Scientia Horticulturae 260 (2020) 108888

Contents lists available at ScienceDirect

Scientia Horticulturae
journal homepage: www.elsevier.com/locate/scihorti

Influence of long-term cold storage on phenylpropanoid and soluble sugar T

metabolisms accompanied with peel browning of ‘Nanguo’ pears during
subsequent shelf life
⁎,1
Junwei Wanga, , Shengzhong Donga,1, Yangao Jianga, Haisheng Hea, Ting Liua, Mei Lvc,
⁎
Shujuan Jib,
a
Experimental Teaching Center, Shenyang Normal University, Shenyang, 110034, PR China
b
Department of Food Science, Shenyang Agricultural University, Shenyang, 110866, PR China
c
Shenyang Grain and Oil Food Science Institute, Shenyang, 110025, PR China

A R T I C LE I N FO A B S T R A C T

Keywords: Cold storage can effectively postpone the senescence of postharvest ‘Nanguo’ pear fruit. However, peel browning
‘Nanguo’ pear (PB) usually develops after the fruit are transferred to shelf life at room temperature. In this study, influence of
Peel browning cold storage on phenylpropanoid and soluble sugar metabolisms accompanied PB in pears was investigated.
Enzyme activity Increased PB and decreased phenolics compounds were observed with the extension of cold storage. The ac-
Gene expression
tivities and genes expression levels of enzymes involved in phenylpropanoid metabolism were restrained by
Phenylpropanoid and soluble sugar
long-term cold storage. Meanwhile, lower content of sucrose and sorbitol, and higher content of fructose and
metabolisms
glucose were detected as the prolonging of storage time, accompanied by decreased activities and genes ex-
pression levels of sucrose synthase (SS) and sucrose phosphate synthase (SPS), and increased activities and genes
expression levels of invertase. The results showed that the occurrence of PB in pears after long-term cold storage
was closely related to phenylpropanoid and soluble sugar metabolisms, and the possible mechanisms are dis-
cussed.

1. Introduction and caused great loss to the commodity value of fruit.

‘Nanguo’ pear (Pyrus ussuriensis Maxim.) is a kind of famous and
widely consumed fruit, which is generally harvested in early September
but has a short shelf life when stored at ambient temperatures (Zhou
et al., 2015; Sheng et al., 2016; Wang et al., 2017a, b). The traditional
method for extending their storage period is cold storage at 0 ± 0.5 °C
and 85–90 % relative humidity (RH), under which the ripening process
of the fruit is delayed (Zhou et al., 2015; Sheng et al., 2016). However,
the pear fruit is highly vulnerable to chilling injury (CI) during long-
term cold storage (Wang et al., 2017b). The CI symptom usually man-
ifested in development of browning on fruit peel, which appeared even
before the fruit softening (Wang et al., 2017b). In addition, the pattern
of peel browning (PB) in ‘Nanguo’ pears after refrigeration is in contrast
to the normal senescence of unrefrigerated ‘Nanguo’ pears, which be-
come soft first and then the flesh and core turn brown (Wang et al.,
2017a, b). Peel browning (PB) of ‘Nanguo’ pear is a major postharvest
problem of ‘Nanguo’ pear, which has limited the postharvest quality
The occurrence of PB is mainly caused by the contact between
polyphenol oxidase (PPO) and phenolic substrates, which are initially
distributed in different cell compartments (Sheng et al., 2016; Wang
et al., 2017b, 2018). This process may be affected by many physiolo-
gical metabolic disorders which occur in long-term cold storage. Phe-
nylpropanoid pathway plays important roles under various external
stresses (Ballester et al., 2011; Dixon and Paiva, 1995). The key en-
zymes involved in phenylpropanoid metabolism include phenylalanine
ammonia lyase (PAL), 4-Coumarate: CoA ligase (4CL), cinnamate-4-
hydroxylase (C4H) and chalcone isomerase (CHI), which are associated
with the biosynthesis of phenolics and flavonoids compounds (Janas
et al., 2000). It was reported that CI symptom was relieved in peach
fruit with higher levels of total phenolic and flavonoid content, and
enhanced activities of phenylpropanoid metabolism-related enzymes
(Wang et al., 2019). Our previous findings suggested that total phenolic
content in cold stored pear fruit showed declined trend along with cold
preservation time (Sheng et al., 2016). Nevertheless, the specific

⁎
Corresponding authors at: Shenyang Normal University, No. 253 Huanghe Road, Shenyang 110034, PR China.
E-mail addresses: synuwjw@163.com (J. Wang), jsjsyau@sina.com (S. Ji).
1
These authors contributed equally.

https://doi.org/10.1016/j.scienta.2019.108888
Received 5 August 2019; Received in revised form 24 September 2019; Accepted 24 September 2019
0304-4238/ © 2019 Elsevier B.V. All rights reserved.
J. Wang, et al.
changing trend and functional mechanism of phenylpropanoid pathway
in ‘Nanguo’ pear during shelf life after long-term cold storage is still
unclear.
Recently, soluble sugar metabolism has increasingly attracted the
attention of scientific researchers (Wang et al., 2019, 2016), owing to
that soluble sugars are not only related to organoleptic quality of fruit,
but also contributes to cell structure and chilling tolerance of fruit
under cold stress (Cao et al., 2013; Yu et al., 2016, 2017; Han et al.,
2018). Our previous proteomic study had screened four differentially
expressed proteins involved in soluble sugar metabolism during the
occurrence of PB in pears, as follows, acid invertase (AI), neutral in-
vertase (NI), sucrose synthase (SS) and sucrose phosphate synthase
(SPS) (Wang et al., 2017b). These enzymes may play important roles on
the quality of fruit under cold storage. It was reported that the en-
hancement of chilling tolerance in peach fruit was closely related to the
high levels of sucrose, higher activities and genes expression levels of SS
and SPS, as well as lower activities and genes expression levels of AI
and NI (Wang et al., 2019; Yu et al., 2016; Wang et al., 2013). On the
contrary, chilling injury was alleviated in loquat and apricot fruit which
had higher levels of glucose and fructose, and higher activities of AI and
NI (Wang et al., 2016; Cao et al., 2013). However, the change of soluble
sugar metabolism in ‘Nanguo’ pear during shelf life after long-term cold
storage is still not fully revealed.
The objective of this study was to investigate the roles of phenyl-
propanoid and soluble sugar metabolisms in the occurrence of PB in
‘Nanguo’ pears. To achieve this goal, we examined PB index, firmness,
electrolyte leakage rate, total phenolic and flavonoid content, and
content of soluble carbohydrates of pear fruit during shelf life after
different cold storage period. In addition, activities and genes expres-
sion levels of enzymes involved in phenylpropanoid and soluble sugar
metabolisms were also analyzed.
2. Materials and methods
2.1. Fruit materials and sampling
Pear fruit (Pyrus ussuriensis Maxim. cv ‘Nanguo’) were handpicked at
an orchard in Anshan, Liaoning province, China (41.04◦N, 123.03◦E)
on September 10th, 2018. Fruit were selected for uniform size and
color, and lack of decay or visual defects. Then the fruit were delivered
to our laboratory promptly on the harvest day.
Samples of pear fruit were stochastically divided into 4 groups of
650 fruit each, and then stored at 0 ± 0.5 °C and 85–90 % RH. Fruit
were sampled after stored for 0 d, 60 d, 120 d or 180 d, respectively,
and the fruit were transferred to shelf life at 20 °C for 15 d at each
sampling point. During the shelf life period, analyses were conducted at
a 3-day interval. At each testing time, 3 replicates of 27 fruit were
collected to determine the browning index (browning index), firmness,
electrolyte leakage, content of phenolic and flavonoid, content of so-
luble carbohydrates, and enzyme activities. At the same time, peel tis-
sues of 9 fruit from each replicates were frozen in liquid nitrogen for the
measurement of gene expression.
2.2. Analysis of PB index, firmness, ethylene production and electrolyte
leakage
The severity of PB in pear fruit was firstly graded on a scale of 0–3
by evaluating the area of browning on peel: 0 = no browning, 1 = less
than 1/3 browning, 2 = 1/3 - 2/3 browning, 3 = more than 2/3
browning. Then the results were expressed as BI by using the following
formula: BI (%) = (Σ (browning degree × fruit number of this degree))
/ (the highest browning degree × total fruit number) × 100%.
Firmness was detected on four pared opposite sides of fruit by using
a texture analyzer (TA-XT2iPlus; StableMicro System, Guildford, UK)
equipped with an 8-mm diameter probe. The penetration rate was 3 mm
s−1, and the depth was 8 mm.
2
Scientia Horticulturae 260 (2020) 108888
The ethylene production was detected by using a gas analyzer (PBI-
Dansensor Checkmate 9900, Denmark) and a gas chromatograph (CP-
3800, Varian, USA) with DB-5 capillary column (30 m × 0.25 mm
×0.25 μm; Agilent Corp., Santa Clara, CA, USA) and a flame ionization
detector. Samples were put in 700 mL jars sealed for 5 h at 20 °C. Then
1 mL of headspace gas was sampled. The temperatures of injector, de-
tector and oven were 110 °C, 140 °C, and 90 °C, respectively.
Electrolyte leakage was measured as described by Zhu et al. (2009)
with some modification. A total of 20 pieces of peel discs (1 cm dia-
meter) from fruit were immerged in 40 mL of ultrapure water. The
conductivity of the solution was measured as P0 by using a conductivity
meter (DDS-307, Shanghai Precise Science Instrument Co., Shanghai,
China). After 10 min, the conductivity of the solution was determined
as P1. Then the solution were boiling for 10 min and cooling to 20 °C,
and the conductivity was detected as P2. The electrolyte leakage was
calculated according to the formula: Electrolyte leakage (%) = (P1 - P0)
/ (P2 - P0).
2.3. Analysis of total phenolic and total flavonoid content
Total phenolic content was measured according to the method of
Hinneburg et al. (2006). Peel sample (2 g) was homogenized with 80%
methanol containing 0.5 mol L−1 hydrochloric acid at 4 °C, and ex-
tracted in the dark for 24 h. Then, a total of 0.5 mL of supernatant was
collected and added with 1.0 mL of Folin-Ciocalteu reagent. The solu-
tion was mixed with 3 mL of 1 mol L−1 Na2CO3. The mixture was added
with distilled water to a final volume of 10 mL, and kept for 1 h at room
temperature. The absorbance was measured at 760 nm, and the results
are expressed as milligrams of gallic acid equivalents per gram fresh
weight (FW).
Total flavonoid content was measured according to the method of
Toor and Savage (2005) with some modification. Peel sample (2 g) was
ground in 60% ethanol. After centrifuged at 12,000 g for 20 min at 4 °C,
2 mL of supernatant was added with 1 mL of ethanol, 1 mL of 3% AlCl3
and 2 mL of acetic acid sodium buffer (pH 5.5). The absorbance was
detected at 510 nm, and results are expressed as milligrams of rutin
equivalents per gram fresh weight (FW).
2.4. Analysis of soluble carbohydrates
Soluble carbohydrates were measured according to the method of
Shao et al. (2013) with some modification. Peel tissue (5 g) was ground
and homogenized with 25 mL of extraction solution containing 3.2 g
L−1 acetic acid and 2.4 g L−1 potassium ferrocyanide. The homogenate
was then centrifuged at 12,000 g for 20 min at 4 °C, and the supernatant
was collected. After diluted to 150 mL by using deionized water, the
solution was passed through a 0.22 mm membrane filter (Millipore
Corp., Bedford, MA, USA). A HPLC instrument (Agilent 1200, Agilent
Corp., Santa Clara, CA, USA) equipped with Zorbax carbohydrate
analysis column (5 μm, 150 × 4.6 mm, Agilent Corp., Santa Clara, CA,
USA) and refractive index detector (Agilent 1200, Agilent Corp., Santa
Clara, CA, USA) was used for the measurement. Mobile phase consisted
of acetonitrile and water (80:20). The flow rate was 1.0 mL min−1. The
injection volume was 10 mL.
2.5. Analysis of phenylpropanoid metabolism enzyme activity
Enzyme activity of PAL was measured by using the method de-
scribed by Assis et al. (2001) with some modifications. Peel tissue (1 g)
was ground in 5 mL of 0.2 mol L−1 sodium borate buffer (pH 8.7)
containing 0.02 mol L−1 β-mercaptoethanol. The mixture was cen-
trifuged at 12,000 g for 20 min at 4 °C. A total of 0.1 mL supernatant
was added with 1 mL of L-phenylalanine, and then incubated for 60 min
at 37 °C. The absorbance was measured at 290 nm. One unit of PAL
activity was defined as the amount of enzyme resulting in an increase of
0.01 per min.
J. Wang, et al. Scientia Horticulturae 260 (2020) 108888

Table 1
Primers for Real-time q-PCR Analysis.
Gene Accession number Forward primer (5'-3') Reverse primer (5'-3') Product size (bp)

AI (acid invertase) AB239589 ATGACCCGACTATCGACGTT TCGGAATGGTGTGAAGGGAA 177

NI (neutral invertase) JQ412749 ATGCGAGGTTACTTCTGGCT ACGGCATGGCATGAAATCAA 147
SS (sucrose synthase) AB045710 CCTCAAATCCGCACAGGAAG ACGGTCAATTCCTCCACACT 126
SPS (sucrose phosphate synthase) EF568782 AGGAAGCTCAAAGGATGGCT TTCTAGGCAGTCTGGCTCTG 159
PAL (phenylalanine ammonia lyase) GU906269 CCACATTCTGCCTCACACAG GGCTTCCAGGATTTCGAACC 100
C4H (cinnamate-4-hydroxylase) HQ901370 AACAAGGTCGTCCAGCAGTA ATCCTCCTCGCTCTCGAATC 183
4CL (4-Coumarate: CoA ligase) KF767455 CTCATCGATGGCGAGTCCT GCCATGGGAGACCTGGATAA 75
CHI (chalcone isomerase) JX403949 GGGTAAGACAGCCAAGGAGT GCAACGCAATTCTCCGAAAC 147
ACTIN JN684184 TTGGGATGGGTCAGAAGG CTGTGAGCAGAACTGGGTG 186

Enzyme activity of C4H was measured according to the method of
Gao et al. (2016) with slight modifications. Peel tissue (1 g) was ground
in 5 mL of 0.05 mol L−1 Tris−HCl buffer, and then centrifuged at
12,000 g for 20 min at 4 °C. The incubation was carried out at 37 °C for
30 min in a reaction mixture containing 0.5 mL enzyme extract and
2 mL of 0.05 mol L−1 Tris−HCl buffer consisted of 8 μmol L−1 trans-
cinnamic acid and 3 μmol L−1 NADPNa2. The absorbance was measured
at 340 nm. One unit of C4H activity was defined as the amount of en-
zyme resulting in an increase of 0.01 per min.
Enzyme activity of 4CL was measured according to the method
described by Li et al. (2014) with some modifications. Peel tissue (1 g)
was ground in 5 mL of 0.2 mol L−1 Tris−HCl buffer, and then cen-
trifuged at 12,000 g for 20 min at 4 °C. The reaction mixture consisted of
0.5 mL enzyme extract and 1.5 mL of Tris−HCl buffer (pH 7.5) con-
taining 0.0075 mol L−1 MgCl2, 0.0002 mol L−1 p-coumarate,
0.0001 mol L−1 adenosine triphosphate and 0.04 mol L−1 CoA. The
mixture was incubated at 40 °C for 5 min, and the absorbance was
measured at 333 nm. One unit of 4CL activity was defined as the
amount of enzyme resulting in an increase of 0.01 per min.
Enzyme activity of CHI was measured according to a modified
method of Ju et al. (1997). Peel tissue (1 g) was ground in 5 mL of
0.1 mol L−1 Tris−HCL buffer, and then centrifuged at 12,000 g for
20 min at 4 °C. The supernatant (0.7 mL) was mixed with 2 mL of
Tris−HCL buffer and 0.01 mL of 0.02 mol L−1 chalcone. The absor-
bance was measured at 370 nm. One unit of CHI activity was defined as
the amount of enzyme resulting in an increase of 0.01 per min.
activity, the reaction mixture consisted of 0.1 mol L−1 HEPES-NaOH
(pH 8.0), 0.01 mol L−1 UDP-glucose, 0.015 mol L−1 glucose-6-phos-
phate, 0.005 mol L−1 fructose-6-phosphate, 0.015 mol L−1 MgCl2 and
enzyme extract. The incubation was conducted at 37 °C for 30 min, and
terminated by adding 0.5 mL of 0.005 mol L−1 NaOH and placing in
boiling water for 5 min. Anthrone was added after the mixture was
cooling, and then the mixture was incubated for 10 min at 80 °C. The
absorbance was measured at 620 nm. One unit activity was defined as
the amount of enzyme resulting in 1 mg sucrose in 1 h.
The quantity of soluble protein was analyzed by using the method of
Bradford (1976).
2.7. RNA isolation and analysis of gene expression
Total RNA from different peel samples was extracted by using Total
RNA Extraction Kit (Solarbio, Beijing, China). First strand cDNA was
synthesized by using Universal RT-PCR Kit (M-MLV) (Solarbio, Beijing,
China). Quantitative real-time quantitative PCR experiments were
conducted by using an iQ5 real-time PCR system (Bio-Rad, USA). qPCR
was performed by using primers (Table 1) and a 2 × SYBR Green PCR
Mastermix (Solarbio) under the following conditions: 30 s at 95 °C, 40
cycles of 5 s at 95 °C, and 34 s at 58 °C. Actin gene (PpActin, JN684184)
of Pyrus was selected as an internal control to normalize small differ-
ences in template amounts. Experiments were conducted in biological
triplicate.

2.8. Statistical analyses

2.6. Analysis of soluble sugar metabolism enzyme activity
Extraction of enzymes was conducted according to the method of
Shao et al. (2013) with some modification. Peel tissue (3 g) was ground
on ice with 0.5 g polyvinylpyrrolidone and 6 mL of buffer (pH 8.5)
containing 0.05 mol L−1 HEPES-NaOH, 0.01 mol L−1 MgCl2,
0.0025 mol L−1 DTT, 0.01 mol L−1 vitamin C, 0.01 mol L−1 β-mer-
captoethanol, 0.1% TritonX-100, 20% glycerol, 0.01 g L−1 chymostatin
and 0.01 g L−1 leupeptin. The mixture was then centrifuged at 12,000 g
for 30 min at 4 °C. The supernatant was collected to measure the ac-
tivities of AI, NI, SS and SPS.
Activity of AI was determined by using the method of Sun et al.
(2011). The reaction mixture consisted of 0.1 mol L−1 sodium citrate
buffer (pH 4.5), 1% sucrose and enzyme extract. The incubation was
conducted at 37 °C for 30 min, and terminated by adding 1 mL of 3, 5-
dinitrosalicylic acid and placing in boiling water for 5 min. The ab-
sorbance was measured at 370 nm. The measurement of NI activity was
similar to that of AI, which used 0.1 mol L−1 sodium phosphate buffer
(pH 7.5). One unit activity was defined as the amount of enzyme re-
sulting in 1 mg glucose in 1 h.
Activities of SS-synthesis and SPS were determined by using the
method of Solomakhin and Blanke (2010). For the assay of SS-synthesis
activity, the reaction mixture consisted of 0.1 mol L−1 HEPES-NaOH
(pH 8.0), 0.004 mol L−1 uridine diphosphate glucose, 0.06 mol L−1
fructose, 0.015 mol L−1 MgCl2 and enzyme extract. For the assay of SPS
Experiments were performed according to a randomized design.
Analyses of all the data were performed by using analysis of variance
(ANOVA) from SPSS software. Duncan’s multiple range tests was car-
ried out to determine mean separations with a significant difference at
the 5% level.
3. Results
3.1. PB index, firmness, ethylene production and electrolyte leakage
PB index of fruit are displayed in Fig. 1A. Unrefrigerated fruit and
those stored for 60 d showed no PB symptom during the whole shelf
life. However, after 120 d and 180 d storage at 0 °C, PB began to appear
on the fruit from day 6 of shelf life, and BI increased dramatically
during the shelf life. Moreover, significantly higher BI was found in fruit
stored for 180 d, which illustrated that the severity of PB was related to
the storage duration.
Although similar changing trend was observed in all groups of fruit,
the firmness of fruit stored for 120 d and 180 d was significantly lower
compared to that of the other two groups (Fig. 1B). Moreover, 40.3%
and 54.6% lower firmness was observed in fruit stored for 120 d and
180 d on the last day compared to that on the day of removal, re-
spectively.
Ethylene production kept at a low level from day 0 to day 6 in all

3
J. Wang, et al.
Fig. 1. BI (a), firmness (b), ethylene production (c) and electrolyte leakage (d) of ‘Nanguo’ pears during shelf life at 20 °C following different durations of cold storage
at 0 °C. Means ± SE of three replicates are shown.
groups of fruit, followed by a sharp increase on day 9, and the upward
trend continued to the end of the shelf life (Fig. 1C). Prolonged re-
frigeration period aggravated the increase of ethylene production in
fruit during shelf life. Significantly higher ethylene production was
found in fruit stored for 180 d compared to that of the other three
groups from day 9 to day 15.
Electrolyte leakage grew gradually during shelf life, but showed
diverse rising trend among the groups. Unrefrigerated fruit and fruit
stored for 60 d didn’t show dramatic increase in electrolyte leakage
during the whole shelf life (Fig. 1D). However, the electrolyte leakage
in fruit after 120 d storage increased sharply on day 9 and significantly
higher electrolyte leakage was observed from day 6 to day 15. With
regards to the fruit stored for 180 d, a dramatic increase in electrolyte
leakage was detected from day 3 to day 15, and significantly higher
electrolyte leakage was observed compared to that of the other three
groups from day 3 to day 15.
3.2. Total phenolics and total flavonoids content
Total phenolics content showed similar changing trend in un-
refrigerated fruit and fruit stored for 60 d and 120 d, increasing from
day 0 to day 12, then decreasing on day 15 (Fig. 2A). However, storage
for 120 d exacerbated the decline of total phenolics content. Total
phenolics content in fruit after 180 d storage remained constant and
kept at a lower level compared to the other three groups from day 0 to
day 9, and then decreased afterwards. Total flavonoids content in fruit
increased before day 6 and then decreased (Fig. 2B). Nevertheless,
lowest total flavonoids content was observed in fruit stored for 180 d.
Total flavonoids content in fruit stored for 120 d and 180 d were 35.4%
and 58.8% lower than that of unrefrigerated fruit on day 15, respec-
tively.
4
Scientia Horticulturae 260 (2020) 108888
3.3. Soluble sugar content
Sucrose is the primary soluble sugar in ‘Nanguo’ pear fruit, which
exhibited higher level than either glucose or fructose (Fig. 3A–C).
However, sucrose content showed varied changing trend after different
storage period. Sucrose content in unrefrigerated fruit and fruit stored
for 60 d experienced a steady increase from day 0 to day 6, and then
decreased sharply (Fig. 3A). On the other hand, sucrose content in fruit
stored for 120 d and 180 d maintained constant in the first 3 d, and
declined gradually afterwards. At the end of storage, sucrose content in
fruit stored for 180 d was 39.2% lower than that in unrefrigerated fruit.
The contents of fructose and glucose increased continuously during the
whole shelf life. Cold storage for 120 d and 180 d promoted the increase
of fructose and glucose on day 9 and day 6, respectively (Fig. 3B and C).
The contents of fructose and glucose were 1.6-fold and 1.3-fold com-
pared to those of unrefrigerated fruit at the end of shelf life. Sorbitol
content in unrefrigerated fruit and fruit stored for 60 d increased dra-
matically and peaked on day 3, whereas, long-term storage inhibited
the increase of sorbitol content (Fig. 3D). Content of sorbitol in fruit
stored for 180 d were 74.8% and 83.7% lower than that of un-
refrigerated fruit on day 3 and day 15, respectively.
Content of total soluble sugars in unrefrigerated fruit and fruit
stored for 60 d increased gradually in the first 6 d, and then decreased
until the last day (Fig. 3E). However, long-term cold storage inhibited
the content of total soluble sugars in pear fruit during shelf life. Content
of total soluble sugars in fruit stored for 120 d and 180 d maintained
constant from day 0 to day 6, and decreased sharply on the last day.
Significantly lower content of total soluble sugars was found in fruit
stored for 180 d compared to that of the other three groups during shelf
life.
J. Wang, et al.
Fig. 2. Total phenolics content (a), total flavonoids content (b) of ‘Nanguo’ pears during shelf life at 20 °C following different durations of cold storage at 0 °C.
Means ± SE of three replicates are shown.
3.4. Activities and gene expression of enzymes in phenylpropanoid
metabolism
PAL activity in unrefrigerated fruit and fruit stored for 60 d in-
creased in the first 6 d, remaining constant from day 6 to day 9, and
then decreased (Fig. 4A). However, a sharp decrease in PAL activity was
observed in fruit stored for 120 d and 180 d on day 9. Long-term cold
storage for 120 d and 180 d also inhibited the uptrend of 4CL activity in
fruit, especially on day 9 (Fig. 4B). C4H activity of unrefrigerated fruit
and fruit stored for 60 d increased sharply in the first 9 d, while long-
term cold storage dramatically inhibited the C4H activity (Fig. 4C).
About 55.1% and 56.1% lower C4H activity was found in fruit stored
for 180 d compared to the unrefrigerated fruit. Similar to the case of
C4H activity, long-term cold storage adversely restrained the CHI ac-
tivity (Fig. 4D). Lowest CHI activity was found in fruit stored for 180 d
during the whole shelf life.
Similar to its activity, gene expression level of PAL showed early
increase and later decrease trend (Fig. 5A). Prolonged cold storage
exacerbated the decline in PAL, which manifested in 79.7% and 87.2%
lower gene expression level of PAL detected in fruit stored for 180 d on
day 6 and day 9, respectively. Gene expression level of 4CL increased
sharply in the first 9 d (Fig. 5B). Lowest gene expression level of 4CL
was also found in fruit stored for 180 d. Gene expression level of C4H in
unrefrigerated fruit peaked at 4.72 on day 9, which was suppressed
below 1 by 180 d storage during the entire shelf life (Fig. 5C). Cold
storage for 120 d and 180 d attenuated the uptrend in gene expression
level of CHI during the first 6 d (Fig. 5D). Lowest gene expression level
of CHI was detected in 180 d stored fruit.
3.5. Activities and gene expression of enzymes in soluble sugar metabolism
AI activities increased during the whole shelf life, with a sharp
uptrend on day 3 (Fig. 6A). Activities of NI in fruit increased sharply on
day 3, with a decreasing on day 6, and then increased again (Fig. 6B).
Long-term cold storage promoted the uptrend in the activities of both
AI and NI, and 1.8-fold higher AI activity and 1.9-fold higher NI activity
were found in fruit stored for 180 d compared to that of unrefrigerated
fruit on day 3. Different changing trends of SS-synthesis activity were
observed among groups. SS-synthesis activity of unrefrigerated fruit
and fruit stored for 60 d increased rapidly in the first 9 d, with a sharp
decline on day 12 (Fig. 6C). Long-term cold storage inhibited the in-
crease of SS-synthesis activity on day 9. SPS activity of unrefrigerated
fruit and fruit stored for 60 d increased continuously from day 0 to day
12 (Fig. 6D). However, the uptrend of SPS activity was suppressed on
day 12 by cold storage for 120 d and 180 d.
Gene expression level of AI in unrefrigerated fruit and fruit stored
for 60 d kept at a low level in the first 9 d, with a sharp increase on day
12 (Fig. 7A). Whereas, a rapid uptrend was observed in fruit stored for
5
Scientia Horticulturae 260 (2020) 108888
120 d and 180 d in the first 6 d. Similar to the NI activity, a dramatic
uptrend in gene expression level of NI was found in fruit stored for 120
d and 180 d (Fig. 7B). Long-term cold storage promoted the gene ex-
pression level of AI and NI, which exhibited at 30-fold and 3.4-fold
higher gene expression level of AI on day 6 and NI on day 3 found in
fruit stored for 180 d compared to that of unrefrigerated fruit. Gene
expression level of SS in unrefrigerated fruit and fruit stored for 60 d
increased gradually in the first 6 d, and then decreased to a low level
similar to the day of removal on day 15 (Fig. 7C). Gene expression level
of SS in fruit stored for 120 d and 180 d remained constant in the first 3
d, and decreased continuously until the end of shelf life. Long-term cold
storage inhibited the uptrend in gene expression level of SPS from day 0
to day 12 (Fig. 7D). Fruit stored for 180 d had 67.9% and 85.6% lower
gene expression level of SPS than that in the unrefrigerated fruit on day
9 and day 12, respectively.
4. Discussion
Our present study showed that cold storage at 0 ± 0.5 °C and
85–90 % RH could effectively prolong the storage period of postharvest
‘Nanguo’ pear. Under this storage condition, cold stored fruit had re-
latively high levels of firmness and total soluble sugars as un-
refrigerated fruit. In addition, pear fruit showed no PB symptom during
the whole 15 d of shelf life after cold storage for 60 d.
PB is a constraining factor to the fruit quality and commercial value
of ‘Nanguo’ pear after cold storage (Zhou et al., 2015; Sheng et al.,
2016; Wang et al., 2017b). The process of PB in long-term cold stored
pear fruit is found to be in contrast to the normal senescence of un-
refrigerated fruit (Wang et al., 2018). It has been suggested that the
occurrence of PB in ‘Nanguo’ pear is a symptom of CI, which is related
to the enzymatic reaction of phenolic compounds catalyzed by PPO,
resulted from the breakdown of compartmentalization in cellular
membrane system, owing to the disorder of physiological metabolic
processes (Wang et al., 2018). Moreover, it has also been reported that
cold storage could cause the overproduction of ethylene, which might
accelerate programmed cell death and lead to over-mature physiolo-
gical disorders during the shelf life of pear fruit (Zhai et al., 2018). In
this study, PB phenomenon developed gradually in pear fruit during
shelf life after long-term cold storage, accompanying with increased
electrolyte leakage and decreased firmness, which was closely related
to the extension of cold storage. Statistical analysis showed that BI was
positively correlated to the electrolyte leakage (r = 0.9868, P < 0.01).
It could demonstrate that the PB in pear was correlated with the da-
mage in the integrity of membrane system and the breakdown of cells in
fruit under cold stress.
The phenylpropanoid metabolism plays important roles in various
postharvest horticultural crops to against stress, and the enhancement
of chilling tolerance in fruit was reported to be connected with the
J. Wang, et al.
Fig. 3. Content of sucrose (a), fructose (b), glucose (c), sorbitol (d) and total sugars (e) in ‘Nanguo’ pears during shelf life at 20 °C following different durations of cold
storage at 0 °C. Means ± SE of three replicates are shown.
increase in phenolic compounds (Gao et al., 2016; Jannatizadeh, 2019;
Ge et al., 2018; Suo et al., 2018; Liu et al., 2014). It was reported that
higher phenols accumulation giving rise to higher DPPH scavenging
capacity was vital for conferring chilling tolerance in pomegranate fruit
(Jannatizadeh, 2019). Ge et al. (2018) reported that the accumulation
of total phenolics and flavonoids obtained by regulating phenylpropa-
noid pathway could prolong the shelf life and delay the senescence of
blueberry fruit stored at 4 °C. Similarly, the inducement of chilling
tolerance in peach fruit was associated with activation of phenolic
biosynthesis (Gao et al., 2016). In our study, total phenolics and total
flavonoids in pear fruit during shelf life decreased with the extension of
cold storage, accompanied by the aggravation of PB in fruit. BI had a
6
Scientia Horticulturae 260 (2020) 108888
positive correlation with total phenolics (r = 0.8392, P < 0.01) and a
negative correlation with total flavonoids (r = 0.9798, P < 0.01). The
results of our study confirmed that decline in phenolic compounds was
adverse to PB in pear fruit during shelf life. The phenolic compounds
also play positive roles in scavenging radical oxygen species (Wang
et al., 2019). Therefore, lower levels of total phenolics and total fla-
vonoids detected in fruit stored for 120 d and 180 d could have an
adverse effect on protection the peroxidation of cellular membrane and
the damage of compartmentalization in cells, leading to the enzymatic
reaction of phenolic compounds and browning in peel.
Biosynthesis of phenolic and flavonoid compounds has close re-
lationship to the activities and gene expression level of enzymes
J. Wang, et al. Scientia Horticulturae 260 (2020) 108888

Fig. 4. Activity of PAL (phenylalanine ammonia lyase, a), 4CL (4-Coumarate: CoA ligase, b), C4H (cinnamate-4-hydroxylase, c) and CHI (chalcone isomerase, d) in
‘Nanguo’ pears during shelf life at 20 °C following different durations of cold storage at 0 °C. Means ± SE of three replicates are shown.

Fig. 5. Relative gene expression of PAL (phenylalanine ammonia lyase, a), 4CL (4-Coumarate: CoA ligase, b), C4H (cinnamate-4-hydroxylase, c) and CHI (chalcone
isomerase, d) in ‘Nanguo’ pears during shelf life at 20 °C following different durations of cold storage at 0 °C. Means ± SE of three replicates are shown.

7
J. Wang, et al. Scientia Horticulturae 260 (2020) 108888

Fig. 6. Activity of AI (acid invertase, a), NI (neutral invertase, b), SS-synthesis (sucrose synthase, c) and SPS (sucrose phosphate synthase, d) in ‘Nanguo’ pears during
shelf life at 20 °C following different durations of cold storage at 0 °C. Means ± SE of three replicates are shown.

Fig. 7. Relative gene expression of AI (acid invertase, a), NI (neutral invertase, b), SS (sucrose synthase, c) and SPS (sucrose phosphate synthase, d) in ‘Nanguo’ pears
during shelf life at 20 °C following different durations of cold storage at 0 °C. Means ± SE of three replicates are shown.

8
J. Wang, et al.
involved in phenylpropanoid metabolism. PAL is the first key enzyme in
phenolic compounds synthesis, which promotes the catalytic conver-
sion of L-phenylalanine into trans-cinnamic acid (Cheng et al., 2015).
PAL was reported to be involved in many biotic and abiotic stress
processes, such as cold stress (Sanchez-Ballesta et al., 2000). C4H cat-
alyzes trans-cinnamic acid into hydroxycinnamic acid to synthesize the
precursors for lignin biosynthesis, such as coumaric acid, ferulic acid,
and caffeic acid (Zhou et al., 2018). Then, 4CL catalyzes the conversion
of coumaric acid to form 4-coumaroyl CoA (Vogt, 2010). CHI, which
plays an important role in defensive resistance, catalyzes chalcone to
flavanone (Christie et al., 1994). It was reported that CI in pomegranate
fruit was alleviated under exogenous melatonin treatment by means of
increasing the activity of PAL (Jannatizadeh, 2019). Blueberry fruit
treated with γ-Aminobutyric acid exhibited significantly higher activ-
ities of PAL, 4CL and C4H, which led to the resistance of decay during
cold storage (Ge et al., 2018). In the present study, the activities and
gene expression levels of PAL, C4H, 4CL and CHI were suppressed
during long-term cold storage, especially in fruit stored for 120 d and
180 d, accompanied by exacerbated PB symptom. Meanwhile, the lower
activities of the enzymes were in accordance with the lower contents of
phenolic and flavonoid compounds in fruit, which played important
roles in membrane protection during cold storage and shelf life. Based
on the results above, it could be suggested that the key enzymes in-
volved in phenylpropanoid metabolism played a crucial role in accu-
mulation of phenolic compounds in pear fruit, which consequently had
an important influence on the resistance to cold stress and the main-
tenance of fruit quality during long-term cold storage.
It has been reported that soluble sugar metabolism has several
beneficial effects in protecting plants against chilling stress (Cao et al.,
2013). Soluble sugars, especially sucrose, glucose and fructose, play a
pivot role in plant structure and metabolism at the cellular and whole-
organism levels (Wang et al., 2019). These sugars may play an im-
portant role in the process of osmoregulation, cryoprotection and sig-
naling in plants, providing carbon source and substrate to physiological
metabolism (Liu et al., 2019), so as to participate in defensive system
under cold stress conditions (Yu et al., 2016, 2017; Han et al., 2018).
Under chilling condition, the structure of cellular membrane may be
damaged, owing to the changes of cell membrane from the gel to the
liquid crystalline phase (Cao et al., 2013). Soluble sugars would play
important roles in protecting the cells of fruit from oxidation under cold
stress (Palma et al., 2014; Cao et al., 2014). Increasing studies have
found that appropriate postharvest handlings could enhance the chil-
ling tolerance of peach fruit by elevating the content of sucrose (Wang
et al., 2019; Yu et al., 2016, 2017; Han et al., 2018). Cao et al. (2014)
also reported that exogenous sucrose treatment alleviated the chilling
stress in cucumber, which exhibited as lower levels of superoxide ra-
dical, hydrogen peroxide and malonaldehyde. Meanwhile, some con-
trary results suggested that higher contents of glucose and fructose were
beneficial to the enhancement of chilling tolerance in apricot fruit and
loquat fruit (Wang et al., 2016; Cao et al., 2013). Moreover, Liu et al.
(2019) claimed that higher soluble sugar levels, including sucrose,
glucose and fructose, might account for the reduced chilling injury in
banana fruit treated with fibroin. In the present study, aggravated
symptom of PB in pear fruit stored for 120 d and 180 d was accom-
panied with lower levels of sucrose and total soluble sugars. BI was
negatively correlated to sucrose (r = 0.9735, P < 0.01) and total so-
luble sugars (r = 0.9061, P < 0.01), while positively correlated to
glucose (r = 0.984, P < 0.01) and fructose (r = 0.9933, P < 0.01). In
addition, it was reported that sorbitol, which converted into fructose
and glucose, could be used as fuel in cells of plants (Cao et al., 2013; Itai
and Tanahashi, 2008). In our present study, significantly lower content
of sorbitol also detected in fruit after long-term cold storage for 120 d
and 180 d. BI was positively correlated to sorbitol (r = 0.9282,
P < 0.01). It could be suggested that long-term cold storage had an
adverse impact on the accumulation of sucrose and total soluble sugars
in pear fruit, and affected the stability of cellular membrane and
9
Scientia Horticulturae 260 (2020) 108888
signaling regulation of cells, leading to disorders in physiological me-
tabolic process.
Among the enzymes involved in soluble sugar metabolism, in-
vertase, SPS and SS are directly involved in sucrose synthesis and/or
degradation (Sasaki et al., 2001). AI and NI, which are two kinds of
main invertase of sucrose, functioned in the accumulation of reducing
sugars (Sturm and Tang, 1999). On the other hand, enzymes of SS and
SPS are responsible for the synthesis of sucrose using glucose and
fructose as substrates (Guo et al., 2002). More and more studies have
been conducted to reveal the effects of these enzymes on the chilling
tolerance in fruit under cold stress. It was reported that cold stress in-
creased activity and gene expression of invertase in tomato, which
suggested that invertase might be involved in chilling tolerance (Xu
et al., 2017). Yu et al. (2016) suggested that an increase in sucrose,
accompanied with higher gene expression level and activity of SPS, and
lower expression level and activity of AI, enhanced the chilling toler-
ance in peach fruit treated by hot air and methyl jasmonate. Similarly,
CI was reduced in peach fruit with higher content of sucrose which was
resulted from higher levels of activities of SS-synthesis and SPS, as well
as lower levels of activities of AI and NI (Wang et al., 2019). Further-
more, Wang et al. (2016) reported that the enhancement of chilling
tolerance has been observed in oxalic acid-treated apricot fruit, paral-
leled with enhanced AI activity and suppressed SS-synthesis activity. In
the present study, long-term cold storage for 120 d and 180 d adversely
inhibited the activities and gene expression levels of SS-synthesis and
SPS, but dramatically promoted the activities and gene expression le-
vels of AI and NI in pear fruit during shelf life. As a consequence, lower
level of sucrose and higher level of glucose and fructose were found in
fruit stored for 120 d and 180 d compared with the unrefrigerated fruit
and that store for 60 d. The results of our study suggested that the
deteriorating decline in sucrose, owing to the changes in sugar meta-
bolism, caused by long-term cold storage, played an important role in
occurrence of PB in pear fruit.
5. Conclusions
In conclusion, phenylpropanoid and soluble sugar metabolisms had
an influence on the development of PB in ‘Nanguo’ pears during shelf
life after long-term cold storage. The severity of PB in fruit was ac-
companied by decreased contents of phenolic compounds and sucrose,
as well as decreased activities and gene expression levels of PAL, 4CL,
C4H, CHI, SS-synthesis and SPS, with the extension of cold storage.
Moreover, dramatically increased contents of glucose and fructose, as
well as increased activities and gene expression levels of AI and NI were
found in fruit after long-term cold storage. Therefore, maintaining a
higher level of phenolic compounds and sucrose plays an important role
in alleviating PB and sustaining fruit quality during cold storage.
Acknowledgements
This work was supported by the National Natural Science
Foundation of China (No. 31570687), and the Basic Research Program
of Education Department of Liaoning (LFW 201707).
References
Assis, J.S., Maldonado, R., Munoz, T., Escribano, M.I., Merodio, C., 2001. Effect of high
carbon dioxide concentration on PAL activity and phenolic contents in ripening
cherimoya fruit. Postharvest Biol. Technol. 23, 33–39.
Ballester, A.R., Lafuente, M.T., Forment, J., Gadea, J., De Vos, C.H.R., Bovy, A.G.,
González-Candelas, L., 2011. Transcriptomic profiling of citrus fruit peel tissues re-
veals fundamental effects of phenylpropanoids and ethylene on induced resistance.
Mol. Plant Pathol. 12, 879–897.
Bradford, M.M., 1976. A rapid method for the quantitation of microgram quantities of
protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254.
Cao, S.F., Yang, Z.F., Zheng, Y.H., 2013. Sugar metabolism in relation to chilling toler-
ance of loquat fruit. Food Chem. 136, 139–143.
Cao, Y.Y., Yang, M.T., Li, X., Zhou, Z.Q., Wang, X.J., Bai, J.G., 2014. Exogenous sucrose
J. Wang, et al.
increases chilling tolerance in cucumber seedlings by modulating antioxidant enzyme
activity and regulating proline and soluble sugar contents. Sci. Hortic. 179, 67–77.
Cheng, Y.D., Liu, L.Q., Zhao, G.Q., Shen, C.G., Yan, H.B., Guan, J.F., Yang, K., 2015. The
effects of modified atmosphere packaging on core browning and the expression
patterns of PPO and PAL genes in ‘Yali’ pears during cold storage. LWT - Food Sci.
Technol. 60, 1243–1248.
Christie, R.J., Alfenito, M.R., Walbot, V., 1994. Impact of low temperature stress on
general phenylpropanoid and anthocyanin pathways, enhancement of transcript
abundance and anthocyanin pigmentation in maize seedlings. Planta 194, 541–549.
Dixon, R.A., Paiva, N.L., 1995. Stress-induced phenylpropanoid metabolism. Plant Cell 7,
1085–1097.
Gao, H., Zhang, Z.K., Lv, X.G., Cheng, N., Peng, B.Z., Cao, W., 2016. Effect of 24-epi-
brassinolide on chilling injury of peach fruit in relation to phenolic and proline
metabolisms. Postharvest Biol. Technol. 111, 390–397.
Ge, Y.H., Duan, B., Li, C.Y., Tang, Q., Li, X., Wei, M.L., Chen, Y.R., Li, J.R., 2018. γ-
Aminobutyric acid delays senescence of blueberry fruit by regulation of reactive
oxygen species metabolism and phenylpropanoid pathway. Sci. Hortic. 240,
303–309.
Guo, J., Jermyn, W.A., Turnbull, M.H., 2002. Carbon assimilation, partitioning and export
in mature cladophylls of two asparagus (Asparagus officinalis) cultivars with con-
trasting yield. Physiol. Plant. 115, 362–369.
Han, S., Cai, H.F., An, X.J., Huan, C., Wu, X.Q., Jiang, L., Yu, M.L., Ma, R.J., Yu, Z.F.,
2018. Effect of nitric oxide on sugar metabolism in peach fruit (cv. Xiahui 6) during
cold storage. Postharvest Biol. Technol. 142, 72–80.
Hinneburg, I., Dorman, H.J.D., Hiltunen, R., 2006. Antioxidant activities of extracts from
selected culinary herbs and spices. Food Chem. 97, 122–129.
Itai, A., Tanahashi, T., 2008. Inhibition of sucrose loss during cold storage in Japanese
pear (Pyrus pyrifolia Nakai) by 1-MCP. Postharvest Biol. Technol. 48, 355–363.
Janas, K.M., Cvikrova, M., Palagiewicz, A., Eder, J., 2000. Alterations in phenylpropanoid
content in soybean roots during low temperature acclimation. Plant Physiol.
Biochem. 38, 587–593.
Jannatizadeh, A., 2019. Exogenous melatonin applying confers chilling tolerance in po-
megranate fruit during cold storage. Sci. Hortic. 246, 544–549.
Ju, Z.G., Yuan, Y.B., Liu, C.L., 1997. Dihydro flavonol reductase activity and anthocyanin
accumulation in ‘Delicious’, ‘Golden Delicious’ and ‘Indo’ apples. Sci. Hortic. 70,
31–34.
Li, D.D., Luo, Z.S., Mou, W.S., Wang, Y.S., Ying, T.J., Mao, L.C., 2014. ABA and UV-C
effects on quality, antioxidant capacity and anthocyanin contents of strawberry fruit
(Fragaria ananassa Duch.). Postharvest Biol. Technol. 90, 56–62.
Liu, J., Li, F.J., Li, T.T., Yun, Z., Duan, X.W., Jiang, Y.M., 2019. Fibroin treatment inhibits
chilling injury of banana fruit via energy regulation. Sci. Hortic. 248, 8–13.
Liu, Y.Y., Ge, Y.H., Bi, Y., Li, C.Y., Deng, H.W., Dong, B.Y., 2014. Effect of postharvest
acibenzolar-S-methyl dipping on phenylpropanoid pathway metabolism in musk-
melon (Cucumis melo L.) fruits. Sci. Hortic. 168, 113–119.
Palma, F., Carvajal, F., Lluch, C., Jamilena, M., Garrido, D., 2014. Changes in carbohy-
drate content in zucchini fruit (Cucurbita pepo L.) under low temperature stress. Plant
Sci. 217-218, 78–86.
Sanchez-Ballesta, M.T., Lafuente, M.T., Zacarias, L., Granell, A., 2000. Involvement of
phenylalanine ammonia-lyase in the response of fortune mandarin fruits to cold
temperature. Physiol. Plantarum 108, 382–389.
Sasaki, H., Ichimura, K., Imada, S., Yamaki, S., 2001. Sucrose synthase and sucrose
phosphate synthase, but not acid invertase, are regulated by cold acclimation and
deacclimation in cabbage seedlings. J. Plant Physiol. 158, 847–852.
Shao, X.F., Zhu, Y., Cao, S.F., Wang, H.F., Song, Y.X., 2013. Soluble sugar content and
metabolism as related to the heat-induced chilling tolerance of loquat fruit during
cold storage. Food Bioprocess Technol. 6, 3490–3498.
Sheng, L., Zhou, X., Liu, Z.Y., Wang, J.W., Zhou, Q., Wang, L., Zhang, Q., Ji, S.J., 2016.
Changed activities of enzymes crucial to membrane lipid metabolism accompany
10
Scientia Horticulturae 260 (2020) 108888
pericarp browning in ‘Nanguo’ pears during refrigeration and subsequent shelf life at
room temperature. Postharvest Biol. Technol. 117, 1–8.
Solomakhin, A.A., Blanke, M.M., 2010. Mechanical flower thinning improves the fruit
quality of apples. J. Sci. Food Agric. 35, 543–584.
Sturm, A., Tang, G., 1999. The sucrose-cleaving enzymes of plants are crucial for devel-
opment, growth and carbon partitioning. Trends Plant Sci. 4, 401–407.
Sun, Z., Li, Y., Zhou, J., Zhu, S.H., 2011. Effects of exogenous nitric oxide on contents of
soluble sugars and related enzyme activities in ‘Feicheng’ peach fruit. J. Sci. Food
Agric. 91, 1795–1800.
Suo, J.T., Li, H., Ban, Q.Y., Han, Y., Meng, K., Jin, M.J., Zhang, Z.K., Rao, J.P., 2018.
Characteristics of chilling injury-induced lignification in kiwifruit with different
sensitivities to low temperatures. Postharvest Biol. Technol. 135, 8–18.
Toor, R.K., Savage, G.P., 2005. Antioxidant activity in different fractions of tomatoes.
Food Res. Int. 38, 487–494.
Vogt, T., 2010. Phenylpropanoid biosynthesis. Mol. Plant 3 (1), 2–20.
Wang, J.W., Lv, M., Li, G.D., Jiang, Y.G., Fu, W.W., Zhang, L., Ji, S.J., 2018. Effect of
intermittent warming on alleviation of peel browning of ‘Nanguo’ pears by regulation
energy and lipid metabolisms after cold storage. Postharvest Biol. Technol. 142,
99–106.
Wang, J.W., Zhou, X., Zhou, Q., Cheng, S.C., Wei, B.D., Ji, S.J., 2017a. Low temperature
conditioning alleviates peel browning by modulating energy and lipid metabolisms of
‘Nanguo’ pears during shelf life after cold storage. Postharvest Biol. Technol. 131,
10–15.
Wang, J.W., Zhou, X., Zhou, Q., Liu, Z.Y., Sheng, L., Cheng, S.C., Ji, S.J., 2017b.
Proteomic analysis of peel browning of ‘Nanguo’ pears after low-temperature storage.
J. Sci. Food Agric. 97, 2460–2467.
Wang, K., Shao, X.F., Gong, Y.F., Zhu, Y., Wang, H.F., Zhang, X.L., Yu, D.D., Yu, F., Qiu,
Z.Y., Lu, H., 2013. The metabolism of soluble carbohydrates related to chilling injury
in peach fruit exposed to cold stress. Postharvest Biol. Technol. 86, 53–61.
Wang, L., Shan, T.M., Xie, B., Ling, C., Shao, S., Jin, P., Zheng, Y.H., 2019. Glycine betaine
reduces chilling injury in peach fruit by enhancing phenolic and sugar metabolisms.
Food Chem. 272, 530–538.
Wang, Z., Cao, J.K., Jiang, W.B., 2016. Changes in sugar metabolism caused by exogenous
oxalic acid related to chilling tolerance of apricot fruit. Postharvest Biol. Technol.
114, 10–16.
Xu, X.X., Hu, Q., Yang, W.N., Jin, Y., 2017. The roles of cell wall invertase inhibitor in
regulating chilling tolerance in tomato. BMC Plant Biol. 17, 195.
Yu, L.N., Liu, H.X., Shao, X.F., Yu, F., Wei, Y.Z., Ni, Z.M., Xu, F., Wang, H.F., 2016. Effects
of hot air and methyl jasmonate treatment on the metabolism of soluble sugars in
peach fruit during cold storage. Postharvest Biol. Technol. 113, 8–16.
Yu, L.N., Shao, X.F., Wei, Y.Y., Xu, F., Wang, H.F., 2017. Sucrose degradation is regulated
by 1-methycyclopropene treatment and is related to chilling tolerance in two peach
cultivars. Postharvest Biol. Technol. 124, 25–34.
Zhai, R., Liu, J.L., Liu, F.X., Zhao, Y.X., Liu, L.L., Fang, C., Wang, H.B., Li, X.Y., Wang,
Z.G., Ma, F.W., Xu, L.F., 2018. Melatonin limited ethylene production, softening and
reduced physiology disorder in pear (Pyrus communis L.) fruit during senescence.
Postharvest Biol. Technol. 139, 38–46.
Zhou, X., Dong, L., Zhou, Q., Wang, J.W., Chang, N., Liu, Z.Y., Ji, S.J., 2015. Effects of
intermittent warming on aroma-related esters of 1-methylcyclopropene-treated
‘Nanguo’ pears during ripening at room temperature. Sci. Hortic. 185, 82–89.
Zhou, Y.H., Ma, J.H., Xie, J., Deng, L.L., Yao, S.X., Zeng, K.F., 2018. Transcriptomic and
biochemical analysis of highlighted induction of phenylpropanoid pathway meta-
bolism of citrus fruit in response to salicylic acid, Pichia membranaefaciens and oli-
gochitosan. Postharvest Biol. Technol. 142, 81–92.
Zhu, L.Q., Zhou, J., Zhu, S.H., Guo, L.H., 2009. Inhibition of browning on the surface of
peach slices by short-term exposure to nitric oxide and ascorbic acid. Food Chem.
114, 174–179.