1.

Go to different NCBI databases, search and make brief report about this ID AM492698
and related protein
Gene Name: Homo sapiens ABO gene for ABO glycosyltransferase, ABO*Avar allele, exons 1-7
Length: 6815bp
Organism: homo sapiens
Chromosomal location (which chromosome and band): Chromosome 9 band q34.1-q34.2
Original tissue type: peripheral blood
Number of introns and exons (and detail location): 7exon (184…211;312…381;1106…
1162;2614…2661;4348…4383;4938…5072;6125…6815)
6intron (212…311;382…1105;1163…2613;2662…4347;4384…4937;5073…6124)
Protein Name: Histo-blood group ABO system transferase

Length: 354aa

Function: This protein is the basis of the ABO blood group system. The histo-blood group ABO
involves three carbohydrate antigens: A, B, and H. A, B, and AB individuals express a
glycosyltransferase activity that converts the H antigen to the A antigen (by addition of UDP-
GalNAc) or to the B antigen (by addition of UDP-Gal), whereas O individuals lack such activity.

Subcellular location:

Transmembrane region (if yes, specify positions): Helical; Signal-anchor for type II membrane
protein (33-53)

3D structure(s) of whole sequence (list ID and data source only)

 2. Use Primer-BLAST or Primer3Plus to design primers for this gene, specifically, which are
within region of exon 6 to exon 7.

List the first 5 pairs of primers: together with length of PCR product, Tm and GC content of each primer

Primer pair 1:
Sequence (5'->3') Template Tm GC%
strand
Forward GTCTGGGAGGGCACATTCAA plus 59.96 55%
primer
Reverse AGAAATCGCCCTCGTCCTTG minus 60.11 55%
primer
Product 508
length

Primer pair 2:
Sequence (5'->3') Template Tm GC%
strand
Forward TCCAGAACACCACCATTGGG plus 58.98 55%
primer
Reverse GAACTCCATGTCCACGTCCA minus 59.68 55%
primer
Product 317
length

Primer pair 3:
Sequence (5'->3') Template Tm GC%
 strand
Forward GACGAGAGCCACCTGAACAA plus 59.97 55%
primer
Reverse CCACAAGTACTCGGGGGAGA minus 60.61 60%
primer
Product 72
length

Primer pair 4:
Sequence (5'->3') Template Tm GC%
strand
Forward AGTTCAGGCTCCAGAACACC plus 59.60 55%
primer
Reverse CACCAGGTAATCCACCTCGC minus 60.46 60%
primer
Product 302
length

Primer pair 5:
Sequence (5'->3') Template Tm GC%
strand
Forward GTGGATTACCTGGTGTGCGT plus 60.32 55%
primer
Reverse AGTAGAAATCGCCCTCGTCC minus 59.25 55%
primer
Product 184
length

Choose a pair of primers which is the best in your opinion, show its location on the sequence, explain
your choice

I choose primer pair 4 because the length is 20bp, GC content is 55% and 60%, the 3’ of primer ending in
C and G, at the last 5 bases at 3’ end there are 3-4 GC clamps, do not have dinucleotide repeats.

3. Check your primers using PCR Primer Stat and OligoAnalyzer

Compare the results from General properties of PCR Primer Stat, are they consistent with report
from design tool
 PCR Primer Stat

Compare the results from PCR suitability test of PCR Primer Stat, are they consistent with report from
OligoAnalyzer tool

Forward primer PCR Primer Stat

Reverse primer PCR Primer Stat

Reverse primer OligoAnalyzer

 Forward primer OligoAnalyzer

OligoAnalyzer

Compare

OligoAnalyzer PCR Primer Stat

GC content is 55% and 60% GC content is pass

Show the warning about the seft annealing and Show the warning about the seft annealing and
hairpin formation in forward primer hairpin formation

4. Check your primers using UCSC in-silico PCR

Give a report of PCR product from your chosen primers within any two organisms
The primer pair is not specific to cow and pig