Biology

Class: 11
Unit: 1
1. The branch of biology, which deals with the life process,
and function of processes is known as:
A. Physiology B. Pathology C. Histology D. Evolution
2. Discovered the microscopic creature under microscope in
the red blood cells of malarial patient:
A. Ronald Ross B. Laveran C. Grassy D. A.F.A king
3. Physical basis of life is:
A. Nucleotide and proteins B. Nucleus C. Cell D. Protoplasm
4. The life was evolved first:
A. On earth B. In water C. In sky D. On the hill
5. The ________ structure was first proposed by Robertson:
A. Cellulo-protein B. Star protein C. Cylo protein D. Lipo
protein
6. Opening and closing of stomata is controlled by which of
the following taking place in the guard cells?
A. Turbidity B. Turgidity C. C. Flaccidity D. Turgor Force
7. If the eyepiece of a microscope is marked 10X and the high
power objective is marked 44X, the total magnification is:
A. 100 B. 144 C. 440 D. 1044
8. Which one of the following areas of biological study could
produce evidence to prove conclusively that two organisms
belong to the same species?
A. Anatomy B. Embryology C. Genetics D. Physiology
9. _________ is a science of exception:
A. Biology B. Zoology C. Botany D. Pathology
10. The branch of biology, which deals with the continuous
adaptation of living organisms to their environment, is known
as:
A. Adaptation B. Evolution C. Similarity D. Genetics
11. Palaeobotany is study of:
A. Living plants B. Dead plants C. Fossil plants D. Fossil animas
12. The word Biology has been derived from _________
language.
A. English B. Latin C. Greek D. French
13. The name malaria is a combination of two _________
words.
A. Italian B. Latin C. English D. French
14. It is currently estimated that the age of the earth is about:
A. 1 billion years B. 4 billion years C. 1 light year D. 100 billion
years
15. An educated guess is known as ______.
A. Hypothesis B. Theory C. Statement D. Problem
 Biology
Class: 11
Unit: 2
1. If one ribose molecule were bonded to one adenine
molecule and one Phosphate molecule, we would have a
A. Ribosome B. Nucleotide C. Nucleic acid D. ATP E. ADP
2. An organic compound in which hydrogen and oxygen are
present in the same ratio as in water is
A. Fat B. Carbohydrate C. Protein D. Nucleic acid E. All of the
above
3. Deficiency of vitamin A causes
A. Rickets B. Osteomalacia C. Delay in coagulation of blood D.
Night blindness E. Anemia
4. Steroids consist of _______ 6-membred carbon rings and
one 5-membred carbon ring.
A. Four B. Three C. Two D. Five E. Six
5. What occurs when sucrose is broken down to
monosaccharides?
A. reducing sugars and releasing water B. condensation of
reducing sugars using water C. hydrolysis, releasing reducing
sugars and releasing water D. hydrolysis, releasing reducing
sugars and using water
6. The structure of a lipid contains all of the following EXCEPT:
A. A carboxyl group B. A CH2O basic structure C. A glycerol
molecule D. A fatty acid molecule E. An OH group
7. Stearin (C57 H10 O6) is an important example of:
A. Carbohydrates B. Proteins C. Waxes D. Acylglycerol E.
Nucleic Acids
8. The above diagram represents the process of:
A. Hydrolysis B. Condensation C. Neutralization D. Metabolism
9. Sugar in stored in the liver as:
A. Starch B. Glycogen C. Maltose D. Cellulose
10. Which of the following is correct:
A. Glucose + fructose = maltose B. Glucose + galactose =
sucrose C. Glucose + glucose = maltose D. Glucose + glucose =
sucrose
11. Polysaccharides are synthesized in plants by the process of
A. Hydrolysis B. Oxidation C. Condensation D. Glycolysis
12. Which one of the following is not immediately essential
for protein synthesis?
A. ATF B. Enzyme C. Glucose D. mRNA
13. The bond present between carbohydrate units
A. Peptide bond B. Covalent bond C. Glycosidic bond
D. Electrostatic bond
14. A lipid molecule is composed of glycerol fatty acid in a
ratio of:
A. 1:1 B. 1:3 C. 1:4 D. 1:2
15. The formula of glyceraldehyde is:
A. C3H6O4 B. C3H6O3 C. C6H12O6 D. C6H14O7
16. In AMYLOPECTIN the linkage is:
A. 1.3 B. 1.6 C. 2.6 D. 6.6
A. C12H35COOH B. (C6H10O5) n
C. C708H1130O224N180S4P4 D. C12H22O11
18. Assuming that only 20 commonest amino acids are
present in a given organism, how many different dipeptides
might theoretically be found in it?
A. 20 B. 40 C. 100 D. 400
19. Why do proteins have a buffering effect in cells?
A. They are non - polar B. They are amphoteric C. They
contain basic amino acids
D. They are a major component of cell surface membranes
20. The most abundant component of a living cell is
A. Carbohydrates B. Proteins C. Lipids D. Water
21. Which of the following are true:
A. glucose + fructose = maltose B. glucose + galactose =
sucrose C. glucose + glucose = maltose
D. glucose + glucose = sucrose
22. Which of the following molecules contain amino acids?
A. Ascorbic acid B. Cellulose C. Collagen D. Glycogen
23. The _________ structure was first proposed by Robertson:
A. Cellulo-protein B. Star protein C. Cyto protein
D. Lipoprotein
24. The distinctive characteristic and functional group of fats
is:
A. Ketone B. Alcohol C. Peptide D. Ester
25. Lipids are different types simple lipids include, natural
fats, and oils and:
A. Waxes B. Sterols C. Lipids D. Cholesterols
26. Cellulose is:
A. Disaccharide B. Pentose Polysaccharide C. Hexane
Polysaccharide D. Mucopolysaccharide
27. Which of the following is not made up of hexose sugar
subunits:
A. Sucrose B. Starch C. Glycogen D. Insulin
28. How many carbon atoms are found in monosaccharide
compound?
A. 1 to 5 Carbon atoms B. 3 to 6 Carbon atoms
C. 5 to 10 Carbon atoms D. 5 to 15 Carbon atoms
29. What is general formula of Carbohydrates?
A. Cn H2n On B. C2n Hn On C. Cn H2n O2n D. None of these
30. Polysaccharides of two types, storage polysaccharides
and:
A. Structural polysaccharides B. Amino polysaccharides
C. Functional polysaccharides D. Cellulosic polysaccharides
31. The test of reducing sugars can be done by using:
A. Cu+2 ions B. Cu+ ions C. Hg+ ions D. None of the above
32. Regarding starch molecule which statement is correct?
A. Amylase chain of starch is branched, amylopectin is not
branched B. Amylopectin chain is branched, amylose is not
17. Which of the following organic compounds represents a
protein?
33. Assuming that only 20 commonest amino acids are
present in a given organism, how many different dipeptides
might theoretically be found in it?
A. 20 B. 40 C. 100 D. 400 E. 10
34. Which of the following has quaternary structure;
A. Myoglobin B. Actin C. Tropomyosin D. Hemoglobin
35. In a typical nucleotide the nitrogenous base is attached to
_________ carbon of pentose sugar:
A. 6 th B. 5 th C. 4 th D. 3 rd E. 1 st
36. Lysosomes function in:
A. Protein synthesis B. Processing C. Intracellular digestion
D. Lipid synthesis E. Carbohydrate synthesis
37. Steroids consist of _______ 6-membred carbon rings and
one 5-membred carbon ring.
A. Four B. Three C. Two D. Five E. Six
38. Which type of protein structure contains the three
dimensional structure?
A. primary B. secondary C. tertiary D. quaternary
39. Which one of the following combinations of statements is
true of saccharides in living organisms? They provide energy
They form storage compounds They form supporting
structures
A. No No Yes B. No No No C. Yes No No D. Yes Yes No
E. Yes Yes Yes
40. The diagram shows a molecule. H H | O N C C H | OH H C
H | H Which substance might include the above molecule?
A. Cellulose B. Serine C. Glucose D. Alanine
41. Listed below are some amino acids and their
corresponding mRNA triplets. amino acid mRNA triplet
phenylalanine UUU lysine AAG arginine CGA alanine GCA
Which DNA sequence would be needed to produce the
polypeptide sequence alanine - arginine - lysine -
phenylalanine?
A. CGT GCT TTC AAA
B. CGT GCT TTC TTT
C. CGU GCU UUC AAA
D. CGU GCU UUC TTT E. GCT CGT TTC AAA
42. Which of the following process is reverse of
condensation?
A. Hydrolysis B. Dehydration synthesis C. Polymerization
D. Vaporization
43. The disease night blindness is caused by deficiency of
vitamin:
A. A
B. В
C. С
D. D
44. Micronutrient in abiotic components is
A. Carbon B. Hydrogen C. Potassium D. Iron E. All of the above
45. Ribose and ribulose are the example of ________ class.
branched C. Both chains are branched
D. Both chains are unbranched
1. 1. Which is true about Turpentine oil:
A.it is lipid B. terpenoid C.obtained from plants D. all of these
2. Lipids found in our body as:
A. triglyceride B. phospholipid C. cholesterol D. all of these
3. What is the base of steroid?
A. cholesterol B. protein C. lipids D. carbohydrates
4. What is not true about Hemoglobin?
A. it is globular protein B. it has secondary level of protein
structure
C. it is functional protein D. it is a dimmer
5.The cytosol is not:
A. plasma gel B. liquid matrix of cytoplasm C. pure organic
D. organic and inorganic
6. The second most abundant organic molecule of a cell is:
A. water B. proteins C. carbohydrates D. lipids
7. During the digestion of starch:
A. H2O is produced B. H2O is consumed C. CO2 produced
D. CO2 consumed
8. The H of water produced during peptide bond formation
comes from:
A. amino group B. carboxyl group C. α-carbon D. sometimes
from amino group and sometimes from carboxyl group
9. Which one is more sweet in taste?
A. glucose B. fructose C. lactose D. maltose
10. The pyransoe ring of glucose in water is produced
between carbon numbers:
A. 1and 2 B. 1 and 4 C. 1 and 5 D. 1 and 6
11. Pick-out the odd one out:
A .maltose B. galactose C. glucose D. fructose
12. Which of the following atoms is found in protein?
a. S b. F c. Mg d. P
13. The next to simplest amino acid is:
a. alanine b. lysine c. glycine d. aspartic acid
14. The final product of hydrolysis of protein is:
a. CO2 and H2O b. Peptones c. Polypeptides d. Amino acids
15. Formation of Glycogen is a type of:
a. hydration synthesis b. dehydration synthesis
c. hydration analysis d. dehydration analysis
16. Which one is a nucleotide?
a. DNA b. NAD c. AMP d. NADP
17. dAMP is a constituent of:
a. tRNA b. DNA c. mRNA d .rRNA
18. Adenosine comprises:
a. adenine and phosphate b. adenine and phospholipids
c. adenine and sugar d. adenine and tyrosine
19. Which one of the following is not a pure carbohydrate?
a. cellulose b. hemicellulose c. chitin d. glycogen
20. The richest source of energy is:
a. glucose b. fructose c. fats d. proteins
21. Examples of structural lipids are:
A. Triose B. Tetrose C. Pentose D. Hexose:
a. choline b. ethanol amino c. serine d. all of these
24. The viscosity of protoplasm is comparable with that of:
a. glycerol b. glycerine c. light machine oil d. all of these
25. The property of contraction and relaxation of cytoplasm is
attributable to special type of:
a. carbohydrates b. lipids c. proteins d.nucleic acids
26. Amount of water in living cells varies from:
a. 75 – 89 b. 70 – 89 c. 60 – 89 d.65 – 89
27. Histones are:
a. single protein b. different kinds of proteins c. conjugated
molecules d. carbohydrates
28. 3-D protems are due to:
a. primary structure b. tertiary structure c. secondary
structure d. both primary and secondary structure
29. Primary product of photosynthesis:
a. carbohydrates b. proteins c. lipids d. nucleotides
30. Total number of amino acids in insulin is:
a. 61 b. 41 c. 71 d. 51
31. Amino acids of hemoglobin are arranged in dimmers, each
dimer with:
a. 574 amino acids b. 287 amino acids c. 141 amino acids d.
146 amino acids
32. A chain containing two amino acids is known as:
a. dipeptide b. peptide c. aminopeptide d. diamino
33. The simplest amino acid is:
a. alanine b. lysine c. glycine d. aspartic acid
34. The essential amino acid means:
a. formed with in the body b. enter from outside the body c.
can change from one to another kind of amino acid d. 20
kinds of amino acids
35. The simplest fatty acid is:
a. acetic acid b. butyric acid c. palmatic acid d. oleic acid
36. The Nucleotide with single ring is:
a. adenine b. guanine c. cytosine d. both a and b
37. Histone present in:
a. DNA b. RNA c. chromosome d. glycolipids
38. Number of Nucleotides in A TP:
a. 1 b. 2 c. 3 d. 4
39. Most diverse macromolecules in a cell:
a. carbohydrate b. protein c. lipid d. DNA
40. Isoprenoid unit has no:
a. N b. P c. O d. All of these
41. Number of Nucleotides in NADP:
a. 1 b. 2 c. 3 d. 4
42. Which one is conjugated molecule?
a. protein b. carbohydrate c. glycoprotein d. lipid
43. Amylopectin not abundant in:
a. wheat b. maize c. both a and b d. pulses
a. phospholipids b. glycolipid c. sterols d. all of these
22. Which one is disaccharide?
a. glucose b. fructose c. galactose d. lactose
23. Which is nitrogen base?
47. What is unique of DNA?
a. replication b. organic c. has n bases d. all of these
48. Reverse of Dehydration synthesis is:
A. hydrolysis b. oxidation c. reduction d. oxidation-reduction
49. Phospholipids are:
a. polar b. non-polar c. polar on one end and non-polar on the
other end d. sometimes polar and sometimes non polar
50. Collagen is protein 'and:
a. trimer b. dimmer c. monomer d. tripeptide
51. Glycerol is the backbone molecule for:
a. disacchardies b. DNA c. triglycerides d. ATP
52. All the information for the structure and functioning of a
cell is stored in:
a. DNA b. tRNA c. mRNA d. rRNA
53. Basic unit of DNA is:
a. nucleotide b. amino acid c. nucleic acid d. double helix
54. Second most abundant compound in living organisms is:
a. protein b. lipids c. DNA d. carbohydrate
55. Tetroses are rare in nature and occur in:
a. some bacteria b. few bacteria c. Bacteria d. most bacteria
56. Evaporation of only two ml out of one liter of water
lowers the temperature of the remaining 998 ml by
__________ oC.
a. 0.01 b. 0.1 c. 1.0 d. 2.0
57. Which of the following atoms is not found in protein?
a. C b. O c. H d. P
58. Generally all the organic compounds contain the
elements:
a. iron and oxygen b. carbon and oxygen c. carbon and
hydrogen d. carbon and nitrogen
59. Potential source of energy for cell activities:
a. C – H b. H – H c. C – O – C d. C – C
60. At 25° C the concentration each of H+ and OH ions in pure
water is about:
a. 10 –7 ml/litre b. 10 –7 mole/litre
c. 10 –7 mg/litre d. 10 –7 moles/m
Answers:
1 D 2 D 3 A 4 B 5 C 6 C 7 B 8 A 9 B 10 C 11 A 12. A 13 A 14 D 15
C 16 C 17 B 18 C 19 B 20 C 21 D 22 D 23 D 24 D 25 C 26 D 27 B
28 C 29 A 30 D 31 C 32 A 33 C 34. B 35 A 36 C 37 C 38 A 39 B
40 D 41 B 42 C 43 D 44 B 45 D 46 C 47 A 48 A 49 C 50 A 51 C
52 A 53 A 54 A 55 A 56. C 57 D 58 C 59 A 60 B
44. Fruit sugar is usually:
a. glucose b. fructose c. maltose d. lactose
45. Example of vitamin/nucleotide/coenzyme is:
a. FAD b. NAD c. NADP d. All of these
46. Base pairs in E. coli:
A. 4288 b. 14000 c. 4639221 d. Four
1. A chromosome with unequal length of its arms is called: a.
metacentric b. sub metacentric c. acrocentric d. telocentric
2. What was the number of wild type flies in F2 generation of
Morgan’s experiment?
a. 728 b. 1550 c. 3470 d. 4252
3. In Hershey and Chase experiment 32p labeled
bacteriophages allowed to infect the bacteria. During analysis
32p activity was detected:
in culture medium on the surface of bacterial cell inside the
bacterial cell both the surface and inside of bacterial cell
4. In Meselson and Stahl experiment, the DNA from sample at
20 minutes, after start of experiment (labeling) made
sediments at the:
a. top b. intermediate c. bottom d. top-and intermediate
5. Sickle cell anemia is the example of _________ type of
mutation.
a. transposition b. deletion c. insertion d. base substitution
6. Which of the following act as a stop codon?
a. UGG b. UGC c. UAG d. UGU
7. In mitochondria UGA codon act to specify _________
instead stop codon.
a. arginine b. valine c. glutamic acid d. trytophan
8. If the amount of adenine in ONA of a bacterial cell is 36 of
the total nitrogenous bases. What will be the amount of
guanine in the DNA of a cell in next generation?
a. 14 % b. 28 % c. 36 % d. 64 %
9. If a mRNA is synthesized with all the different codons, what
is the minimum number of amino acids in the protein that is
formed by mRNA:
a. 64 amino acids b. 62 amino acids
c. 60 amino acids d. 61 A.A
10. In eukaryotic mRNA molecule there are 90 nucleotide
involved in translation process. What is the number of amino
acid in the protein formed by this mRNA molecule?
a. 29 amino acids b. 30 amino acids
c. 45 amino acids d. 90 amino acids
11. The complementary mRNA triplet for the DNA triplet GAT
would read:
a. CAT b. CUA c. CTG d. TAG
12. The two-pyrimidine bases most commonly found in DNA
are:
a. cytosine and thiamine b. cytosine and uracil
c. adenine and thymine d. cytosine and thymine
14. It has been established that, in many cells, ribosomes
occur in chains along mRNA molecules. What is the advantage
the bases would be adenine:
a. 5 % b. 10 % c. 20 % d. 40 %
16. A synthetic mRNA molecule is made by using only two
types of nucleotide, containing adenine and cytosine. How
many different codons could it contains?
a. 6 b. 4 c. 8 d. 16
17. A protein includes 17 of the 20 different amino acids
commonly occurring in proteins, what is the minimum
number of different kinds of tRNA molecules involved in the
synthesis of this protein:
a. 17 b. 51 c. 20 d. 102
18. If the nucleus of a -human motor neuron contains 6.8
picograms (pg) of DNA, what mass of DNA is in the nucleus of
an actively dividing human skin cell likely to contain at the end
of interphase?
a. 3.4 pg b. 13.6 pg c. 6.8 pg d. 20.4 pg
19. What is the action of the enzyme DNA ligase?
a. DNA is broken up at specific sites
b. DNA Fragments are joined together
c. DNA Replication occur d. DNA Transcription Occur
20. mRNA codon for the amino acid alanine is GCC. How many
alanine molecules are present in the polypeptide, containing 8
amino acids coded for by the following DNA template:
TCGGCCTACCGGGCCCATGCCAAT zero one two three
21. During DNA replication, lagging strand is formed by:
a. P 1 b. P II c. P III d. All of these
22. Genetic code for Glycine is:
a. GGU b. UAG c. UGA d. AUG
23. RNA Polymerases in Prokaryotes are of:
a. one type b. two type c. four type c. three type
24. In RNA nucleotides are attached by:
a. peptide bonds b. phosphodies ter bond
c. hydrogen bond d. covalent bond
25. Most amino acids are identified by:
a. one codon b. more than one codons c. two codons d. three
codons 26. The basic unit of heredity is:
a. DNA b. Replication c. Codon d. Gene
27. Okazaki fragments are formed in:
a. leading strand b. lagging strand
c. transcription d. translation
28. The addition of a few bases in a gene is:
a. point mutation b. transposition c.. deletion d. inversion
29. The tail of mRNA of eukaryotic cells is protected by:
a. poly a b. 7 methyl gtp c. four or more u d. 7 methyl atp
30. Each okazaki fragment is synthesized by DNA:
a. polymerase I b. polymerase II c. polymerase III d. primase
of this arrangement when compared with a situation in which 31. Down's syndrome is due to:
ribosomes occur singly? a. an extra X chromosome b. an extra autosome
a. a greater variety of polypeptides can be produced c. a missing X chromosome d. a missing autosome
b. fewer tRNA molecules are used in protein synthesis 32. The' replication of DNA in a semi conservative manner was
c. larger number of polypeptides can be produced practically demonstrated in 1958 by Mathew Meselson and:
d. polypeptides can be produced more rapidly a. Rosalind b. Franklin Stahl c .Maurice Wilkins d. Griffith
15. Biochemical analysis of a sample of DNA showed that 40
of the nitrogenous bases was cytosine, what percentage of d. Charles Darwin
33. The chromosome is: 51. First evidence that genes reside on the chromosomes was
a. gene b. genes + protein c. gene + protein d. DNA + genes presented by:
34. Gene action in neurospora was studied by: a. Sutton b. Morgan c. Correns d. Mendel
a. beadle and best b. baddle and tatum 52. DNA was first discovered by:
c. beadle and tatum d. banting and tatum a. Alfred Hershey b. Martha Cahse c. J.W. Watson d. Friedrich
35. The one gene one enzyme explanation of gene action was Miesche
developed by: Answers:
a. Morgans and Muller b. Beadle and Best
c. Beadle and Tatum d. Banting and Tatum 1 B 2 C 3 C 4 C 5 D 6 C 7 D 8 A 9 D 10 A 11 B 12. D 13 B 14 D 15
36. The only difference between the normal and sickle cell B 16 C 17 D 18 * 19 A 20 C 21 B 22 B 23 D 24 A 25 A 26 B 27 B
hemoglobin is that at one place in the chain of amino acids 28 D 29 B 30 A 31 A 32 C 33 B 34. B 35 C 36 B 37 C 38 D 39 D
glutamic acid, in the latter, is replaced by: 40 B 41 C 42 C 43 B 44 D 45 B 46 A 47 B 48 A 49 C 50 D 51 A 52
a. histidine b. leucine c. proline d. valine A
37. The existing of familial diseases was first proposed by:
a. Archibald Garrot b. William Bateson
c. G.W Beadle d. both a and b
38. The DNA strands open up at the place where enzyme is
attached to the template strand forming:
a. rRNA b. Transcription bubble c. mRNA d. tRNA
39. At the time of DNA replication, the primer is recognized
by:
a. DNA polymerase I b. DNA polymerase II c. DNA polymerase
III d. any of them
40. RNA Polymerases in Eukaryotes are of:
a. one type b. two type c. three type d. four type
41. The basic monomers used in DNA replication are:
a. glucose b. DNA nucleotides c. fatty acids d. amino acids
42. To make a karyotype, chromosomes are photographed
during:
a. meiosis b. interphase c. fertilization d. mitosis
43. When a mutation is limited to the substitution of one
nucleotide pair for another, it is called a:
a. translocation point b. mutation c. inversion d. deletion
44. The creation of Mutations is called:
a. mutagenesis b. evolution c. development d. mutagens
45. Which mutations have evolutionary importance?
a. in blood cell b. in germ line cells
c. in stem cells d. in somatic cells
46. During translation, peptide bond is formed in the initiation
complex of ribosome at:
a. P site b. A site c. E site d. Any of them
47. Garrod investigated that in the disease alkaptonuria, the
patient produces urine containing:
a. uric acid b. gentisic acid
c. homogentisic acid d. heterogentisic acid
48. The length of a strand of DNA from a single human
chromosome is about:
a. 5 mµ b. 5 mm c. 5 mµ d. 5 cm
49. In phosphodiester, phosphate is linked to two sugars by
means of a pair of ester bonds which are:
a. P – O – C b. C – O – C c. N – H d. C – N
50. Mendel's work was rediscovered by:
a. Karl Correns b. Walter Sutton c. Thomas Hunt Morgan