Food Control 115 (2020) 107281

Contents lists available at ScienceDirect

Food Control
journal homepage: www.elsevier.com/locate/foodcont

A novel AuNPs colorimetric sensor for sensitively detecting viable T

Salmonella typhimurium based on dual aptamers
Sihan Chen, Xinyan Yang, Shiqian Fu, Xue Qin, Tao Yang, Chaoxin Man∗∗, Yujun Jiang∗
Key Laboratory of Dairy Science, Ministry of Education, Department of Food Science, Northeast Agricultural University, Harbin, 150000, China

A R T I C LE I N FO A B S T R A C T

Keywords: A sensitive and accurate strategy was presented based on gold nanoparticles (AuNPs) for visual detecting viable
Aptamer Salmonella typhimurium (S. typhimurium). In this paper, dual aptamers were used to capture S. typhimurium and
Colorimetric sensor PCR amplification, respectively. The highly stable network structure formed by the hybridization between
Salmonella typhimurium amplicons and AuNPs-probes protects AuNPs from self-aggregation and color change in the presence of salt.
Gold nanoparticles
Under optimized conditions, the ratio of the absorbance intensity of AuNPs between A523 and A650 changed
Magnetic beads
regularly with the decrease of pathogen concentration, which showed a linear relationship of S. typhimurium
within the concentration ranging from 3.3 × 101 to 3.3 × 106 CFU/mL. The detection limit of S. typhimurium
can be read out by naked eye as low as 33 CFU/mL in pure culture and 95 CFU/mL in spiked milk. The assay
performed an accurate and specific diagnosis of positive results without cross-reactivity to dead S. typhimurium
and 12 non-S. typhimurium strains. In our perception, this colorimetric sensor would be a promising platform for
point-of-care testing (POCT) application of viable S. typhimurium in milk samples.

1. Introduction
As a causal agent of foodborne infections worldwide (da Cunha-
Neto et al., 2019; Yang et al., 2020), Salmonella typhimurium (S. typhi-
murium) cause a variety of clinical manifestations including diarrhea,
typhoid fever, abdominal cramps, nausea, vomiting, and even can be
life-threatening in severe cases (CDC, 2014; Christidis, Hurst, Rudnick,
Pintar, & Pollari, 2020). S. typhimurium infects humans mainly through
contaminated food (Christidis et al., 2020), and dairy products are one
of the dominant carriers of S. typhimurium (Portela et al., 2019;
Sánchez-Gamboa et al., 2018). With the increasingly stringent re-
quirements of global food safety, several methods have been developed
for monitoring S. typhimurium (Lee, Runyon, Herrman, Phillips, &
Hsieh, 2015). Traditional culture-based assays are labor-intensive,
time-consuming and low-sensitivity (Mooijman, Pielaat, & Kuijpers,
2019). The molecular assays represented by PCR not only require
complex nucleic acid extraction procedure but also may overestimate
the number of viable cells due to the amplified DNA that comes from
dead cells (Sun et al., 2018). Therefore, it is an urgent task to develop a
rapid and reliable detection of S. typhimurium for monitoring food
safety.
Magnetic separation has been proven to be an effective strategy of
reducing the pre-enrichment step, eliminating the PCR inhibitors and
increasing the specificity and sensitivity of detection (Du et al., 2018;
Xu et al., 2014). However, these studies relied on antibodies and DNA
extraction, limiting their practical field applicability. As single-stranded
oligonucleotide (DNA or RNA), aptamers can recognize the targets with
high affinity and specificity (Citartan, Gopinath, Tominaga, Tan, &
Tang, 2012), which were screened from the library by SELEX (sys-
tematic evolution of ligands by exponential enrichment) (Mairal et al.,
2008). In brief, aptamers are more friendly than antibodies, depending
on their advantages, such as high binding efficiency, structural stability
and long shelf-life, easy to synthesize in vitro, a wide range of targets,
and convenient for modification (Alizadeh, Memar, Moaddab, & Kafil,
2017; Zhou & Rossi, 2017). Recently, antibodies have been substituted
by aptamers as recognition agents in sensors for rapid detection of
pathogenic bacteria (Duan et al., 2013; Feng, Dai, Tian, & Jiang, 2018;
H. S. Kim et al., 2017).
Gold nanoparticles (AuNPs), an optical colorimetric tool, have been
widely used in the field of detection (Jiang et al., 2020; Pan et al.,
2018). DNA-functionalized AuNPs are stable in a suitable salt con-
centration by hybridization with their complementary DNA
(Wachiralurpan et al., 2018). Conversely, if the density of unhybridized
ssDNA on the surface of AuNPs is less than 26 pmol/cm2, AuNPs will
self-aggregate due to salt screening effects, resulting in visible color
changes from red to blue-gray (Song, Li, Cheng, & Liu, 2010). Based on

∗
Corresponding author.
∗∗
Corresponding author.
E-mail addresses: mcxwh2006@qq.com (C. Man), yujun_jiang@163.com (Y. Jiang).

https://doi.org/10.1016/j.foodcont.2020.107281
Received 22 December 2019; Received in revised form 24 March 2020; Accepted 26 March 2020
Available online 03 April 2020
0956-7135/ © 2020 Elsevier Ltd. All rights reserved.
S. Chen, et al.
that optical property, AuNPs-based colorimetric assays have been re-
ported for visual diagnosis of different pathogens, such as Listeria
monocytogenes (L. monocytogenes) (Wachiralurpan et al., 2018) and
Salmonella spp. (Quintela, de los Reyes, Lin, & Wu, 2019). Un-
fortunately, these methods rely on DNA extraction from the target
microorganisms, resulting in an inability to deal with false positives
caused by DNA amplification of dead bacteria.
Here, we developed a novel AuNPs colorimetric sensor based on
streptavidin magnetic beads - dual aptamers (SMBs - Apts) sandwich
for point-of-care testing (POCT) of S. typhimurium in milk samples. In
particular, one of the aptamers, but not the DNA of microbes, was used
as a template for PCR reaction to amplify detection signal, and self-
assembly of AuNPs-probe was utilized to achieve visual detection. The
system provides a sensitive and accurate tool for monitoring S. typhi-
murium in complex matrices and is expected to be applied to other
foodborne pathogens detection fields.
2. Materials and methods
2.1. Chemicals and reagents
Streptavidin magnetic beads (SMBs) (1.0 μm in diameter, 10 mg/
mL) was purchased from Invitrogen Biotechnology Co., Ltd (Carlsbad,
CA, USA). Phosphate buffered saline (PBS, 10 mM, pH 7.4) and phos-
phate buffered saline tween-20 (PBST, 10 mM, pH 7.4) were supplied
by Solarbio Tech Co., Ltd (Beijing, China). Salmon sperm DNA obtained
from Solarbio was used as a blocking agent. Colloidal gold (15 nm) was
obtained from Jieyi Biotechnology Co., Ltd. (Shanghai, China). The
biotinylated capture aptamer (Apt1) and the signal aptamer (Apt2),
PCR primers and probe sequences were shown in Table 1, synthesized
by Sangon Biotech Co., Ltd. (Shanghai, China). All other reagents were
of analytical grade.
2.2. Bacterial cultures
The bacterial strain used in this work was S. typhimurium ATCC
14028, obtained from the American Type Culture Collection. A single
colony of S. typhimurium from Lysogeny broth (LB) agar was transferred
to liquid medium and cultivated at 37 °C for 12 h with gentle shaking
(150 rpm). The broth culture was pelleted by centrifugation at 5000 ×
g for 5 min and resuspended in sterilized PBS. The cell concentrations
were determined by plating on LB agar.
2.3. Preparation of Apt1 conjugated SMBs
First, 12 μL of SMBs were removed into a silane-treated tube and
washed three times with an equal volume of 1 × B&W buffer (10 mM
Tris-HCl, 1 mM EDTA, 2 M NaCl). Then 10 μL of biotinylated Apt1
(2 μM) was added and incubated for 10 min at room temperature with
gentle rotation. The mixture was separated on a magnetic stand and
washed twice with PBS to remove any unconjugated Apt1. Afterwards,
100 μL of PBS solution containing salmon sperm DNA (1 mg/mL) and
yeast tRNA (0.1 mg/mL) was added to the mixture and pipette-mixed,
followed by a 10 min incubation at room temperature to block unbound
sites on the SMBs and inhibit non-specific adsorption. Finally, after
rinsing twice with PBS, the SMBs - biotinylated Apt1 conjugate was
Table 1
The sequences of aptamers, primers and probe were used in this study.
Name Sequence (5′ to 3′)
Apt1 biotin- GAGGAAAGTCTATAGCAGAGGAGATGTGTGAACCGAGTAA
Apt2 CTCCTCTGACTGTAACCACGGAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGCCGCATAGGTAGTCCAGAAGCC
Forward primer TGACTGTAACCACGGA
Reverse primer TTCTGGACTACCTATGC
probe SH-AAAAAAAAAAGTTAATCAATACAAGGCGGG
2
Food Control 115 (2020) 107281
collected by magnetic separation.
2.4. Preparation of AuNPs-probe
The preparation of AuNPs-probe was appropriately improved based
on the previous research (Mirkin, Letsinger, Mucic, & Storhoff, 1996),
and the specific steps were as follows. Five nanomoles thiol-modified
DNA probe were added to 1 mL AuNPs (15 nm in diameter). After mild
shaking (150 rpm) at 50 °C for 22 h, 100 μL of 0.1 M phosphate buffer A
containing 0.1% (m/v) sodium dodecyl sulfate (SDS) (pH = 7.6) was
supplemented. Phosphate buffer B (0.01 M) containing 2 M NaCl was
slowly added (drop-wise) for aging until the NaCl concentration in the
solution reached 0.1 M. Then the supernatant was removed after cen-
trifugation at 20,000 × g for 15 min, and the pellet was washed twice
with 0.01 M phosphate buffer C (containing 0.1 M NaCl and 0.01%
SDS) to remove unbound DNA probe. Eventually, AuNPs-probe was
resuspended in phosphate buffer C and preserved in the dark at 4 °C
until use. Moreover, the ultraviolet–visible (UV–vis) absorption spectra
of AuNPs-probe and untreated AuNPs were measured by a UV-2600
UV–vis spectrophotometer (Shimadzu Co., Ltd. Japan) with quartz
cuvettes.
2.5. Assay protocol
2.5.1. Bacteria capture
Five hundred microliters of the S. typhimurium broth cultured to
106 CFU/mL was centrifuged and resuspended in PBS solution. Ten
microliters of Apt2 (100 nM) was added to the bacterial solution and
incubated at 37 °C for 30 min. Next, the incubated S. typhimurium - Apt2
conjugate was mixed with the SMBs - Apt1 conjugate and incubated
again at 37 °C for 30 min. The unbound aptamer remaining in the su-
pernatant was then removed magnetically. At last, the SMBs - Apt1 - S.
typhimurium - Apt2 sandwich was collected after washing 3 times with
PBST and resuspended in 10 μL pure water for downstream applica-
tions.
2.5.2. PCR assay
The primers used in this study were designed by Primer Premier 5.
The PCR reaction was performed in 25 μL reaction mixture containing
1 μL (10 μM) of each primer, 12.5 μL of 2 × Taq Master, 2 μL of the
complex obtained from the previous step and 8.5 μL of sterile distilled
water. Thermal cycling was carried out as follows: initialization at 95 °C
for 3 min, followed by 30 cycles of denaturation at 95 °C for 30 s, an-
nealing at 45 °C for 45 s, elongation at 72 °C for 1 min, and final
elongation at 72 °C for 5 min. The PCR products were separated using
4% agarose gel electrophoresis (AGE) and imaged under a UV tran-
silluminator.
2.5.3. Colorimetric detection of S. typhimurium
The ratio of optimal hybridization conditions was modified from
Wachiralurpan et al. (2018) for the visual detection of PCR products.
Briefly, amplicons were directly mixed with 10 μL AuNPs-probe in a
volume ratio of 1:1. After 5 min of incubation, 10 μL of MgSO4 (50 mM)
was added to induce the aggregation of colloidal gold. The color
changes were observed by naked-eye after thoroughly pipette-mixing
and their corresponding absorption spectra were recorded with the
S. Chen, et al.
UV–vis spectrophotometer at a wavelength of 400–700 nm. Distilled
water was used as a negative control.
2.6. Interference assay of dead cells
To prepare dead cells of S. typhimurium, the diluted log phase cul-
tures were heat-treated at 95 °C for 5 min and then cooled in an ice
bath. The absence of viable cells of S. typhimurium was confirmed by
incubation on LB plates with 1.5% agar for 24 h at 37 °C. To determine
the accuracy of colorimetric sensor, a suspension of dead cells and live
cells were mixed at a ratio of 1:100 for the interference test of dead
cells. Following the steps above to perform the analysis, live cells at
106 CFU/mL were used as a positive control, while dead cells at
104 CFU/mL was used as a negative control.
2.7. Evaluation of sensitivity and specificity
S. typhimurium cultured at late log phase was serially diluted 10-fold
ranging from 107 to 10−1 CFU/mL. The assay was carried out in ac-
cordance with the above assay protocol at optimal conditions. For re-
search purpose, both AGE and AuNPs color changes were taken as re-
sults for exhibition, and further confirmation of the optical observations
was conducted by UV–vis spectrophotometer. Each experiment was
carried out in triplicate.
To evaluate the specificity of the proposed colorimetric sensor,
twelve common pathogenic microorganisms were selected for inter-
ference testing, including Staphylococcus aureus (S. aureus) ATCC
25923, Staphylococcus epidermidis (S. epidermidis) ATCC 12228,
Escherichia coli (E. coli) ATCC 25922, Cronobacter sakazakii (C. saka-
zakii) ATCC 29544, Cronobacter malonaticus (C. malonaticus) DSM
18702, L. monocytogenes ATCC 19114, Listeria welshimeri (L. welshimeri)
ATCC 43550, Vibrio parahaemolyticus (V. parahaemolyticus) ATCC
17802, Shigella Flexner (S. Flexner) CMCC 51572, Bacillus cereus (B.
cereus) CMCC 63303, Enterobacter aerogenes (E. aerogenes) ATCC 13048,
Enterobacter cloacae (E. cloacae) CMCC 45301. Each strain was per-
formed on pure culture with a concentration of 107 CFU/mL and used
for further test followed the same procedure mentioned above. The
sterile LB was used as a negative control. All experiments were carried
out in triplicate.
2.8. Application in milk samples
The milk samples were purchased from local supermarket and were
free of S. typhimurium by standard culture method ISO 6579:2017 (ISO,
2017). Different final concentrations of S. typhimurium (1.9 × 107,
1.9 × 106, 1.9 × 105, 1.9 × 104, 1.9 × 103, 1.9 × 102, 9.5 × 101,
1.9 × 101 and 9.5 CFU/mL) were prepared by diluting bacteria into
25 mL sterile milk. One milliliter spiked sample was taken and cen-
trifuged at 5000 × g for 5 min, and then the sediment was reconstituted
with sterile PBS to obtain skim milk sample. The analysis was carried
out following the above procedure (Section 2.5. assay protocol) and
each experiment was repeated in triplicate.
3. Results and discussion
3.1. Principle
The principle of the SMBs - Apts based colorimetric sensor for de-
tecting S. typhimurium was shown in Scheme 1. First, Apt1 was im-
mobilized on the surface of SMBs by biotin-streptavidin affinity reac-
tion. After blocked by the synergistic effect of salmon sperm DNA and
yeast tRNA, SMBs - Apt1 was added to the sample for specifically en-
riching S. typhimurium. Meanwhile, Apt2 was added to the sample re-
sulting in the formation of SMBs - Apt1 - S. typhimurium - Apt2 sandwich
conjugate via the specific interaction of dual aptamers with the target
bacteria. Subsequently, Apt2, released from the sandwich by heating,
3
Food Control 115 (2020) 107281
was used as a template for PCR amplification. With the production of a
large amount of dsDNA, the probe on the surface of AuNPs was hy-
bridized with its complement oligonucleotide contributing to a highly
stable network structure. Accordingly, the AuNPs-dsDNA complexes
remained undisturbed (original red) even after adding salt. In the ab-
sence of S. typhimurium, there were no complementary products hy-
bridized with the probe, therefore, the nanoparticles assembled im-
mediately under the screening effect of salt and the color of reaction
mixture converted to blue-gray from the original red obviously.
3.2. Characterization of AuNPs-probe
In this work, we designed a probe that introduced HS-(CH2)6 che-
mically at the 5′-end, which hybridized to the PCR products specifi-
cally. The covalent bond mediated by thiol (SH) functional groups be-
tween gold and sulfur offers high stability for conjugating
oligonucleotides onto the surface of AuNPs (Li, Zhang, Dever, Li, & Le,
2013). The characterization of AuNPs was displayed with the UV–vis
spectrophotometry (Fig. 1). Compared with untreated AuNPs, the ab-
sorption peak of probe labeled AuNPs was observed a modest red-shift
from 519 nm to 523 nm, chiefly due to the increase of refractive index,
which demonstrated the successful conjugation between oligonucleo-
tide probe and AuNPs. After hybridization with positive sample, the
interaction between probe and oligonucleotide promoted electrostatic
repulsion among nanoparticles, which may contribute to a stronger
ordered B-form of DNA and overcome the van der Waals force caused
by salt ion, resulting in the absorption peak of AuNPs remained the
same (Quintela et al., 2019). In contrast, negative samples could not
cause the formation of AuNPs-dsDNA network structure, thus the ag-
gregation of AuNPs and a new peak at about 650 nm were observed
under the induction of MgSO4.
3.3. Optimization for the colorimetric sensor
3.3.1. Optimization of capture conditions
The amounts of SMBs and Apt1 were optimized to enhance the
capture efficiency of SMBs. 106 CFU/mL of S. typhimurium was captured
using different amounts of SMBs (0, 40, 80, 120, 160 and 200 μg). The
bacterial count was determined using a conventional plate method, and
each sample was measured in parallel three times. The capture effi-
ciency of SMBs - Apt1 was calculated based on the plate count ac-
cording to the following formula:
Capture efficiency (%) = A/B × 100%
Where A represents the number of cells after SMBs - Apt1 capture; B
represents the total number of cells before magnetic separation.
As shown in Fig. 2A, capture efficiency increased progressively as
the volume of SMBs increased to 120 μg before bacteria were saturated
with SMBs. As the amount of SMBs continued to increase, the capture
efficiency was not significantly improved, indicating 120 μg was the
appropriate amount of SMBs. Next, we optimized the final concentra-
tion of Apt1 (0, 20, 40, 60, 80, 100 nM) (Fig. 2B). As the final con-
centration of Apt1 progressively increased to 40 nM, capture efficiency
grew up and reached the platform. Concurrently, by measuring the
UV–vis absorption peak (at 260 nm) of the supernatant after Apt1 and
SMBs binding, we found that the concentration of Apt1 remaining in
the supernatant increased significantly when that exceeded 40 nM,
suggesting that the adsorption of SMBs has reached saturation. Like-
wise, incubation time is also one of the key parameters affecting cap-
ture efficiency. Based on the optimized conditions, we incubated 120 μg
of SMBs and 40 nM of Apt1 with S. typhimurium for 1, 5, 10, 20, 30, 45
and 60 min, respectively. As shown in Fig. 2C, the capture efficiency of
SMBs - Apt1 kept rising over time until it came to a plateau at 30 min.
In this case, the capture rate of SMBs reached 92%, indicating that the
method had the potential to be applied to the separation and
S. Chen, et al.
Scheme 1. Schematic illustration of the proposed SMBs-Apt1 sandwich based colorimetric sensor for detection of S. typhimurium in milk (Size not to scale).
Fig. 1. Characterization of UV absorption spectra peak alteration of unlabeled
AuNPs, AuNPs-probe and AuNPs-probe incubation with samples.
enrichment of pathogenic bacteria. In order to get the optimum bac-
terial concentration, capture efficiency analysis was performed on 10-
fold serial dilutions of S. typhimurium cells (ranged from 2.0 × 102 to
2.0 × 109 CFU/mL). As shown in Fig. 2D, when the concentration of
the target microbes was 2.0 × 109 CFU/mL, the capture efficiency was
only 65%, which may be caused by the shortage of SMBs - Apt1 while
the number of cells was excessive. When the cell concentration was
2.0 × 102 to 2.0 × 107 CFU/mL, the capture efficiency of SMBs - Apt1
to S. typhimurium could reach more than 91%.
3.3.2. Determination of blocking agents and pH of washing buffer
Since the ssDNA aptamer with a negative charge at phosphate
backbone is readily adsorbed on the surface of the positively charged
magnetic nanobead via electrostatic interaction, it is necessary to
completely prevent Apt2 from adsorbing on SMBs to avoid false positive
results (Kim and Jurng, 2013). We optimized the blocking agents of
SMBs and pH of washing buffer separately. BSA, salmon sperm DNA,
and yeast tRNA (diluted in PBS at pH = 7.5) were selected to block
unbound sites on the surface of the magnetic beads. As shown in
Fig. 3A, the band of lane 2 was almost as bright as the positive, in-
dicating that BSA produced a weak barrier effect. The reason may be
that large-volume BSA cannot wholly block the unbound site of SMBs,
so the small molecule aptamer can still adsorb on the surface of SMBs.
Conversely, the blocking effects of salmon sperm DNA cooperate with
yeast tRNA were superior to BSA because of their smaller steric hin-
drance. Since the essence of the aptamer is DNA, when SMBs were only
blocked by salmon sperm DNA, which probability of binding SMBs was
4
Food Control 115 (2020) 107281
comparable with Apt2. Thus, it is necessary to supplement yeast tRNA
to enhance blocking effect. Unfortunately, under the combined action
of salmon sperm DNA and yeast tRNA, we could still observe weak
bands from the electropherogram.
Further, we explored the impact of pH of washing buffer on the
adsorption of SMBs against Apt2. The isoelectric point (pI) of the SMBs
used in this study was about 4.5, suggesting that SMBs were negatively
charged at pH greater than 4.5. Buffer solutions with different pH (7.5,
8, 8.5, 9, 9.5) were optimized to eliminate non-specific adsorption be-
tween SMBs and Apt2. As shown in Fig. 3B, the electrophoretic band
weakened gradually as the pH increased. Until the pH was 9, the band
completely disappeared, and the false positive result caused by the non-
specific adsorption of SMBs could be favorably prevented. Previous
studies had also confirmed the role of alkaline conditions on the des-
orption of magnetic beads against aptamers (Wang et al., 2017; Zhang
et al., 2019).
3.3.3. Optimization of salt concentration for self-aggregation of AuNPs
Electrolytes such as salt which are used to screen for electrostatic
repulsion between probe-coated AuNPs have a great significance on
self-aggregation of AuNPs (H. X. Li & Rothberg, 2004). We investigated
the effect on the color change of AuNPs with the different concentra-
tions of MgSO4 (10 mM to 100 mM). From Fig. 4 we could find that the
concentration of 50 mM had the most conspicuous color contrast (by
naked-eye) between positive and negative results. The lower level of
MgSO4 (10 mM) produced a false positive result (red) with the negative
control, while higher concentrations (80–100 mM) resulted in a false
negative effect (blue-gray/colorless). Therefore, the concentration of
MgSO4 selected in this study was 50 mM.
3.4. Analysis of the detection performance using colorimetric sensor
3.4.1. Detection for live cells
In this study, the two aptamers we used were screened with mod-
ified SELEX technology to identify live S. typhimurium with high se-
lectivity. As shown in Fig. 5, for the dead target bacteria (lane 2), we
noted that the specific band on gel disappeared and the AuNPs turned
blue-gray. At the same time, the incorporation of dead cells (lane 3) did
not change the color of the brightness of gel band or the color of AuNPs
compared to the presence of only live cells (lane 1). Hence, it can be
considered that only live cells could bind to the aptamers and trigger
subsequent reactions, proving that the assay can effectively avoid the
disturbance of dead cells at 104 CFU/mL. This high selectivity may be
attributed to the degradation of outer membrane proteins of S. typhi-
murium caused by heat treatment so that aptamers cannot recognize
and bind to it, which is consistent with the findings of Zhang et al.
(2017). These results indicated that the sensor has good specificity for
S. Chen, et al. Food Control 115 (2020) 107281

Fig. 2. Optimization of capture efficiency for SMBs-Apt1 against S. typhimurium. Effect of the amount of SMBs on capture efficiency (A). Effect of the concentration of
Apt1 on capture efficiency (B). Effect of the incubation time on capture efficiency (C). Effect of the concentration of S. typhimurium on capture efficiency (D). Error
bars: the standard deviations based on three independent measurements.

Fig. 3. Effects of blocking agents and wash buffer pH on non-specific adsorp-

tion. Kinds of blocking agents (A). Lane M: 50 bp DNA marker; Lane -: negative
control; Lane1: positive sample; Lane 2: BSA; Lane 3: salmon sperm DNA; Lane
4: yeast tRNA; Lane 5: sperm DNA cooperate with yeast tRNA. Determined of
pH of wash buffer (B). Lane M: 50 bp DNA marker; Lane -: negative control;
Lane 1: positive sample; Lane 2 to 6: pH of 7.5, 8, 8.5, 9 and 9.5.

detecting live S. typhimurium.

3.4.2. Detection sensitivity

Under the above-mentioned optimum conditions, a series of 10-fold
diluted S. typhimurium suspension were tested respectively and the
Fig. 5. The effect of dead cells on detection accuracy. Lane M: 50 bp DNA
corresponding UV–vis spectra were recorded. As illustrated in Fig. 6A,
marker; Lane -: negative control (sterile PBS); Lane 1: live cells; Lane 2: dead
upon a decrease in the concentration of S. typhimurium, the color cells; Lane 3: live cells + dead cells.
changed from red to blue-gray since fewer and fewer PCR products
complemented with probes. Correspondingly, the absorbance of AuNPs
at 523 nm declined gradually while the absorbance at 650 nm increased

Fig. 4. Effects of the MgSO4 concentration on the

visualization of colorimetric detection. -: negative
control (without template DNA); +: positive control
(Apt2 as a PCR template).

5
S. Chen, et al.
Fig. 6. Sensitivity of the proposed assay for the detection of viable S. typhi-
murium. The image of PCR products by 4% AGE (A). Lane M: 50 bp DNA
marker; Lane 1: negative control; Lane 2 to 10: from 3.3 × 107 to
3.3 × 10−1 CFU/mL. Inset: the corresponding color changes. UV absorption
spectrum analysis of AuNPs-probe incubation with different concentration S.
typhimurium (B). NC: negative control. The absorbance ratio at wavelengths
523 nm and 650 nm to quantitatively analyze S. typhimurium (C). Error bars: the
standard deviations based on three independent measurements. (For inter-
pretation of the references to color in this figure legend, the reader is referred to
the Web version of this article.)
(Fig. 6B). Thus, the value of A523/A650 was inversely proportional to
the aggregation of AuNPs and proportional to the concentration of
bacteria. Based on this phenomenon, we use the absorbance intensity
6
Food Control 115 (2020) 107281
ratio (A523/A650) for quantitative analysis of various concentrations
of bacteria (Fig. 6C). The results showed that the proposed SMBs - Apts
assay had a limit of detection (LOD) of 33 CFU/mL for S. typhimurium
pure cultures. Although the colorimetric results of AuNPs were con-
sistent with AGE, its non-toxic, rapid and visually distinguishable ad-
vantages were unmatched by AGE. Furthermore, a linear relationship
between A523/A650 and the concentration of S. typhimurium was es-
tablished in the range of 3.3 × 101 to 3.3 × 106 CFU/mL: y = 0.934 x
+ 1.6157 (R2 = 0.9838, n = 3), where y was the absorption ratio of
A523/A650 and x was the logarithm (log) concentration of S. typhi-
murium. Compared with other Salmonella detection methods previously
reported (Table 2), the SMBs - Apts analysis system performs good
sensitivity. Although the LOD of our method is higher than that of
LAMP-LFD in pure cultures, it is difficult to eliminate aerosol cross-
contamination in the process of LAMP, which leads to false positives
and limits its practical application.
3.4.3. Detection specificity
To validate the specificity of SMBs – Apts based colorimetric sensor,
12 strains of other common foodborne pathogens were selected as non-
target bacteria for challenging our proposed assay. As shown in Fig. 7,
only in the presence of S. typhimurium did AuNPs remain red, and at this
time the A523/A650 had a maximum ratio. On the contrary, in terms of
other non-target bacteria, the color of AuNPs solution changed appar-
ently from red to blue-gray and the value of A523/A650 decreased
significantly. The results demonstrated that the proposed method was
able to specifically distinguish live S. typhimurium against dead ones by
naked-eye.
3.5. SMBs - Apts based colorimetric sensor for POCT in spiked milk samples
The diluted S. typhimurium were spiked artificially into sterile milk
samples with different concentrations from 9.5 to 1.9 × 107 CFU/mL.
The results showed that the AuNPs remained red when the S. typhi-
murium concentration was as low as 95 CFU/mL, indicating that the
protocol provided the effectiveness of bacterial detection in complex
samples (Fig. 8). This result showed the deterioration of LOD compared
with that in pure cultures, which may be caused by complex compo-
nents in the milk sample. However, compared to other published assays
(Table 2), our assay had a satisfied sensitivity in the detection of spiked
samples, primarily due to the strong support of SMBs in enriching target
bacteria and reducing matrix effects. Suh et al. (2014) observed that
aptamer-modified magnetic beads produced lower LOD than anti-
bodies-modified when detecting small volumes of sample. This phe-
nomenon may be owing to the small size of aptamers, increasing the
probability of binding to target cells. Thus, the proposed method ex-
hibited a good analysis performance in real milk samples.
Compared with existing commercial testing products, the developed
SMBs - Apt1 sandwich based colorimetric sensor is competitive due to
its low-cost ($ 1.5/sample). More importantly, this assay is environ-
ment-friendly, because the PCR products are analyzed by harmless
AuNPs instead of AGE (the ethidium bromide used is highly toxic) or
other toxic nanoparticles (such as quantum dots) (Lee, Xie, & Chen,
2010). Considering that PCR instruments are restricted in some eco-
nomically underdeveloped areas, we are committed to developing
portable analytical devices for POCT independent of specialized or
expensive equipment in the future. In addition, we will select aptamers
that match other pathogens in order to extend the SMBs - Apt1 sand-
wich based colorimetric sensor on the detection of various foodborne
pathogens.
4. Conclusions
In summary, we successfully established a rapid and sensitive col-
orimetrical system for the detection of viable S. typhimurium based on
the SMBs - Apts sandwich. In particular, one of the aptamers on
S. Chen, et al. Food Control 115 (2020) 107281

Table 2
Summary of the analytical performance of various methods for Salmonella.
Detection Strategy LOD in buffer LOD in sample Ref.

MicroSEQ® Salmonella spp. Detection kit 3.25 ± 0.51 log CFU/mL – Hu et al. (2018)
3M™ Molecular Detection Assay Salmonella 2.75 ± 1.18 log CFU/mL – Hu et al. (2018)
ANSR™ Salmonella Assay 3.42 ± 0.99 log CFU/mL – Hu et al. (2018)
Pro-AmpRTTM SALM spp. Kit 2.75 ± 0.57 log CFU/mL – Hu et al. (2018)
Roka Atlas® Salmonella Assay 1.92 ± 1.10 log CFU/mL – Hu et al. (2018)
TD-NMRa biosensor 104 CFU/mL 104 CFU/mL Jin et al. (2020)
LAMP-LFDb 6.7 CFU/mL 144 CFU/mL or CFU/g Mei et al. (2019)
a colorimetric PAD combined with IMSc 102 CFU/mL 103 CFU/mL in milk Srisa-Art, Boehle, Geiss, and Henry (2018)
a hairpin DNA aptasensor 102 CFU/mL – (J. Lee, Jung, Lee, & Ha, 2017)
AuNPs self-aggregate based on SMBs - Apts sandwich 33 CFU/mL 95 CFU/mL in milk this work

a
TD-NMR: time domain nuclear magnetic resonance.
b
LAMP-LFD: loop-mediated isothermal amplification with lateral flow dipstick.
c
IMS: immunomagnetic separation.

sandwich instead of bacteria DNA was used as a PCR template for signal
amplification. This operation effectively avoided tedious DNA extrac-
tion and false positive results generating by dead bacteria DNA. Under
optimal parameters, the highly sensitive assay toward pure S. typhi-
murium cultures was achieved with a superior LOD of 33 CFU/mL by
naked eye. The separation and concentration of the aptamer-functio-
nalized magnetic beads made the assay suitable for detection in spiked
milk with a LOD of 95 CFU/mL. In addition, the method exhibited
excellent discrimination against other common pathogens. We believe
that the proposed sensor is a valuable tool for POCT of S. typhimurium
and holds promise to be extended to the applications of detecting other
foodborne pathogens.

CRediT authorship contribution statement

Sihan Chen: Formal analysis, Writing - original draft,

Conceptualization. Xinyan Yang: Validation, Investigation. Shiqian
Fu: Data curation, Visualization. Xue Qin: Writing - review & editing.
Tao Yang: Software. Chaoxin Man: Methodology. Yujun Jiang:
Project administration.
Fig. 7. Specificity of the proposed assay over other non- S. typhimurium. NC:
negative control. Inset: the corresponding color changes. Error bars: the stan-
Declaration of competing interest
dard deviations based on three independent measurements. (For interpretation
of the references to color in this figure legend, the reader is referred to the Web
version of this article.) We confirm that the manuscript has been read and approved by all
named authors and that there are no other persons who satisfied the
criteria for authorship but are not listed. We further confirm that the
order of authors listed in the manuscript has been approved by all of us.

Acknowledgments

This work was supported by the National Natural Science

Foundation of China (No. 31871828).

References

Fig. 8. Practical application test of the colorimetric sensor in spiked milk. Inset:
the corresponding color changes. Error bars: the standard deviations based on
three independent measurements. (For interpretation of the references to color
in this figure legend, the reader is referred to the Web version of this article.)
Alizadeh, N., Memar, M. Y., Moaddab, S. R., & Kafil, H. S. (2017). Aptamer-assisted novel
technologies for detecting bacterial pathogens. Biomedicine & Pharmacotherapy, 93,
737–745. https://doi.org/10.1016/j.biopha.2017.07.011.
CDC (2014). Salmonella data now at your fingertips. https://www.cdc.gov/media/
releases/2014/p0326-salmonella-data.html, Accessed date: 5 March 2020.
Christidis, T., Hurst, M., Rudnick, W., Pintar, K. D., & Pollari, F. (2020). A comparative
exposure assessment of foodborne, animal contact and waterborne transmission
routes of Salmonella in Canada. Food Control, 109, 106899. https://doi.org/10.1016/
j.foodcont.2019.106899.
Citartan, M., Gopinath, S. C. B., Tominaga, J., Tan, S. C., & Tang, T. H. (2012). Assays for
aptamer-based platforms. Biosensors and Bioelectronics, 34(1), 1–11. https://doi.org/
10.1016/j.bios.2012.01.002.
Duan, N., Wu, S. J., Yu, Y., Ma, X. Y., Xia, Y., Chen, X. J., et al. (2013). A dual-color flow
cytometry protocol for the simultaneous detection of Vibrio parahaemolyticus and
Salmonella typhimurium using aptamer conjugated quantum dots as labels. Analytica
Chimica Acta, 804, 151–158. https://doi.org/10.1016/j.aca.2013.09.047.
da Cunha‐Neto, A., Carvalho, L. A., Castro, V. S., Barcelos, F. G., Carvalho, R. C. T.,
Rodrigues, D.d. P., et al. (2019). Salmonella anatum, S. Infantis and S.

7
S. Chen, et al.
Schwarzengrund in Brazilian cheeses: Occurrence and antibiotic resistance profiles.
International Journal of Dairy Technology, 73(1), 296–300. https://doi.org/10.1111/
1471-0307.12636.
Du, M. H., Li, J. W., Zhao, R. X., Yang, Y., Wang, Y. F., Ma, K., et al. (2018). Effective pre-
treatment technique based on immune-magnetic separation for rapid detection of
trace levels of Salmonella in milk. Food Control, 91, 92–99. https://doi.org/10.1016/
j.foodcont.2018.03.032.
Feng, J. L., Dai, Z. Y., Tian, X. L., & Jiang, X. N. (2018). Detection of Listeria mono-
cytogenes based on combined aptamers magnetic capture and loop-mediated iso-
thermal amplification. Food Control, 85, 443–452. https://doi.org/10.1016/j.
foodcont.2017.10.027.
Hu, L., Deng, X., Brown, E. W., Hammack, T. S., Ma, L. M., & Zhang, G. (2018). Evaluation
of Roka Atlas Salmonella method for the detection of Salmonella in egg products in
comparison with culture method, real-time PCR and isothermal amplification assays.
Food Control, 94, 123–131. https://doi.org/10.1016/j.foodcont.2018.06.039.
Jiang, Y., Chen, S., Zhao, Y., Yang, X., Fu, S., McKillip, J. L., et al. (2020). Multiplex loop-
mediated isothermal amplification-based lateral flow dipstick for simultaneous de-
tection of 3 food-borne pathogens in powdered infant formula. Journal of Dairy
Science. https://doi.org/10.3168/jds.2019-17538 In press.
Jin, L., Li, T., Wu, B., Yang, T., Zou, D., Liang, X., et al. (2020). Rapid detection of
Salmonella in milk by nuclear magnetic resonance based on membrane filtration
superparamagnetic nanobiosensor. Food Control, 110, 107011. https://doi.org/10.
1016/j.foodcont.2019.107011.
Kim, Y. S., & Jurng, J. (2013). A simple colorimetric assay for the detection of metal ions
based on the peroxidase-like activity of magnetic nanoparticles. Sensors and Actuators
B: Chemical, 176, 253–257. https://doi.org/10.1016/j.snb.2012.10.052.
Kim, H. S., Kim, Y. J., Chon, J. W., Kim, D. H., Yim, J. H., Kim, H., et al. (2017). Two-stage
label-free aptasensing platform for rapid detection of Cronobacter sakazakii in
powdered infant formula. Sensors and Actuators B: Chemical, 239, 94–99. https://doi.
org/10.1016/j.snb.2016.07.173.
Lee, J., Jung, J., Lee, C. S., & Ha, T. H. (2017). Design and optimization of an ultra-
sensitive hairpin DNA aptasensor for Salmonella detection. RSC Advances, 7(56),
34933–34938. https://doi.org/10.1039/c7ra06000a.
Lee, K. M., Runyon, M., Herrman, T. J., Phillips, R., & Hsieh, J. (2015). Review of
Salmonella detection and identification methods: Aspects of rapid emergency re-
sponse and food safety. Food Control, 47, 264–276. https://doi.org/10.1016/j.
foodcont.2014.07.011.
Lee, S., Xie, J., & Chen, X. (2010). Activatable molecular probes for cancer imaging.
Current Topics in Medicinal Chemistry, 10(11), 1135–1144. https://doi.org/10.2174/
156802610791384270.
Li, H. X., & Rothberg, L. J. (2004). Label-free colorimetric detection of specific sequences
in genomic DNA amplified by the polymerase chain reaction. Journal of the American
Chemical Society, 126(35), 10958–10961. https://doi.org/10.1021/ja048749n.
Li, F., Zhang, H., Dever, B., Li, X.-F., & Le, X. C. (2013). Thermal stability of DNA func-
tionalized gold nanoparticles. Bioconjugate Chemistry, 24(11), 1790–1797. https://
doi.org/10.1021/bc300687z.
Mairal, T., Ozalp, V. C., Sanchez, P. L., Mir, M., Katakis, I., & O'Sullivan, C. K. (2008).
Aptamers: Molecular tools for analytical applications. Analytical and Bioanalytical
Chemistry, 390(4), 989–1007. https://doi.org/10.1007/s00216-007-1346-4.
Mei, X., Zhai, X., Lei, C., Ye, X., Kang, Z., Wu, X., et al. (2019). Development and ap-
plication of a visual loop-mediated isothermal amplification combined with lateral
flow dipstick (LAMP-LFD) method for rapid detection of Salmonella strains in food
samples. Food Control, 104, 9–19. https://doi.org/10.1016/j.foodcont.2019.04.014.
Mirkin, C. A., Letsinger, R. L., Mucic, R. C., & Storhoff, J. J. (1996). A DNA-based method
for rationally assembling nanoparticles into macroscopic materials. Nature,
382(6592), 607–609. https://doi.org/10.1038/382607a0.
Mooijman, K. A., Pielaat, A., & Kuijpers, A. F. A. (2019). Validation of EN ISO 6579-1 -
microbiology of the food chain - horizontal method for the detection, enumeration
and serotyping of Salmonella - Part 1 detection of Salmonella spp. International
Journal of Food Microbiology, 288, 3–12. https://doi.org/10.1016/j.ijfoodmicro.2018.
03.022.
Pan, R., Jiang, Y., Sun, L., Wang, R., Zhuang, K., Zhao, Y., et al. (2018). Gold
Food Control 115 (2020) 107281
nanoparticle-based enhanced lateral flow immunoassay for detection of Cronobacter
sakazakii in powdered infant formula. Journal of Dairy Science, 101(5), 3835–3843.
https://doi.org/10.3168/jds.2017-14265.
Portela, J. B., Coimbra, P. T., Cappato, L. P., Alvarenga, V. O., Oliveira, R. B., Pereira, K.
S., et al. (2019). Predictive model for inactivation of salmonella in infant formula
during microwave heating processing. Food Control, 104, 308–312. https://doi.org/
10.1016/j.foodcont.2019.05.006.
Quintela, I., de los Reyes, B., Lin, C.-S., & Wu, V. C. (2019). Simultaneous colorimetric
detection of a variety of Salmonella spp. in food and environmental samples by op-
tical biosensing using oligonucleotide-gold nanoparticles. Frontiers in Microbiology,
10, 1138. https://doi.org/10.3389/fmicb.2019.01138.
Sánchez-Gamboa, C., Hicks‐Pérez, L., Gutiérrez‐Méndez, N., Heredia, N., García, S., &
Nevárez‐Moorillón, G. V. (2018). Seasonal influence on the microbial profile of
Chihuahua cheese manufactured from raw milk. International Journal of Dairy
Technology, 71, 81–89. https://doi.org/10.1111/1471-0307.12423.
Song, J. Z., Li, Z. P., Cheng, Y. Q., & Liu, C. H. (2010). Self-aggregation of oligonucleotide-
functionalized gold nanoparticles and its applications for highly sensitive detection of
DNA. Chemical Communications, 46(30), 5548–5550. https://doi.org/10.1039/
c0cc00308e.
Srisa-Art, M., Boehle, K. E., Geiss, B. J., & Henry, C. S. (2018). Highly sensitive detection
of Salmonella typhimurium using a colorimetric paper-based analytical device cou-
pled with immunomagnetic separation. Analytical Chemistry, 90(1), 1035–1043.
https://doi.org/10.1021/acs.analchem.7b04628.
Suh, S. H., Dwivedi, H. P., & Jaykus, L. A. (2014). Development and evaluation of aptamer
magnetic capture assay in conjunction with real-time PCR for detection of
Campylobacter jejuni. Lwt-Food Science and Technology, 56(2), 256–260. https://doi.
org/10.1016/j.lwt.2013.12.012.
Sun, L. H., Jiang, Y. J., Pan, R. L., Li, M. Y., Wang, R., Chen, S. H., et al. (2018). A novel,
simple and low-cost paper-based analytical device for colorimetric detection of
Cronobacter spp. Analytica Chimica Acta, 1036, 80–88. https://doi.org/10.1016/j.
aca.2018.05.061.
Wachiralurpan, S., Sriyapai, T., Areekit, S., Sriyapai, P., Augkarawaritsawong, S.,
Santiwatanakul, S., et al. (2018). Rapid colorimetric assay for detection of Listeria
monocytogenes in food samples using LAMP formation of DNA concatemers and gold
nanoparticle-DNA probe complex. Frontiers in Chemistry, 6. https://doi.org/10.3389/
fchem.2018.00090.
Wang, L., Wang, R., Wang, H., Slavik, M., Wei, H., & Li, Y. (2017). An aptamer-based PCR
method coupled with magnetic immunoseparation for sensitive detection of
Salmonella Typhimurium in ground Turkey. Analytical Biochemistry, 533, 34–40.
https://doi.org/10.1016/j.ab.2017.06.010.
Xu, F., Li, P., Ming, X., Yang, D., Xu, H. Y., Wu, X. L., et al. (2014). Detection of
Cronobacter species in powdered infant formula by probe-magnetic separation PCR.
Journal of Dairy Science, 97(10), 6067–6075. https://doi.org/10.3168/jds.2014-
8287.
Yang, X., Wu, Q., Huang, J., Wu, S., Zhang, J., Chen, L., et al. (2020). Prevalence and
characterization of Salmonella isolated from raw vegetables in China. Food Control,
109, 106915. https://doi.org/10.1016/j.foodcont.2019.106915.
Zhang, M., Li, L. X., Li, B. C., Tian, N., Yang, M. J., Zhang, H., et al. (2019). Adsorption of
DNA by using polydopamine modified magnetic nanoparticles based on solid-phase
extraction. Analytical Biochemistry, 579, 9–17. https://doi.org/10.1016/j.ab.2019.05.
004.
Zhang, P., Liu, H., Li, X. C., Ma, S. Z., Men, S., Wei, H., et al. (2017). A label-free
fluorescent direct detection of live Salmonella typhimurium using cascade triple
trigger sequences-regenerated strand displacement amplification and hairpin tem-
plate-generated-scaffolded silver nanoclusters. Biosensors and Bioelectronics, 87,
1044–1049. https://doi.org/10.1016/j.bios.2016.09.037.
Zhou, J. H., & Rossi, J. (2017). Aptamers as targeted therapeutics: Current potential and
challenges. Nature Reviews Drug Discovery, 16(3), 181–202. https://doi.org/10.1038/
nrd.2016.199.
ISO (2017). Microbiology of the food chain — horizontal method for the detection, enu-
meration and serotyping of Salmonella — Part 1: Detection of Salmonella spp. https://
www.iso.org/standard/56712.html.