 1. Isol. BEF, CEF, Giemsa PCR, ISH VN, ELISA
(BFD)

1. Isol. CEK, CED, QT-35, LMH cells

Immunoblotting, Sequencing; AGED, VN,
Poxvirus 25 2. Isol. CE-CAM, Pocks on CAM, TEM RFLP, PCR
Host pathogenicity, VN ELISA
3. IP, IFA

ELISA, VN and
Reovirus 39 l.Isol. CE-YS, AGID, FA
AGID

Rotavirus 1. Isol. CEK, TEK, CEL, MA 104 Electropherotyping, FA, IEM,

34
(enteric) 2. EM, IEM PGE

1. Isol, by TKY inoc.

Siadenovirus 2. MDTC cells
20 PCR AGID, ELISA
(HEV, MSDV) 3. AGID for Ag, Ag capture ELISA,EHC, ISH
4. FA, IP, ISH, Ac-ELISA (spleen)
Torovirus (enteric) 34 1. Direct EM, FA, IFA ELISA, VN

246
 Index

Acholeplasma, 69, 72 Brain heart infusion (Media), 23, 158

Adeno-associated, 101, 104, 230 Brooder pneumonia, 90
Adenovirus, 33, 98, 100, 101, 102, 103, 104, 105, 107, 109, 136, Budgerigar fledgling disease, 143, 145
146, 153,170,171, 172, 204, 212, 223, 228, 241, 246, 248, Buffered peptone water (Media), 282
253, 260, 274, 278, 279, 280, 282 Calicivirus, 182, 216, 217, 248
Aflatoxicosis, 94, 95, 96,209 Campylobacter coli, 27, 30
Agar gel immunodiffusion test (Procedures),88, 108, 139, 162, Campylobacter jejuni, 27, 30
Agar gel precipitin (Procedures), 109, 224, 229, 268 Campylobacteriosis, vii, 27
Agar overlay (Media), 196, 235 Canarypox, 139, 141, 248
Agglutination (Procedures), 9, 11, 15, 20, 21, 20, 21, 24, 27, 29, Candida, 90, 92, 97, 287
33, 39,45, 46, 51, 64, 67, 68, 70, 73, 74, 82, 85, 87, 89, 162, Candidiasis, 92
187, 188, 228, 260, 261, 265, 273, 274, 283, 284 Catalase (Procedures), 19, 21, 20, 24, 26, 39, 43, 44, 45, 46, 50,
Airsacculitis, 12, 15, 19,22, 68, 71, 87, 89, 112 52
Amniotic Sac Inoculation, 244 Cefoperazone, Amphotericin, Teicoplanin agar, 28
Amplified Fragment Length Polymorphism (Procedures), 70, 74, Cell culture (Media), 43, 77, 78, 79, 80, 81, 85, 99, 100, 101,
282 102, 104, 107,109, 111, 113, 114, 117, 120, 126, 128, 131,
Andrade’s, 39 133, 137, 138,142, 143, 147, 149, 158, 167, 171, 172, 175,
Anemia dermatitis syndrome, 146, 148 180, 182, 187,189, 198, 205, 208, 211, 215, 216, 218, 219,
Antibiotic solution (Media), 78 220, 231, 232,234, 235, 239, 246, 250, 257, 260, 264, 273,
Antigen capture (Procedures), 1, 11, 108, 155, 162, 174, 175, 288
220, 274,279 Cell lines (Procedures), 78, 119, 123, 131, 148, 224, 232, 233,
Antigen capture ELISA (Procedures), 114 238, 240, 246
Antigen preparation (Procedures), 102, 263, 274 Cell-associated virus, 239
Antiserum (Procedures), 9, 20, 25, 39, 69, 79,100, 101, 102, 107, Cellulitis, 12, 58, 59
108, 109, 126,132, 138, 147, 153, 154, 155, 159, 162, 167, Chicken anemia virus, 145, 146, 147, 148,248,282
172,183,184, 190, 196, 197, 198, 199, 224, 228, 262, 274 Chicken embryo fibroblast (Procedures), 142
API 20E (Procedures), 12 Chicken embryo kidney (Procedures), i, 112
Arbitrarily primed PCR (Procedures), 282 Chlamydiosis, 13, 21, 33, 71, 76, 77,.79, 85, 86
Arbovirus, 218,219, 220, 221 Chlamydophila psittaci, 76, 79, 80, 81, 82, 83, 85, 86
Arbovirus infection, 219 Chorioallantoic Membrane Inoculation (Procedures), 243
Arizonosis, 11 Chronic respiratory disease, 26
Aspergillosis, i, 9, 44, 90, 92, 93, 96 Circovirus, 101, 144, 145, 148, 248, 253
Aspergillus, i, 64, 90, 91, 92, 94, 95, 96,287 Clostridium, 36, 52, 53, 54, 55, 56, 58, 59, 60, 133, 221, 279
Avian encephalomyelitis, 44, 54, 203, 205,221,241, 246, 260, CMGS (Media), 53, 282, 286
263, 268, 274, 280 Coagulase test (Procedures), 46
Avian influenza, i, 2, 40, 71,128, 133,150, 151, 152, 153, 155, Colibacillosis, 9,12, 13,14,24, 33, 36,40,46,48, 51, 89, 109
156, 162, 168,173, 190, 209, 244, 253, 260, 262, 263, 265, Columbia (Media), vii, 23, 45, 156
268, 274, 275, 278, 279, 280, 283 Complement fixation (Procedures), 44, 52, 54, 76, 79, 82, 86,
Avian leukosis, 64,193, 200, 201,202,238,241,254,274,278, 132, 193, 222, 239, 246, 280
279, 280, 282 Conditioned medium (Media), 237
Avian pneumovirus, 26, 157, 165, 168, 169, 254, 275,279 Cornmeal agar (Media), 92
Avian pox, 115, 138, 139, 140 Coronaviral enteritis, 175,178, 185, 191,280
Avian rhinotracheitis, 165 Coronavirus, ix, 171, 183, 191, 217, 248, 288
Avibacterium, 15, 17, 18, 21, 22, 23,24, 26, 27 Coryza, 1, 17, 18,21, 22,23, 25, 26,27,173,265
Avipoxvirus, 137, 138, 139, 248 Crop mycosis, 92, 97
Bacillus, 44, 52 Cross-challenge tests (Procedures), 170, 173
Bacitracin (Media), 23 Cryptosporidiosis, 21, 71
Balanced salt solution (Media), 111, 138, 208, 232, 233, 235, Dactylaria, 90, 93, 96, 287
255,283 Dactylariosis, 93, 96
Basal medium, Eagle’s (Media), 282 Decontamination (Procedures), 62, 63, 64, 66
Beak and feather disease, 143, 144, 145, 248, 280, 284 Delayed secondary enrichment (Procedures), 4,283
BEM (Media), 282 Dextrose starch agar, 16, 283
BGN (Media), 6, 7, 8, 11, 282, 286 Dilutions (Procedures), 20, 35, 69, 70, 79, 81, 103, 104, 114,119,
BGS (Media), 8,282 128, 132, 143, 148, 152, 167, 172, 181, 188, 199, 204, 207,
Big liver disease, 192 208, 209, 215,220, 221, 224, 239, 255, 256, 257, 259, 261,
Bile esculin (Media), 50 262, 263, 264
Bimavirus, 224, 288 Dimethyl sulfoxide (Media), 118
Bismuth sulfite (Media), 6 Direct fluorescent antibody test (Procedures), 126
Bluecomb, 175,177, 178, 179, 191, 280 Dot blot hybridization (Procedures), 149
Bordetella avium, 24, 21, 265,282 Drag swabs (Procedures), 4, 5, 6, 11
Bordetellosis, 18, 24 Duck hepatitis, 206, 207, 208, 209, 210, 229, 249, 283
Borrelia, 31, 32, 33, 36, 37,286 Duck hepatitis B virus, 206
Botulism, 52, 53, 54, 59, 60, 133 Duck plague, 17, 125, 126, 127,128, 129, 229, 248, 279
Bovamick’s (Media), 78 Duck septicemia, 19
Brachyspira, 33, 35, 36, 37, 286 Duck virus enteritis, 125,283
247
 QUICK REFERENCE DIAGNOSTIC CHART: VIRAL DISEASES

Molecular Serogrouping, serotyping,

Pathogen CH Preferred Isolation techniqne/Diagnostic test
Diagnosis speciation, pathogenicity

1. Isol. CKN or TKY TOC, CE-YS, TE-YS, CEF,

Metapneumovirus 31 VERO, QT-35 PCR VN using monoclonals, ID
2. IP, IF, Ag detection

Subgroup by VN or flow
1. Isol. SPF CEFs resistant to subgroup E ALV and
Oncornavirus PCR cytometry, Pathogenicity in
35 lack endogenous viral genes; Demonstrate ALV gs
(ALV) (Exogenous) SPF genetically susceptible
(p27) by ELISA
chicks

1. Isol. SPF CEFs and assay for virus by ELISA, IFA,

Subtype determination using
Oncornavirus IP, FC, AGID
35 PCR, RT-PCR Mab, Pathogenicity in SPF
(REV) 2. Direct ELISA or CF for gs (p30) in albumin and
chicks
cloacal and vaginal swabs
Subtyping (HI, NI),
pathogenicity (IV in 4-8w old
Orthomyxovirus RT-PCR,
29 1. Inoc. CE-AS, HA activity, AGID chicks), PCR for aminoacid
(Al) rRT-PCR
sequence at the Hemagglutinin
cleavage site for H5 and H7

Parvovirus of 1. Isol. Muscovy DE-AS, EM PCR and

42
waterfowl 2. Isol. Muscovy DEF, EM, IF, IP, AC-ELISA, VN sequencing

Picomavirus
36 1. Isol. CE-YS, FA
(AE)

1. Isol. SQ or IM 1-7 d old DVH type 1 susceptible

ducks; death with lesions; isol v from liver; No death
in challenged ducks known to have passive or active
Picomavirus immunity to DVH type 1
37 RT-PCR
(DHV I) 2. Isol. DE-AS, lesions; Hyperimmune serum inhibits
pathogenic effects in embryos.
3. Isol. Ckn Emb
4. Isol. DEL, DVH 1 antisera inhibits CPE
1. Isol. IV or IM 1 day old susceptible ducks;
mortality
Picomavirus
37 2. Isol. DE-CAM; CAM lesions; neutralization by
(DHVni)
antisera;
3. FA DEL cells.

1. Isol. CE-YS; Neg. stain EM

Picomavirus-1 ike
38 2. Isol. By inoc of 1-7 day old poult with liver
(TVH)
suspension or yolk from inf. Embryos

Polyomavirus
26 1. Isol. BEF, CEF, Giemsa PCR, ISH
(BFD)

1. Isol. CEK, CED, QT-35, LMH cells

Immunoblotting, Sequencing;
Poxvirus 25 2. Isol. CE-CAM, Pocks on CAM, TEM RFLP, PCR
Host pathogenicity, VN
3. IP, IFA

Reovirus 39 1. Isol. CE-YS, AGID, FA

Rotavirus 1. Isol. CEK, TEK, CEL, MAI 04 Electropherotyping, FA, IEM,

34
(enteric) 2. EM, IEM PGE

1. Isol, by TKY inoc.

Siadenovirus 2. MDTC cells
20 PCR
(HEV, MSDV) 3. AGID for Ag, Ag capture ELISA,IHC, ISH
4. FA, IP, ISH, Ac-ELISA (spleen)
Torovirus (enteric) 34 1. Direct EM, FA, IFA

246
Index

Dulbecco's modified Eagle's medium (Media), 187, 283 Immunodiffusion (Procedures), 8, 32, 33, 35, 36, 88, 102,106,
Eagle’s minimum essential medium (Media) 283 108, 111, 112, 137, 150, 153, 156, 159, 162, 167, 171, 214,
Earle’s balanced salt (Media), 235 215, 228, 260, 263, 273, 274, 280, 282, 283
EDTA, 79, 118,119, 121,127, 139,208, 233, 234, 237, 249, Immunoelectron microscopy (Procedures), 101,279
269, 276,283 Immunofluorescence (Procedures), 8, 33, 42, 69, 75, 82, 98, 100,
Egg-drop syndrome (Procedures), 136 101,102, 116, 117, 118, 122, 123, 126,128, 132, 142, 146,
Electron microscopy, 98, 109, 165, 175, 183, 190, 254, 273, 283 147,148,156, 167, 182, 195, 197, 198, 199, 208, 218, 224,
Encephalitis, 4, 36,42, 93, 96, 218, 220, 221, 222, 235, 283, 285 227, 239, 278, 279, 280, 283
Encephalomyelitis Immunohistochemical staining (Procedures), 77, 78, 100,109,
AE, 203, 204, 205, 221, 222, 248, 282 142,233, 273,279
Enrichment (Procedures), 4, 5, 6, 7, 11, 28, 30,42, 43, 53, 79, Immunosuppression, 1, 45, 52,94, 95, 106, 117, 148, 192, 223,
235, 274,282,286 225
Enteric viruses, 101, 179, 180, 182, 190, 273 Inclusion body hepatitis, 98, 101, 104,225, 253
Enterobacter, 12, 13 Indirect fluorescent antibody test (Procedures), 36,102, 175, 177,
Enterococcus, 48, 51, 64, 286 199,215
Enterovirus, 177, 182, 191, 205, 279 Indole test (Procedures), 12, 16
Enzyme linked immunosorbent assay (Procedures), 104, 106, Infectious anemia, 1, 146,148,149, 201, 253
148, 175, 176,218 Infectious bronchitis, i, 1, 24, 71, 114, 165, 168, 170, 173, 174,
Epidemic tremor, 203 175, 177, 178, 181, 183, 184, 191, 225, 241, 246, 253, 254,
Erysipelas, 13, 38, 39, 40, 44,48, 51, 216 260, 263, 268, 274, 278, 279, 280, 281
Erysipelothrix selective (Media), 38, 283 Infectious bronchitis virus
Escherichia coli, 1, 8, 12, 13, 14, 20, 24, 29, 46, 58, 60, 64, 71, IBV, 1,168, 183, 274
110, 133, 165, 173, 191,212, 282 Infectious bursal disease
Favus, 93, 287 IBD, 1, 52, 58, 96, 148, 173, 200, 223, 225, 241, 246, 253,
Filtration (Procedures), 28, 30, 73, 78, 118, 131, 151, 233, 234, 254, 260, 268, 274, 278, 279, 280
235, 236, 250,274 Infectious bursal disease virus
Flaviviruses, 220 IBDV, 223, 224, 248, 280, 283
Fluorescein isothiocyanate (Media), 283 Infectious laryngotracheitis
Fluorescent Antibody Test (Procedures), 121, 167 ILT, 1, 114, 115,116,122, 130, 135, 136, 137, 138,139,140,
Food Safety, v, 27 173, 216, 265, 268, 275, 278, 279, 281
Fowl cholera, 15, 16,17, 21, 22, 26,40,46, 54, 71, 87, 89 Infectious laryngotracheitis virus
Fowl pox, 26, 137, 201, 246, 263, 268 ILTV, 114,115, 173,283
Frey's (Media), 73 Influenza (Al), 150
FTA cards(Media), 269 Intracerebral Pathogenicity Index (Procedures), 160
Fusarium, 90, 94, 95 Laboratory safety, 2, 76
Gallibacterium, 15, 17, 18, 22, 58, 87 Lake Victoria Cormorant, 131
Gangrenous dermatitis, 52, 58, 59, 146,225 Leukosis, 33,107, 192, 200,201,202,241,265,280,282,284
Gel diffusion precipitin test, 22,109 Listeria, 40,42,43, 44, 50, 286
Gentamicin(Media), 13,19, 77, 78, 87, 92,125,151, 193, 208, Listeriosis, 40,42,43,44
234,237,243 LMH, 112, 138, 181, 233, 237, 289
Geometric mean titers (Procedures), 255, 258, 262,266 Lowenstein-Jensen (Media), 284
Glycerol (Media), 17 Lymphoid leukosis, 201
Goose hepatitis, 226,249 Lymphoproliferative disease, 108,198
Goose parvovirus, 226, 227,228, 229, 230, 248, 278 Lysine iron,(Media) 8, 284
Gosling plague, 226 M199 (Media), 130,131,232, 235,237
Gumboro, 223 M20 (Media), 233,238
Hajna (Media), 7 MacConkey (Media) 7,11,12,13,16,17,18, 19,24,20,48, 50,
Hajna and Damon (Media), 7 87, 88,284
Hektoen enteric (Media), 6, 8 Malabsorption syndrome, 179, 214, 217
Hemagglutination (Procedures), 16, 21, 20, 21, 22, 24,25, 27, 44, Malignant edema, 58
68, 70, 73, 74, 98,100,101, 103, 126,129,133,137,139, Mannitol-salt (Media), 45
140, 144, 145, 150, 153, 159, 164, 166, 170, 171, 174, 179, Marble spleen disease, 98,106,109, 248
183, 184, 187, 191, 218, 220, 221, 241, 246, 251, 258, 260, Marek’s disease, 33, 44, 54, 64, 107, 117, 118, 122, 123, 124,
261,262,268,274,280,283 130, 131, 135, 136, 146, 148, 192, 197, 200, 201, 202, 205,
Hemagglutination Inhibition (Procedures), 172 216,224,238, 239, 240, 246,248, 253, 254, 263,268, 275,
Hemorrhagic enteritis, 1, 54,98,108, 109, 110, 179, 219,248, 278, 284
260,265, 279 McClung-Toabe egg yolk agar, 53, 56, 59
Hemorrhagic syndrome, 146 Micrococcus, 46
Herpesvirus, 101, 111, 113, 117, 118, 119,120, 122, 123, 124, Microsporum, 90, 93
125, 126, 131,135, 136, 139, 192, 229, 240, 246, 248, 280 Middlebrook 7H9 (Media), 62, 63
Herpesvirus of turkeys, 123, 135, 240 Minimum essential medium (Media), 131, 182,184, 208, 215,
High pressure liquid chromatography (Procedures) 96 237
Highlands J virus, 221,222, 248 Molecular probes, 64,286
Hybridization with nucleic acid probes (Procedures), 269 Monoclonal antibodies (Media), 42, 43, 64, 79, 85, 114,117,
Hydropericardium syndrome, 98, 104, 278 118, 120, 122, 132, 135, 140,147, 148, 159, 164, 165, 168,
Immunocytochemistry (Procedures), 280 170, 172, 174, 176, 185, 192,194, 197, 198, 200, 201, 202,
225, 227, 229, 246, 278, 280
248
 Index

Muscovy duck parvovirus, 226, 229, 230, 248, 284 Quail pox, 137
Mycobacterium, 61, 62, 63, 64, 66, 67, 133, 284, 286 Quality control, 260, 262, 266
Mycoplasma, i, 1, 22, 46, 68, 69, 70, 71, 72, 73, 74, 75,104, 168, Rambach (Media), 8,286
170, 173, 216, 234, 235, 241, 260, 261, 263, 265, 266, 268, Reovirus, 1, 104, 172, 177, 178, 191, 212, 214, 215, 216, 217,
269, 274, 275, 280, 284, 286 223, 240, 241, 246, 248, 265, 274, 275, 284
Mycoplasmosis, 1, 13, 18, 21, 89, 114, 173, 260, 263, 265 Reticuloendotheliosis, 108, 122, 123, 139, 140, 192, 200, 201,
Mynah pox, 140 202,216, 238, 274, 278, 282
Necrotic enteritis, 52, 54, 56, 57, 58, 59, 60, 279 Retrovirus, 197
Neoplasms, 64 Rhinotracheitis, 2,21, 136, 157, 165, 168, 169, 221, 248, 282
Neuraminidase, 39, 150, 152, 154, 156, 159, 161, 166, 168, 172, Ringworm, 93
260, 283 Rotavirus, 136, 148, 177,179, 187, 189, 191, 248, 251
New duck disease, 19 Sabouraud (Media), i, 91, 93
Newcastle disease, 1, 3, 9, 24, 21, 40,44, 54, 71, 122, 128, 133, Salmonella, 8, 9, 11
153, 155, 156, 157, 158, 160, 161, 164, 167, 170, 173, 174, Salmonella pullorum, 260
190, 205, 209, 221, 241, 244, 246, 248, 253, 254, 260, 268, Salmonellae, 6, 7, 8, 9, 11
275, 279, 280, 284 Salmonellosis, 4, 9, 13, 21, 36, 40, 44, 209, 265
Newcastle disease virus, 156, 167, 190 Sarcoma, 192, 196, 198
Nichrome loop (Media), 151 Selenite (Media), 7
Non-producer Cell Activation (Procedures), 196 Sentinel chicken, 220
Notification, 19, 157 Siadenovirus, 98, 106, 108,246,248, 289
Ochratoxin, 90, 95 Silica gel (Media), 48, 151
Oncornavirus, 198, 199, 200, 202 Sodium dodecyl sulfate (Media), 35, 74, 127,139, 184, 189
Ornithosis, 76, 85 SPG buffer (Media), 77
Orthomyxovirus, 246 Spirochetosis, 31, 32, 33, 36, 37, 282
Orthomyxovirus, 289 Splenomegaly, 33,48,206
Osteopetrosis, 192 Staphylococcus, 45, 48, 216
Osteoporosis, 214, 217 Streptococcosis, 40, 44, 48, 51
Pacheco’s disease, 135, 136,248 Stunting syndrome, 179, 190, 191, 214, 217
Packer’s (Media), 38, 39 Stunting syndrome agent, 284
Papovavirus, 143 Supplemental test medium without NAD (Media), 285
Paramyxovirus, 157, 158, 159, 160, 162, 164, 166, 205, 246, 253, Swollen head syndrome, 12,26,157, 165, 169
282 Tellurite glycine (Media), 45
Paratyphoid, 4, 5, 8, 9 Tergitol (Media), 6, 7, 11, 285
Parrot fever, 76 Tetrathionate (Media), 6, 11
Parvovirus, 216, 226, 229, 248, 289 TM/SN, 23, 24, 285
Pasteurella multocida, 15, 16, 21, 22,44, 128, 212, 229, 265, 284 Togaviruses, 133
Penicillium, 90, 94, 95 Torovirus, 179, 190
peptone (Media), 6, 23, 28, 151, 215, 282 Transformation (Focus) Assay, 196
Phenotypic Mixing (Procedures), 196 Tri-buffered saline (Media), 284
Phosphate-buffered saline (Media), 79, 284 Trichophyton, 93
phosphotungstic acid (Media), 183, 189, 246, 251, 273 Triple Sugar Iron (Media), 8
picomavirus, 203, 206, 207, 211 Tris borate Buffer (Media), 284
Picomavirus-like, 289 Tuberculosis, 21,61, 62, 63, 64, 66, 67, 287
Pigeon pox, 135, 137 Tumors, 117, 119, 120, 122, 124, 130, 192, 193, 196, 197,198,
Plague, 17, 126, 127, 129, 150 200, 202,238
Pneumovirus, 1, 21, 169 Turkey herpesvirus, 248
Polyomavirus, 142, 143, 145, 229 Turkey meningoencephalitis, 218
Potato dextrose (Media), 91 Turkey pox, 137
Poult enteritis, 175,177, 178, 179, 191 Turkey viral enteritis, 179
Poult enteritis and mortality syndrome Turkey viral hepatitis, 211, 212, 285
PEMS, 179 Tween 80 Hydrolysis (Media), 63
Pox, 115, 132,137,138, 139 Typhoid, 4,9, 11, 17,46, 265
Poxvirus, 128, 137, 138, 139, 140, 246 Ulcerative enteritis, 52, 54, 58, 59
Proteus, 7, 8, 24 Ureaplasma, 72, 74
Providencia, 7, 8 Vibrionic hepatitis, 27, 30
Pseudomonas, 7, 133 Viral arthritis, 46,214,216, 217,248,260,263
Pseudotuberculosis, 13, 15, 17, 18, 21, 22 Viral enteritis, 129, 134, 229, 275
Psittacine beak and feather disease Virus transport medium (Media), 146, 165
PBFD, 143 Western duck sickness, 53
Psittacosis, 76, 85, 86 XLD supplemented with novobiocin, 285
Pullorum disease (Procedures), 2, 4 XLT4, 6, 7, 8, 11,285,286
Quail bronchitis, 98 Xylose lysine desoxycholate (XLD) (Media), 6
Quail disease, 52, 54, 59 Yersinia, 17, 21
buffer at pH9.0

249
THE AMERICAN ASSOCIATION OF AVIAN PATHOLOGISTS

Fifth Edition 2008

ISBN 978-0-9789163-2-·