MINERVA BIOTEC 2008;20:51-5
Gene silencing in thalassemia
The β-thalassemias are characterized by a very hetero-
geneous group of inherited mutations causing abnor-
mal expression of globin genes, leading to total absence
or quantitative reduction of synthesis of β-globin chains.
The reduction of β-globin chains is associated with a
corresponding excess of the complementary α-globin
chains in erythroid cells, causing premature hemoly-
sis of red blood cells and destruction of erythroid pre-
cursors in the bone marrow and extramedullary sites
(ineffective erythropoiesis). Several molecules appear to
be not necessary or even harmful to the erythroid cell,
i.e. abnormal β-globin mRNA molecules (for instance
in the case of aberration of splicing) and α-globin mRNA
molecules, present in large excess. In agreement, inhi-
bition of the expression of abnormal β- or α-globin
mRNAs could be beneficial. Gene silencing could be of
interest also in experimental therapy employing acti-
vation of the expression of human γ-globin genes by
interfering with transcriptional repressors. The con-
clusion of the experiments described in the present
review is that experimental therapy of β-thalassemia is
commonly dedicated to induce the forced expression
(by gene therapy and gene corrections of the mutations)
of the adult not functional β-globin gene. On the other
hand induction of fetal γ-globin genes can be achieved
by inhibiting putative transcription repressors. Finally,
Acknowledgements and Fundings.—R.G. is granted by Fondazione
Cariparo (Cassa di Risparmio di Padova e Rovigo), AIRC, Cofin-2005, by
STAMINA Project (University of Ferrara), by UE ITHANET Project
(eInfrastructure for the Thalassaemia Research Network) and by Telethon
(contract GGP07257). This research is also supported by Regione Emilia-
Romagna (Spinner Project) and by Associazione Veneta per la Lotta alla
Talassemia (AVLT), Rovigo.
Received on May 25, 2008.
Accepted for publication on June 3, 2008.
Address reprint requests to: R. Gambari, Department of Biochemistry
and Molecular Biology, University of Ferrara, Via Fossato di Mortara 74,
44100 Ferrara, Italy. E-mail: gam@unife.it
Vol. 20 - No 1. MINERVA BIOTECNOLOGICA
N. BIANCHI, M. BORGATTI, R. GAMBARI
GenTech-for-Thal, Department of Biochemistry and
Molecular Biology
University of Ferrara, Ferrara, Italy
Laboratory for the Development of Pharmacological and
Pharmacogenomic Therapy of Thalassaemia
Biotechnology Center
University of Ferrara, Ferrara, Italy
in addition to this primary issue, the inhibition of the
excess of α-globin mRNA might turn to be an approach
able to ameliorating the clinical parameters of β-tha-
lassemia.
Key words: Gene silencing - Oligonucleotides - Globins -
Fetal hemoglobin - Beta-thalassemia.
he β-thalassemias are characterized by a very het-
T erogeneous group of inherited mutations causing
abnormal expression of globin genes, leading to total
absence or quantitative reduction of synthesis of β-glo-
bin chains.1-3 This disease is frequent in the Mediter-
ranean area, in Middle-East, in Africa and Asia. The
reduction of β-globin chains is associated with a corre-
sponding excess of the complementary α-globin chain
in erythroid cells, that causes premature hemolysis of red
blood cells and destruction of erythroid precursors in the
bone marrow and extramedullary sites (ineffective ery-
thropoiesis) (Figure 1).4-8 More than 200 different muta-
tions have been identified in β-thalassemia patients,1, 7, 9
including deletions of the β or δβ gene region, stop
codons leading to premature termination of a non func-
tional β-globin chain, mutations suppressing correct
maturation of the β-globin RNA precursor.9
51
BIANCHI GENE SILENCING IN THALASSEMIA

β-Thalassemia 1 atg gtg cac ctg act cct gag gag aag tct
gcc gtt act gcc ctg tgg ggc aag gtg aac
11
Absent/reduced of β-globin, inadequate γ-globin lys val asn
condon 23 condon 18 AAA GGT GAA
lys gly val
Excess of α-globin 21 gtg gat gaa gtt ggt ggt gag gcc ctg ggc
val asp glu val gly gly glu ala leu gly

Haemolysis Precipitation Apoptosis of 21 CGT GGA TGA AGT TGG TGG TGA GGC CCT GGG
ROS damage RBC percursors A arg gly Stop

Splenomegaly Ineffective erythropoiesis

TGA +T

ANAEMIA

Erythropoietin

Transfusion
Bone marrow
IRON LOADING
expansion
Increased iron
absorption
Endocrine deficiencies
Skeletal deformity cirrhosis
osteoporosis cardiac failure

Figure 1.—Clinical impact of the excess of α-globin synthesis in β-tha-

B
lassemia. Modified from Eleftheriou.4
β-globin/α-globin ratio

In conclusion, as reviewed by Bank,10 several mole-
cules appear to be not necessary or even harmful to the
erythroid cells, i.e. abnormal β-globin mRNA molecules
(for instance in the case of aberration of the splicing
process) and α-globin mRNA molecules, present in large
excess.10 The accumulation of unbalanced amounts of α-
globin causes the presence of excessive free α-globin
chains, which precipitate to the erythrocyte membrane,
resulting in hemolytic anemia. In agreement with these
considerations, inhibition of the expression of abnormal
mRNAs could be beneficial. This research takes great
benefits from the availability of several in vivo mice mod-
el system mimicking several features of β-thalassemia. For
instance, Voon et al.11 recently demonstrated that coin-
heritance of α- and β-thalassaemia in mice improves the
thalassaemic phenotype. In they experiments, heterozy-
gous murine β-globin knockout (KO) mice (β+/-) which
display severe anaemia were mated with heterozygous
α-globin KO mice (α++/--). The resulting progeny were
compared with wild-type WT (α++/++; β+/+), heterozygous
α-KO (α++/--; β+/+), heterozygous β-KO (α++/++; β+/-) or
double heterozygous (DH) α-KO/β-KO (α++/--; β+/-) with
respect to blood parameters and spleen dimension.
1
0.75 ∗∗
0.5
0.25
C
Figure 2.—A) Characterization of the novel single nucleotide insertion
in the first exon (codon 18) of the γ-globin gene. B) Electropherograms
showing the nucleotide sequence near the novel mutation (+T)
obtained from the patient. C) Stability of β-globin mRNA. Erythroid
progenitors from unaffected subjects (white box) and from the
proband (black box) were treated with 100 μg/ml ethidium bromide
for 2 hours. After a recovering and a washing step, the cells were fur-
ther cultured for 24 hours, RNA was extracted and quantitative RT-PCR
performed. Results are reported as β-globin mRNA/α-globin mRNA
ratios. Modified from Feriotto et al.14
Heterozygous β-KO mice (β+/-) showed spleen enlarge-
ment, marked reductions in hemoglobin and hematocrit
levels and significant increases in reticulocyte counts
compared to WT mice. In contrast, α-KO/β-KO mice
showed near normal dimension of the spleen and of the
red blood cell indices.11

52 MINERVA BIOTECNOLOGICA March 2008

GENE SILENCING IN THALASSEMIA
These results indicate that reduction of α-globin
expression leads to correction of the globin chain imbal-
ance in β-thalassaemic mice and therefore an improved
phenotype. Similar situation is found in humans.1-3 In this
respect, it is well established that αβ-thalassemia patients
can exhibit a milder phenotype.1-3 In agreement with the
interplay between accumulation of α-globin and sever-
ity of β-thalassemia are recent observations demon-
strating that α-haemoglobin stabilising protein is a
quantitative trait gene that modifies the phenotype
of β-thalassaemia.11 If this gene is down-regulated,
the β-thalassemia phenotype is clinically mild.
It should also be underlined that post-transcrip-
tional gene silencing is operated in nature; an exam-
ple is the well described nonsense-mediated mRNA
decay (NMD) 12-15 of the β°39-globin mRNA present in
the most frequent type of β-thalassemia in Italy. In this
case the CAG (Gln) codon of the in β-globin mRNA
is mutated to the UAG stop codon,12, 13 leading to pre-
mature translation termination and to mRNA destabi-
lization. Another example is constituted by a novel tha-
lassemia mutation (insertion of a single A nucleotide
at codon 18 of the exon 1 of the β-globin gene) asso-
ciated with a 13.4 kb δβ-globin gene deletion in a
hereditary persistence of fetal hemoglobin (HPFH)
patient. The novel mutation causes a frame shift with
the generation of a UGA stop codon. The levels of β-
globin mRNA found by quantitative reverse tran-
scriptase polymerase chain reaction (RT-PCR) analy-
sis were found to be much lower than those expect-
ed, suggesting that the mutated β-globin mRNA was
not stable.14 These data were confirmed by inhibiting
transcription with ethidium bromide (Figure 2).
On the other hand, gene silencing could be relevant,
rather than for eliminating or lowering the amount of
aberrant globin mRNA molecules, for inducing the
expression of γ-globin genes, with the aim of stimulate
the production of fetal hemoglobin (HbF). In this respect
it is firmly established that HPFH in β-thalassemia is
associated with benign clinical parameters. Interestingly,
coexistence of HPFH with homozygous β-thalassemia
often results in complete phenotypic complementation
of the disease.16, 17 Therefore, there has been consider-
able interest in recent years in finding ways of increas-
ing production of HbF.8 Accordingly, an alternative ther-
apeutic approach for β-thalassemia is to devise strate-
gies to reactivate the γ-globin genes.8 In addition, HbF
induction in vivo (for instance with hydroxyurea) ren-
ders the patients not dependent from blood transfu-
sions.8 As representative example, Dixit et al. reported
Vol. 20 - No 1. MINERVA BIOTECNOLOGICA
BIANCHI
a study on thirty-seven patients with β-thalassemia inter-
media to assess response to HU therapy.18 Major
response was defined as transfusion independence or
Hb rise of more than 20 g/l and minor response as rise
in Hb of 10-20 g/L or reduction in transfusion frequen-
cy by 50%. Twenty-six patients (70.2%) showed
response to hydroxyurea (HU) therapy. Seventeen
patients (45.9%) were major responders, and nine
patients (24.3%) showed minor response. Mean HbF
levels rose on HU therapy.18
In conclusion down-regulation or silencing of the
expression of specific gene could represent a strate-
gy to ameliorate the biochemical parameters of ery-
throid cells from β-thalassemia patients.19 Accordingly,
several research groups designed silencing strategies
in this applied filed of molecular medicine.
Approaches for gene silencing
Several approaches are available for gene silencing,
including post-transcription targeting of mRNA
employing lentiviral vectors or short hairpin RNA
(shRNA) and the use of decoy oligonucleotides tar-
geting transcription factors. With respect of the use of
the RNA interference approach, exogenous target
gene-complementary short hairpin RNAs (shRNAs)
are capable of down-regulating target gene expression
through sequence-specific pre-mRNA degradation 20−
22 via a process known as RNA interference (RNAi).23
The transcription factor decoy approach (TFD), on
the other hand, has as target molecules transcription
factors.24−26 TFD has been proposed to modulate gene
expression in vitro. This approach is based on the
intracellular delivery of double stranded oligodeoxynu-
cleotides mimicking binding sequences of transcrip-
tion factors and causing inhibition of the binding of TF-
related proteins to the specific consensus sequences
in the promoter of TF-target genes. This treatment
leads to inhibition of transcription if the target TF is an
activator, and to transcriptional activation, if the target
gene is a repressor.27, 28
Restoration of the balanced α/β-globin gene
expression in β-thalassemia mice using RNAi
approach
Xie et al.27 explored post-transcriptional strategies
aiming at the reduction of α-globin chains on
53
BIANCHI
Mouse α-globin mRNA
Exon 1
IVS
Exon 2
IVS
Exon 3
pH1
CA
GCACCGUGCUGACCUCCAAUU
A
CGUGGCACGACUGGAGGUUAG
AG
TTTT
A
pβ A AS-RNA
βavector
pH1
Sh-RNA
αivector
Sh-RNA pH1 pβ A AS-RNA
αiβavector
B with nuclear proteins isolated from human leukemic
Figure 3.—Structure of the mouse α-globin mRNA and the specific
shRNA used by Xie et al.27 A) Boxes indicate exons; lines, introns; short
bar below RNA, shRNA targeting site. The αi sequence is shown as
hairpin structure, which was linked to pH1 (RNA polymerase III H1
promoter) and TTTT (poly T termination signal). (B) Scheme repre-
senting the recombinant lentiviral vectors employed by Xie et al.27
Three types of vectors were constructed to correct aberrant splicing
of β-globin (βa), suppress α-globin expression (αi) or both (αiβa). pβA,
β globin gene promoter. Modified from Xie et al.27
β(654)[Hbb(th-4)/Hbb(+)] mouse, carrying a human
splicing-deficient β-globin allele [Hbb(th-4)] (Figure
3). This mouse model system carries a normal mouse
β-globin allele, and a defective human βIVS-2-654
allele associated with aberrant splicing due to C>T
substitution at nt654 of intron 2. Therefore, the β654
mice produce half of the normal mouse β-globin
chains but no functional human β-globin, manifesting
typical signs of a moderate form of β-thalassemia,
including anemia, splenomegaly, abnormal hemato-
logic indices. Xie et al.27 have explored combined
employmend of post transcriptional approaches for
gene therapy of β-thalassemia, one aiming at cor-
recting the βIVS-2-654 globin mRNA, the other aiming
at “silencing” the α-globin mRNA, in order to achieve
a reduction of the excess of α-globin chains. Through
lentiviral vectors, three types of β654 transgenic mice
have been produced, namely αi-Hbbth-4/Hbb(+), βa-
Hbbth-4/Hbb(+) and αiβa-Hbbth-4/Hbb(+), integrat-
54 MINERVA BIOTECNOLOGICA
GENE SILENCING IN THALASSEMIA
ed with α-globin-specific shRNA for suppression, anti-
sense RNA for interfering aberrant splicing of β-glo-
bin pre-mRNA and both, respectively. The data
obtained revealed significant and persistent amelio-
ration of β-thalassemia in all transgenic mice and their
F1 progeny, especially in αiβa-Hbbth-4/Hbb(+). In
conclusion, these data support the feasibility of tech-
niques for β-thalassemia therapy by balancing the
synthesis of α/β-globin chains.27
Increase of γ-globin mRNA and HbF production
with decoy oligonucleotides
Within their laboratory, the authors attempted to
apply a transcription factors decoy strategy for sub-
tracting putative repressor factors. One of the designed
decoy oligonucleotides, mimicking a DNA region of
he human γ-globin gene was able to 1) stably interact
K562 cells; 2) induce erythroid differentiation of K562
cells and increased γ-globin mRNA expression and
HbF production in erythroid precursor cells from nor-
mal donors.28 This demonstrates that down modula-
tion of regulatory genes associated with the repression
of target genes target can induce increase of the
expression of target genes.
Conclusions
Experimental therapy of β-thalassemia is commonly
dedicated to induce the forced expression (by gene
therapy and gene corrections of the mutations) of the
adult, not functional, β-globin gene. In addition to
these “gain-of-function” strategies, “loss-of-function”
approaches can be employed. The first strategy focus-
es on the inhibition of α-globin gene expression with
the aim to reduce the umbalanced α-globin/β-globin
ration in the erythroid cells. It has been indeed demon-
strated that reduction of the excess of α-globin chains
might turn to be an approach able to ameliorating
the clinical parameters of β-thalassemia. The aim of the
second strategy is to induce the expression of silent
genes (such as the fetal γ-globin gene) by interfering
with putative repressors. This might induce an increase
of γ-globin chains, production of functional HbF and,
consequently, also reduction of the excess of α-glo-
bin.
March 2008
GENE SILENCING IN THALASSEMIA
References
1. Cao A and Moi P. Genetic modifying factors in beta-thalassemia.
Clin Chem Lab Med 2000;38:123-32.
2. Ho PJ. The regulation of beta globin gene expression and beta tha-
lassemia. Pathology 1999;31:315-24.
3. Wealtherall DJ, Clegg JB. The thalassemia syndromes. Oxford
Blackwell Scientific 2001;133-91.
4. Eleftheriou A. The pathophysiology of thalassaemia: Lack of b-
chains and excess of a-chains. In: About Thalassemia. The
Thalassemia International Federation publisher 2007; pp. 16-8.
5. Schrier SL. Pathophysiology of thalassemia. Curr Opin Hematol
2002;9:123-6.
6. Traeger-Synodinos J, Papassotiriou I, Vrettou C, Skarmoutsou C,
Stamoulakatou A, Kanavakis E. Erythroid marrow activity functional
anemia in patients with the rare interaction of a single functional
α-globin and b-globin gene. Haematologica 2001;86:363-7.
7. Lai MI, Jiang J, Silver N, Best S, Menzel S, Mijovic A et al. Alpha-
haemoglobin stabilising protein is a quantitative trait gene that
modifies the phenotype of beta-thalassaemia. Br J Haematol
2006;133:675-82.
8. Gambari R, Fibach E. Medicinal chemistry of fetal hemoglobin
inducers for treatment of beta-thalassemia. Curr Med Chem
2007;14:199-212.
9. Gu X, Zeng Y. A review of the molecular diagnosis of thalassemia.
Hematology 2002;7:203-9.
10. Bank A. Regulation of human fetal hemoglobin: new players, new
complexities. Blood 2006;107:435-43.
11. Voon HP, Wardan H, Vadolas J. Co-inheritance of a- and b-thalas-
saemia in mice ameliorates thalassaemic phenotype. Blood Cells
Mol Dis 2007;39:184-8.
12. Piras I, Vona G, Falchi A, Latini V, Ristaldi S, Vacca L et al. Beta-
globin cluster haplotypes in normal individuals and b(0)39-tha-
lassemia carriers from Sardinia, Italy. Am J Hum Biol 2005;17:765-
72.
13. Colosimo A, Guida V, Scolari A, De Luca A, Palka G, Rigoli L et al.
Validation of dHPLC for molecular diagnosis of b-thalassemia in
Southern Italy. Genet Test 2003;7:269-75.
14. Feriotto G, Salvatori F, Finotti A, Breveglieri G, Venturi M, Zuccato
C et al. A novel frame shift mutation (+A) at codon 18 of the b-glo-
bin gene associated with HPFH phenotype and b°-thalassemia. Acta
Haematologica 2008;119:28-37.
15. Mo QH, Li XR, Li CF, He YL, Xu XM. A novel frameshift mutation
Vol. 20 - No 1. MINERVA BIOTECNOLOGICA
BIANCHI
(+G) at codons 15/16 in a b0-thalassaemia gene results in a signi-
ficant reduction of beta globin mRNA values. J Clin Pathol
2005;58:923-6.
16. Forget BG. Molecular basis of hereditary persistence of fetal hemo-
globin. Ann N Y Acad Sci 1998;850:38-44.
17. Old JM. Screening and genetic diagnosis of haemoglobin disorders.
Blood Rev 2003;17:43-53.
18. Dixit A, Chatterjee TC, Mishra P, Choudhry DR, Mahapatra M,
Tyagi S et al. Hydroxyurea in thalassemia intermedia - a promising
therapy. Ann Hematol 2005;84:441-6.
19. Bank A. Understanding globin regulation in b-thalassemia: it’s as
simple as a, b, g, d. J Clin Invest 2005;6:1470-3.
20. McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA.
RNA interference in adult mice. Nature 2002;418:38-9.
21. Paddison PJ, Caudy AA, Bernstein E, Hannon GJ, Conklin DS.
Short hairpin RNAs (shRNAs) induce sequence-specific silencing
in mammalian cells. Genes Dev 2002;16:948-58.
22. Rubinson DA, Dillon CP, Kwiatkowski AV, Sievers C, Yang L,
Kopinja J et al. A lentivirus-based system to functionally silence
genes in primary mammalian cells, stem cells and transgenic mice
by RNA interference. Nat Genet 2003;33:401-6.
23. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC.
Potent and specific genetic interference by double-stranded RNA
in Caenorhabditis elegans. Nature 1998;391:806-11.
24. Borgatti M, Finotti A, Romanelli A, Saviano M, Bianchi N, Lampronti
I et al. Peptide nucleic acids (PNA)-DNA chimeras targeting tran-
scription factors as a tool to modify gene expression. Curr Drug
Targets 2004;5:735-44.
25. Piva R, Penolazzi L, Zennaro M, Bianchini E, Magri E, Borgatti M
et al. Induction of apoptosis of osteoclasts by targeting transcrip-
tion factors with decoy molecules. Ann N Y Acad Sci 2006;1091:509-
16.
26. Lambertini E, Penolazzi L, Tavanti E, Pocaterra B, Schincaglia GP,
Torreggiani E et al. Modulation of expression of specific tran-
scription factors involved in the bone microenvironment. Minerva
Biotec 2008;20:69-78.
27. Xie SY, Ren ZR, Zhang JZ, Guo XB, Wang QX, Wang S et al.
Restoration of the balanced alpha/beta-globin gene expression
in beta654-thalassemia mice using combined RNAi and antisense
RNA approach. Hum Mol Genet 2007;16:2616-25.
28. Bianchi N, Feriotto G, Gambari R, Mischiati C. Synthetic oligonu-
cleotides as inducers of erythroid differentiation. United States
Patent US 7,262,175 B2, August 28, 2007.
55