Scribd Logo
Upload

Welcome to Scribd!

  • Primer-BLAST Result

    Uploaded by

    Rafiif Wasis Ibaadurrahmaan
    87 views12 pages
    The document summarizes the results of a Primer-BLAST analysis. It identifies 6 specific primer pairs that target the input template (Query_1) without finding other targets in the selected database. For each primer pair, it lists the forward and reverse primers and shows they produce amplicons only on the intended template sequence (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1).

    Original Description:

    Copyright

    © © All Rights Reserved

    Available Formats

    PDF, TXT or read online from Scribd

    Did you find this document useful?

    Is this content inappropriate?

    Report this Document
    The document summarizes the results of a Primer-BLAST analysis. It identifies 6 specific primer pairs that target the input template (Query_1) without finding other targets in the selected database. For each primer pair, it lists the forward and reverse primers and shows they produce amplicons only on the intended template sequence (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1).

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    87 views12 pages

    Primer-BLAST Result

    Uploaded by

    Rafiif Wasis Ibaadurrahmaan
    The document summarizes the results of a Primer-BLAST analysis. It identifies 6 specific primer pairs that target the input template (Query_1) without finding other targets in the selected database. For each primer pair, it lists the forward and reverse primers and shows they produce amplicons only on the intended template sequence (Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1).

    Copyright:

    © All Rights Reserved
    Download as PDF, TXT or read online from Scribd
    Flag for inappropriate content
    of 12

    9/27/2020 Primer-Blast results

    NCBI Home
    Sign in to NCBI
    Skip to Main Content
    Skip to Navigation
    About NCBI Accesskeys

    U.S. National Library of Medicine

    NCBI National Center for Biotechnology Information

    My NCBI
    Sign in to NCBI
    Register
    Sign Out

    Primer-BLAST» JOB ID:vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ


    Primer-BLAST Results
    [?]

    Input PCR template


    lcl|Query_1
    Range
    1 - 3900
    Specificity of primers
    Primer pairs are specific to input template as no other targets were found in selected database: RefSeq Representative Genome Database
    (Organism limited to Severe acute respiratory syndrome coronavirus 2)
    Other reports
    Search Summary

    Graphical view of primer pairs


    Query_1 Find:
    Template

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 1/12
    9/27/2020 Primer-Blast results

    (U) Primer pairs for job vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ

    Query_1: 1..3.9K (3,900 nt)

    Detailed primer reports


    You can re-search for specific primers by accepting some of the unintended targets, check the box(es) next to the ones you accept
    and try again to re-search for specific primers Submit
    [?]
    Primer pair 1
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer GACTAATTCTCCTCGGCGGG Plus 20 2053 2072 59.97 60.00 4.00 3.00
    Reverse primer TGTACCCGCTAACAGTGCAG Minus 20 2665 2646 60.04 55.00 4.00 2.00
    Internal oligo Plus
    Product length 613
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 613


    Forward primer 1 GACTAATTCTCCTCGGCGGG 20

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 2/12
    9/27/2020 Primer-Blast results

    Template 23593 .................... 23612

    Reverse primer 1 TGTACCCGCTAACAGTGCAG 20


    Template 24205 .................... 24186

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 2
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer GTCCTTCCCTCAGTCAGCAC Plus 20 3172 3191 60.04 60.00 3.00 1.00
    Reverse primer GACTCCTTTGAGCACTGGCT Minus 20 3826 3807 59.96 55.00 3.00 3.00
    Internal oligo Plus
    Product length 655
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 655


    Forward primer 1 GTCCTTCCCTCAGTCAGCAC 20
    Template 24712 .................... 24731

    Reverse primer 1 GACTCCTTTGAGCACTGGCT 20


    Template 25366 .................... 25347

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 3/12
    9/27/2020 Primer-Blast results

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 3
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer CTGCACTGTTAGCGGGTACA Plus 20 2646 2665 60.04 55.00 4.00 3.00
    Reverse primer ACACCATGAGGTGCTGACTG Minus 20 3201 3182 59.96 55.00 5.00 1.00
    Internal oligo Plus
    Product length 556
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 556


    Forward primer 1 CTGCACTGTTAGCGGGTACA 20
    Template 24186 .................... 24205

    Reverse primer 1 ACACCATGAGGTGCTGACTG 20


    Template 24741 .................... 24722

    Products on allowed targets

    Products on allowed transcript variants

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 4/12
    9/27/2020 Primer-Blast results

    Products on potentially unintended templates

    Products on target templates

    Primer pair 4
    Template Self Self 3'
    Sequence (5'->3') Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer CGGCCTTACTGTTTTGCCAC Plus 20 2590 2609 60.04 55.00 4.00 1.00
    Reverse primer GTGCTGACTGAGGGAAGGAC Minus 20 3191 3172 60.04 60.00 3.00 1.00
    Internal oligo Plus
    Product length 602
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 602


    Forward primer 1 CGGCCTTACTGTTTTGCCAC 20
    Template 24130 .................... 24149

    Reverse primer 1 GTGCTGACTGAGGGAAGGAC 20


    Template 24731 .................... 24712

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 5/12
    9/27/2020 Primer-Blast results

    Primer pair 5
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer GATGCTGTCCGTGATCCACA Plus 20 1742 1761 60.11 55.00 4.00 2.00
    Reverse primer CCCGCCGAGGAGAATTAGTC Minus 20 2072 2053 59.97 60.00 4.00 3.00
    Internal oligo Plus
    Product length 331
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 331


    Forward primer 1 GATGCTGTCCGTGATCCACA 20
    Template 23282 .................... 23301

    Reverse primer 1 CCCGCCGAGGAGAATTAGTC 20


    Template 23612 .................... 23593

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 6
    Template Self Self 3'
    Sequence (5'->3') Length Start Stop Tm GC%
    strand complementarity complementarity

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 6/12
    9/27/2020 Primer-Blast results

    Forward primer TTGCCACCTTTGCTCACAGA Plus 20 2603 2622 60.11 50.00 4.00 2.00
    Reverse primer CATGAGGTGCTGACTGAGGG Minus 20 3197 3178 60.11 60.00 4.00 0.00
    Internal oligo Plus
    Product length 595
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 595


    Forward primer 1 TTGCCACCTTTGCTCACAGA 20
    Template 24143 .................... 24162

    Reverse primer 1 CATGAGGTGCTGACTGAGGG 20


    Template 24737 .................... 24718

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 7
    Template Self Self 3'
    Sequence (5'->3') Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer CTGATGCTGTCCGTGATCCA Plus 20 1740 1759 59.82 55.00 4.00 2.00
    Reverse primer GTGGCAAAACAGTAAGGCCG Minus 20 2609 2590 60.04 55.00 4.00 2.00
    Internal oligo Plus

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 7/12
    9/27/2020 Primer-Blast results

    Product length 870


    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 870


    Forward primer 1 CTGATGCTGTCCGTGATCCA 20
    Template 23280 .................... 23299

    Reverse primer 1 GTGGCAAAACAGTAAGGCCG 20


    Template 24149 .................... 24130

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 8
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer CAAATCGCTCCAGGGCAAAC Plus 20 1247 1266 60.11 55.00 3.00 0.00
    Reverse primer CTGTGGATCACGGACAGCAT Minus 20 1762 1743 60.11 55.00 4.00 2.00
    Internal oligo Plus
    Product length 516
    Product Tm
    Product Tm -

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 8/12
    9/27/2020 Primer-Blast results

    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 516


    Forward primer 1 CAAATCGCTCCAGGGCAAAC 20
    Template 22787 .................... 22806

    Reverse primer 1 CTGTGGATCACGGACAGCAT 20


    Template 23302 .................... 23283

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 9
    Template Self Self 3'
    Sequence (5'->3')
    Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer CCTCAGTCAGCACCTCATGG Plus 20 3179 3198 60.11 60.00 4.00 2.00
    Reverse primer ATGGCAGGAGCAGTTGTGAA Minus 20 3264 3245 59.89 50.00 3.00 1.00
    Internal oligo Plus
    Product length 86
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 9/12
    9/27/2020 Primer-Blast results

    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    product length = 86
    Forward primer 1 CCTCAGTCAGCACCTCATGG 20
    Template 24719 .................... 24738

    Reverse primer 1 ATGGCAGGAGCAGTTGTGAA 20


    Template 24804 .................... 24785

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    Primer pair 10
    Template Self Self 3'
    Sequence (5'->3') Length Start Stop Tm GC%
    strand complementarity complementarity
    Forward primer TTCAGGTTGGACAGCTGGTG Plus 20 787 806 60.18 55.00 6.00 3.00
    Reverse primer CAGATGCAAATCTGGTGGCG Minus 20 1070 1051 59.90 55.00 6.00 2.00
    Internal oligo Plus
    Product length 284
    Product Tm
    Product Tm -
    min(OLIGO Tm)
    Exon junction
    Total intron size
    Products on intended targets

    >NC_045512.2 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 10/12
    9/27/2020 Primer-Blast results

    product length = 284


    Forward primer 1 TTCAGGTTGGACAGCTGGTG 20
    Template 22327 .................... 22346

    Reverse primer 1 CAGATGCAAATCTGGTGGCG 20


    Template 22610 .................... 22591

    Products on allowed targets

    Products on allowed transcript variants

    Products on potentially unintended templates

    Products on target templates

    If you want to allow any of the unintended targets, check the box(es) next to the ones you accept and try again to re-search for
    specific primers Submit
    [?]
    BLAST is a registered trademark of the National Library of Medicine

    Support center Mailing list YouTube

    National Library Of Medicine

    National Institutes Of Health

    U.S. Department of Health & Human Services

    USA.gov

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 11/12
    9/27/2020 Primer-Blast results

    NCBI

    National Center for Biotechnology Information, U.S. National Library of Medicine 8600 Rockville Pike, Bethesda MD, 20894 USA
    Policies and Guidelines | Contact

    https://www.ncbi.nlm.nih.gov/tools/primer-blast/primertool.cgi?ctg_time=1601191471&job_key=vLZj0mOJbiFJG_4e837aLIllyx6kdtADpQ 12/12

    You might also like