Acta Tropica 112 (2009) 77–85

Contents lists available at ScienceDirect

Acta Tropica
journal homepage: www.elsevier.com/locate/actatropica

Phylogeography of Androctonus species (Scorpiones: Buthidae) in Tunisia:

Diagnostic characters for linking species to scorpionism
A. Ben Othmen a,b , K. Said a , S.S. Mahamdallie b , J.M. Testa b , Z. Haouas a , N. Chatti a , P.D. Ready b,∗
a
Laboratoire de Génétique, Biodiversité et Valorisation des Bioressources, Institut Supérieur de Biotechnologie de Monastir (ISBM), 5000 Monastir, Tunisia
b
Molecular Systematics Laboratory, Department of Entomology, Natural History Museum, Cromwell Road, London SW7 5BD, UK

a r t i c l e i n f o a b s t r a c t

Article history: A fragment of the mitochondrial (mt) 16S ribosomal RNA gene was amplified by PCR and sequenced
Received 26 March 2009 from individual adult scorpions of the genus Androctonus, which were sampled from central and south-
Received in revised form 17 June 2009 ern Tunisia and identified using an explicit set of morphological characters. Phylogenetic analyses placed
Accepted 1 July 2009
the mtDNA haplotypes in three well-supported monophyletic lineages, corresponding to the morphos-
Available online 8 July 2009
pecies Androctonus aeneas, Androctonus amoreuxi and Androctonus australis. The latter species was the
most abundant and widespread, and it was characterized by two mtDNA sub-lineages each of which pre-
Keywords:
dominated only north or south of the Chott el Jerid, a seasonally flooded saline depression that divides
Scorpions
Androctonus species
non-Mediterranean Tunisia. The divergence of the two mtDNA lineages was dated by mtDNA molecular
Phylogeography clocks, indicating that the formation of the Chott el Jerid is unlikely to have been the barrier generating
Mitochondrial DNA the vicariant evolution of the two lineages of A. australis, although it may have impeded their mixing fol-
Tunisia lowing secondary contact. Both regional mtDNA lineages were found in A. australis hector and A. australis
garzonii, indicating that these two morphological forms are neither monophyletic nor geographically iso-
lated and, therefore, should not be treated as species or subspecies. It is recommended that no subspecies
of A. australis should be recognized in North Africa and toxicologists should cease the taxonomic error
of referring to a species “Androctonus australis Hector”. The morphological form “hector” has no proven
association with an increased risk of scorpionism compared with “garzonii”. However, it might be prudent
to produce anti-venom in Tunisia by using both morphological forms of A. australis collected each side of
the Chott el Jerid, because of the evidence for regional variation in toxins. The highest risk for scorpion
stings occurs in the central region, where the new diagnostic markers should be used to discover any
association between Androctonus species and scorpionism.
© 2009 Elsevier B.V. All rights reserved.

1. Introduction phy based on the characterization of both mitochondrial DNA and

Only about thirty species of scorpion (Chelicerata, Scorpiones)
are known to have “stings” delivering neurotoxins responsible for
envenomation potentially dangerous to humans (Chippaux and
Goyffon, 2008), and all but one are classified in the largest fam-
ily (Buthidae Koch, 1837) that contained 73 genera according to Fet
and Lowe (2000). Among the 64 Old World genera, Androctonus
Ehrenberg, 1828 is considered to be widely distributed in North
Africa, where large specimens are particularly dangerous (Chippaux
and Goyffon, 2008) and seven of its eight species (or 13 of the 17
subspecies) occur (Fet and Lowe, 2000), including the species with
the most potent venom and widest distribution, Androctonus aus-
tralis (Linnaeus) (Keegan, 1998). The current report investigates the
number of species of Androctonus in Tunisia and their phylogeogra-
∗ Corresponding author. Tel.: +44 20 7942 5622; fax: +44 20 7942 5229.
E-mail address: P.Ready@nhm.ac.uk (P.D. Ready).
morphology. The taxonomic uncertainties could have significant
medical implications in Tunisia, because of regional variation in the
risk of envenomation (Goyffon et al., 1982; Chippaux and Goyffon,
2008) or venom toxicity (El Ayeb and Rochat, 1985; Goyffon, 1984;
Goyffon and El Ayeb, 2002). If the venom exerts a severe or lethal
outcome, the incident is defined as scorpionism (Lourenço and
Cuellar, 1995).
Recent molecular and biochemical reports from Tunisia (Ben
Ali et al., 2000; Ben Othmen et al., 2004) referred to four taxa of
Androctonus, namely: Androctonus aeneas Koch, 1839, Androctonus
amoreuxi (Audouin, 1826), A. australis hector Koch, 1839 and Androc-
tonus australis garzonii Goyffon and Lamy, 1973. However, Fet and
Lowe (2000) had recognized only two of these taxa from Tunisia,
listing A. aeneas as Androctonus bicolor aeneas (Koch, 1839) with
lost syntypes from North Africa, and A. a. garzonii with undesig-
nated types from Tozeur, Tunisia. Fet and Lowe (2000) recognized
two other subspecies of A. australis and included Tunisia in their dis-
tributions, namely: Androctonus australis australis (Linnaeus, 1758)
with a type from Africa that is probably lost; and, A. australis

0001-706X/$ – see front matter © 2009 Elsevier B.V. All rights reserved.
doi:10.1016/j.actatropica.2009.07.001
78 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85

africanus Lamy, Le Pape and Weill, 1974 with types from Tozeur,
Tunisia, not in a known depository. They listed A. amoreuxi amoreuxi
with a holotype from Egypt that might be lost and a north African
distribution that included Morocco, Algeria and Egypt, but not
Tunisia.
Earlier, Vachon (1948, 1958) had distinguished three colour vari-
ants of A. australis, namely A. a. australis, A. a. hector and Androctonus
australis libycus Ehrenberg, 1828. The absence of other diagnos-
tic characters for the three subspecies was discussed by Levy and
Amitai (1980), and Fet and Lowe (2000: 69) concluded that the “Cur-
rent status of A. a. hector and A. a. libycus is unclear”. Fet and Lowe
(2000) synonymized both with A. australis, listing A. libycus Ehren-
berg, 1828 with types from Libya and/or Egypt and A. hector with
three lost female syntypes from North Africa, and noting that the
modern toxicological literature commonly makes the taxonomic
error of referring to a species “Androctonus australis Hector”.
In a taxonomic review of Androctonus, Lourenco (2005) exam-
ined specimens of A. australis sensu lato from Egypt, Libya and
Tunisia. He concluded that the morphological variation was con-
sistent with a single species presenting a certain degree of
polymorphism and, therefore, synonymized both A. a. garzonii and
A. a. africanus with A. australis.
Biochemical characterization of Androctonus species was first
reported by Goyffon et al. (1970), using the electrophoretic separa-
tion of haemocyanins (respiratory proteins) from the haemolymph.
Goyffon and Lamy (1973) described A. a. garzonii as a new sub-
species from Tunisia by distinguishing it from the allopatric A. a.
hector on haemocyanin profiles and on morphology—presence or
absence, respectively, of four tubercles on the dorsal surface of the
femur of the pedipalps. However, the nominate subspecies (A. a.
australis) was not characterized, and the haemocyanin profile of
a putative hybrid of A. a. hector and A. a. garzonii was discovered
(Lamy et al., 1974a). The same biochemical criteria were used to
describe A. a. africanus from Tunisia (Lamy et al., 1974b), although
type material was not explicitly designated.
More recently, Tunisian scorpions were compared by DNA
sequence analysis of part of the nuclear ribosomal RNA genes (Ben
Ali et al., 2000) and at 18 polymorphic alloenzyme loci (Ben Othmen
et al., 2004), but A. aeneas, A. amoreuxi, A. a. hector and A. a. garzonii
were not shown to be monophyletic taxa or biological species.
The aim of the current report is to disentangle inter- and intra-
specific variation of the Androctonus species present in Tunisia,
based on a comparative sequence analysis of mitochondrial (mt)
DNA obtained from individual specimens that had been identified
according to a set of explicit morphological characters (Table 1). A
fragment of the mitochondrial 16S ribosomal RNA gene (16S rDNA)
was targeted because it had proven informative for phylogenetic
studies of buthid genera (Fet et al., 2003) and of Mediterranean
populations of the scorpion Buthus occitanus (Amoreux, 1789)
(Gantenbein and Largiadèr, 2003), although a new reverse primer
had to be designed to improve the sensitivity of the polymerase
chain reaction (PCR) amplification of the gene fragment of Androc-
tonus.
2. Materials and methods
2.1. Biological material
Forty adult specimens were collected in 14 localities (each with
a search area of about 1000 m2 ) in the semi-arid and arid regions
of central-south Tunisia during the summer months of 1998–2003
(Fig. 1, Table 2). Collections were made at night using an ultravi-
olet lamp, under the light of which scorpions appear fluorescent
(Anglade et al., 1990). Specimens were transported alive to the lab-
oratory and, after morphological identification, stored dry at −70 ◦ C
or in 80% ethanol at +4 ◦ C to −20 ◦ C prior to DNA extraction.
2.2. Morphological identifications
The diagnostic characters used for species/subspecies-level
identification are given in Table 1. Both subspecies of A. australis
have a globular “tail” or metasoma (not always clear in immatures)
and a bifurcated tooth on the prolateral basitarsal spur of the legs
(clear in immatures), but A. a. hector lacks the four dark tubercles
that are present on the upper face of the femur of the pedipalps
of A. a. garzonii (not always clear in immatures) and a putative
hybrid (Goyffon and Lamy, 1973). The number of pectinal teeth
was recorded for adults of each sex of A. australis, and the differ-
ences between subspecies and regional populations were tested
using ANOVA (Statistica 4.3, StatSoft, Inc. 1993).
2.3. DNA extraction, PCR amplification and sequencing of 16S
rDNA
Total DNA was extracted from muscle tissue usually dissected
from a pedipalp (without washes if frozen, or after two washes in
distilled water if ethanol-preserved) using the DNAzol® extraction
kit (Chomczynski et al., 1997). A fragment of the mitochondrial

Table 1
Morphological characterization of Androctonus taxa in Tunisia. All characters were used to identify each species and subspecies.

A. australis garzonii A. australis hector A. amoreuxi A. aeneas

Colour Yellow-brown Black

Pectinal teeth number ♂ 32–38 ♂ 28–33 ♂ 27–32
♀ 25–29 ♀ 22–29 ♀ 20–27
Metasoma (or tail) Globular; 3rd segment with width greater than length; Tapered; 3rd, 4th and 5th Globular; 2nd and 3rd
4th segment with width not greater than length segments with width less segments with width
than length; all segments greater than length; 4th
of same length* and 5th segments with
width less than length
Pedipalp femur Length 2–3 times greater than width Length less than 2 Length 2–3 times
*
times width greater than width
Presence of 4 dark tubercules dorsally Absence of 4 dark
tubercules dorsally*
Pedipalp patella Thick; length 2 times greater than width Thinner; length 3 times
greater than width*
Movable finger 2 times longer than tibia Less than 2 times longer 2 times longer than tibia
than tibia
Legs Bifurcated tooth on the prolateral basitarsal spur* Simple tooth on the Simple or bifurcated tooth
prolateral basitarsal spur on the prolateral basitarsal
spur
*
Starred character states are combinations most useful for diagnosis.
 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85 79

Fig. 1. Sampling localities of analysed populations of Androctonus species. Localities 1, 4 and 13: A. aeneas. Localities 7, 8 and 12: A. amoreuxi. Localities 2–7 and 9: only
northern 16S rDNA lineage (N) of A. australis. Localities 12–14: only southern 16S rDNA lineage (S) of A. australis. Localities X and XI: both 16S rDNA lineages of A. australis.
Nefta: origin of specimen of A. australis providing 16S rDNA haplotype (GBaust, N lineage) in GenBank accession AJ506868. g: A. australis garzonii; h: A. australis hector.

16S rRNA gene was amplified using the following primers. The
forward primer (16S-Rgant: 5 –3 GTGCAAAGGTAGCATAATCA) was
scorpion-specific, non-degenerate and designed by Gantenbein et
al. (1999). They referred to it as a reverse primer, but it is a ver-
sion of the “universal” primer 16Sbr or LR-J-12887 (Simon et al.,
1994) corresponding to nucleotides 13,328 (not 12,218)-13,310 near
the 5 end of the 16S rRNA gene of Drosophila melanogaster. In
combination with 16S-Rgant, a new degenerate reverse primer
(16S-R06: 5 –3 TAATYCAACATCGAGGTCAYAAACT) was designed by
P.D.R. to amplify more consistently the 16S rDNA target in Buthi-
dae. It corresponds to nucleotides 362–419 near the 3 end of the
16S rRNA gene of the tick Haemaphysalis cretica (Black and Peisman,
1994).
Each 50 ␮l PCR reaction mixture consisted of 1× Promega buffer,
1.5 mM MgCl2 , 60 ␮M each dNTP, 0.5 ␮M each of the two primers
and 1.5 units of Taq DNA polymerase (Promega). DNA amplification
was performed in a Techne-Genius thermocycler with the following
amplification cycles: denaturation at 94 ◦ C for 3 min; 40 cycles of
denaturation at 94 ◦ C for 30 s, annealing at 47 ◦ C for 30 s, extension
at 72 ◦ C for 90 s; a final extension at 72 ◦ C for 10 min; and a hold at
4 ◦ C. The size and quantity of the amplified DNA fragments were
determined by submerged horizontal gel electrophoresis, using
1.5% agarose gels along with DNA standards (Promega PCR Markers
G316A). The DNA in each excised gel fragment was purified with
glassmilk (Geneclean II Kit, BIO 101 Inc.) and each strand directly
sequenced using one of the PCR primers (3.2 pmoles) and the ABI
Prism® Big DyeTM Terminator Cycle Sequencing Ready Reaction Kit
(versions 2.0 and 3.1, PE Applied Biosystems). The extension prod-
ucts were purified by ethanol precipitation and their sequences
were resolved using an ABI 373A or 377 automated system, all
according to ABI protocols (PE Applied Biosystems).
2.4. Phylogenetic analysis
The nucleotide sequences of 303–304 base-pairs (bp) were
manually edited using Sequencher 3.1.1 software (Gene Codes Cor-
poration), which was also used for making alignments based on
the secondary structure model given by Black and Peisman (1994).
For phylogenetic analysis, the 16S rDNA region of B. occitanus
from Banyuls, France (AN: AJ518826; Gantenbein and Largiadèr,
2003) was used as an outgroup. Also included were homologous
sequences of A. amoreuxi from Morocco (GenBank accession num-
ber: AY226175; Fet et al., 2003) and A. australis from Nefta, Tunisia
(GenBank accession number: AJ506868; Gantenbein and Largiadèr,
2003).
Initial sequence comparisons and measures of variability were
performed using MEGA version 3.1 (Kumar et al., 2001). Transi-
tion/transversion ratios and the ␣-parameter of the ␥ distribution
of rate variation among sites were estimated using TREE-PUZZLE
version 5.0 (Schmidt et al., 2002).
All phylogenetic analyses by maximum parsimony (MP) were
conducted using PAUP* version 4.0b (Swofford, 2002). All charac-
ters were treated as equally weighted in the MP heuristic searches,
with inactive steepest descent option, tree bisection reconnection
(TBR) branch-swapping option, and 10,000 random-taxon addition
sequences to search for optimal trees. Support for nodes in MP
reconstructions was assessed using nonparametric bootstrapping
(Felsenstein, 1985) with 1000 full heuristic pseudo-replicates (10
random-taxon-addition sequence replicates per bootstrap pseudo-
replicate).
The Bayesian approach to phylogenetic reconstruction
(Huelsenbeck et al., 2001; Yang and Rannala, 1997) was imple-
mented using MrBayes 3.0B4 (Huelsenbeck and Ronquist, 2001).
80 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85

Table 2
Sampling sites, number of specimens analysed and 16S rDNA haplotypes obtained for each morphospecies (N: 16S rDNA lineage predominating north of the Chott el Jerid. S:
16S rDNA lineage predominating south of the Chott el Jerid).

Morpho-species Sampling sites Number of specimens 16S rDNA haplotypes (lineage)

(subspecies of A. australis)

A. aeneas 1 Monastir 1 male Andr01 (A. aeneas)

4 Sidi Bouzid 1 female Andr02 (A. aeneas)
1 male Andr04 (A. aeneas)
13 Medenine 1 male Andr03 (A. aeneas)

Total specimens = 4 Total haplotypes = 4

A. amoreuxi 7 Hezoua 1 male Andr05 (A. amoreuxi)

8 Mahboubine, 1 female
Djerba island 1 male
12 Blidet 1 female

Total specimens = 4 Total haplotypes = 1

A. australis 2 Kraten, 1 female (garzonii) Andr10 (A. australis N)

Kerkennah island 1 female (garzonii) Andr11 (A. australis N)
3 Sidi Youssef, Kerkennah island 1 female (hector)
4 Sidi Bouzid 1 male (garzonii) Andr10 (A. australis N)
1 female (garzonii)
5 Gafsa 1 female (garzonii)
6 Tozeur 1 female (garzonii)
1 female (hector)
7 Hezoua 1 male (garzonii)
1 female (hector)
1 male (hector) Andr14 (A. australis N)
1 female (hector)
1 male (garzonii)
9 Midoun, Djerba island 2 male (garzonii) Andr10 (A. australis N)
1 male (hector) Andr13 (A. australis N)
X Ajim, Djerba island 1 male (garzonii) Andr10 (A. australis N)
1 male (hector)
1 male (garzonii) Andr06 (A. australis S)
X1 Gabes 1 female (garzonii) Andr12 (A. australis N)
1 male (garzonii) Andr08 (A. australis S)
12 Blidet 1 male (garzonii) Andr09 (A. australis S)
1 female (garzonii)
13 Medenine 1 female (garzonii) Andr07 (A. australis S)
1 male (hector)
2 male (garzonii) Andr06 (A. australis S)
2 female (garzonii)
14 BaniKhdech 2 male (garzonii) Andr07 (A. australis S)
1 female (garzonii)

Total specimens = 32 Total haplotypes = 9

All 3 species Total specimens = 40 Total haplotypes = 14

The 16S rDNA region was analysed as a single, non-partitioned
fragment. We used two parallel searches of four Markov chains
(one cold and three heated) under default temperatures. Markov
chain length was set at 1,000,000 generations, and sampled
every 100 generations where the first 10% of tree samples were
discarded as burn-in. Model parameter values were estimated
according to the HKY +G model of nucleotide substitution as
selected by the program MODELTEST 3.7 (Posada and Crandall,
1998). Convergence of the two MCMCs to a stationary distribution
was determined by an assessment of convergence diagnostics
in MrBayes sump. Bayesian posterior probabilities (Pbay) were
calculated from the 50% majority-rule consensus of trees sampled
every 100 generations once the Markov chain reached stationary.
using all the diagnostic morphological characters, namely A. aeneas,
A. amoreuxi, A. australis hector and A. australis garzonii.
The sample size for A. australis was increased, by including all
available adult specimens not just those characterized molecularly,
in order to test for geographical variation in the numbers of pectinal
teeth. For each sex, the number of pectinal teeth was significantly
greater for populations from north of the Chott el Jerid (Fig. 1) than
for southern populations (Table 3), but there were no significant
differences between the subspecies A. a. hector and A. a. garzonii
identified by the absence and presence of tubercles on the superior
surface of the femurs of the pedipalps, respectively. Specimens from
Gabès and the localities on the island of Djerba were not included
in this morphological analysis.

3. Results 3.2. 16S rDNA haplotypes as markers for Androctonus

3.1. Morphological variation
Immatures could not always be unambiguously scored for all
the diagnostic morphological characters (Table 1), and so only adult
specimens of A. amoreuxi and A. australis were characterized molec-
ularly. For adults, four taxa were unambiguously distinguished
taxa from Tunisia
All haplotypes were 303–304 nucleotides long (GenBank acces-
sion numbers: DQ060260–DQ060262, DQ124365, DQ144725–
DQ144734). The transition/transversion parameter was estimated
to be 1.97 (S.E. 0.26). Substitution rates varied among sites, resulting
in an overall ␣-value of 0.29 (S.E. 0.06). Base composition was biased
 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85 81

Table 3 with a deficiency of guanine (A = 29.12%, C = 17, 92%, G = 11.56%,

Mean number +SE of pectinal teeth of adult females or males of A. australis cate-
T = 41.43%).
gorized either by morphological subspecies or by geographical region (ANOVA test:
not significant if P > 0.05; highly significant if P < 0.01). No haplotype was shared by the different morphospecies
(Table 2), and so 16S rDNA provided diagnostic markers for
A. a. hector A. a. garzonii
each of the three species. Four species-specific haplotypes
Female (22) Male (16) Female (22) Male (16) (Andr01–Andr04) were obtained from four specimens of A. aeneas
25.45 ± 0.48 32.82 ± 0.71 24.11 ± 0.74 32.03 ± 0.26 (three males and one female) collected from three widespread
ANOVA, F = 1.12; P < 0.2925 (not significant) localities, two north of the Chott el Jerid and one south of this
depression (Fig. 1). In contrast, only one species-specific haplo-
North of Chott el Jerid South of Chott el Jerid type (Andr05) was obtained from four specimens of A. amoreuxi
Female (63) Male (39) Female (37) Male (29) (two males and two females) collected from three central locali-
26.05 ± 0.44 33.59 ± 0.55 23.96 ± 1.04 31.24 ± 0.38 ties, one (Hezoua) near the western end of the Chott el Jerid, one
ANOVA, F = 58.51; P < 1.31 × 10−12 (highly significant) (Blidet) just south of this depression and one (Mahboubine) on the
island of Djerba. The samples of A. australis were more widespread,
with 32 specimens collected from 12 localities and characterized
by nine species-specific haplotypes (Andr06–Andr14). Some hap-
lotypes were shared by the two subspecies A. a. garzonii and A. a.
hector, and their phylogeography is reported later.

Fig. 2. Phylogenetic tree of the mitochondrial 16S rDNA haplotypes of Androctonus species. Numbers above the branches indicate the bootstrap percentages (1000 replications)
for the majority-rule consensus tree given by maximum parsimony and the Bayesian posterior probabilities, respectively. MP and Bayesian analysis produced trees with the
same topology. GBaust: haplotype of A. australis from Nefta, Tunisia, in GenBank accession AJ506868. GBamor: haplotype of A. amoreuxi from Morocco in GenBank accession
AY226175. Bocit (outgroup): haplotype of Buthus occitanus from Banyuls, France, in GenBank accession AJ518826.
82 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85

Table 4
Sequence divergence between all Androctonus haplotypes. Uncorrected p distances (below diagonal) and HKY85 distances (above diagonal).

[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17]

[1] Andr01 0.011 0.014 0.004 0.097 0.125 0.129 0.122 0.125 0.104 0.100 0.104 0.108 0.108 0.108 0.108 0.247
[2] Andr02 0.010 0.018 0.007 0.093 0.122 0.125 0.118 0.122 0.108 0.104 0.100 0.104 0.104 0.104 0.104 0.234
[3] Andr03 0.014 0.018 0.011 0.090 0.125 0.129 0.122 0.125 0.104 0.100 0.104 0.108 0.108 0.100 0.108 0.226
[4] Andr04 0.003 0.007 0.010 0.093 0.122 0.125 0.118 0.122 0.100 0.097 0.100 0.104 0.104 0.104 0.104 0.236
[5] Andr05 0.136 0.132 0.125 0.130 0.129 0.129 0.133 0.129 0.118 0.122 0.118 0.122 0.125 0.061 0.125 0.235
[6] Andr06 0.200 0.196 0.205 0.194 0.203 0.004 0.004 0.007 0.068 0.072 0.075 0.072 0.075 0.133 0.075 0.283
[7] Andr07 0.209 0.205 0.215 0.203 0.201 0.003 0.007 0.011 0.072 0.075 0.079 0.075 0.079 0.136 0.079 0.280
[8] Andr08 0.202 0.198 0.208 0.196 0.210 0.010 0.014 0.011 0.072 0.075 0.079 0.075 0.079 0.136 0.079 0.296
[9] Andr09 0.200 0.196 0.205 0.194 0.203 0.010 0.013 0.013 0.068 0.072 0.075 0.072 0.075 0.133 0.075 0.283
[10] Andr10 0.164 0.172 0.169 0.159 0.177 0.079 0.085 0.087 0.084 0.004 0.007 0.004 0.007 0.125 0.007 0.292
[11] Andr11 0.159 0.167 0.163 0.153 0.183 0.084 0.089 0.092 0.088 0.003 0.011 0.007 0.011 0.129 0.011 0.280
[12] Andr12 0.166 0.158 0.171 0.160 0.179 0.089 0.094 0.097 0.093 0.007 0.010 0.004 0.007 0.125 0.007 0.316
[13] Andr13 0.172 0.164 0.177 0.166 0.180 0.090 0.096 0.099 0.095 0.004 0.007 0.004 0.004 0.129 0.004 0.303
[14] Andr14 0.173 0.165 0.178 0.167 0.186 0.089 0.094 0.097 0.094 0.007 0.010 0.007 0.004 0.133 0.007 0.316
[15] GenB amoreuxi 0.161 0.157 0.150 0.155 0.070 0.216 0.226 0.229 0.223 0.195 0.201 0.197 0.199 0.205 0.133 0.118
[16] GenB australis 0.183 0.175 0.188 0.177 0.197 0.095 0.101 0.103 0.100 0.010 0.014 0.010 0.004 0.003 0.215 0.199
[17] Buth AJ518826 0.144 0.141 0.137 0.141 0.137 0.155 0.155 0.159 0.155 0.159 0.155 0.166 0.162 0.166 0.166 0.126

3.3. Phylogeny of the 16S rDNA haplotypes of
Androctonus morphospecies
Of 305 aligned bases with the haplotype of B. occitanus as
outgroup, 79 sites were variable and 56 sites were parsimony-
informative. The MP heuristic search on the combined dataset
found 136 equally parsimonious trees of 2587 steps. The MP
majority-rule consensus tree (with 1000 replicates) resolved the
haplotypes of Androctonus into well-supported clades (bootstrap
support >75%) on two primary branches: one branch with the two
sister clades of A. aeneas and A. amoreuxi; and, a second branch
with two clades containing all the haplotypes of A. australis (Fig. 2).
Based on this phylogeny of their 16S rDNA haplotypes, each of the
three morphospecies is monophyletic, but A. a. garzonii and A. a.
hector are not monophyletic subspecies because both were found
in each of the two well-supported clades of A. australis (Fig. 2). The
MP majority-rule consensus tree was congruent with that yielded
by Bayesian analysis.
Four out of the nine haplotypes of A. australis were shared by
both subspecies: Andr11 in Kraten and Sidi Youssef on the more
northerly archipelago of Kerkennah; Andr14 in Hezoua, north of
the Chott el Jerid; Andr10 in Hezoua and nearby Tozeur, as well as
in Ajim on the island of Djerba; and, Andr07 in Medenine, south
of the Chott el Jerid. Of the other five haplotypes, three (Andr08,
Andr12, Andr13) were found in single specimens, one (Andr09)
came from two specimens collected in a single location, and so
only one haplotype (Andr06) was relatively abundant (five spec-
imens from 2 localities) but restricted to a single subspecies (A. a.
garzonii). In total, only three haplotypes were found in more than
one locality, and the two more frequent ones occurred in both sub-
species: Andr10 was widespread (seven of 12 localities), but only
north of the Chott el Jerid (5 localities, including one of the Kerken-
nah islands) or on the island of Djerba (two localities); and, Andr11
was restricted to two nearby Kerkennah islands.
These distribution patterns indicate that humans are unlikely to
be dispersing A. australis across the Chott el Jerid.

3.5. Molecular clock and estimation of divergence times

3.4. Phylogeography of 16S rDNA haplotypes of
A. australis in Tunisia
All the phylogenetic analyses placed the haplotypes of A. aus-
tralis in two groups with well-supported long branches (bootstrap
support 99%) (Fig. 2). These two lineages are geographical and not
taxonomic, because each contains both of the morphological sub-
species, A. a. garzonii and A. a. hector.
Each of the two clades or lineages of A. australis contained hap-
lotypes that predominated only north or south of the Chott el Jerid
(Fig. 1, Table 2). The northern lineage (N) contained five haplo-
types (Andr10–Andr14), and most of the specimens (13/19) were
collected north of the Chott, with just five (two male A. a. hector
and three male A. a. garzonii) coming from the island of Djerba,
and only one (a female A. a. garzonii) collected from mainland
Gabès at the eastern end of the Chott. In contrast, the southern
lineage (S) contained four haplotypes (Andr06–Andr09), and most
of the specimens (11/13) were collected south of the Chott, with
just two co-occurring with the northern lineage on the island
of Djerba (a male A. a. garzonii) and in Gabès (a male A. a. gar-
zonii).
Of the eight specimens of A. a. hector, five came from north of
the Chott el Jerid, two from the island of Djerba and just one from
south of the Chott, in Medenine. This regional distribution was not
shared by A. a. garzonii (24 specimens), which predominated north
of the Chott el Jerid (eight specimens), in the intermediate localities
(six specimens from Gabès and the island of Djerba) and south of
the Chott (10 specimens).
A likelihood ratio test (LRT) on the presence of a molecular clock
was performed according to Huelsenbeck and Crandall (1997). The
LRT was significant (LRT = 17.86, d.f. = 15, P < 0.05), and therefore a
clock-like evolution of the 16S rDNA sequences was assumed. Diver-
gence dates for 16S rDNA lineages were estimated using a rate of
divergence between pairs of haplotypes of 2.3% per million years
(p.m.y.) (Brower, 1994) or 1.0% p.m.y. (Gantenbein and Largiadèr,
2002, 2003). MODELTEST (Posada and Crandall, 1998) determined
that the HKY model with ␥-distributed rates (HKY +G) (Hasegawa
et al., 1985) was the statistically appropriate model for the data
set with the outgroup sequence of B. occitanus. HKY85 distances
are given in Table 4, along with the uncorrected genetic (p) dis-
tances. The divergence estimates were 6.91–21.5 m.y.a. for A. aeneas
from A. australis (p = 15.9–21.5%), 7.69–21.0 m.y.a. for A. amoreuxi
from A. australis (p = 17.7–21.0%), and 5.43–13.60 m.y.a. for A. aeneas
from A. amoreuxi (p = 12.5–13.6%). The genetic distances between
pairs of haplotypes varied greatly within each of the three species’
clades: 0.3–1.8% between the Tunisian haplotypes of A. aeneas; 7.0%
between the Tunisian and Moroccan haplotypes of A. amoreuxi,
with an estimated divergence date of 3.04–7.00 m.y.a.; and 7.9–9.9%
between the two Tunisian clades of A. australis, with an estimated
divergence date of 3.43–9.90 m.y.a.
4. Discussion
The phylogenetic analyses of mitochondrial 16S rDNA haplo-
types indicated that the specimens of Androctonus sampled from
 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85
central and southern Tunisia belonged to three well-supported
monophyletic clades, corresponding to the morphospecies A.
aeneas, A. amoreuxi and A. australis (Fig. 2). These three phylogenetic
species showed different levels of mtDNA diversity. Four haplo-
types of a single mtDNA lineage were detected in four specimens
of A. aeneas collected from three localities, compared with only one
mtDNA haplotype in four specimens of A. amoreuxi from three local-
ities, and 4–5 haplotypes in each of two regional mtDNA lineages
in 32 specimens of A. australis from 12 localities. Each of the two
regional mtDNA lineages of A. australis contained A. a. hector and A.
a. garzonii, and so neither of these two morphological subspecies
was proven to be monophyletic.
In contrast, Ben Ali et al. (2000) did not resolve the phylogenetic
relationships among these three species of Tunisian Androctonus
based on a Neighbor-Joining (NJ) analysis of the genetic distances
between the alleles of the Internal Transcribed Spacers in the
nuclear ribosomal rRNA gene array (ITS-rDNA). The two alleles of A.
aeneas were monophyletic, but their branch was sister to just one
of the four alleles of A. amoreuxi, and monophyly was not demon-
strated for A. amoreuxi, A. australis, A. a. hector (4 alleles) and A. a.
garzonii (4 alleles). Ben Ali et al. (2000) concluded that A. aeneas
might be a race of A. amoreuxi, even though it is “. . . easily recog-
nizable by its uniformly black cuticle”. However, their analysis did
not support this conclusion because, together or alone, A. aeneas
and A. amoreuxi were not resolved as phylogenetic species. They
reported no regional distribution of the alleles of any species.
Later, an analysis of genetic distances between populations of
Tunisian scorpions characterized at 18 nuclear allozyme loci (Ben
Othmen et al., 2004) produced a tree topology that also did not
support the monophyly of A. amoreuxi and A. australis: all five pop-
ulations of A. amoreuxi grouped together, but this group had low
bootstrap support (28%) and was placed within one of the two
groups containing all nine subspecific populations of A. australis.
Each of the two groups of the paraphyletic A. australis had low boot-
strap support (29%) and contained both A. a. hector and A. a. garzonii,
providing no support for the monophyly of these two subspecies.
All three investigations of Tunisian scorpions failed to detect
monophyletic subspecies of A. australis, and only the mtDNA tree
was congruent with the species tree. In part, this can be explained
by the different analytical approaches: the DNA analyses related
haplotypes or alleles from individual scorpions of all four taxa,
whereas the alloenzyme investigation did not include A. aeneas and
related the allele frequencies of populations of A. australis that may
well have included both mtDNA lineages. The absence of phyloge-
netic signal from the nuclear ITS-rDNA might have resulted from
the misidentification of small specimens of some morphospecies.
Goyffon and Lamy (1973) noted that the presence of four tubercles
on the femurs of the pedipalps of A. a. garzonii is easy to detect by
the naked eye for light-coloured adults, but not for dark-coloured
adults or immature scorpions. We also found it difficult to distin-
guish immatures of A. amoreuxi and A. australis based on the shape
of the “tail” (or metasoma), and so only adults were used for mtDNA
characterization.
Before drawing conclusions about the taxonomic and biologi-
cal status of Tunisian Androctonus, it is first necessary to consider
geographical variation. All three Androctonus species are endemic
in the semi-arid and arid bioclimate zones of Tunisia to the south
of the Tel Atlas range, but their distributions were found to differ
within these central and southern parts of the country (Ben Ali et
al., 2000; Ben Othmen et al., 2004; Fig. 1, Table 2). The black scor-
pion A. aeneas was widespread latitudinally, but it was collected
only in three eastern littoral localities on the mainland. The taper-
ing “tailed”, light brown scorpion A. amoreuxi was more widespread
longitudinally, including the island of Djerba and the archipelago
of Kerkennah in the Mediterranean. However, except for a northern
collection on Kerkennah (Ben Othmen et al., 2004), all the speci-
83
mens came from close to the Chott el Jerid or south of it, including
Douz and Remeda (Ben Ali et al., 2000). In contrast, the fat “tailed”,
light brown scorpion A. australis was widespread both latitudinally
and longitudinally. It was collected with the other two species from
all their localities except two, and from additional localities includ-
ing Douz, Ercifa and Remeda (Ben Ali et al., 2000). In most localities
A. australis was numerically predominant.
The mtDNA investigation revealed two regional lineages of A.
australis (Fig. 2), each predominating only north or south of the
Chott el Jerid and only co-occurring in a contact zone to the east of
the Chott, in Gabès and on the island of Djerba (Table 2, Fig. 1). The
alloenzyme analysis did not demonstrate any geographical pattern
(Ben Othmen et al., 2004). The suitability of mtDNA for phylogeo-
graphic analyses of arthropods (Avise, 2000) is usually explained
by the maternal inheritance and the infrequency of recombination
of the mitochondrial genome.
A clock-like evolution of the mtDNA sequences can be assumed,
because of the significant likelihood ratio test given by the test of
Huelsenbeck and Crandall (1997). The two lineages of A. australis
in Tunisia originated about 3.43–9.90 m.y.a., based on a pairwise
sequence divergence of 2.3% p.m.y. (Brower, 1994) to 1% p.m.y.
(Gantenbein and Largiadèr, 2002, 2003). These dates do not cor-
relate with the alternative dates for the formation of the Chott el
Jerid, which are 65 m.y.a. if it is the remains of an Eocene inland
sea (Levy and Amitai, 1980), or 90,000–150,000 y.a. if it is a conti-
nental lake formed by both tectonic and climate changes (Fontes
et al., 1983; Ben Ouezdou, 1998; Causse et al., 2003). In fact, the
dating of the divergence between the lineages of A. australis is sim-
ilar to that (about 3.04–10.00 m.y.a.) for the Moroccan and Tunisian
lineages of B. occitanus (Gantenbein and Largiadèr, 2002, 2003) or
that (about 3.04–7.00 m.y.a.) for the Moroccan haplotype (Fet et
al., 2003) and the Tunisian haplotype of A. amoreuxi. Consequently,
we conclude that the Chott el Jerid is unlikely to have formed the
barrier generating the vicariant evolution of the two lineages of A.
australis, although it may well have impeded their mixing following
secondary contact.
The divergence of the two lineages of A. australis in Tunisia might
be associated with vicariance events involving other physical or
ecological barriers. In their paper describing A. a. garzonii, Goyffon
and Lamy (1973) proposed that this subspecies is restricted to the
low-altitude arid and saline plains of Algeria and Tunisia, to the
south and east of the submontane steppic plateaux of Algeria where
only A. a. hector occurs. However, Goyffon and colleagues did little
sampling for geographic variation (Goyffon and Lamy, 1973; Lamy
et al., 1974a,b): all their A. a. hector came from one plateau locality
(Djelfa) in centre-north Algeria; only one specimen of A. a. garzonii
was reported from the southern plains of Algeria (Beni-Abbès); and,
all the Tunisian samples came from two localities (Gafsa and Mede-
nine) on or near the plains, where only A. a. garzonii and two hybrid
females were collected. Moreover, the presence of only A. a. hector
on the Algerian plateaux relied on general statements by Vachon
(1951, 1952a,b), which were made before Goyffon and Lamy (1973)
described the characters distinguishing the subspecies.
In the current report, all scorpions were collected on or near
the plains of central-southern Tunisia. Only A. a. garzonii, not A.
a. hector, was found at moderate altitudes in the localities of Sidi
Bouzid (312 m a.s.l.), Gafsa (297 m a.s.l.) and Banikhdech (491 m
a.s.l.) (Fig. 1). Most scorpions were collected on the plains at alti-
tudes below 100 m a.s.l., where both morphological subspecies of
A. australis were present. They co-occurred and always shared the
same mtDNA haplotypes or lineage, north of the Chott el Jerid in
Tozeur (sharing haplotype Andr10), west of the Chott in Hezoua
(sharing haplotypes Andr10 and Andr14), south of the Chott in
Medenine (sharing haplotype Andr07), and within the contact zone
for the mtDNA lineages in Ajim on the island of Djerba (sharing
haplotype Andr10). However, A. a. hector did appear to exhibit an
84 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85
association with the northern mtDNA lineage (7/8 specimens) and
northern region (4/8 specimens from north of the Chott el Jerid, and
only 1/8 to the south). In comparison, A. a. garzonii was equally asso-
ciated with both mtDNA lineages (12 specimens with the northern
and 12 specimens with the southern lineage) and both regions
(8/24 specimens from north of the Chott el Jerid, and 10/24 to the
south). However, the association of the subspecies with different
mtDNA lineages was not significant (Chi-squared with Yates cor-
rection = 2.116; P > 0.5), and larger samples are required to resolve
this. Previous results showed the same regional pattern (Ben Ali et
al., 2000; Ben Othmen et al., 2004), with 19/25 A. a. hector being
collected north of the Chott el Jerid. This Chott was also associated
with a change in the number of pectinal teeth (Table 3), with the
divergence again being geographical rather than subspecific.
In total, these regional and mtDNA associations are consistent
not only with the hypothesis that the morphology associated with
A. a. garzonii predominates in the southeast of Tunisia (Goyffon and
Lamy, 1973), but also with the conclusion that there is geograph-
ical differentiation between Tunisian populations of A. australis
which is not strictly associated with subspecies (Ben Othmen et
al., 2004). Moreover, some hypotheses can be refuted: Goyffon and
Lamy (1973) wrongly concluded that A. a. hector does not occur
on the plains of Tunisia and can be distinguished from A. a. gar-
zonii by the number of pectinal teeth; and, Goyffon (1992) and Ben
Othmen et al. (2004) incorrectly suggested that recent range exten-
sions of A. australis have been promoted by human activities, which
is incompatible with the greater genetic differentiation reported for
island populations (Ben Othmen et al., 2004) and with the regional
distributions of mtDNA lineages.
Less clear is the status of some taxa of Androctonus previously
reported from Tunisia. Based on morphology (Table 1) and mtDNA
phylogeny (Fig. 2), both A. aeneas and A. amoreuxi are good phylo-
genetic species in Tunisia, and Fet and Lowe (2000) concluded that
these are valid names. However, we do not follow Fet and Lowe
(2000) in treating these two taxa as subspecies, because there is
no evidence that the putative subspecies are allopatric. It does not
help that there are no types available for redescribing the taxa and
that the type locality of A. aeneas is unknown.
The taxonomy of A. australis is more complicated. Many compli-
cations have arisen because of a failure to follow good taxonomic
practice: types have been lost (A. a. australis, A. a. hector), their
depository not given (A. a. garzonii), or they have not been prop-
erly designated (A. a. africanus) (Fet and Lowe, 2000). However,
there has also been a failure to apply either the phylogenetic species
concept or the biological species concept. Thus, A. a. africanus was
described by Lamy et al. (1974b) based on the haemocyanin pro-
files of a female from south Tunisia and her 28 offspring, all of
which were morphologically indistinguishable from A. a. garzonii.
The female had a haemocyanin profile that was deduced to be a
mixture of the profile of A. a. garzonii (g) and of a new profile of A. a.
africanus (a), because the ratio of the three genotypic profiles found
in the offspring was 2 ga: 1 gg: 1 aa (Lamy et al., 1974b). However,
this only demonstrated that the haemocyanin bands are inherited
Mendelianly, not that each of the two homozygous states (gg, aa)
is diagnostic for one of two species. Based on the ratio of offspring
genotypes, the father must also have been a putative hybrid (ga)
like the mother and, therefore, such “hybrids” are able to produce
viable offspring, which is inconsistent with strong reproductive iso-
lation. A similar investigation of a female and her 68 offspring from
Medenine, Tunisia, had found that she and 38 of the offspring had
a mixture of the haemocyanin profiles of A. a. garzonii (g) and A.
a. hector (h) and 30 of the offspring had the profile of A. a. gar-
zonii, but once again the authors (Goyffon and Lamy, 1973; Lamy et
al., 1974a) failed to note that these Mendelian ratios did not pro-
vide proof of species status. The approximately 1 ga: 1 gg ratio of
genotypic profiles indicated that the father had been homozygous
(gg) and, therefore, that at least one back-cross is fertile. In con-
clusion, these reports failed to demonstrate that A. a. hector, A. a.
garzonii and A. a. africanus are good biological species or good phylo-
genetic subspecies, because no population genetics was carried out
to prove, respectively, the absence of frequent hybridization or the
existence of allopatric distributions of morphotypes and genotypes.
This conclusion has been reinforced by the previous investigations
in Tunisia (Ben Ali et al., 2000; Ben Othmen et al., 2004) as well as
the current mtDNA analysis. Therefore, we recommend that no sub-
species of A. australis should be recognized, and we follow recent
taxonomic reviews in synonymizing with it the taxa A. hector and
A. libycus (Fet and Lowe, 2000), as well as the taxa A. garzonii and A.
africanus (Lourenco, 2005). “hector” and “garzonii” should only be
considered morphological forms.
Further genetic investigations of Androctonus should be carried
out in Tunisia to investigate any associations between the four phy-
logenetic lineages of mtDNA and stinging rates or severe or lethal
outcomes defined as scorpionism. Most of the scorpion stings in
Tunisia occur in the centre and south of the country (Sidi Bouzid,
Sfax, Gafsa and Tozeur, in particular) and are assumed to involve A.
australis (Chippaux and Goyffon, 2008). This should be confirmed
by using the morphological and mtDNA markers associated in the
current report. Chippaux and Goyffon (2008) compared reports
from the central Tunisian governorates of Sidi Bouzid and Sfax,
which demonstrated large differences in the annual mortality from
stings (6.67 and 2.83 per 100,000 inhabitants, respectively) that
were approximately proportional to the annual number of scorpion
stings in each governorate (1280–1500 and 600 per 100,000 inhab-
itants, respectively). Future investigations should clarify which
scorpion species is responsible for most stings and envenomations
in each region, and if any species or venom genotypes (potentially
linked to morphological form) are associated with a higher risk of
scorpionism. The current report demonstrates that both morpho-
logical forms (garzonii and hector) of A. australis are common in
the centre and south of Tunisia, and so it would be prudent for the
Institut Pasteur de Tunis to produce anti-venom by using both mor-
phological forms. These should be collected both north and south
of the Chott el Jerid, because of new evidence of regional mtDNA
variation and past reports of regional toxin variation (El Ayeb and
Rochat, 1985; Goyffon, 1984; Goyffon and El Ayeb, 2002). Toxicol-
ogists should cease referring to “A. australis Hector” because it is
taxonomically incorrect, and also they should not focus on this
morphological form because it has no proven association with an
increased risk of scorpionism.
Acknowledgements
We thank OuldBrhim for helping to collect scorpions; Katherine
Richardson, Clare Stace and Parviz Parvizi for technical assistance
in the Molecular Systematics Laboratory, NHM; and Maha Benlarbi
for helping to organize the stay of A.B.O. in London.
References
Anglade, F., Ricordel, I., Goyffon, M., 1990. Données spectroscopiques sur la fluores-
cence de la cuticule de scorpion. Bull. Soc. Eur. Arach. 1, 5–9.
Avise, J.C., 2000. Phylogeography: The History and Formation of Species. Harvard
Univ. Press, Cambridge, MA, pp. 1–447.
Ben Ali, Z., Boursot, P., Said, K., Lagnel, J., Chatti, N., Navajas, M., 2000. Comparison of
ribosomal ITS regions among Androctonus ssp. scorpions (Scorpionida: Buthidae)
from Tunisia. J. Med. Entomol. 37, 787–790.
Ben Othmen, A., Chatti, N., Ben Ali-Haouas, Z., Ouldbrahim, I., Said, K., 2004.
Allozymic differentiation of Tunisian populations of Androctonus species and
Buthus occitanus (Scorpiones: Buthidae). Biol. J. Linn. Soc. 81, 255–265.
Ben Ouezdou, H., 1998. Sur l’hypothèse de la mer saharienne Quaternaire: anal-
yse du contexte géomorphologique et géologique de l’évolution récente des
chotts algéro-tunisiens et du seuil d’Ouedref (Tunisie). C. R. Acad. Sci. Paris 308,
767–772.
 A. Ben Othmen et al. / Acta Tropica 112 (2009) 77–85
Black, W.C., Peisman, J., 1994. A phylogeny of hard and soft tick taxa based on
mitochondrial 16S ribosomal DNA sequences. Proc. Natl. Acad. Sci. U.S.A. 91,
10034–10038.
Brower, A.V.Z., 1994. Rapid morphological radiation and convergence among races
of the butterfly Heliconius erato inferred from patterns of mitochondrial DNA
evolution. Proc. Natl. Acad. Sci. U.S.A. 91, 6491–6495.
Causse, C., Ghaleb, B., Chkir, N., Zouari, K., Ben Ouezdou, H., Mamou, A., 2003. Humid-
ity changes in southern Tunisia during the late Pleistocene from U–Th dating of
mollusc shells. Appl. Geochem. 18, 1691–1703.
Chippaux, J.-P., Goyffon, M., 2008. Epidemiology of scorpionism: a global appraisal.
Acta Trop. 107, 71–79.
Chomczynski, P., Mackey, K., Drews, R., Wilfinger, W., 1997. DNAzol: a reagent for the
rapid isolation of genomic DNA. BioTechniques 22, 550–553.
El Ayeb, M., Rochat, H., 1985. Polymorphism and quantitative variations of toxins in
the venom of the scorpion Androctonus australis Hector. Toxicon 23, 755–760.
Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the boot-
strap. Evolution 39, 783–791.
Fet, V., Lowe, G., 2000. Family Buthidae C.L. Koch, 1837. In: Fet, V., Sissom, W.D., Lowe,
G., Braunwalder, M.E. (Eds.), Catalog of the Scorpions of the World (1758–1998).
The New York Entomological Society, New York, pp. 54–286.
Fet, V., Gantenbein, B., Gromov, A.V., Lowe, G., Lourenço, W.R., 2003. The first molec-
ular phylogeny of Buthidae (Scorpiones) Euscorpius. Occ. Publ. Scorpiol. 4, 1–10.
Fontes, J., Coque, Ch., Dever, R., Filly, L., Mamou, A.A., 1983. Paléohydrologie iso-
topique de l’Oued el Akarit (Sud Tunisie) au Pléistocène supérieur et à l’Holocène.
Palaeogeogr. Palaeoclimatol. Palaeoecol. 43, 41–62.
Gantenbein, B., Largiadèr, C.R., 2002. Mesobuthus gibbosus (Scorpiones: Buthidae)
on the island of Rhodes Hybridisation between Ulysses’ stowaways and native
scorpions? Mol. Ecol. 11, 925–938.
Gantenbein, B., Largiadèr, C.R., 2003. The phylogenetic importance of the strait of
Gibraltar as a gene flow barrier in terrestrial arthropods: a case study with
the scorpion Buthus occitanus as a model organism. Mol. Phylogenet. Evol. 28,
119–130.
Gantenbein, B., Largiadèr, C.R., Scholl, A., 1999. First DNA phylogeny of the genus
Euscorpius (Thorell, 1876) (Scorpiones Euscorpiidae) and its bearing on the tax-
onomy and biogeography of this genus. Biogeographica (Paris) 75, 59–72.
Goyffon, M., 1984. Scorpionisme et sérums antiscorpioniques. Rev. Arachnol. 5,
311–319.
Goyffon, M., 1992. Le rôle de l’homme dans l’expansion territoriale de quelques
espèces de scorpions. Bull. Soc. Zool. Fr. 117, 15–19.
Goyffon, M., El Ayeb, M., 2002. Epidémiologie du scorpionisme. Infotox 15, 2–6.
Goyffon, M., Lamy, J., 1973. Une nouvelle sous-espèce d’Androctonus australis L. (Scor-
piones, Buthidae): A. australis garzonii n. ssp. Caractéristiques morphologique,
écologiques et biochimiques. Bull. Soc. Zool. Fr. 98, 137–144.
Goyffon, M., Lamy, J., Vachon, M., 1970. Identification de trois espèces de scorpions
du genre Androctonus à l’aide du protéinogramme de leurs hémolymphe en gel
de polyacrylamide. C. R. Acad. Sci. Paris D 270, 3315–3317.
Goyffon, M., Vachon, M., Broglio, N., 1982. Epidemiological and clinical characteris-
tics of the scorpion envenomation in Tunisia. Toxicon 20, 337–344.
Hasegawa, M., Kishino, M., Yano, T., 1985. Dating the human-ape split by a molecular
clock of mitochondrial DNA. J. Mol. Evol. 22, 160–174.
85
Huelsenbeck, J.P., Crandall, K.A., 1997. Phylogeny estimation and hypothesis testing
using maximum likelihood. Annu. Rev. Ecol. Syst. 28, 437–466.
Huelsenbeck, J.P., Ronquist, F.R., 2001. MrBayes: Bayesian inference of phylogeny.
Bioinformatics 17, 754–755.
Huelsenbeck, J.P., Ronquist, F., Nielsen, R., Bollback, J.P., 2001. Bayesian infer-
ence of phylogeny and its impact on evolutionary biology. Science 294,
2310–2314.
Keegan, H.L., 1998. Scorpions of Medical Importance. Fitzgerald Press, edition The
University Press of Mississippi, London, pp. 1–140.
Kumar, S., Tamura, K., Jakobsen, I.B, Nei, M., 2001. MEGA2: molecular evolutionary
genetics analysis software. Bioinformatics 17, 1244–1245.
Lamy, J., Le Pape, G., Goyffon, M., Weill, J., 1974a. Sur l’obtention de scorpions de la
sous-espèce Androctonus australis garzonii Goyffon et Lamy à partir d’une femelle
hybride sérologique. Confirmation de la validité des critères de détermination
utilisés. C. R. Acad. Sci. Paris D 278, 129–132.
Lamy, J., Le Pape, G., Weill, J., 1974b. Hétérogénéité de l’espèce Androctonus australis L.
(Scorpions, Buthidae). Création d’une nouvelle sous-espèce, A. australis africanus
n. ssp. sur la base de critères biochimiques et génétiques. C. R. Acad. Sci. Paris D
278, 3223–3226.
Levy, G., Amitai, P., 1980. Fauna palaestina. Arachnida I: Scorpiones. Israel Acad. Sci.
Humanities Jerusalem, 1–132.
Lourenco, W.R., 2005. Nouvelles considérations taxonomiques sur les espèces du
genre Androctonus Ehrenberg, 1828 et description de deux nouvelles espèces
(Scorpiones Buthidae). Rev. Suisse Zool. 112, 145–171.
Lourenço, W.R., Cuellar, O., 1995. Scorpions, scorpionism, life history strategies and
parthenogenesis. J. Venom. Anim. Toxins 1, 51–62.
Posada, D., Crandall, K.A., 1998. MODELTEST: testing the model of DNA substitution.
Bioinformatics 14, 817–818.
Schmidt, H.A., Strimmer, K., Vingron, M., von Haeseler, A., 2002. TREE-PUZZLE: max-
imum likelihood phylogenetic analysis using quartets and parallel computing.
Bioinformatics 18, 502–504.
Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H., Flook, P., 1994. Evolution, weight-
ing, and phylogenetic utility of mitochondrial gene sequences and a compilation
of conserved polymerase chain reaction primers. Ann. Entomol. Soc. Am. 87,
651–701.
Swofford, D.L., 2002. PAUP*: Phylogenetic analysis using parsimony (*: and other
methods), version 4.0b. Smithsonian Institution Press, Washington, DC.
Vachon, M., 1948. Biogéographie des scorpions de Nord de l’Afrique. Arch. Inst.
Pasteur Alger. 26, 61–65.
Vachon, M., 1951. Biogéographie des Scorpions du Nord de l’Afrique. C. R. Soc. Bio-
geogr. 28, 61–65.
Vachon, M., 1952a. Etudes sur les Scorpions. Institut Pasteur d’Algérie, Algiers, pp.
1–482.
Vachon, M., 1952b. Essai d’une biogéographie des scorpions tunisiens. 70ème Congr.
A.F.A.S. Tunis 4, pp. 1–6.
Vachon, M., 1958. Mission scientifique au Tassili des Ajjer (1949) Zoologie pure et
appliquée. Scorpions. Trav. Inst. Tech. Sahar. Univ. Alger Zool. 3, 177–193.
Yang, Z., Rannala, B., 1997. Bayesian phylogenetic inference using DNA sequences: a
Markov chain Monte Carlo method. Mol. Biol. Evol. 14, 717–724.