Research article

Study of virulence genes in vancomycin

resistant Enterococci (vre) from animals and
human clinical isolates
By: Mofoluwaso Adedeji Oyinloye, Bondira Olamide Ndagana, Adeola Egbebi, and Pius Abimbola Okiki

Journal Name: International Journal of biosciences

Publisher: international network for natural sciences

 Home  Login  Register SUBMIT YOUR PAPER ON VOLU

INNSPUB JOURNALS FOR AUTHORS ARCHIVES EXCELLENCE TUTORIALS

Study of virulence genes in vancomycin resistant Enterococci (vre) from animals and human clinical Bangla Journal
isolates
Bangla Journal
By: Mofoluwaso Adedeji Oyinloye, Bondira Olamide Ndagana, Adeola Egbebi, Pius Abimbola Okiki

Key Words: Enterococci, Vancomycin, Antibiotics, Resistance, Virulence.

CALL FOR PAPERS
Int. J. Biosci. 18(1), 1-14, January 2021.

DOI: http://dx.doi.org/10.12692/ijb/18.1.1-14
Publish Your Article
Certification: ijb 2021 0146 [Generate Certificate]

Menu Abstract
With Enterococcus species in the leading cause of nosocomial infections and resistance to an array of
Publications Category antibiotics, this study focused to determine the frequency and distribution of vancomycin-resistant Enterococci,
the presence of virulence genes and to determine the relative nucleotide sequence relatedness among isolates 0
Book Publication
using 16S rRNA sequence. A random sampling of 120 fecal samples of cattle, poultry, and piggery, and human
Call for Reviewers clinical isolates was analyzed. Standard bacteriological methods were employed in the isolation and
INNSPUB on FB
characterization of isolates and the disk diffusion method was used in determining their antibiotic resistance
ANNOUNCEMENT profiles. Results showed Enterococcus species in cattle at 100%, followed by clinical isolates at 80%.
Vancomycin resistance was observed at high rates in Enterococcus species from human clinical isolates and
cattle isolates at 90% and 80% respectively. Multiple antibiotic-resistant isolates yielded twelve resistance Email Update
profiles and 16S rDNA sequences identified E. faecalis, E. durans, E. mundtii, and Enterococcus sp. Isolates
from cattle samples were the most probable source of clinical isolates at 78% homology of conserved regions
with the clinical isolates. Virulence determinant genes Asa1 was recorded at66.6%, Cyl at 16.6% and GelE at
8.3% among the isolates. This study established farm animals as possible reservoirs of VRE isolates to man. Submit
Hence, healthy and professional practices among animal farmers with antibiotic usage, as well as hygienic and
preventive measures among hospital workers are here recommended.

Off print Download the full paper

 Reference

 Citation Sample

Mofoluwaso Adedeji Oyinloye, Bondira Olamide Ndagana, Adeola Egbebi, Pius Abimbola Okiki.
Study of virulence genes in vancomycin resistant Enterococci (vre) from animals and human clinical
isolates.
Int. J. Biosci. 18(1), 1-14, January 2021.
https://innspub.net/ijb/study-virulence-genes-vancomycin-resistant-enterococci-vre-animals-human-
clinical-isolates/

 Copyright

Copyright © 2021
By Authors and International Network for
Natural Sciences (INNSPUB)
https://innspub.net

 Twitter  Facebook  LinkedIn  Pinterest

International Network for Natural Sciences

Home Terms & Conditions Privacy & Policy
Copyright © 2009-2021. All Rights Reserved.
 Int. J. Biosci. 2021

International Journal of Biosciences | IJB |

ISSN: 2220-6655 (Print), 2222-5234 (Online)
http://www.innspub.net
Vol. 18, No. 1, p. 1-14, 2021

RESEARCH PAPER OPEN ACCESS

Study of virulence genes in vancomycin resistant Enterococci

(vre) from animals and human clinical isolates

Mofoluwaso Adedeji Oyinloye*, Bondira Olamide Ndagana, Adeola Egbebi, Pius

Abimbola Okiki

Department of Biological Sciences, AfeBabalola University, Ado-Ekiti, Nigeria

Key words: Enterococci, Vancomycin, Antibiotics, Resistance, Virulence.

http://dx.doi.org/10.12692/ijb/18.1.1-14 Article published on January 20, 2021

Abstract
With Enterococcus species in the leading cause of nosocomial infections and resistance to an array of antibiotics,
this study focused to determine the frequency and distribution of vancomycin-resistant Enterococci, the
presence of virulence genes and to determine the relative nucleotide sequence relatedness among isolates using
16S rRNA sequence. A random sampling of 120 fecal samples of cattle, poultry, and piggery, and human clinical
isolates was analyzed. Standard bacteriological methods were employed in the isolation and characterization of
isolates and the disk diffusion method was used in determining their antibiotic resistance profiles. Results
showed Enterococcus species in cattle at 100%, followed by clinical isolates at 80%. Vancomycin resistance was
observed at high rates in Enterococcus species from human clinical isolates and cattle isolates at 90% and 80%
respectively. Multiple antibiotic-resistant isolates yielded twelve resistance profiles and 16S rDNA sequences
identified E. faecalis, E. durans, E. mundtii, and Enterococcus sp. Isolates from cattle samples were the most
probable source of clinical isolates at 78% homology of conserved regions with the clinical isolates. Virulence
determinant genes Asa1 was recorded at66.6%, Cyl at 16.6% and GelE at 8.3% among the isolates. This study
established farm animals as possible reservoirs of VRE isolates to man. Hence, healthy and professional
practices among animal farmers with antibiotic usage, as well as hygienic and preventive measures among
hospital workers are here recommended.
* Corresponding Author: Mofoluwaso Adedeji Oyinloye  oyinloyema@abuad.edu.ng

1 Oyinloye et al.
 Int. J. Biosci.
Introduction
Enterococcus species are a diverse group of Gram-
positive, facultatively anaerobic bacteria able to adapt
to harsh temperature, pH, hyper-osmolarity and
prolonged desiccation conditions (Moraes et al. 2012;
Ali et al., 2014; Lebreton et al., 2014). they were
initially classified as Group D Streptococci due to the
presence of group D cell wall antigen (Teixeira and
Merquior, 2013) but with further Molecular DNA
studies, Enterococcus was classified in its genus
(Byappanahalli et al., 2012). It is a common isolate in
the intestines of most invertebrates, supporting
intestinal, microbial homeostasis, stimulating
immune modulation to prevent infections with
pathogenic bacteria and viruses (Kondoh et al., 2012).
In decades past, Enterococcus pathogens have been
reported as a major cause of nosocomial infections in
various tissues, the urinary tract, respiratory tract,
peritoneum, and bloodstream (Bonten and Willems,
2012). Enterococcus faecalis and Enterococcus
faecium, the most prevalent species cultured from
humans, account for more than 90% of clinical
enterococcal isolates (Fisher and Phillips, 2009).
Their infections are difficult to treat because of their
intrinsic and acquired resistance to many antibiotics
such as ampicillin and vancomycin (Van Harten et al.,
2017).
Vancomycin-Resistant Enterococci (VRE) especially
has emerged as a major cause of outbreaks of
nosocomial infections, which with their extensive
resistance to a plethora of other antibiotics have
attracted more and more attention in recent years
(Flokas et al., 2017). Factors such as their propensity
and inherent ability to acquire resistance to
antimicrobials, putative virulence traits, biofilm-
forming, and horizontal transfer of antimicrobial
resistance and virulence determinants to other
bacteria are reasons their infections are could be life-
threatening (Werner, 2012). Most VRE is known to
belong to the species E. faecium, a major agent in
hospital-acquired infections (Flokas et al., 2017).
Enterococci comprise a widespread bacterial group of
diverse species and are present in a variety of surfaces
2 Oyinloye et al.
2021
and fecal origins, which are important opportunistic
pathogens causing life-threatening infections in
hospitals (Liliana et al., 2014). The emergence of
multidrug-resistance isolates, particularly to
vancomycin, erythromycin and streptomycin have
become a major cause of concern for the infectious
diseases community (Liliana et al., 2014).
This study aimed at detecting vancomycin resistance
and virulence traits in Enterococci of human and
animal origin with the view of identifying the possible
source(s) of clinical infections in man.
Materials and methods
Sample collection and analysis
One hundred and twenty fecal samples (120) were
collected from four different sources between
September and December 2018.
The collected samples were made up of Cattle (30),
Poultry (30), Piggery (30) and Human clinical isolates
(30). Human clinical isolates were obtained from the
Microbiology laboratory Ekiti State Teaching
Hospital, (EKSUTH) Ado-Ekiti. Animal samples were
collected from AfeBabalola University Farm, Ado-
Ekiti and Abattoir, Iworoko road Ado-Ekiti, Ekiti
State, Nigeria. Samples were collected by obtaining
fresh feces from large intestines of selected animals
after slaughtering (Diego et al., 2016). Samples were
also analyzed based on color, consistency, presence of
blood, mucus, or pus.
Isolation of enterococci
Samples were processed within two hours of
collection, by serial dilution and inoculated on sterile
plates of BileEsculin agar (Oxoid CM0888),
incubated aerobically at 37oCfor 24hours.
The plates were observed for luxuriant colonies with
characteristic dark coloration in agar (a characteristic
of enterococci during esculin hydrolysis) (Meyer and
Schonfeld, 1926). These colonies were subcultured on
nutrient agar for purity before further biochemical
characterization (Chuard and Reller, 1998). Isolates
were stored on nutrient agar slants as stock.
 Int. J. Biosci.
Antibiotic susceptibility testing
A sterile wire loop was used to pick one well-isolated
colony of the bacterial isolate and inoculated in
peptone broth for 18hours at 37oC. The overnight
culture was adjusted to 0.5 McFarland turbidity
standards (Cattoiret al., 2013). Antimicrobial
susceptibility test was carried out on Mueller Hinton
agar using disk diffusion according to the Clinical and
Laboratory Standards Institute (CLSI 2016)
guidelines. The following antibiotics were used
vancomycin (30µg), ceftazidime (30µg), gentamicin
(10µg), cefuroxime (30µg), ceftriaxone (30µg),
erythromycin (5µg), cloxacillin (5µg), ofloxacin (5µg)
and augmentin (30µg) (AbtekBiologicals Ltd, UK).
The standard inoculum was streaked evenly to the
surface of a 150mm diameter Mueller-Hinton agar
plate using a sterile swab stick. After 3minutes, sterile
forceps were used to place the commercially-
prepared, fixed concentration, multi antibiotic disc as
well as the single vancomycin disc on the inoculated
agar surface. Plates were incubated for 24–48 hours
at 37°C before the determination of results. The zones
of growth inhibition around each of the antibiotic
disks were measured to the nearest millimeter using a
meter rule. The zone diameters of each drug were
interpreted using the criteria published by the CLSI
(2016) Results was recorded as Resistant (R) or
sensitive (S) (Cattoiret al., 2013).
Molecular analyses
A total of 12 isolates made up of 3 each from human
clinical isolates, poultry, cattle and Piggery were
selected based on their antibiotic resistance
phenotypes for 3 virulence determinant genes;
gelatinase (gelA), aggregation substance (asa1),
cytolysin (cylA), as well as confirmation of the
bacterial identity using 16S rDNA sequence by
Polymerase Chain Reaction (Olawaleet al., 2015).
This was done by coupling PCR to the DNA
sequencing analysis of 16S rDNA genes (Wang et al.,
1992; Manzanoet al., 2000). DNA was extracted using
the ZymoBIOMICS™ DNA MiniprepKit (CA, USA)
and the procedure was carried out according to
manufacturers’ guidelines. DNA concentration was
quantified using a NanoDrop 1000
3 Oyinloye et al.
2021
Spectrophotometer (NanoDrop Technologies,
Wilmington, DE, United States). The A260/A280
absorbance ratio was used to determine undesired
contaminations. To evaluate the quality and
intactness of the extracted DNA, gel electrophoresis
was used. The extracted DNA (5μl) was loaded on
1.5% agarose gel (Invitrogen, California, United
States), which contained ethidium bromide (1μg/ml)
for DNA staining. For image acquisitions, a G:Box™
gel documentation system (Syngene, Cambridge,
United Kingdom) was used (Olawaleet al., 2015).
PCR cycling parameters
Polymerase Chain Reaction (PCR) was performed
using 27F (5’- AGAGTTTGATCMTGGCTCAG – 3’)
and 1525R (5’- AAGGAGGTGWTCCARCCGCA -3’)
universal primers and PCR protocols were performed
as described by Bubertet al. (1992).PCR for the
amplification of the 16S rDNA procedure was at 94oC
for 5mins for initial denaturation, followed by 36
cycles of denaturation at 94oC for 30seconds,
annealing at 56oC for 30seconds and elongation at
72oC for 45seconds followed by a final elongation step
at 72oC for 7 minutes and hold temperature at 10oC.
Amplified fragments were visualized on SafeView-
stained 1.5% agarose electrophoresis gels using Hyper
ladder 1 DNA marker. The amplicons were subjected
to sequencing reactions using BigDye Terminator v3.1
Cycle Sequencing Kit. The products were loaded unto
3130xl Genetic Analyzer (Applied Biosystems) to
generate the molecular sequences (Naser et al.,
2005). PCR for the virulence genes was at annealing
temperatures of 50oC for gelE and 55oC for cylA and
asa1 (Naser et al., 2005). The PCR thermal cycler
used was the GeneAmp PCR system 9700 (Applied
BiosystemsTM). Sequences were edited using the
Bioedit6 software and identified using the basic local
alignment search tool (BLAST) at >95% identity on
NCBI database (www.blast.ncbi.nlm.nih.gov).
Three designated virulence specific primer pairs
(forward and reverse) (Olawaleet al., 2015) were used
on the genomic DNA of twelve isolates to determine
the presence of virulence genes. Primer sequences are
detailed in Table 1.
 Int. J. Biosci. 2021

Data analysis
Data presented in this study were subjected to
statistical analyses using MEGA 7 software;
Alignment of sequences (Pairwise and Multiple) was
done with gap opening and extension penalty at 15
and 6.66 respectively; percentage relationships of
samples from different isolates in relations to the
conserved and variable regions of DNA sequences;
and the use of Neighbor-joining statistical method at
1000 bootstrap replications for the phylogenetic
analysis.
Results and discussion
Results of Bacterial Analyses
A total of one hundred and twenty fecal (120) samples
from four different sources were collected for this
study made up of the poultry (30), cattle (30), piggery
(30) and human clinical isolates (30). The result of
bacteria isolation and characterization showed
94(78.3%) growth of Enterococcus species. Table 2
shows the distribution of Enterococcus isolated from
different sources in the course of this study. The
positive samples showed Cattle 30(100%) with
highest percentage growth, poultry 24(80%), piggery
20(67%) and from human clinical isolates collected,
20(67%) was confirmed Enterococcus spp. Figure 6
indicates positive esculin hydrolysis from
Enterococcus species with a visible change of color of
the media to dark brown due to the reaction of
esculetin and ferric ions and pure cultures of the test
organism on nutrient agar after 24 hours of
incubation at 37oC.

Table 1. Primers selected for detection of virulence determinants among twelve Enterococcistrains.
Target Gene Sequence (5’- 3’) Position (bp) Product Size (bp)
GelE ACCCCGTATCATTGGTTT F 762 405
ACGCATTGCTTTTCCATC R 1163
CylA GACTCGGGGATTGATAGGC F 6656 688
GCTGCTAAAGCTGCGCTTAC R 7344
AsaI CCAGCCAACTATGGCGGAATC F 3122 529
CCTGTCGCAAGATCGACTGTA R 3651

Antibiotic Test Results
The percentage antibiotic resistance of cattle isolates
presented in Fig. 1 shows multiple resistance patterns
with high resistance in the following antibiotics:
Erythromycin (93.3%), cloxacillin (93.3%),
vancomycin (80%) and augmentin (60%). Ofloxacin
was observed as the most suitable antibiotic in-vitro
for cattle isolates with a high potencyat 100%.
Multiple resistance patterns recorded are ERY- CXC-
VAN (23%), ERY- CXC- AUG- VAN (50%) and ERY-
CXC- AUG(27%). Fig. 2 shows the multiple resistance
frequency in piggery isolates; the most potent
antibiotic was ofloxacin at (100%) and the lowest was
ceftazidime at (10%). Two resistance patterns were
recorded: CAZ- CRX- CTR- CXC (10%) and CAZ
(15%).

Table 2. Distribution of Enterococcus isolated.

Sample source No. of isolates %
n=30
Cattle 30 100
Piggery 20 67
Clinical isolates 20 67
Poultry 24 80
Total 94

Fig. 3 shows the percentage resistance for poultry isolates was Ofloxacin (63%) and the weakest was
isolates to cloxacillin (79%) followed by erythromycin erythromycin at (17%). Three resistant patterns were
(67%), ceftazidine (63.5%) and vancomycin (41%). recorded from this sample source to include: ERY-
However, the most potent antibiotic to poultry CXC- AUG- VAN (21%), CAZ- CRX- ERY- CXC- AUG

4 Oyinloye et al.
 Int. J. Biosci. 2021

(8%) and CAZ- CRX- ERY- CXC- AUG –VAN (13%).
In Fig. 4, human clinical isolates were resistant to
vancomycin at (90%) having the highest frequency
followed by ceftazidine (80%), cefuroxime (80%),
cloxacillin (80%), erythromycin (75%), augmentin
(80%), ofloxacin (30%), gentamycin (25%) and
ceftriaxone (0%). Ceftriaxone was recorded as the
most effective amongst all the antibiotics used at
(75%). Four resistance patterns were recorded in
human clinical isolates which include: CAZ- CRX-
ERY- CXC-AUG- VAN(15%), CAZ- CRX- ERY- CXC-
OFL- VAN (10%), CAZ- CRX- GEN- ERY- CXC-
AUG- VAN (10%) and CAZ (15%).

Table 3. Antibiotic resistance profile of bacterial isolates.

Sample source Resistance profile %
Cattle ERY-CXC-VAN 23
ERY-CXC-AUG-VAN 50
ERY-CXC-AUG 27
Piggery CAZ- CRX- CTR- CXC 10
CAZ 15
Poultry ERY-CXC-AUG- VAN 2
CAZ- CRX- ERY-CXC-AUG 8
CAZ- CRX- ERY-CXC-AUG –VAN 13
CAZ- CRX- ERY- CXC-AUG- VAN 15
Clinical isolates CAZ- CRX- ERY- CXC- OFL- VAN 10
CAZ- CRX- GEN- ERY- CXC- AUG- VAN 10
CAZ 15
KEY: CAZ- Ceftazidime CRX-Cefuroxime GEN-Gentamycin CTR- Ceftriaxone ERY-Erythromycin CXC-
Cloxacillin OFL- Ofloxacin AUG-Augmentin VAN- Vancomycin.

Results of Molecular Analyses
Table 3 presents the antibiotic resistance patterns of
the isolates from different sample sources while DNA
bands of representative isolates visualized on safe
view-stained 1.5% agarose electrophoresis gel are
presented in Fig. 7. Figure 8 presents the bands of the
16S rDNA gene of 12 isolates with an amplicon size of
about 1500bp using the hyper ladder 1 DNA ladder.
Table 4 shows the BLAST hits of representative
isolates after sequences were edited.

Table 4. BLAST hits of representative isolates.

Sample Isolate name Accession no. Identity %
C1 Enterococcus duransstrain CAU9886 MF098119.1 96.90
C2 Enterococcus duransstrain CAU9886 MF098119.1 97.17
C3 Enterococcus duransstrain CAU9886 MF098119.1 97.55
H1 Enterococcus sp. strain CAU6869 MF428647.1 92.33
H2 Enterococcus duransstrain CAU9886 MF098119.1 99.44
H3 Enterococcus duransstrain CAU9886 MF098119.1 99.53
S1 Enterococcus mundtii HQ419189.1 96.75
S2 Enterococcus faecalisstrain CAU6617 MF108410.1 97.03
S3 Enterococcus duransstrain CAU9886 MF098119.1 98.91
P1 Enterococcus duransstrain CAU6590 MF108374.1 99.27
P2 Enterococcus duransstrain CAU9886 MF098119.1 98.28
P3 Enterococcus sp. strain LABC MH734729.1 87.44
KEY: C1-C3: Cattle; S1-S3: Piggery; H1-H3: clinical; and P1-P3: Poultry isolates.

Figures 9, 10 and 11 show the results of the PCR isolates at (66.6%), Cytolysin (Cyl1) in 2 isolates at
detection of virulence genes in Enterococcus spp: (16.6%) and Gelatinase (GelE) in 1 isolate at (8.3%).
Aggregation substance (Asa1), which was present in 8 This is further detailed in Table 5.

5 Oyinloye et al.
 Int. J. Biosci. 2021

Table 5. Distribution of Virulence genes in selected isolates.

Isolates Sample source Asa1 gene CylAgene GelEgene
C1 Cattle + - -
C2 Cattle + - -
C3 Cattle + - -
H1 Clinical + + -
H2 Clinical - - -
H3 Clinical + - -
S1 Piggery - - -
S2 Piggery + - -
S3 Piggery - + -
P1 Poultry - - +
P2 Poultry + - -
P3 Poultry + - -

From the evolutionary analysis using MEGA7 most probable source of infection in humans with
software, it was inferred that cattle samples were the 78% conserved region of 16S rDNA gene (Figure 5).

Fig. 1. Percentage antibiotic susceptibility of Enterococcus spp. from cattle samples to antibiotics.

Results discussion infections in humans and animals, having the

Enterococcus species have developed from being gastrointestinal tract of mammals as their normal
commensal bacteria to leading pathogens that cause habitat (Knijff et al., 2001).

Fig. 2. Percentage antibiotic susceptibility of Enterococcus spp. from piggery isolates to antibiotics.

6 Oyinloye et al.
 Int. J. Biosci. 2021

A high incidence of Enterococcus species was
observed (78%) in this study as it is on other studies
from around the world; South Africa (Iweriebor, et
al., 2015), Tunisia (Said et al., 2017), China (Liu et al.,
2012), Nigeria (Anyanwu and Obetta 2015), Korea
(Bang et al., 2017), Turkey (Gökmenet al., 2017) and
Australia (Barlow et al., 2017), where Enterococcus
species are commensal organisms that inhabit the
gastrointestinal tract of animals.

Fig. 3. Percentage antibiotic susceptibility of Enterococcus spp. from poultry isolates to antibiotics.

The most common species identified in this study was
E. duransat 67% across all samples analyzed. While
the clinical characteristics and treatment outcomes of
species such as E. faecalis and E. faecium bacteremia
are well known, those of E. durans bacteremia are
still largely unclear. However, reports have been
made of E. durans to have proven to lead to
hematologic malignancy, and longer duration of
hospital stay in bacteremia cases more than the
known clinical isolates (DePerio et al., 2006).

Fig. 4. Percentage antibiotic susceptibility of Enterococcus spp. from clinical isolates to antibiotics.

It was also reported to cause biliary and urinary tract reports of E. durans infection in humans causing
infection and tended to cause infective endocarditis mainly endocarditis and blood access (Stepanovicet
more than the clinical isolates. Most infections of E. al., 2004; Vijayakrishnan and Rapose, 2012;
durans were reported being community-acquired Kenzakaet al., 2013; Fallavollitaet al., 2016; Zala and
(Ryuet al., 2019). There have been several other Collins, 2016).

7 Oyinloye et al.
 Int. J. Biosci. 2021

Fig. 5. Conserved regions of aligned 16S rDNA sequences of isolates of clinical and cattle origin using MEGA7
software.

Several genes, including vanA, vanB, vanC, vanD,
and vanE, contribute to resistance to vancomycin in
enterococci, and most commonly, this resistance is
seen in E. faecium and E. faecalis, but also has been
recognized in E. raffinosus, E. avium, E. durans, and
several other enterococcal species (CDC, 2010).
Vancomycin resistance was recorded in isolates from
all samples except the piggery where a low level of
resistance was seen to all antibiotics. The plasticity of
the enterococcal genomes allows Enterococci to
respond rapidly and adapt to selective constraints by
acquiring genetic determinants that increase their
ability to colonize or infect the host (VanTyne and
Gilmore, 2014).

Fig. 6. (a) Esculin Hydrolysis by Enterococcusisolate showing dark coloration on bile esculin agar. (b)
Enterococcusspp subculture on Nutrient agar after 24 hours of incubation at 37oC.

Though most vancomycin-resistant Enterococci
(VRE) belong to the species E. faecium, a major agent
in hospital-acquired infections (Flokas et al., 2017),
this study reports vancomycin-resistant E. durans.
There have been different reports of vancomycin
resistance in E. durans, vanA and vanBas the means
of resistance (Hall et al., 1992; Torres et al., 1994;
Cercenado et al., 1995, Descheemaekeret al., 2000;
Jenney et al., 2000). However, a recent study reports
E. durans isolates susceptible to penicillin, ampicillin,
and vancomycin (Ryu et al., 2019). All three virulence
genes, aggregation substance (Asa1), Cytolysin (CylA)

8 Oyinloye et al.
 Int. J. Biosci. 2021

and Gelatinase (GelE) were present in the study family known to help escape the host immune system
isolates, indicating them as potential pathogens if an by destroying macrophages and neutrophils.
opportunity arises. The gelatinase is an extracellular Moreover, asa1 mediates the production of
metalloprotease known to hydrolyze collagen, gelatin, aggregation substances involved in adherence to
and small peptides (Comerlatoet al., 2013), while the eukaryotic cells; cell aggregation and conjugation
enterococcal cytolysin is a member of bacteriocin (Upadhyaya et al., 2009; Ferguson et al., 2016).

Fig. 7. DNA bands of representative isolates.

KEY: C1-C3: Cattle isolates; S1-S3: Piggery isolates; H1-H3: clinical isolates; P1-P3: Poultry isolates.

Fig. 8. 16S rRNAAmplicon of representative isolates of Enterococcus species.

KEY: C1-C3: Cattle isolates; S1-S3: Piggery isolates; H1-H3: clinical isolates; P1-P3: Poultry isolates.

Reports like Foka and Ateba (2019) have recorded the
presence of the three genes in E. durans either all in
one isolate or two more/less across the same species.
While Asa1 was present in isolates from all samples
analyzed, CylA was present in isolates of clinical and
piggery origin and GelE was present only in an isolate
of poultry origin. A study in Eastern Cape Province of
South Africa concluded that Enterococcus spp. from
pigs and poultry must be treated with the highest
caution because they may be reservoirs for virulence
and antibiotic resistance genes (Iwerieboret al.,
2015). Enterococcus mundtii is rarely reported in

9 Oyinloye et al.
 Int. J. Biosci. 2021

human infections and rarely known to harbor and others but the resistance gene of vanC has been
virulence genes, as the case of the isolate in this study reported (Foka and Ateba, 2019).

Fig. 9. PCR detection of Asa1 gene inEnterococcus spp.

KEY: C1-C3: Cattle isolates; S1-S3: Piggery isolates; H1-H3: clinical isolates; P1-P3: Poultry isolates.

It has been associated with raw milk, plants, the Acinetobacter, etc. (De Kwaadstenietet al., 2005;
intestinal tract of humans and dairy cattle (Collins et Ferreira et al., 2007; Settanniet al., 2008).
al., 1986; Giraffaet al., 1997; Giraffa, 2003; Especheet
al., 2009), it has low GC content ranging between 38 It was reported to be used for the prevention of
and 39% and lacks catalase and cytochrome-C mastitis in cows (Especheet al., 2009). However, a
oxidase enzymes, but can contribute in carbohydrates case report of endophthalmitis in a 66-year-old
fermentation to produce lactic acid. It produces individual and reports of the presence of some
enterocins such as Bacteriocin ST15, that are quite virulent genes (such as asa1, esp, ace, hyl, and efaA)
active against bacteria such as Pseudomonas, calls for caution with the isolate (Higashideet al.,
Clostridium, Klebsiella, Lactobacillus, and 2005; Trivedi et al., 2011).

Fig. 10. PCR detection of CylA gene in Enterococcus spp.

KEY: C1-C3: Cattle isolates; S1-S3: Piggery isolates; H1-H3: clinical isolates; P1-P3: Poultry isolates.

10 Oyinloye et al.
 Int. J. Biosci.
This study also reported that the isolates had a high
incidence of the aggregation substance gene as
observed in other studies (Kataoka et al., 2014;
Ossiprandi and Zerbini, 2015). It is of importance to
note that Enterococcus strains can have silent
virulence genes as well and that environmental
signals play a vital role in gene expression, hence
influencing pathogenicity (Iseppiet al., 2015).
Regardless of the fact that the gelE gene was least
prevalent, it is not indicative of the production of
gelatinase. It has been suggested that other genes are
associated with the expression of gelatinase
Fig. 11. PCR detection of gelE gene in Enterococcus spp.
KEY: C1-C3: Cattle isolates; S1-S3: Piggery isolates; H1-H3: clinical isolates; P1-P3: Poultry isolates.
Conserved nucleotide sequence analysis of the
isolates in this study showed that isolates from cattle
were closest to human clinical isolates at 79%,
establishing the fact that animals act as reservoirs of
most bacteria species later found in humans.
According to Kataoka et al. (2014), animals are
generally not affected by enterococcal infections;
however, they act as a reservoir for pathogenic
strains.
Conclusion
The results of this study showed that VREs of
potential pathogenicity in humans are of animal
origin, hence the need to practice safe agricultural
11 Oyinloye et al.
2021
(Lindenstraubet al., 2011). According to Kim et al.
(2013), it is important to note that the presence of
virulent strains among Enterococcus isolates alone is
not predictive of infection as there may be other
mediators of pathogenicity that have yet to be
elucidated. It has been suggested that pathogenicity is
also related to the ability of virulent strains to grow in
high densities in the intestinal tract and spread to
other sites in the body. Host factors, such as
predisposing medical conditions, immune status, and
exposure to antibiotics, are also thought to play a role
in the ability of Enterococci to establish infection
(Mundy et al., 2000).
procedures and a good level of hygiene which involves
hand hygiene, contact/barrier precautions and source
control.
Acknowledgment
Authors will like to place on records the contributory
role of the staff of the Bioscience Department of
International Institute of Tropical Agriculture,
Ibadan, for their support in the molecular analyses.
References
Ali SA, Hasan KA, Bin Asif H, Abbasi A. 2014.
Environmental Enterococci: Prevalence of Virulence,
Antibiotic Resistance and Species Distribution in
 Int. J. Biosci. 2021

Poultry and its Related Environment in Karachi, De Kwaadsteniet M, Todorov SD, Knoetze H,
Pakistan. Letters in Applied Microbiology 58(5), Dicks LM. 2005. Characterization of a 3944 Da
423–432. bacteriocin, produced by Enterococcus mundtii ST15,
with activity against Gram-positive and Gram-
Barlow RS, McMillan KE, Duffy LL, Fegan N, negative bacteria.International Journal of Food
Jordan D, Mellor GE. 2017. Antimicrobial Microbiology 105, 433–444.
Resistance Status of Enterococcus from Australian http://dx.doi.org/10.1016/j.ijfoodmicro.2005.03.021
Cattle Populations at Slaughter. PLoS One 12(5), 1–
13. Descheemaeker P, Ieven M, Chappelle S,
Lammens C, Hauchecorne M, Wijdooghe M,
Bonten MJ, Willems RJ. 2012. Vancomycin- Vandamme P, Goossens H. 2000. Prevalence and
resistant Enterococcus chronicle of a foretold molecular epidemiology of glycopeptide-resistant
problem. Nederlands Tijdschriftvoor Geneeskunde enterococci in Belgian renal dialysis units.Journal of
156, 52-33. Infectious Diseases 181, 235–41.

Byappanahalli MN, Nevers MB, Korajkic A, Diego C, Andrigetto C, Lombardi A. 2016.

Staley ZR, Harwood VJ. 2012. Enterococci in the
Environment. Microbiology and Molecular Biology
Reviews 76(4), 685–706.
Cattoir V, Giard JC. 2014. Antibiotic Resistance in
Enterococcus faecium Clinical Isolates. Expert Review
of Anti-Infective Therapy 12, 239–248.
Cercenado E, Ûnal S, Eliopoulos CT, Rubin
LG, Isenberg HD, Moellering RC, Eliopoulos
GM. 1995. Characterization of vancomycin resistance
in Enterococcus durans. Journal of Antimicrobial
Chemotherapy 36, 821–5.
Clinical, Laboratory Standard Institute. 2016.
Performance Standards for Antimicrobial
Susceptibility Testing: Test Approved Standard. CLSI
document no M100-S26.
Occurrence of virulence factors and Antibiotic
Resistance in Enterococcus faecalis and Enterococcus
faecium Collected From Dairy and Human Samples
in North Italy. Food Control 19(9), 886-892.
Espeche MC, Otero MC, Sesma F, Nader-
Macias ME. 2009. Screening of surface properties
and antagonistic substances production by lactic acid
bacteria isolated from the mammary gland of healthy
and mastitic cows. Veterinary Microbiology 135,
346–357.
http://dx.doi.org/10.1016/j.vetmic.2008.09.078
Facklam RR, Carvalho MG, Teixeira LM. 2002.
Enterococcus. In M.S. Gilmore, Clewell D.B.,
Courvalin P., Dunny G.M., Murray B.E. and Rice L.B.
The Enterococci: Pathogenesis, Molecular Biology,
and Antibiotic Resistance. 1-54.

Collins MD, Farrow JA, Jones D. 1986. Fallavollita L, Di Gioacchino L, Balestrini F.

Enterococcus mundtii sp. nov.International Journal
of Systematic Evolutionary Microbiology 36, 8–12.
Comerlato CB, Resende MC, Caierao
d'Azevedo PA. 2013. Presence of virulence factors
in Enterococcus faecalis and Enterococcus faecium
susceptible and resistant to vancomycin. Memórias
do InstitutoOswaldo Cruz 108(5), 590–595.
2016. Bioprosthetic aortic valve endocarditis in
association with Enterococcus durans.Texas Heart
Institute Journal 43(2), 165–167.
J, https://doi.org/10.14503/thij-14-4980
Ferguson DM, Talavera GN, Hernández LA,
Weisberg SB, Ambrose RF, Jay JA. 2016.
Virulence genes among Enterococcus faecalis and
Enterococcus faecium isolated from coastal beaches

12 Oyinloye et al.
 Int. J. Biosci. 2021

and human and nonhuman sources in Southern Sugiyama K. 2005. Endophthalmitis Caused by
California and Puerto Rico. Journal of Pathogenesis Enterococcus mundtii. Journal of Clinical
2016, 3437214. Microbiology 43(3), 1475–1476.
http://dx.doi.org/10.1155/2016/3437214
Kenzaka T, Takamura N, Kumabe A, Takeda
Ferreira AE, Canal N, Morales D, Fuentefria K. 2013. A case of subacute infective endocarditis and
DB, Corção G. 2007. Characterization of enterocins blood access infection caused by Enterococcus
produced by Enterococcus mundtii isolated from durans. BMC Infectious Diseases 13, 594.
humans feces. Brazilian Archives of Biology and https://doi.org/10.1186/1471-2334-13-594
Technology 50, 249–258.
http://dx.doi.org/10.1590/S15168913200700020001 Kondoh M, Fukada K, Fujikura D, Shimada T,
0 Suzuki Y, Iwai A. 2012. Effect of Water-Soluble
Fraction from Lysozyme-Treated Enterococcus
Flokas ME, Karageorgos SA, Detsis M, faecalis FK-23 on Mortality Caused by Influenza A
Alevizakos M, Mylonakis E. 2017.Vancomycin- virus in Mice. Viral Immunology 25(1), 86–90.
Resistant Enterococci Colonisation, Risk Factors and
Risk for Infection Among Hospitalized Paediatric Lebreton F, Depardieu F, Bourdon N, Fines-
Patients: a Systematic Review and Metanalysis. Guyon M, Berger P, Camiade S. 2011. D- Ala-d-
International Journal of Antimicrobial Agents 49, SerVanN-type Transferable Vancomycin Resistance
565-572. in Enterococcus faecium. Antimicrobial Agents
Chemotherapy 55, 4606–4612.
Foka FET, Ateba CN. 2019. Detection of Virulence
Genes in Multidrug Resistant Enterococci Isolated Liliana L, Diana M, Bessa L, Angelo M,
from Feedlots Dairy and Beef Cattle: Implications for Augusto J, DeMatos J, Paulo Martins da
Human Health and Food Safety. BioMedical Research Costa. 2014. Spread of Multidrug-Resistant
International, Article ID 5921840, 13 pages. Enterococcus faecalis Within the Household Setting.
https://doi.org/10.1155/2019/5921840 Microbial drug resistance 20, 5-7.

Giraffa G. 2003. Functionality of enterococci in Meyer K, Schonfeld H. 1926. Über die

dairy products. International Journal of Food Unterscheidung des Enterococcus von Streptococcus
Microbiology 88, 215–222. viridans und die BeziehungbeiderzumStreptococcus
http://dx.doi.org/10.1016/S0168-1605(03)00183-1 lactis. Zentralbl. Bakteriol. Parasitenkol. Infektionskr.
Hyg. Abt. 1 Orig. 99, 402–416.
Giraffa G, Carminati D, Neviani E. 1997.
Enterococci isolated from dairy products: a review of Moraes PM, Perin LM, Todorov SD, Silva A,
risks and potential technological use. Journal of Food Franco BD, Nero LA. 2012. Bacteriocinogenic and
Protection 60, 732–738. Virulence Potential of Enterococcus Isolates Obtained
http://dx.doi.org/10.4315/0362-028X-60.6.732 from raw Milk and Cheese. Journal of Applied
Microbiology 113(2), 318–328.
Hall LM, Chen HY Williams RJ. 1992.
Vancomycin-resistant Enterococcus durans. Lancet Naser S, Thompson FL, Hoste B, Gevers D,
340, 1105. Vandemeulebroecke K, Cleenwerck I,
Thompson CC, Vancanneyt M, Swings J. 2005.
Higashide T, Takahashi M, Kobayashi A, Phylogeny and Identification of Enterococci by atpA
Ohkubo S, Sakurai M, Shirao Y, Tamura T, Gene Sequence Analysis. Journal of Clinical

13 Oyinloye et al.
 Int. J. Biosci. 2021

Microbiology 43(5), 2224–2230. Upadhyaya GPM, Ravikumar KL, Umapathy

BL. 2009. “Review of virulence factors of
Olawale AK, Onasanya A, Oyelakin OO, David Enterococcus: an emerging nosocomial pathogen,”
OM, Famurewa O. 2015. Enterococcus faecalis Indian Journal of Medical Microbiology 27(4), 301–
isolates of Food Origin and Detection of Their 305.
Virulence Determinant Genes in Osun State, Nigeria.
Microbiology Research International 2(2), 18-27. Van Harten RM, Willems RJL, Martin NI,
Hendrickx APA. 2017. Multidrug-Resistant
Ryu B, Hong J, Jung J, Min JK, Heungsup S, Enterococcal Infections: New Compounds, Novel
Mi-Na K, Yong PC, Sung-Han K, Sang-Oh L, Antimicrobial therapies. Trends in Microbiology 25,
Yang SK, Jun HW, Sang-Ho C. 2019. Clinical 467–479.
characteristics and treatment outcomes of
Enterococcus durans bacteremia: a 20-year Vijayakrishnan R, Rapose A. 2012. Fatal
experience in a tertiary care hospital. European Enterococcus durans aortic valve endocarditis: a case
Journal of Clinical Microbiology and Infectious report and review of the literature. BMJ Case Report.
Diseases 38, 1743–1751 https://doi.org/10.1136/bcr-02-2012-5855
http://dx.doi.org/10.1007/s10096-019-03605-z
Yilema A, Moges FS, Tadele LL. 2017. Isolation
Settanni L, Valmorri S, Suzzi G, Corsetti A. of Enterococci, their antimicrobial susceptibility
2008. The role of environmental factors and medium patterns and associated factors among patients
composition on bacteriocin-like inhibitory substances attending at the University of Gondar Teaching
(BLIS) production by Enterococcus mundtii Hospital. BMC Infectious Diseases 17, 276.
strains.Food Microbiology 25, 722–728.
http://dx.doi.org/10.1016/j.fm.2008.01.011 Yılmaz EŞ, Aslantaş O, Onen SP, Turkyilmaz
S, Kurekci C. 2016. Prevalence, Antimicrobial
Stepanovic S, Jovanovic M, Lavadinovic L, Resistance and Virulence Traits in Enterococci from
Stosovic B, Pelemis M. 2004. Enterococcus food of animal origin in Turkey. Food Science and
durans endocarditis in a patient with transposition of Technology 66, 20–26.
the great vessels. Journal of Medical Microbiology
53(3), 259–261. Zala A, Collins N. 2016. Enterococcus durans
https://doi.org/10.1099/jmm.0.05382-0 prosthetic valve endocarditis: a previously unreported
clinical entity. Heart, Lung and Circulation 25(10),
Trivedi K, Cupakova S, Karpiskova R. 2011. e133–e136.
Virulence factors and antibiotic resistance in https://doi.org/10.1016/j.hlc.2016.01.010
enterococci isolated from food-stuffs. Veterinarni
Medicina 56(7), 352–357.

14 Oyinloye et al.