Environmental Challenges 3 (2021) 100030

Contents lists available at ScienceDirect

Environmental Challenges
journal homepage: www.elsevier.com/locate/envc

Demonstrating an ideal compostable plastic using biodegradability kinetics

of poly(lactic acid) (PLA) based green biocomposite films under aerobic
composting conditions
Naba Kumar Kalita a, Anubhav Sarmah b, Siddharth Mohan Bhasney a, Ajay Kalamdhad c,
Vimal Katiyar a,∗
a
Department of Chemical Engineering, Indian Institute of Technology, Guwahati, Assam, India
b
Department of Chemical Engineering, MNNIT, Allahabad, Uttar Pradesh, India
c
Department of Civil Engineering, Indian Institute of Technology, Guwahati, Assam, India

a b s t r a c t

This study demonstrates the kinetics of aerobic biodegradation of melt-extruded poly(lactic acid) (PLA) based biocomposite films by online monitoring of CO2 using gas
chromatography technique following ASTM International D 5338–15 protocol. Biodegradation studies of PLA and its biocomposites were carried out in the presence of
compost microbes, without the addition of any external inoculum. The first-order kinetics model was modified by incorporating a linear lag phase for each test sample.
Bacterial identification by 16S rRNA gene sequencing showed Bacillus flexus as one of the microbes responsible for biodegradation of the exposed films at thermophilic
temperatures. Neat PLA (NPLA) and PLA/Chitosan composite films were found to evolve high amounts of C–CO2 (carbon-to-carbon dioxide). C–CO2 conversion was
found to be very low in PLA/cellulose nanocrystals and PLA/gum arabic biocomposites, expressing the presence of only 4% and 6% slowly hydrolysable carbon,
respectively, as compared to NPLA and PLA/chitosan samples. The C–CO2 evolution rate was the highest for PLA/chitosan sample at 1.13 day−1 . Experimental
data of all the test samples showed a good fit (R2 ~ 99.99) with the kinetic model. Morphological analysis by FESEM confirmed the erosion of polymer during
composting.

1. Introduction (Bitinis et al., 2013). Most biopolymers are hydrophilic in nature,

The use of non-degradable plastic materials leads to environ-
mental problems due to improper waste disposal. Issues like en-
vironmental sustainability have promoted tremendous research to-
ward developing biopolymers, which could undergo biodegradation
(Cadar et al., 2012; Valapa et al., 2015). Some of the represen-
tative biodegradable polymers which are commonly present on the
shelf are poly(lactic acid) [PLA], polyvinyl alcohol [PVA], polyhy-
droxybutyrate [PHB], poly(butylene adipate-co-terephthalate) [PBAT]
(Qi et al., 2017). Biopolymers, including cellulose, chitosan, gums, etc.
(Lucas et al., 2008) can also be used to develop biopolymer-based
biocomposite products. Among all, PLA has significant and durable
properties to replace fossil-based plastics (Garlotta, 2002; Shah et al.,
2008). Most of these plastics are specifically targeted towards pack-
aging applications since they undergo degradation during composting
(Arrieta et al., 2014; Ge et al., 2016; Narancic et al., 2018). It has been
observed that biopolymers such as cellulose (Dhar et al., 2016), chitosan
(Pal and Katiyar, 2016a), gums (Tripathi and Katiyar, 2017), when
dispersed in PLA, can enhance certain required properties for food
packaging. Studies show that cellulose nanocrystal (CNC), one of
the most abundantly available biopolymer, can significantly im-
prove the thermo-mechanical properties of PLA based composites
but certain grafting techniques can be applied to change their surface
properties from hydrophilic to hydrophobic. Accordingly, chitosan and
gum arabic have been applied as the reinforcing phase for improv-
ing gas barrier properties of PLA films for food packaging applications
(Pal and Katiyar, 2016b; Tripathi and Katiyar, 2017). However, these
improved modified composite films must meet certain criteria regard-
ing biodegradability, like 90% organic carbon present in the composite
film must be converted to CO2 , water, etc., under either compost or
soil, following certain standards. In this regard, ASTM International has
detailed protocol (ASTM D 5338–15) about biodegradation (ASTM In-
ternational, 2015). However, this standard is inherent to different com-
posites and substrates, though the testing protocols remain similar.
Composting can transform biodegradable waste materials into fer-
tile soil, which enhances the growth of the agro-economy. Several
studies have reported that PLA undergoes biodegradation under com-
posting conditions within a short period (Castro-Aguirre et al., 2017;
Leejarkpai et al., 2011; Pattanasuttichonlakul et al., 2018). The rate of
PLA biodegradation may vary, depending upon various factors such as
temperature and moisture content (Kale et al., 2007b; Pradhan et al.,
2010b). Biodegradation of PLA follows two steps, which include (1)
hydrolytic degradation and (2) biodegradation (Pradhan et al., 2010a;
Sikorska et al., 2015; Zenkiewicz et al., 2012). During hydrolytic

∗
Corresponding author.
E-mail address: vkatiyar@iitg.ac.in (V. Katiyar).

https://doi.org/10.1016/j.envc.2021.100030
Received 11 December 2020; Received in revised form 13 January 2021; Accepted 13 January 2021
2667-0100/© 2021 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/)
N.K. Kalita, A. Sarmah, S.M. Bhasney et al.
degradation of PLA, degradation occurs by water molecules through
random chain scission, reducing the molar mass that leads to low molec-
ular chain formation as low as <20,000 Da. Low molecular weight poly-
mer chains are required for microbial digestion. These intermediates
are assimilated by microbes for energy and decomposed into various
compounds like CO2 and water (Gu, 2003; Torres et al., 1999). Even
though no microbe has been identified as the degrader of high molecular
weight PLA directly (Sikorska et al., 2015), various microorganisms and
enzymes have been identified as PLA degraders (Castro-Aguirre et al.,
2017; Leja and Lewandowicz, 2010; Lucas et al., 2008; Sikorska et al.,
2015). In the current investigation, the authors had prepared and inves-
tigated PLA films and biocomposites by melt extrusion process to use
them to create thermoformed, or vacuum formed products. The leeway
of research for improvements in PLA based food packaging applications
is extensive (Arrieta et al., 2014; Luo et al., 2012; Nieddu et al., 2009;
Petinakis et al., 2010a; Weng et al., 2013). Studies reported that PLA is
readily biodegradable under composting conditions but takes more time
to degrade under soil conditions (Kale et al., 2007a; Kucharczyk et al.,
2016; Weng et al., 2013).
CO2 (carbon dioxide) evolution measurement is an utmost tool to
measure biodegradation as it can help to monitor kinetic parameters
during biodegradation. Various analytical techniques are used to mea-
sure CO2 evolution for assessing percentage biodegradation of PLA and
its derivative materials under different environments, which include di-
rect measurement respirometry (DMR), non-dispersive infrared (NDIR),
cumulative measurement respirometry (CMR) titration, etc. (Castro-
Aguirre et al., 2017; Gómez and Michel, 2013; Kale et al., 2007c;
Kijchavengkul et al., 2008, 2006; Petinakis et al., 2010b; Pradhan et al.,
2010b). Results observed show that reproducibility is one of the main
issues for the measurement of CO2 evolution by these methods. Gas
chromatography is another technique to monitor the evolved CO2 and
can be used for assessing biodegradation. Kinetic studies have exhib-
ited that carbon mineralization is a first-order reaction (Komilis, 2006;
Leejarkpai et al., 2011). Microbial identification and DNA sequencing
studies have revealed various PLA biodegrading microbes responsible
for biodegradation at both mesophilic and thermophilic temperatures
(Fontanella et al., 2010; Walczak et al., 2015).
In line with the development of various online CO2 evolution tests,
we have also developed a test according to the ASTM D5338–15 stan-
dard with few modifications for measuring the CO2 evolution using a
gas chromatography system having 16 port valves connected with the
composting reactors. The current study’s main objective is to highlight
the biodegradability of a new class of PLA-based green biocomposites.
Melt extruded composite films of NPLA (neat PLA), PLA/Chitosan 5%,
PLA/CNC-SO4 (̴1%) and PLA/Gum Arabic 5% were used for this study.
This study helped check the test protocol, validate the system, and un-
derstand the compostability of the green biocomposites. A kinetic study
corresponding to PLA based biocomposite biodegradation was employed
and experimental data were analyzed to understand various phases and
forms of carbon produced during biodegradation. Assessment of micro-
bial flora involved in the thermophilic state of biodegradation and anal-
ysis of the biocomposite films’ surface morphology, both before and after
biodegradation, will help in better understanding the biodegradation of
the films. Information obtained from these analytical parameters will
lead to a better and more reliable prediction of the PLA-based compos-
ites films’ biodegradability.
2. Materials and methods
2.1. Materials
PLA granules were purchased from Nature Works○R 2003D. Molec-
ular weight (Mn ) of the granules were 140 kDa. Melting point of the
granules was found to be 180 °C. Food waste compost was used for
the composting process. Modified chitosan, gum arabic masterbatches
(Pal and Katiyar, 2016a; Tripathi and Katiyar, 2017), H2 SO4 hydrolyzed
2
Environmental Challenges 3 (2021) 100030
CNC (Dhar et al., 2016) were used as raw materials for the preparation
of extruded films.
2.2. Composting set-up
The composting set-up consisted of composting reactors (CRs) of 2 L
volume made up of Borosil glass, and connected to a gas chromatog-
raphy (GC) system, through a 16-port gas-analyzing valve. H2 SO4 was
used to trap moisture of the cylindrical glass vessels placed in between
the composting reactors, and the gas valve was connected to the GC.
Air compressor was used to create aerobic condition inside the CRs. Ro-
tameter (purchased locally) was used to control the air flow. A GC sys-
tem (Trace 1310, Thermo Scientific) was used for measuring the evolved
CO2 gas (Fig. 1) Helium, hydrogen and zero air with 99.9% purity were
used as the mobile phases for GC.
2.3. Testing material and compost preparation
The PLA based biocomposite films were fabricated in a pilot scale
twin screw extruder-cum-sheet casting unit (Boolani Engineering Corpo-
ration, India). The extrusion process and parameters (Kalita et al., 2019)
were kept fixed for testing all the bioplastic materials, namely, neat
PLA (NPLA), PLA/Chitosan 5% (PLA/Chitosan), PLA/CNC-SO4 (̴1%)
(PLA/CNC) and PLA/Gum Arabic 5% (PLA/Gum), respectively. The
thickness of the testing films was 0.45 mm.
For the preparation of compost, vegetable waste and dry leaves were
collected in the month of October 2017 from different hostels of IIT
Guwahati, India. Cow dung and saw dust were procured from a nearby
village of Guwahati, India. The protocol followed in our previous in-
vestigations was followed for compost preparation (Kalamdhad and
Kazmi, 2009; Varma and Kalamdhad, 2014). Physio-chemical charac-
teristics of the compost were determined according to conventional pro-
tocols (Kalita et al., 2019).
2.4. Elemental analysis
An elemental analyser (Euro Vector E 3000) was used for the elemen-
tal analysis of the samples, according to the ASTM D5373–16 standard.
Carbon percentage (C %) of the samples were also analyzed using the
elemental analyser instrument.
2.5. Biodegradation test
Biodegradation test of the samples was done in accordance to ASTM
D5338–15 standard (Fig. 1). Set of three CRs were used for each test
material. Each CR (width 12 cm and thickness 200 μm) was filled with
50 g of test material and 700 g of compost. The contents were thor-
oughly mixed and incubated at 58 ± 5 °C in the dark at 60% relative
humidity. A set of CR with only the compost material was kept as blank
and another set of CR with cellulose (Whatman No. 1 filter papers) was
kept as positive control. All the CRs were supplied with humidified com-
pressed air and all the exit gases were continuously purged through the
GC (since, compressed air was used in the CRs, 0.05% of CO2 was sub-
tracted as it is the amount of CO2 present in normal air) for assessing the
amount of CO2 accumulated inside the CRs. Distilled water was added at
regular intervals to replenish the lost moisture (Pradhan et al., 2010b).
Temperature, pH and aeration were closely monitored and controlled
during the whole experiment.
2.5.1. Calculation and interpretation of the biodegradation test process
Cumulative evolution of CO2 and net cumulative CO2 production
was determined according to the ASTM D5338–15 standard. The per-
centage of biodegradation of the test materials for each measurement
interval was determined from the released cumulative CO2 amount an-
alyzed using the GC system wherein the following equation (Eq. (1))
N.K. Kalita, A. Sarmah, S.M. Bhasney et al. Environmental Challenges 3 (2021) 100030

Fig. 1. Aerobic biodegradation process in accordance to the ASTM D5338-15 standard. Flowchart design used for biodegradation.

was used for calculating the percentage biodegradation:

𝑑 𝐶𝑚
(𝐶 𝑂2 )𝑇 − (𝐶 𝑂2 )𝐵 = −𝑘ℎ𝑚 .𝐶𝑚 (3)
%Biodegrdation = × 100 (1) 𝑑𝑡
𝑇 ℎ𝐶 𝑂2
Where, (CO2 )T was the cumulative amount of CO2 evolved in each com- 𝑑 𝐶𝑠
= −𝑘ℎ𝑠 .𝐶𝑠 (4)
posting flask containing the polymer sample, g/flask; (CO2 )B was the 𝑑𝑡
mean cumulative amount of CO2 evolved in the blank flask, g/flask;
𝑑 𝐶𝑎𝑞 ( ) ( )
and 𝑇 ℎ𝐶 𝑂2 was the amount of carbon in the test compound which was = 𝑘ℎ𝑟 .𝐶𝑟 + 𝑘ℎ𝑚 .𝐶𝑚 + 𝑘ℎ𝑠 .𝐶𝑠 − 𝑘𝑎𝑞 .𝐶𝑎𝑞 (5)
added, g. 𝑑𝑡

𝑑 𝐶𝑇
2.6. Biodegradation mechanism and kinetics = 𝑘𝑎𝑞 .𝐶𝑎𝑞 (6)
𝑑𝑡

The biodegradation mechanism followed by three kinetically differ-
ent forms of solid carbon (SC) namely: rapidly, moderately and slowly
hydrolysable, at different rates, until a common water soluble interme-
diate was reached, which then mineralized readily to release CO2 , thus
achieving degradation, was studied. The rate equations Eqs. (2)-((6))
involved in the entire mechanism are as follows:
𝑑 𝐶𝑟
= −𝑘ℎ𝑟 .𝐶𝑟 (2)
𝑑𝑡
Where, Cr , Cm & Cs were the percentages of the rapidly, moderately and
slowly hydrolysable SCs in the initial polymer chain, respectively. Caq
was the percentage of intermediate water-soluble carbon and CT was
the percentage of mineralization, i.e., cumulative C–CO2 production of
the polymer sample. khr , khm & khs were the hydrolysis rate constants of
the rapidly, moderately and slowly hydrolysable carbon fractions (HCF),
respectively, and kaq was the ultimate mineralization rate constant, de-
scribing the formation of CO2 from the water soluble intermediate.

3
N.K. Kalita, A. Sarmah, S.M. Bhasney et al. Environmental Challenges 3 (2021) 100030

2.6.1. Analytical solutions for the biodegradation kinetics

The above-stated rate equations Eqs. (2)-((6)) are differential equa-
tions of the first order, and hence their solutions could only be derived
using an integrating factor. While solving the equations, a lag phase, c,
was taken for each substance undergoing biodegradation to account for
the initial days of the process, when first order biodegradation kinetics
was not followed. The analytical solutions were modified Eqs. (7)-((11))
according to our previous study (Kalita et al., 2020a) in order to satisfy
our experimental observations during the lag phase which were more
suitable to the solutions given in previous studies (Leejarkpai et al.,
2011; Stloukal et al., 2015b), wherein the lag phase was taken to be
a period of negligible carbon mineralization.
𝐶𝑟_𝑡 = 𝐶𝑟𝑜 .𝑒−𝑘ℎ𝑟 (𝑡−𝑐 ) ; for 𝑡 > 𝑐, (7)

𝐶𝑚_𝑡 = 𝐶𝑚𝑜 .𝑒−𝑘ℎ𝑚 (𝑡−𝑐 ) ; for 𝑡 > 𝑐, (8)

𝐶𝑠_𝑡 = 𝐶𝑠𝑜 .𝑒−𝑘ℎ𝑠 (𝑡−𝑐 ) ; for 𝑡 > 𝑐, (9)

Fig. 2. Carbon dioxide evolution from the compost plus the test samples during
the composting period. Bar represents the standard error.
( )
−𝑘𝑎𝑞 .(𝑡−𝑐 )
𝑒−𝑘ℎ𝑟 .(𝑡−𝑐) − 𝑒−𝑘𝑎𝑞 .(𝑡−𝑐 )
𝐶𝑎𝑞 _𝑡 = 𝐶𝑎𝑞𝑜 .𝑒 + 𝐶𝑟𝑜 .𝑘ℎ𝑟 .
𝑘𝑎𝑞 − 𝑘ℎ𝑟
( ) 1492R (TACGGCTACCTTGTTACGACTT) were used to amplify nearly
−𝑘𝑎𝑞 .(𝑡−𝑐 )
𝑒−𝑘ℎ𝑚 .(𝑡−𝑐 ) −𝑒 the full length 16S rRNA gene. Target gene fragment was amplified us-
+ 𝐶𝑚𝑜 .𝑘ℎ𝑚 .
𝑘𝑎𝑞 − 𝑘ℎ𝑚 ing the Teledyne Prime Thermal Cycler. DNA fragments were amplified
( ) using 1 μl of template DNA in 20 μl of total PCR reaction mixture us-
𝑒−𝑘ℎ𝑠 .(𝑡−𝑐 ) − 𝑒−𝑘𝑎𝑞 .(𝑡−𝑐)
+ 𝐶𝑠𝑜 .𝑘ℎ𝑠 . ; ing the 27F/1492R primers (50 pmol) and 35 amplification cycles with
𝑘𝑎𝑞 − 𝑘ℎ𝑠
following program:
for 𝑡 > 𝑐, (10)
(i) Denaturation: 94 °C for 50 s,
( ) (ii) Annealing: 52 °C for 55 s,
⎛ [ ( 𝐶𝑎𝑞𝑜 . 1 − 𝑒−𝑘𝑎𝑞 . (𝑡 − 𝑐 )
)] ⎞ (iii) Chain Elongation: 72 °C for 65 s.
⎜ 𝑘𝑎𝑞 −𝑘 .(𝑡−𝑐 ) + 𝑘ℎ𝑟 −𝑘𝑎𝑞 .(𝑡−𝑐 ) ⎟
⎜ + 𝐶𝑟𝑜 . 1 − 𝑘𝑎𝑞 −𝑘ℎ𝑟 .𝑒 ℎ𝑟 𝑘𝑎𝑞 −𝑘ℎ𝑟
. 𝑒 ⎟
⎜ [ ( )]⎟ 2.8. Morphological study
𝐶 𝑇 _𝑡 = ⎜
.𝑒−𝑘𝑎𝑞 .(𝑡−𝑐 ) ⎟⎟
𝑘𝑎𝑞 −𝑘ℎ𝑚 .(𝑡−𝑐 ) + 𝑘ℎ𝑚
⎜+ 𝐶𝑚𝑜 . 1 − 𝑘𝑎𝑞 −𝑘ℎ𝑚 .𝑒 𝑘𝑎𝑞 −𝑘ℎ𝑚
(11)
⎜ [ ( )] ⎟ The effects of biodegradation on the surface morphology of the green
⎜ + 𝐶𝑠𝑜 . 1 − 𝑘𝑎𝑞 .𝑒−𝑘ℎ𝑠 .(𝑡−𝑐 ) + 𝑘ℎ𝑠 .𝑒−𝑘𝑎𝑞 .(𝑡−𝑐 ) ⎟ biocomposites were investigated using Field emission scanning electron
⎝ 𝑘 −𝑘 𝑘𝑎𝑞 −𝑘ℎ𝑠 ⎠
( ) 𝑎𝑞 ℎ𝑠 microscope (FESEM) (ZEISS, USA), operating at an accelerating voltage
for 𝑡 > 𝑐, or 𝐶𝑐 ∕𝑐 .𝑡 for 𝑡 ≤ 𝑐,
of 3–5 kV.
Where, Cro , Cmo & Cso referred to the initial percentages of rapidly, mod-
erately and slowly HCFs, respectively, while Cr_t , Cm_t & Cs_t were the per- 3. Results and discussion
centages of the same fractions at time, t. Caqo was the initially present
percentage of the intermediate water soluble carbon, and Caq_t denoted 3.1. Biodegradation test
the same at time, t. CT_t, gave the cumulative percentage of C–CO2 pro-
duction at time t. Cc denoted the C–CO2 %. The slow hydrolysis rate C % of NPLA, PLA/Chitosan, PLA/CNC and PLA/Gum was found
constant was assumed to be zero. All the kinetic parameters were con- to be ~50.26%, ~50.06%, ~50.05%, and ~49.99%, respectively. Aer-
strained to be positive. obic composting (AC) tests revealed that the standard cellulose films
Mathematically, the constraints were as follows: degraded more than 90% within 37 days, which confirmed the authen-
ticity of our composting set-up (Fig. 1) according to ASTM D5338–15
CC0 = Cro + Cmo + Cso + Caqo standard. CO2 evolution test results for the samples are presented in
Fig. 2. It could be observed that ~435 g of CO2 was evolved in 113
CFC = Cr,final + Cm,final + Cs,final + Caq,final
days from the PLA/Chitosan sample plus the inoculum, followed by
0 ≤ khm < khr < kaq, khs = 0 NPLA, PLA/CNC and PLA/Gum, in ascending number of days. Differ-
CT _t = (Cc /c).t, for t ≤ c ent amounts of CO2 evolution from the samples plus the inoculums rep-
resented the samples’ viability or their compatibility to degrade in the
2.7. Isolation and identification of the degrading strain particular compost in a definite duration. The composition of the micro-
bial consortium, biodegradability of the test sample in the compost and
Three samples of plate count agar (PCA) media and nutrient agar moisture content in different CRs were the factors governing the study.
(NA) media were prepared for measuring microbial count. 1 g of the The amount of CO2 evolution of from respective samples representing
compost sample was dissolved in 9 ml sterile water using a vortex mixer. the percentage biodegradation is given in Fig. 3.
The mixture was then diluted progressively to 10−6 by adding 1 ml of The percentage biodegradation trend was as follows: PLA/Chitosan
the compost suspensions to 9 ml of sterile water. 100 μl of the diluted >NPLA> PLA/CNC > PLA/Gum. In NPLA, 94.20% biodegradation was
solution samples were spread onto the prepared media plates which observed in 136 days, whereas 88.30% biodegradation was observed
were then incubated at 58 °C for 72 h. Pure colonies were isolated for for PLA/CNC in 138 days and 80.50% biodegradation was observed
identification. Genomic DNA was isolated using the InstaGeneTM Matrix for PLA/Gum in 139 days. After hydrolytic degradation, microorgan-
DNA isolation kit. The primers 27F (AGAGTTTGATCATGGCTCAG) and isms present in the compost metabolized the PLA oligomers and other

4
N.K. Kalita, A. Sarmah, S.M. Bhasney et al. Environmental Challenges 3 (2021) 100030

Table 1
Kinetic model parameters and coefficient of determination (R2 ).

Material NPLA PLA/Chitosan PLA/CNC PLA/Gum

−1
kaq (day ) 0.99 1.13 0.99 1.00
khr (day−1 ) 0.02 0.04 0.01 0.01
khm (day−1 ) 0.02 0.02 0.01 0.01
khs (day−1 ) 0 0 0 0
Caq0 (%) 0.98 0.94 2.00 3.31
Cr0 (%) 46.90 46.59 45.96 44.36
Cm0 (%) 50.13 50.56 48.03 45.73
Cs0 (%) 1.97 1.89 3.98 6.57
Lag Phase (days) 8 3 3 4
R2 (%) 99.99 99.99 99.99 99.96
RMSE 0.17 0.17 0.27 0.16

the initial hydrolysis commenced, the short polymer chains generated

Fig. 3. Percentage biodegradation of the test samples under aerobic composting
conditions. Bar represents standard error.
intermediates, and converted them to carbon dioxide, water and hu-
mus. This step occurred at the surface of the material through biofilm
formation (Kale et al., 2007a; Fukushima et al., 2009; Kalita et al.,
2020b). It was observed that 85% of the composite fraction degraded
within 70 days, against 95 days needed in NPLA. An almost similar ob-
servation was reported elsewhere; however, the lag phase was not re-
ported, providing valuable information in comparing the two systems
(Kale et al., 2007a; Rudeekit et al., 2008). It further established our re-
sults for compostability of PLA in the used compost. The degradability
of the PLA/Chitosan samples significantly enhanced in comparison to
neat PLA. Whereas, in case of PLA/CNC and PLA/Gum, biodegradation
rate was comparatively slow. This might be due to several reasons like
compost suitability, molecular structure of the material and mechanical
strength of the material. All these factors were found to be higher in
PLA/Chitosan and PLA/Gum than NPLA before biodegradation. Some
authors had also reported a slower disintegration rate for the compos-
ites like PLA/CNC/NR (natural rubber) blend under composting con-
ditions (Bitinis et al., 2013). They attributed this behavior to a higher
resistance to water uptake and diffusion through the composites than
NPLA. Parameters that might have affected the rate are percentage crys-
tallinity and hydrophilicity of the biocomposites’ surface (Picard et al.,
2011). In the PLA/Gum case, the barrier property like oxygen solubil-
ity decreased significantly for the processed films (Tripathi and Kati-
yar, 2016). Good barrier properties of the films might be another rea-
son behind the slow biodegradation of PLA/Gum biocomposites, as low
water and oxygen solubility would hinder the hydrolysis process as well
as the growth of aerobic microorganisms on the film surface. In another
work (Lee, 2002), the nanocomposites’ improved gas barrier properties
were found to have similar detrimental effects upon its biodegradabil-
ity. In this study, the PLA biocomposites had specific improved proper-
ties such as mechanical and gas barrier properties compared to NPLA.
From our observation, it became clear that material properties like high
mechanical strength or gas barrier characteristics play a crucial role in
determining the rate of biodegradation.
3.2. Biodegradation mechanism and kinetics
Biodegradation began with hydrolysis wherein the PLA chain scis-
sion occurred by the hydrolytic attack of H2 O on the ester group of
PLA primary backbone. As the entire chain was not identical in its affin-
ity towards hydrolysis, the primary chain was assumed to be composed
of three different SC’s kinetic forms, namely, rapidly, moderately and
slowly hydrolysable. This difference could be on account of their posi-
tion with respect to the chain ends, percentage crystallinity, etc. Once
became susceptible to microbial assimilation, leading to biofilm forma-
tion on their surfaces. This biofilm formation facilitated enzymatic se-
cretion on the polymer that promoted biodegradation. The proposed
biodegradation mechanism (as shown in Fig. 4) was assumed to be fol-
lowed by all the three forms of SC, at different rates, until a final com-
mon water-soluble intermediate form of carbon was reached then miner-
alized readily to release carbon dioxide, thus achieving biodegradation.
To further upgrade the existing model developed by previous authors,
the mineralization was assumed to occur linearly during the lag phase
for the sake of uniformity before the onset of first-order mechanism.
Unique duration and percentage conversion was considered for the lag
phase of each sample, as determined experimentally. The biodegrada-
tion rate of all the test materials are given in Table 1, and the trends are
shown in Fig. 5.
The obtained results showed a faster biodegradation rate for
PLA/Chitosan biocomposite films compared with the extruded NPLA
films. This was in agreement with various works of literature where
the authors increased the biodegradability of PLA based biocomposites
by adding biopolymers as reinforcements (Kalita et al., 2020b, 2020a;
Pradhan et al., 2010b, 2010a; Qi et al., 2017; Stloukal et al., 2015a)
varying when compared to our results for PLA/CNC and PLA/Gum bio-
composites.
From the model data analysis, CO2 evolution percentage was found
to be within the range of 90% - 70% in 113 days for all the test samples.
This signified that the prepared green biocomposites were suitable for
industrial composting because of their rate of biodegradation. Industrial
composting setup or municipal composting setups are generally large
scale up operation of the in-vessel laboratory setups, which degrades
biopolymeric wastes on larger scale (Sikorska et al., 2015).
Ready biodegradation in PLA/chitosan occurred because of higher
intermediate carbon mineralization activity at 1.13 day−1 , leading to
a faster rate of biodegradation. The faster rate of rapidly hydrolysable
carbon at 0.04 day−1 resulted in faster biodegradation of the sample
than NPLA or other test samples. The moderately hydrolysable carbon
hydrolysis rate was 0.02 day −1 , compared to 0.01 day−1 for PLA/CNC.
The intermediate rate constant was almost similar to NPLA. How-
ever, PLA/Gum showed that the hydrolysable rate constants for the
rapidly and moderately hydrolysable carbon were very low as com-
pared to the other samples, i.e., 0.01 day−1 and 0.01 day−1 , respec-
tively. The intermediate carbon mineralization of PLA/Gum was found
relatively high at 1.00 day−1 compared with NPLA and PLA/CNC. This
might be due to the complex structure that the Gum arabica formed
with the PLA matrix, making hydrolysis difficult, but once the inter-
mediates were formed, carbon mineralization became faster. We had
incorporated the lag phase to C–CO2 evolution, since our experiments
showed some amount of CO2 being released during the lag phase, which
was close to zero in some studies (Komilis, 2006; Leejarkpai et al., 2011;
Stloukal et al., 2015b). The kinetic model adopted in our calculation
of the relevant parameters was initially developed earlier (Komilis and
Ham, 2003). Further, the non-predetermined calculation of the

5
N.K. Kalita, A. Sarmah, S.M. Bhasney et al. Environmental Challenges 3 (2021) 100030

Fig. 4. Proposed biodegradation mechanism of biodegradable polymers and carbon degradation during aerobic composting. Cr , Cm and Cs were the three different
kinetic forms of SC, i.e., rapidly, moderately and slowly hydrolysable. Intermediates were mainly amorphous regions attacked by microbes at first, leaving behind
the crystalline polymer regions.

mineralization rate constant was taken to be 106 day−1 as reported by
Komilis (2006) (Komilis, 2006). The kinetic model was further modi-
fied other investigators (Leejarkpai et al., 2011). But, in the authors’
assumptions, the lag phase was taken to be a period in the initial days
of the experiment, where the carbon mineralization percentage was non-
existent. In contrast, as observed experimentally during the composting
process, results were found to be different.
Moreover, due to the differences in each polymer blend’s char-
acteristic in the biodegradation process, every material had its own
lag phase and a unique conversion percentage in the given period.
Hence, to further upgrade the existing model developed by the authors
(Komilis, 2006; Leejarkpai et al., 2011) during the lag phase, the min-
eralization was assumed to occur linearly for the sake of uniformity,
before the onset of first-order mechanism. A unique duration and per-
centage conversion were considered for each sample’s lag phase, as de-
termined experimentally. After the growth phase, the stationary phase
or the plateau commenced after that, indicating reduction in depoly-
merization rate.
It is generally assumed that biocomposites derived by dispersion
of bio-fillers in bioplastics have greater biodegradability. But, it was
observed from our experiments that it was always not necessary. As
showed by Komilis (2006), different carbon forms followed differ-
ent biodegradation pathways, and most importantly, at different rates.
These discrepancies in the composites’ molecular structures had led to

6
N.K. Kalita, A. Sarmah, S.M. Bhasney et al.
Fig. 5. Kinetics of percentage CO2 evolution during biodegradation of: (a) NPLA; (b) PLA/Chitosan; (c) PLA/CNC; (d) PLA/Gum biocomposites. Bar denotes standard
error.
(a)
(b) 66 JX297471.1 Bacillus flexus strain TTK-017
4 16S sample 27-F
2 firmed that the participating microorganisms’ compatibility could ex-
1 KP236203.1 Bacillus flexus strain 0065
KJ401066.1 Bacillus flexus strain MTA-12
KR999908.1 Geobacillus stearothermophilus strain NB3-8
JQ977706.1 Bacillus flexus strain 1121
KY962908.1 Bacillus flexus strain FS-3
0 MF755293.1 Bacillus flexus strain NK1
2 KX254607.1 Geobacillus stearothermophilus strain GL
7 MG937596.1 Bacillus flexus strain SML I301
Fig. 6. (a). Electrophoresis documenting microbial identification analysis. (b).
Phylogenetic analysis of the 16S rRNA gene sequence of the isolated bacteria
(denoted as 16S sample).
7
Environmental Challenges 3 (2021) 100030
other kinetic parameters observed in our experimental analysis. Gum
Arabica, a complex polysaccharide (natural plant origin), used with
NPLA, showed the lowest rate of biodegradation and highest quantity of
slowly HCF, which was in accordance with the classification put forth
by the authors (Komilis, 2006), pertaining to the biodegradation rates of
various carbon forms. According to our modeled data, PLA/CNC showed
a higher quantity of readily HCF and a lower quantity of slowly HCF than
PLA/Gum. Again, this supported Komilis (2006) classification, which
claimed a higher biodegradation rate of cellulose than proteins. The
next filler involved in our experiment set was chitosan, which is ob-
tained by deacetylation of chitin. Chitosan, a bioactive polysaccharide
or a marine polysaccharide derived from chitin, showed an immense
increase in biodegradation capacity when infused with PLA. This was
validated experimentally by the highest mineralization rate constant of
PLA/Chitosan, even surpassing NPLA.
3.3. Microbiological analysis
Microbes were isolated at 58 °C, and were further purified for pure
colony isolation and genomic DNA analysis. The microbial analysis con-
plain the differences in biodegradation rate between different PLA-based
biocomposites in this study with the biocomposites. This study also re-
vealed that different biodegradable fillers had different biodegradation
rate. Through 16S rRNA gene analysis (Fig. 6a and b), we were able to
identify one of the bacterial strains, which was acting during the ther-
mal biodegradation process. The strain was found to be highly similar to
Bacillus flexus. Thus, it was clear that Bacillus flexus could degrade high
molecular weight PLA-based biocomposites. This strain could survive
N.K. Kalita, A. Sarmah, S.M. Bhasney et al.
Fig. 7. FESEM images of the different test samples before and after biodegradation under composting conditions.
in extreme conditions and form endospores. This strain has not been
reported for PLA based biocomposites biodegradation till now.
3.4. Morphological studies
The biodegradability and model results were corroborated by FESEM
(Fig. 7). The FESEM images after composting showed degradation on
the PLA based green biocomposites surface. This morphological change
was observed on the 40th and 80th day of the composting process.
Microbial assimilation of the amorphous regions as well as hydrolytic
degradation led to intermediate formation during the biodegradation
process. This resulted in large holes and cracks formation, which could
be seen on the polymer surface and the cross-section during the time of
biodegradation, which attributed the action of microbes or biofilm for-
mation on the surface of the polymers and diffusion of the cells to the
core of polymer, leading to surface erosion, and leaving cavities on PLA.
Moisture inside the CR diffused into the amorphous domains which ini-
tiated hydrolytic degradation for further microbial assimilation of the
polymeric intermediates. With progress in the hydrolytic degradation
process, the fillers tended to move away from the matrix towards the
8
Environmental Challenges 3 (2021) 100030
compost, resulting in holes, cavities and cracks which was observed on
the 40th as well as 80th day. This disorientation of the films during
biodegradation also suggested that short chains were assimilated by mi-
crobes first and then the long crystalline chains were attacked through
chain scission mechanism (Kalita et al., 2020b, 2020a). These morpho-
logical changes also proved that these new class of PLA based composites
were biodegradable under controlled composting environment.
Visually if we observe the samples (Fig. 8) during the biodegrada-
tion process, we can divide the degradation process in four different
stages. Stage 1 represents the stage of the samples before biodegrada-
tion. Stage 2 represents the biodegradation process’s initial stage i.e.
hydrolytic degradation, which is the onset of the biodegradation pro-
cess. During this stage polymer starts degradation due to hydrolysis of
the ester bonds and forms low and medium molecular weight poly-
mers. During this stage carbon mineralization is slow. During stage
3 this low molecular weight and medium molecular weight polymers
get further disintegrated into oligomers, helping in faster carbon min-
eralization. If we observe the final stage 4 we can observe a lump
of biodegraded biomass after total carbon mineralization as shown in
Fig. 8.
N.K. Kalita, A. Sarmah, S.M. Bhasney et al.
Fig. 8. Compostable materials identification flowchart for further visual iden-
tification and assessment.
The merits of the compostable plastics are large like environmen-
tal protection to sustainability. After total mineralization, the biomass
formed can be further use as fertilizer or soil enhancer for crop growth
(Janczak et al., 2020). The plastics biodegradability is effected by its
property. The biodegradability data can also help in tuning and charac-
terization of the plastics for specific uses. However, proper segregation
policy and system would be needed during waste collection in order
to maintain value addition. This waste management would prove to be
demerits in some developing countries where municipal or large-scale
composting facilities are not available.
4. Conclusion
The present study successfully demonstrated the biodegradability of
PLA/Chitosan, NPLA, PLA/CNC and PLA/Gum biocomposites, whose
percentage biodegradation were observed to be 97%, 94.2%, 88.3% and
80.5%, respectively in 120–145 days. The first order reaction kinetics,
which was in streak with lag phase, showed the best fitting with the ex-
perimental datasets. Various kinetic parameters including initial solid
carbon (SC) fractions (readily, moderately, and slowly HCF), mineral-
ization rate, hydrolysis rate constant (ready, moderate, and slow hydrol-
ysis rate), and lag time were thoroughly investigated. Initial SC in NPLA,
PLA/Chitosan, PLA/CNC and PLA/Gum consisted of readily, moder-
9
Environmental Challenges 3 (2021) 100030
ately HCFs and intermediate SCs. However, a high amount of slowly
hydrolysable carbon was present in PLA/CNC and PLA/Gum, which
signified their slow rate of biodegradation compared with NPLA and
PLA/Chitosan as predicted from the biodegradation model. This study
also enhanced the possibility of using some modified biopolymers in the
biocomposites for sustainable packaging applications. Microbial analy-
sis and 16S rRNA data revealed that Bacillus flexus was responsible for
PLA based biocomposite biodegradation, which has not been reported
elsewhere yet. Thus, it could be assumed that it is not necessary to add
inoculum before biodegradation if proper and high-quality compost is
used. This study might give further insights about different strains de-
grading PLA based composites at thermophilic temperatures. The limi-
tations of this research are that we have used only one type of compost
for the degradation study. If different kinds of compost is used will give
different degradation results for the same samples, due to variation in
microbial community. However, one can try with different compost type
to select the best one for the degradation of the above mentioned com-
postable polymeric biocomposites. This investigation has further opened
the window for single strain degradation of PLA based biocomposites un-
der composting condition with the help of microbes naturally occurring
in the compost. Morphological analysis revealed cracks and holes caused
due to microbial assimilation and release of bio-fillers from the PLA ma-
trix. This kind of sustainable strategy can benefit to satisfy the 90% car-
bon constituent degradation/biodegradation requirements of the mod-
ified biopolymers in a compostable PLA based composites within 180
days.
Declaration of Competing Interest
All the authors and the corresponding author of the manuscript titled
“Demonstrating an Ideal Compostable Plastic using Biodegradability
Kinetics of Poly(lactic acid) based Green Biocomposite Films under
Aerobic Composting Conditions” would like to state that there is no
conflict of interest relevant to this article ethically. However, authors
would like to acknowledge their gratitude towards the Department of
Chemicals and Petrochemicals, Ministry of Chemicals and Fertilizers,
Government of India funded Center of Excellence for Sustainable Poly-
mers (CoE-SusPol) at IIT Guwahati, India, for providing the excellent
research facilities to perform this research study. Moreover, the authors
would like to state that they have no financial conflict of interest with
any funding agency.
Acknowledgments
The authors sincerely thank the Department of Chemicals and Petro-
chemicals, Ministry of Chemicals and Fertilizers, Government of India
funded Center of Excellence for Sustainable Polymers (CoE-SusPol) at
IIT Guwahati for the research facilities to perform this research work.
The authors further thanks to Neelima Tripathi, Akhilesh Kumar Pal and
Prodyut Dhar for providing various composite films for the composting
studies.
References
Arrieta, M.P., Lopez, J., Rayon, E., Jiminez, A., 2014. Disintegrability under compost-
ing conditions of plasticized PLA-PHB blends. Polym. Degrad. Stab. 108, 307–318.
doi:10.1016/j.polymdegradstab.2014.01.034.
ASTM International, 2015. ASTM D5338-15: standard test method for determining
aerobic biodegradation of plastic materials under controlled composting con-
ditions, conditions, incorporating thermophilic temperatures. ASTM Stand. 1–7.
doi:10.1520/D5338-15.2.
Bitinis, N., Verdejo, R., Bras, J., Fortunati, E., Kenny, J.M., Torre, L., Lopez-
Manchado, M.A., 2013. Poly(lactic acid)/natural rubber/cellulose nanocrystal bio-
nanocomposites Part I. Processing and morphology. Carbohydr. Polym. 96, 611–620.
doi:10.1016/j.carbpol.2013.02.068.
Cadar, O., Paul, M., Roman, C., Miclean, M., Majdik, C., 2012. Biodegradation behaviour of
poly(lactic acid) and (lactic acid-ethylene glycol-malonic or succinic acid) copolymers
under controlled composting conditions in a laboratory test system. Polym. Degrad.
Stab. 97, 354–357. doi:10.1016/j.polymdegradstab.2011.12.006.
N.K. Kalita, A. Sarmah, S.M. Bhasney et al.
Castro-Aguirre, E., Auras, R., Selke, S., Rubino, M., Marsh, T., 2017. Insights on
the aerobic biodegradation of polymers by analysis of evolved carbon diox-
ide in simulated composting conditions. Polym. Degrad. Stab. 137, 251–271.
doi:10.1016/j.polymdegradstab.2017.01.017.
Dhar, P., Bhasney, S.M., Kumar, A., Katiyar, V., 2016. Acid functionalized cellulose
nanocrystals and its effect on mechanical, thermal, crystallization and surfaces prop-
erties of poly (lactic acid) bionanocomposites films: a comprehensive study. Polym.
U.K. 101, 75–92. doi:10.1016/j.polymer.2016.08.028.
Fontanella, S., Bonhomme, S., Koutny, M., Husarova, L., Brusson, J.M., Courdavault, J.P.,
Pitteri, S., Samuel, G., Pichon, G., Lemaire, J., Delort, A.M., 2010. Comparison of
the biodegradability of various polyethylene films containing pro-oxidant additives.
Polym. Degrad. Stab. 95, 1011–1021. doi:10.1016/j.polymdegradstab.2010.03.009.
Garlotta, D., 2002. A literature review of poly (lactic acid). J. Polym. Environ. 9, 63–84.
doi:10.1023/A:1020200822435.
Ge, J., Huang, G., Huang, J., Zeng, J., Han, L., 2016. Particle-scale modeling of methane
emission during pig manure/wheat straw aerobic composting. Environ. Sci. Technol.
50, 4374–4383. doi:10.1021/acs.est.5b04141.
Gómez, E.F., Michel, F.C., 2013. Biodegradability of conventional and bio-based
plastics and natural fiber composites during composting, anaerobic diges-
tion and long-term soil incubation. Polym. Degrad. Stab. 98, 2583–2591.
doi:10.1016/j.polymdegradstab.2013.09.018.
Gu, J.D., 2003. Microbiological deterioration and degradation of synthetic poly-
meric materials: recent research advances. Int. Biodeterior. Biodegrad. 52, 69–91.
doi:10.1016/S0964-8305(02)00177-4.
Janczak, K., Dąbrowska, G.B., Raszkowska-Kaczor, A., Kaczor, D., Hrynkiewicz, K.,
Richert, A., 2020. Biodegradation of the plastics PLA and PET in cultivated soil
with the participation of microorganisms and plants. Int. Biodeterior. Biodegrad. 155.
doi:10.1016/j.ibiod.2020.105087.
Kalamdhad, A.S., Kazmi, A.A., 2009. Rotary drum composting of different organic waste
mixtures. Waste Manag. Res. 27, 129–137. doi:10.1177/0734242X08091865.
Kale, G., Auras, R., Singh, S.P., 2007a. Comparison of the degradability of poly(lactide)
packages in composting and ambient exposure conditions. Packag. Technol. Sci. 20,
49–70. doi:10.1002/pts.742.
Kale, G., Auras, R., Singh, S.P., Narayan, R., 2007b. Biodegradability of polylactide
bottles in real and simulated composting conditions. Polym. Test. 26, 1049–1061.
doi:10.1016/j.polymertesting.2007.07.006.
Kale, G., Kijchavengkul, T., Auras, R., Rubino, M., Selke, S.E., Singh, S.P., 2007c. Com-
postability of bioplastic packaging materials: an overview. Macromol. Biosci. 7, 255–
277. doi:10.1002/mabi.200600168.
Kalita, N.K., Bhasney, S.M., Kalamdhad, A., Katiyar, V., 2020a. Biodegradable kinetics and
behavior of bio-based polyblends under simulated aerobic composting conditions. J.
Environ. Manag. 261, 110211. doi:10.1016/j.jenvman.2020.110211.
Kalita, N.K., Bhasney, S.M., Mudenur, C., Kalamdhad, A., Katiyar, V., 2020b. End-
of-life evaluation and biodegradation of Poly(lactic acid) (PLA)/Polycaprolactone
(PCL)/Microcrystalline cellulose (MCC) polyblends under composting conditions.
Chemosphere 247, 125875. doi:10.1016/j.chemosphere.2020.125875.
Kalita, N.K., Nagar, M.K., Mudenur, C., Kalamdhad, A., Katiyar, V., 2019. Biodegradation
of modified Poly(lactic acid) based biocomposite films under thermophilic composting
conditions. Polym. Test. 76, 522–536. doi:10.1016/j.polymertesting.2019.02.021.
Kijchavengkul, T., Auras, R., Rubino, M., Ngouajio, M., Fernandez, R.T., 2008.
Assessment of aliphatic-aromatic copolyester biodegradable mulch films.
Part II: laboratory simulated conditions. Chemosphere 71, 1607–1616.
doi:10.1016/j.chemosphere.2008.01.037.
Kijchavengkul, T., Auras, R., Rubino, M., Ngouajio, M., Thomas Fernandez, R.,
2006. Development of an automatic laboratory-scale respirometric sys-
tem to measure polymer biodegradability. Polym. Test. 25, 1006–1016.
doi:10.1016/j.polymertesting.2006.06.008.
Komilis, D.P., 2006. A kinetic analysis of solid waste composting at optimal conditions.
Waste Manag. 26, 82–91. doi:10.1016/j.wasman.2004.12.021.
Komilis, D.P., Ham, R.K., 2003. The effect of lignin and sugars to the
aerobic decomposition of solid wastes. Waste Manag. 23, 419–423.
doi:10.1016/S0956-053X(03)00062-X.
Kucharczyk, P., Pavelkova, A., Stloukal, P., Sedlarek, V., 2016. Degradation behaviour of
PLA-based polyesterurethanes under abiotic and biotic environments. Polym. Degrad.
Stab. 129, 222–230. doi:10.1016/j.polymdegradstab.2016.04.019.
Lee, S., 2002. Microstructure, tensile properties, and biodegradability of
aliphatic polyester/clay nanocomposites. Polym. Guildf 43, 2495–2500.
doi:10.1016/S0032-3861(02)00012-5.
Leejarkpai, T., Suwanmanee, U., Rudeekit, Y., Mungcharoen, T., 2011. Biodegradable ki-
netics of plastics under controlled composting conditions. Waste Manag. 31, 1153–
1161. doi:10.1016/j.wasman.2010.12.011.
Leja, K., Lewandowicz, G., 2010. Polymer biodegradation and biodegradable polymers -
a review. Polish J. Environ. Stud. 19, 255–266.
Lucas, N., Bienaime, C., Belloy, C., Queneudec, M., Silvestre, F., Nava-Saucedo, J.E., 2008.
Polymer biodegradation: mechanisms and estimation techniques - a review. Chemo-
sphere 73, 429–442. doi:10.1016/j.chemosphere.2008.06.064.
Luo, Y.B., Wang, X.L., Wang, Y.Z., 2012. Effect of TiO 2 nanoparticles on the long-
term hydrolytic degradation behavior of PLA. Polym. Degrad. Stab. 97, 721–728.
doi:10.1016/j.polymdegradstab.2012.02.011.
Narancic, T., Verstichel, S., Reddy Chaganti, S., Morales-Gamez, L., Kenny, S.T.,
De Wilde, B., Babu Padamati, R., O’Connor, K.E., 2018. Biodegradable Plastic
10
Environmental Challenges 3 (2021) 100030
blends create new possibilities for end-of-life management of plastics but they
are not a panacea for plastic pollution. Environ. Sci. Technol. 52, 10441–10452.
doi:10.1021/acs.est.8b02963.
Nieddu, E., Mazzucco, L., Gentile, P., Benko, T., Balbo, V., Mandrile, R., Ciardelli, G., 2009.
Preparation and biodegradation of clay composites of PLA. React. Funct. Polym. 69,
371–379. doi:10.1016/j.reactfunctpolym.2009.03.002.
Pal, A.K., Katiyar, V., 2016a. Nanoamphiphilic chitosan dispersed poly (lactic acid) bio-
nanocomposite films with improved thermal, mechanical, and gas barrier properties.
17, 8, 2603–2618. doi:10.1021/acs.biomac.6b00619.
Pal, A.K., Katiyar, V., 2016b. Thermal degradation behaviour of nanoamphiphilic chitosan
dispersed poly (lactic acid) bionanocomposite films. Int. J. Biol. Macromol. 95, 1267–
1279. doi:10.1016/j.ijbiomac.2016.11.024.
Pattanasuttichonlakul, W., Sombatsompop, N., Prapagdee, B., 2018. Accelerating
biodegradation of PLA using microbial consortium from dairy wastewater sludge
combined with PLA-degrading bacterium. Int. Biodeterior. Biodegrad. 132, 74–83.
doi:10.1016/j.ibiod.2018.05.014.
Petinakis, E., Liu, X., Yu, L., Way, C., Sangwan, P., Dean, K., Bateman, S., Edward, G.,
2010a. Biodegradation and thermal decomposition of poly(lactic acid)-based ma-
terials reinforced by hydrophilic fillers. Polym. Degrad. Stab. 95, 1704–1707.
doi:10.1016/j.polymdegradstab.2010.05.027.
Petinakis, E., Liu, X., Yu, L., Way, C., Sangwan, P., Dean, K., Bateman, S., Edward, G.,
2010b. Biodegradation and thermal decomposition of poly(lactic acid)-based ma-
terials reinforced by hydrophilic fillers. Polym. Degrad. Stab. 95, 1704–1707.
doi:10.1016/j.polymdegradstab.2010.05.027.
Picard, E., Espuche, E., Fulchiron, R., 2011. Effect of an organo-modified montmoril-
lonite on PLA crystallization and gas barrier properties. Appl. Clay Sci. 53, 58–65.
doi:10.1016/j.clay.2011.04.023.
Pradhan, R., Misra, M., Erickson, L., Mohanty, A., 2010a. Compostability and biodegra-
dation study of PLA-wheat straw and PLA-soy straw based green compos-
ites in simulated composting bioreactor. Bioresour. Technol. 101, 8489–8491.
doi:10.1016/j.biortech.2010.06.053.
Pradhan, R., Reddy, M., Diebel, W., Erickson, L., Misra, M., Mohanty, A., 2010b. Com-
parative compostability and biodegradation studies of various components of green
composites and their blends in simulated aerobic composting bioreactor. Int. J. Plast.
Technol. 14, 45–50. doi:10.1007/s12588-010-0009-z.
Qi, X., Ren, Y., Wang, X., 2017. New advances in the biodegradation of Poly(lactic) acid.
Int. Biodeterior. Biodegrad. 117, 215–223. doi:10.1016/j.ibiod.2017.01.010.
Rudeekit, Y., Numnoi, J., Tajan, M., Chaiwutthinan, P., Leejarkpai, T., 2008. Determining
biodegradability of polylactic acid under different environments. J. Met. Mater. Miner.
18, 83–87.
Shah, A.A., Hasan, F., Hameed, A., Ahmed, S., 2008. Biological degrada-
tion of plastics: a comprehensive review. Biotechnol. Adv. 26, 246–265.
doi:10.1016/j.biotechadv.2007.12.005.
Sikorska, W., Musiol, M., Nowak, B., Pajak, J., Labuzek, S., Kowalczuk, M., Adamus, G.,
2015. Degradability of polylactide and its blend with poly[(R,S)-3-hydroxybutyrate]
in industrial composting and compost extract. Int. Biodeterior. Biodegrad. 101, 32–41.
doi:10.1016/j.ibiod.2015.03.021.
Stloukal, P., Kalendova, A., Mattausch, H., Laske, S., Holzer, C., Koutny, M.,
2015a. The influence of a hydrolysis-inhibiting additive on the degradation
and biodegradation of PLA and its nanocomposites. Polym. Test. 41, 124–132.
doi:10.1016/j.polymertesting.2014.10.015.
Stloukal, P., Pekarovs, S., Kalendova, A., Mattausch, H., Laske, S., Holzer, C., Chitu, L.,
Bodner, S., Maier, G., Slouf, M., Koutny, M., 2015b. Kinetics and mechanism of the
biodegradation of PLA/clay nanocomposites during thermophilic phase of composting
process. Waste Manag. 42, 31–40. doi:10.1016/j.wasman.2015.04.006.
Torres, A., Li, S.M., Roussos, S., Vert, M., 1999. Microbial degradation of a poly(lactic
acid) as a model of synthetic polymer degradation mechanisms in outdoor conditions
218–226. doi:10.1021/bk-1999-0723.ch014.
Tripathi, N., Katiyar, V., 2017. Poly (lactic acid)/ modified gum Arabic based bionanocom-
posite films: thermal degradation kinetics. 57, 11, 1193–1206. doi:10.1002/pen.
Tripathi, N., Katiyar, V., 2016. PLA / functionalized-gum Arabic based bionanocomposite
films for high gas barrier applications 43458, 1–8. doi:10.1002/app.43458.
Valapa, R.B., Pugazhenthi, G., Katiyar, V., 2015. Effect of graphene content on
the properties of poly (lactic acid) nanocomposites. RSC Adv. 5, 28410–28423.
doi:10.1039/C4RA15669B.
Varma, V.S., Kalamdhad, A.S., 2014. Stability and microbial community analysis during
rotary drum composting of vegetable waste. 3, 52. doi: 10.1007/s40093-014-0052-4
Walczak, M., Swiontek Brzezinska, M., Sionkowska, A., Michalska, M., Jankiewicz, U.,
Deja-Sikora, E., 2015. Biofilm formation on the surface of polylactide during its
biodegradation in different environments. Colloids Surf. B Biointerfaces 136, 340–
345. doi:10.1016/j.colsurfb.2015.09.036.
Weng, Y.X., Wang, L., Zhang, M., Wang, X.L., Wang, Y.Z., 2013. Biodegradation behav-
ior of P(3HB,4HB)/PLA blends in real soil environments. Polym. Test. 32, 60–70.
doi:10.1016/j.polymertesting.2012.09.014.
Zenkiewicz, M., Malinowski, R., Rytlewski, P., Richert, A., Sikorska, W., Kra-
sowska, K., 2012. Some composting and biodegradation effects of physi-
cally or chemically crosslinked poly(lactic acid). Polym. Test. 31, 83–92.
doi:10.1016/j.polymertesting.2011.09.012.