12th Bio Botany EM WWW - Tntextbooks.in

www.tntextbooks.
in
GOVERNMENT OF TAMIL NADU
BIOLOGY
BOTANY
HIGHER SECONDARY SECOND YEAR
Untouchability is Inhuman and a Crime

A publication under Free Textbook Programme of Government of Tamil Nadu
Department of School Education
TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 1 3/14/2020 12:34:30 PM

www.tntextbooks.in
Government of Tamil Nadu

First Edition - 2019
Revised Edition - 2020
(Published under New Syllabus)
NOT FOR SALE
Content Creation
The wise
possess all
State Council of Educational

Research and Training
© SCERT 2019
Printing & Publishing
Tamil NaduTextbook and Educational

Services Corporation
www.textbooksonline.tn.nic.in
II

www.tntextbooks.in
CONTENTS
BIOLOGY: BOTANY
UNIT VI: Reproduction in Plants

Chapter 1 Asexual and Sexual Reproduction in Plants 1 June
UNIT VII: Genetics
Chapter 2 Classical Genetics 31 July
Chapter 3 Chromosomal Basis of Inheritance 50 August
UNIT VIII: Biotechnology
Chapter 4 Principles and Processes of Biotechnology 68 August
Chapter 5 Plant Tissue Culture 96 September
UNIT IX: Plant Ecology
Chapter 6 Principles of Ecology 109 October
Chapter 7 Ecosystem 134 October
Chapter 8 Environmental Issues 155 November
UNIT X: Economic Botany
Chapter 9 Plant Breeding 171 November
Chapter 10 Economically Useful 185
December
Plants and Entrepreneurial Botany
Annexure
References 204
English – Tamil Terminology 206
Competitive Examination Questions 209
Botany Practicals 223
E-book Assessment DIGI links

Lets use the QR code in the text books ! How ?
• Download the QR code scanner from the Google PlayStore/ Apple App Store into your smartphone
• Open the QR code scanner application
• Once the scanner button in the application is clicked, camera opens and then bring it closer to the QR code in the text book.
• Once the camera detects the QR code, a url appears in the screen.Click the url and goto the content page.
III

www.tntextbooks.in
Career corner List of professions related to the subject
Learning objectives are brief statements that describe what

Learning Objectives: students will be expected to learn by the end of school year,
course, unit, lesson or class period.
Chapter Outline Illustrate the complete overview of chapter
Amazing facts, Rhetorical questions to lead students

to biological inquiry
Activity Directions are provided to students to conduct activities

in order to explore, enrich the concept.
Infographics Visual representation of the lesson to enrich learning .

HOW TO USE
THE BOOK Evaluation Assess students to pause, think and check their understanding
To motivate the students to further explore the content

digitally and take them in to virtual world
ICT To enhance digital Science skills among students
Conceptual diagram that depicts relationships between

Concept Map concepts to enable students to learn the content schematically
Glossary Explanation of scientific terms
Tamil terminology for Botanical terms given for easy

English - Tamil Terminology understanding
References List of related books for further details of the topic
Web links List of digital resources
Competitive
Model questions to face various competitive exams
Exam questions
IV

www.tntextbooks.in
Scope of Botany
Higher Studies and Career Opportunities
List of Medical Courses

8 B.O.T (Occupational Therapy) – 3 years
1 M. B. B. S. (Bachelor of Medicine and
The Occupational Therapy helps the
Bachelor of Surgery) – 5.5 years
people to enable in their everyday life
MBBS is the bachelor degree in medical and treats the emotionally and physically
field for cure & diagnose, awarded in challenged people.
many countries.
2 B. D. S. (Bachelor of Dental Surgery) – 4

years 9 B.U.M.S (Unani Medicine) – 5.5 years
BUMS degree is equivalent to the BAMS,
BDS is a professional degree programme
but in Unani medicines.
in dentistry.
Naturopathy & Yogic Science is one of
3 B. H. M. S. (Bachelor of Homeopathic the trusted fields after Allopathy in India.
Medicine & Surgery) – 5.5 years Duration: 4 Years

B HMS is a bachelor degree in
Homeopathic Education in India
regulated by the National Institute of 10 D.Pharm (Ayurvedic, Siddha Medicine)
Homeopathy. – 2 years
It is a medical diploma course in pharmacy
4 B. A. M. S. (Bachelor of Ayurvedic of ayurvedic medicines.
Medicine and Surgery) – 5.5 years
AMS is a bachelor degree in ayurvedic
B
system of medical field. In India, the BMLT (Bachelor of Medical Lab
11
Ayurvedic Education is regulated by Technicians) – 3 year
the Central Council of Indian Medicine
It is a bachelor degree of medical
(CCIM).
laboratory technology, contains the
B.Pharm (Bachelor of Pharmacy) – 4 entire laboratory practices of the
5
years medical system. Various institutions are
This degree involves the knowledge of offering the B.Sc. programme in medical
pharmacy. laboratory technology in India.
6 B.Sc Nursing – 4 years

The motive of B.Sc. Nursing programme 12 DMLT (Diploma of Medical Lab
is to produce the qualified nurses, as a Technicians) – 1 year
member of the health care team. It is a medical diploma course of medical
laboratory technology, contains the
7 B.P.T (Physiotherapy) – 4.5 years laboratory practices of the medical field.
Physiotherapy helps the temporary Candidate must have cleared the 10+2
disabled people in their rehabilitation. exam with PCB.
V

www.tntextbooks.in
Agricultural Courses Botany Career Opportunities and

 B.Sc in Agriculture Job Prospects
 B.Sc in Genetics and Plant Breeding
 B.Sc in Agriculture Economics and Farm The amount of diversity in the field of Botany
Management gives it students to choose their specializations
 B.Sc in Animal Husbandry as per their choice, aptitude and interests. One
 B.Sc in Fisheries can be a part of any reputed organization as a
 B.Sc in Forestry Plant explorer: Botanist with a passion for
 B.Sc Soil and water management plants who could be a photographer, writer,
 B.Sc in Horticulture expeditioner, etc
 B.Sc Agriculture and Food Business Conservationist: Is an individual who works
 M.Sc in Agronomy for the conservation of the environment and is
 M.Sc Agricultural Economics often linked to organisations working for the
 M.Sc Seed science and Technology cause.
 M.Sc Agricultural Entomology
 M.Sc Agricultural Statistics Ecologist: A person who works for the eco-
 Diploma in Agriculture system and a balanced environment.
Environment consultant: Some botanists
Various Botany courses qualify to work as environmental consultants,
 Bachelor of Science in Botany providing inputs and advice for the conservation
 Bachelor of Science (Hons) in Botany of the environment.
 Master of Science in Botany Horticulturist: A horticulturist knows the
 Master of Science in Botany and Forestry science behind different plants, flowers, and
 Master of Science in Applied Botany greenery. They conduct research in gardening
 Master of Science in Herbal Science and landscaping, plant propagation, crop
 Post Graduate Diploma in Medico botany production, plant breeding, genetic engineering,
 Post Graduate Diploma in Plant Biodiversity plant biochemistry, and plant physiology.
Specializations available for botany are: Plant biochemist: Biochemists study the
chemical and physical principles of living
 Cytology  Genetics
things and of biological processes, such as cell
 Lichenology  Economic botany
development, growth, heredity, and disease.
 Palynology  Palaeobotany
 Bryology  Ethnobotany Molecular biologist: Molecular biologists
conduct research and academic activities.
 Phycology Phytochemistry
The research component involves the study
 Forestry  Plant morphology
of biological structures in well-equipped
 Phytopathology  Plant anatomy
laboratories with advanced technology to help
 Plant physiology  Plant genetics them explore complex molecular structures
 Agronomy  Horticulture and their particular functions. The equipment
 Plant ecology  Plant systematic may include microscopes, lab centrifuges,
computers with specific software that allows
Veterinary Science
them to analyze obtained data, and many more.
Bachelor of Veterinary Science or B.V.Sc. is an
undergraduate program in veterinary
VI

www.tntextbooks.in
UNIT VI: Reproduction in Plants

Chapter
1 Asexual and Sexual

Reproduction in Plants
One of the essential features of all living things

Learning Objectives on the earth is reproduction. Reproduction is a
The learner will be able to vital process for the existence of a species and it
also brings suitable changes through variation in
Recall various types of reproduction in
the offsprings for their survival on earth. Plant
lower and higher organisms.
reproduction is important not only for its own
Discuss different methods of vegetative survival but also for the continuation and existence
reproduction in plants. of all other organisms since the latter directly or
Recognise modern methods of indirectly depend on plants. Reproduction also
reproduction. plays an important role in evolution.
Recall the parts of a flower. In this unit let us learn in detail about
Recognise the structure of mature reproduction in plants.
Basically reproduction occurring in
anther.
organisms fall under two major categories
Describe the structure and types of
1. Asexual reproduction
ovules.
2. Sexual reproduction.
Discuss the structure of embryo sac.
Recognise different types of pollination. Panchanan Maheswari (1904-1966)
Identify the types of endosperms. Professor P. Maheswari
Differentiate the structure of Dicot and was an eminent Botanist
Monocot seed. who specialised in plant
embryology, morphology
and anatomy. In 1934,
Chapter outline he became the Fellow
of Indian Academy of
1.1 Asexual reproduction Science. He published
1.2 Vegetative reproduction the book titled “An introduction to the
1.3 Sexual Reproduction Embryology of Angiosperms”in 1950. He
1.4 Pre-fertilization established the International Society for
structure and events Plant Morphologists, in 1951.
1.5 Fertilization 1.1 Asexual Reproduction
1.6 Post fertilization structure and events The reproduction method which helps
1.7 Apomixis to perpetuate its own species without the
1.8 Polyembryony involvement of gametes is referred to as asexual
1.9 Parthenocarpy reproduction. From Unit I of Class XI we
know that reproduction is one of the attributes
Asexual and Sexual Reproduction in Plants 1
TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 1 3/14/2020 10:29:58 AM

www.tntextbooks.in
of living things and the different types of

reproduction have also been discussed. Lower Scourge of water bodies /
plants, fungi and animals show different methods Water hyacinth (Eichhornia
of asexual reproduction. Some of the methods crassipes) is an invasive weed
include, formation of Conidia (Aspergillus on water bodies like ponds,
and Penicillium); Budding (Yeast and Hydra); lakes and reservoirs. It is popularly called
Fragmentation (Spirogyra); production of “Terror of Bengal”. It
Gemma (Marchantia); Regeneration (Planaria) spreads rapidly through
and Binary fission (Bacteria) (Refer chapter 1 of offsets all over the water
Unit I of class XI). The individuals formed by body and depletes the
this method is morphologically and genetically dissolved oxygen and
identical and are called clones. Higher plants causes death of other
also reproduce asexually by different methods aquatic organisms.
which are given below:
B. Vegetative reproduction in stem
1.2 Vegetative reproduction From the Unit 3 of class XI (Vegetative
1.2.1 Natural methods morphology) you are familiar with the structure
Natural vegetative reproduction is a form of of various underground stem and sub aerial stem
asexual reproduction in which a bud grows modifications. These include rhizome (Musa
and develops into a new plant. The buds may paradisiaca, Zingiber officinale and Curcuma
be formed in organs such as root, stem and longa); corm (Amorphophallus and Colocasia);
leaf. At some stage, the new plant gets detached tuber (Solanum tuberosum); bulb(Allium cepa
from the parent plant and starts to develop and Lilium) runner (Centella asiatica); stolon
into a new plant. Some of the organs involved (Mentha, and Fragaria); offset (Pistia, and
in the vegetative reproduction also serve as the Eichhornia); sucker (Chrysanthemum) and
organs of storage and perennation. The unit of bulbils (Dioscorea and Agave). The axillary buds
reproductive structure used in propagation is from the nodes of rhizome and eyes of tuber give
called reproductive propagules or diaspores. rise to new plants.
Some of the organs that help in vegetative C. Vegetative reproduction in leaf
reproduction are given in Figure 1.1.
In some plants adventitious buds are developed
A. Vegetative reproduction in root on their leaves. When they are detached
The roots of some plants develop vegetative or from the parent plant they grow into new
adventitious buds on them. Example Murraya, individual plants. Examples: Bryophyllum,
Dalbergia and Millingtonia. Some tuberous Scilla, and Begonia. In Bryophyllum, the
adventitious roots apart from developing buds leaf is succulent and notched on its margin.
also store food. Example Ipomoea batatus Adventious buds develop at these notches and
and Dahlia. Roots possessing buds become are called epiphyllous buds. They develop
detached from the parent plant and grow into into new plants forming a root system and
independent plant under suitable condition. become independent plants when the leaf gets
decayed. Scilla is a bulbous plant and grows
Activity in sandy soils. The foliage leaves are long and
Visit to a vegetable market and classify the narrow and epiphyllous buds develop at their
vegetables into root, stem or leaf based on tips. These buds develop into new plants when
their utility and identify how many of them they touch the soil.
can be propagated through asexual methods.
2 Asexual and Sexual Reproduction in Plants

www.tntextbooks.in
Murraya tree
Epiphyllous
young plant buds
growing from roots (f) Reproduction
by leaf
Bryophyllum
(a) Reproduction by roots – Murraya

Terminal bud
Node
Internode
(g) Runner
Centella asiatica
Runner
(b) Rhizome – Zingiber officinale
Terminal bud
(Daughter plant)
Root
Stolon
(c) Corm – Colocasia (h) Stolon
Fragaria
Offset
Bud from eye

(i) Offset
Pistia stratiotes
(d) Tuber – Solanum tuberosum
Fleshy scale leaf (j) Sucker

Axillary bud Chrysanthemum
Reduced stem
Adventitious roots Sucker
i) Tunicated – Allium cepa

(e) Bulb
Naked scale
leaves
Bulbil
(k) Axillary bulbils

Dioscorea bulbifera
ii) Naked – Lilium
Figure 1.1 a-k: Natural methods of vegetative reproduction in plants.

www.tntextbooks.in
Advantages of natural vegetative contact with the soil is called stock and the
reproduction plant used for grafting is called scion (Figure
• Only one parent is required for propagation. 1.2 a). Examples are Citrus, Mango and Apple.
• The new individual plants produced are There are different types of grafting based on the
genetically identical. method of uniting the scion and stock. They are
bud grafting, approach grafting, tongue grafting,
• In some plants, this enables to spread
crown grafting and wedge grafting.
rapidly. Example: Spinifex
• Horticulturists and farmers utilize these i. Bud grafting: A T- shaped incision is made
organs of natural vegetative reproduction in the stock and the bark is lifted. The scion bud
for cultivation and to harvest plants in with little wood is placed in the incision beneath
large scale. the bark and properly bandaged with a tape.
Disadvantage of natural vegetative ii. Approach grafting: In this method both

reproduction the scion and stock remain rooted. The stock
• New plants produced have no genetic is grown in a pot and it is brought close to
variation. the scion. Both of them should have the same
thickness. A small slice is cut from both and the
1.2.2 Artificial Methods
cut surfaces are brought near and tied together
Apart from the above mentioned natural methods
and held by a tape. After 1-4 weeks the tip of
of vegetative reproduction, a number of methods
the stock and base of the scion are cut off and
are used in agriculture and horticulture to
detached and grown in a separate pot.
propagate plants from their parts. Such methods
are said to be artificial propagation. Some of the iii. Tongue grafting
artificial propagation methods have been used by A scion and stock having the same thickness is
man for a long time and are called conventional cut obliquely and the scion is fit into the stock
methods. Now-a-days, technology is being used and bound with a tape.
for propagation to produce large number of plants iv. Crown grafting.
in a short period of time. Such methods are said When the stock is large in size scions are cut
to be modern methods. into wedge shape and are inserted on the slits
A. Conventional methods or clefts of the stock and fixed in position
The common methods of conventional using graft wax.
propagation are cutting, grafting and layering. v. Wedge grafting
a. Cutting: It is the method of producing a new In this method a slit is made in the stock or the
plant by cutting the plant parts such as root, stem bark is cut. A twig of scion is inserted and tightly
and leaf from the parent plant. The cut part is placed bound so that the cambium of the two is joined.
in a suitable medium for growth. It produces root
and grows into a new plant. Depending upon the Activity
part used it is called as root cutting (Malus), stem Visit a nursery, observe the method of
cutting (Hibiscus, Bougainvillea and Moringa) and grafting, layering and do these techniques
leaf cutting (Begonia, Bryophyllum). Stem cutting with plants growing in your school or home
is widely used for propagation.
c. Layering: In this method, the stem of
b.Grafting: In this, parts of two different plants
a parent plant is allowed to develop roots
are joined so that they continue to grow as one
while still intact. When the root develops,
plant. Of the two plants, the plant which is in

www.tntextbooks.in
‘T’
shaped Bud (Scion) Scion
insertion Stock Scion
Stock Stock
Stock Scion
(ii) Approach (iii) Tongue
(i) Bud grafting (iv) Crown grafting (v) Wedge grafting
grafting grafting
a) Types of Grafting
Figure 1.2(a): Artificial methods of vegetative reproduction in plants
the rooted part is cut and planted to grow as branches after 2-4 months. Such branches are
a new plant. Examples: Ixora and Jasminum. removed from the parent plant and grown in a
Mound layering and Air layering are few types separate pot or ground.
of layering (Figure 1.2 b). Advantages of conventional methods
i. Mound layering: This method is applied for • The plants produced are genetically uniform.
the plants having flexible branches. The lower
• Many plants can be produced quickly by
branch with leaves is bent to the ground and
this method.
part of the stem is buried in the soil and tip of
the branch is exposed above the soil. After the • Some plants produce little or no seeds;
roots emerge from the part of the stem buried in others, the seeds produced do not
in the soil, a cut is made in parent plant so that germinate. In such cases, plants can be
the buried part grow into a new plant. produced in a short period by this method.
• Some plants can be propagated more
economically by vegetative propagation.
Example: Solanum tuberosum.
• Two different plants with desirable
(i) Mound layering characters such as disease resistance and
high yield can be grafted and grown as a new
plant with the same desirable characters.
Disadvantages of conventional methods
• Use of virus infected plants as parents
Bark tissue Polythene
Moist soil tied to retain produces viral infected new plants.
removed
moisture
(ii) Air layering
• Vegetative structures used for propagation
are bulky and so they are difficult to handle
b) Types of Layering
and store.
Figure 1.2(b): Artificial methods of
vegetative reproduction in plants 1.3 Sexual Reproduction
In previous classes reproduction in lower plants
ii. Air layering: In this method the stem is
like algae and bryophytes was discussed in detail.
girdled at nodal region and hormones are
Sexual reproduction involves the production
applied to this region which promotes rooting.
and fusion of male and female gametes. The
This portion is covered with damp or moist soil
former is called gametogenesis and the latter
using a polythene sheet. Roots emerge in these

www.tntextbooks.in
is the process of fertilization. Let us recall the The structures and events involved in pre-
sexual reproduction in algae and bryophytes. fertilization are given below
They reproduce by the production of gametes
which may be motile or non motile depending 1.4.1 Male Reproductive part -
upon the species. The gametic fusion is of three Androecium
types (Isogamy, Anisogamy and Oogamy). In Androecium is made up of stamens. Each
algae external fertilization takes place whereas stamen possesses an anther and a filament.
in higher plants internal fertilization occurs. Anther bears pollen grains which represent
the male gametophyte. In this chapter we
Flower shall discuss the structure and development of
A flower is viewed in multidimensional anther in detail.
perspectives from time immemorial. It is an
Development of anther: A very young
inspirational tool for the poets. It is a decorative
anther develops as a homogenous mass of
material for all the celebrations. In Tamil
cells surrounded by an epidermis. During
literature the five lands are denoted by different
its development, the anther assumes a four-
flowers. The flags of some countries are
lobed structure. In each lobe, a row or a few
embedded with flowers. Flowers are used in the
rows of hypodermal cells becomes enlarged
preparation of perfumes. For a Morphologist,
with conspicuous nuclei. This functions as
a flower is a highly condensed shoot meant for
archesporium. The archesporial cells divide
reproduction. As you have already learned about
by periclinal divisions to form primary
the parts of a flower in Unit II of Class XI, let us
parietal cells towards the epidermis and
recall the parts of a flower. A Flower possesses
primary sporogenous cells towards the inner
four whorls- Calyx, Corolla, Androecium and
side of the anther. The primary parietal cells
Gynoecium. Androecium and Gynoecium
undergo a series of periclinal and anticlinal
are essential organs(Figure 1.3). The process
division and form 2-5 layers of anther walls
or changes involved in sexual reproduction of
composed of endothecium, middle layers and
higher plants include three stages .They are Pre-
tapetum, from periphery to centre.
fertilization, Fertilization and Post fertilization
Microsporogenesis: The stages involved
changes. Let us discuss these events in detail.
in the formation of haploid microspores from
Stigma diploid microspore mother cell through meiosis
Style is called Microsporogenesis. The primary
Stamen
sporogeneous cells directly, or may undergo
Petal
a few mitotic divisions to form sporogenous
tissue. The last generation of sporogenous tissue
Sepal
functions as microspore mother cells. Each
Ovary microspore mother cell divides meiotically
Ovule
to form a tetrad of four haploid microspores
Pedicel (microspore tetrad). Microspores soon separate
Figure 1.3 Parts of a Flower from one another and remain free in the anther
1.4 Pre-fertilization: structures locule and develop into pollen grains. The stages
in the development of microsporangia is given in
and events Figure 1.4. In some plants, all the microspores in
The hormonal and structural changes
a microsporangium remain held together called
in plant lead to the differentiation and
pollinium. Example: Calotropis. Pollinia are
development of floral primordium.

www.tntextbooks.in
Parietal cell
Archesporial Sporogenous cell
cell
(a) Anther primordium (b) Differentiation of (c) Formation of parietal and (d) Formation of wall layers
archesporial cell sporogenous cell
Epidermis
Epidermis Endothecium
Middle layers Middle layer
Tapetum Tapetum
Sporogenous cell Microspores
Pollen tetrad
Stomium
Connective
(e) Sporogenous stage (f) Pollen tetrad stage (g) Microspore stage
Connective
Epidermis
Endothecium Activity
Middle layer
Pollen grain Collect buds and opened flowers of Datura
Stomium metel. Dissect the stamens, separate the
anthers and take thin transverse sections and
observe the structure under the microscope.
Record the various stages of anther
development from your observations.
(h) Pollen grain stage
Figure 1.4 Stages in the Figure

development of anther
2.1 Development of anther (Microsporogenesis) Connective
Epidermis
attached to a clamp or clip like sticky structure
Endothecium
called corpusculum. The filamentous or thread Middle layer
like part arising from each pollinium is called Tapetum
Stomium
retinaculum. The whole structure looks like Pollen grain
inverted letter 'Y' and is called translator
T.S. of Mature anther
Transverse section of mature anther reveals
Diagrammatic view
the presence of anther cavity surrounded by an
anther wall. It is bilobed, each lobe having 2 theca
(dithecous). A typical anther is tetrasporangiate.
The T.S. of Mature anther is given in Figure 1.5.
1. Anther wall
View under microscope
The mature anther wall consists of the Figure 1.5 T.S of Mature anther
following layers a. Epidermis b. Endothecium b.Endothecium: It is generally a single layer
c. Middle layers d. Tapetum. of radially elongated cells found below the
a. Epidermis: It is single layered and protective epidermis. The inner tangential wall develops
in function. The cells undergo repeated bands (sometimes radial walls also) of α cellulose
anticlinal divisions to cope up with the rapidly (sometimes also slightly lignified). The cells are
enlarging internal tissues. hygroscopic. In the anthers of aquatic plants,

www.tntextbooks.in
saprophytes, cleistogamous flowers and extreme • The pollenkitt material is contributed by

parasites endothecial differentiation is absent. tapetal cells and is later transferred to the
The cells along the junction of the two sporangia pollen surface.
of an anther lobe lack these thickenings. This • Exine proteins responsible for ‘rejection
region is called stomium. This region along with reaction’ of the stigma are present in the
cavities of the exine. These proteins are
the hygroscopic nature of endothecium helps in
derived from tapetal cells.
the dehiscence of anther at maturity.
c. Middle layers: Two to three layers of
Many botanists speak of a
cells next to endothecium constitute middle third type of tapetum called
layers. They are generally ephemeral. They amoeboid, where the cell wall
disintegrate or get crushed during maturity. is not lost. The cells protrude
d. Tapetum: It is the innermost layer of anther into the anther cavity through an amoeboid
wall and attains its maximum development at the movement. This type is often associated with
tetrad stage of microsporogenesis. It is derived male sterility and should not be confused with
partly from the peripheral wall layer and partly periplasmodial type.
from the connective tissue of the anther lining
2. Anther Cavity : The anther cavity is filled with
the anther locule. Thus, the tapetum is dual in
microspores in young stages or with pollen grains
origin. It nourishes the developing sporogenous
at maturity. The meiotic division of microspore
tissue, microspore mother cells and microspores.
mother cells gives rise to microspores which are
The cells of the tapetum may remain uninucleate
haploid in nature.
or may contain more than one nucleus or
the nucleus may become polyploid. It also 3. Connective: It is the column of sterile tissue
contributes to the wall materials, sporopollenin, surrounded by the anther lobe. It possesses
pollenkitt, tryphine and number of proteins that vascular tissues. It also contributes to the
control incompatibility reaction .Tapetum also inner tapetum.
controls the fertility or sterility of the microspores Microspores and pollen grains
or pollen grains. Microspores are the immediate product of
There are two types of tapetum based on its meiosis of the microspore mother cell whereas
behaviour. They are: the pollen grain is derived from the microspore.
Secretory tapetum (parietal/glandular/ The microspores have protoplast surrounded
cellular): The tapetum retains the original by a wall which is yet to be fully developed. The
position and cellular integrity and nourishes pollen protoplast consists of dense cytoplasm
the developing microspores. with a centrally located nucleus. The wall is
Invasive tapetum (periplasmodial): The differentiated into two layers, namely, inner
cells loose their inner tangential and radial layer called intine and outer layer called exine.
walls and the protoplast of all tapetal cells Intine is thin, uniform and is made up of pectin,
coalesces to form a periplasmodium. hemicellulose, cellulose and callose together
with proteins. Exine is thick and is made up
Functions of Tapetum: of cellulose, sporopollenin and pollenkitt. The
• It supplies nutrition to the developing exine is not uniform and is thin at certain areas.
microspores.
When these thin areas are small and round it is
• It contributes sporopollenin through called germ pores or when elongated it is called
ubisch bodies thus plays an important
furrows. It is associated with germination of
role in pollen wall formation.
pollen grains. The sporopollenin is generally

www.tntextbooks.in
absent in germ pores.The surface of the exine of male gametophyte takes place while they are
is either smooth or sculptured in various still in the microsporangium. The nucleus of the
patterns (rod like, grooved, warty, punctuate microspore divides mitotically to form a vegetative
etc.) The sculpturing pattern is used in the and a generative nucleus. A wall is laid around the
plant identification and classification. generative nucleus resulting in the formation of two
Shape of a pollen grain varies from species unequal cells, a large irregular nucleus bearing with
to species. It may be globose, ellipsoid, fusiform, abundant food reserve called vegetative cell and a
lobed, angular or crescent shaped. The size of the small generative cell. Generally at this 2 celled stage,
pollen varies from 10 micrometers in Myosotis the pollens are liberated from the anther. In some
plants the generative cell again undergoes a division
to 200 micrometers in members of the family
to form two male gametes. The pollen is liberated at
Cucurbitaceae and Nyctaginaceae
2 celled stage. In 60% of the angiosperms pollen is
Palynology is the study of pollen liberated in 2 celled stage. Further, the growth of the
grains.It helps to identify the male gametophyte occurs only if the pollen reaches
distribution of coal and to locate the right stigma. The pollen on reaching the stigma
oil fields. Pollen grains reflect absorbs moisture and swells.
the vegetation of an area.
Liquid nitrogen (-1960C) is used to (e)
preserve pollen in viable condition for
Generative nucleus
prolonged duration. This technique is called Pollen tube
cryopreservation and is used to store pollen Tube nucleus
grains (pollen banks) of economically
important crops for breeding programmes..
Exine (f)
(a) Intine
The wallBeematerial
pollen is a natural substance is
sporopollenin Nucleus Dividing
contributed byandbothcontains high protein,
pollen cytoplasm and Germ pore
generative
nucleus
carbohydrate, trace
tapetum. It is derived from carotenoids. amount of
minerals and vitamins. Therefore, Vacuole
It is resistant to physical and biological (b) Tube nucleus
it is used as dietary supplement and is sold as Nucleus
decomposition.
pollen tablets andIt syrups.
helps Further
to withstand high
, it increases
temperature
the performance and is ofresistant to strong acid, (g)
alkali and race

athletes, enzyme action. Hence, it preserves
horses (c)
andpollen
the also for
heals
long the
periods in fossil deposits, Dividing nucleus
wounds
and it also caused
protects by
pollen during its journey Male gametes
from anther to stigma.of

burns . The study Vegetative cell
honey pollen is called (d)
Generative cell
Mellitopalynology. Tube nucleus
Figure 1.6Stages
Figure 2.3 Development of male
in the development gametophyte
of male gametophyte
Pollenkitt is contributed by the tapetum
and coloured yellow or orange and is chiefly The intine grows as pollen tube through the germ
made of carotenoids or flavonoids. It is an oily pore. In case the pollen is liberated at 2 celled stage the
layer forming a thick viscous coating over pollen generative cell divides in the pollen into 2 male cells
surface. It attracts insects and protects damage (sperms) after reaching the stigma or in the pollen
from UV radiation. tube before reaching the embryo sac. The stages
Development of Male gametophyte: in the development of male gametophyte is given
The microspore is the first cell of the male in Figure 1.6.
gametophyte and is haploid. The development

www.tntextbooks.in
1.4.2 Female reproductive part - Chalazal end

Gynoecium Integument
The gynoecium represents the female Raphe
reproductive part of the flower. The word Nucellus
gynoecium represents one or more pistils of a Embryo sac

flower. The word pistil refers to the ovary, style Hilum
and stigma. A pistil is derived from a carpel. The Micropyle

Funicle
word ovary represents the part that contains the
Vascular supply
ovules. The stigma serves as a landing platform Ovule structure - diagrammatic
for pollen grains. The style is an elongated slender
part beneath the stigma. The basal swollen part
of the pistil is the ovary. The ovules are present
inside the ovary cavity (locule)on the placenta
.Gynoecium (carpel) arises as a small papillate
outgrowth of meristematic tissue from the
growing tip of the floral primordium. It grows
actively and soon gets differentiated into ovary, View under microscope
style and stigma. The ovules or megasporangia Figure 1.7 Structure of an ovule
arise from the placenta. The number of ovules in
oval, sac-like structure in the nucellus toward
an ovary may be one (paddy, wheat and mango)
the micropylar end called embryo sac or female
or many (papaya, water melon and orchids).
gametophyte. It develops from the functional
Structure of ovule(Megasporangium): megaspore formed within the nucellus. In some
Ovule is also called megasporangium and is species(unitegmic tenuinucellate) the inner
protected by one or two covering called layer of the integument may become specialized
integuments. A mature ovule consists of a stalk to perform the nutritive function for the embryo
and a body. The stalk or the funiculus (also called sac and is called as endothelium
funicle) is present at the base and it attaches the or integumentary tapetum (Example :
ovule to the placenta. The point of attachment of Asteraceae). There are two types of ovule based
funicle to the body of the ovule is known as on the position of the sporogenous cell. If the
hilum. It represents the junction between ovule sporogenous cell is hypodermal with a single
and funicle. In an inverted ovule, the funicle is layer of nucellar tissue around it is called
adnate to the body of the ovule forming a ridge tenuinucellate type. Normally tenuinucellate
called raphe. The body of the ovule is made up of ovules have very small nucellus. Ovules with
a central mass of parenchymatous tissue called subhypodermal sporogenous cell is called
nucellus which has large reserve food materials. crassinucellate type. Normally these ovules
The nucellus is enveloped by one or two protective have fairly large nucellus. Group of cells found
coverings called integuments. Integument at the base of the ovule between the chalaza and
encloses the nucellus completely except at the top embryo sac is called hypostase and the thick
where it is free and forms a pore called micropyle. -walled cells found above the micropylar end
The ovule with one or two integuments are said above the embryo sac is called epistase. The
to be unitegmic or bitegmic ovules respectively. structure of ovule is given in Figure 1.7.
The basal region of the body of the ovule where
Types of Ovules
the nucellus, the integument and the funicle meet
The ovules are classified into six main types
or merge is called as chalaza. There is a large,
based on the orientation, form and position

www.tntextbooks.in
of the micropyle with respect to funicle and As the ovule develops, a single hypodermal
chalaza. Most important ovule types are cell in the nucellus becomes enlarged and
orthotropous, anatropous, hemianatropous and functions as archesporium. In some plants,
campylotropous. The types of ovule is given in the archesporial cell may directly function as
Figure 1.8. megaspore mother cell. In others, it may undergo
Orthotropous: In this type of ovule, the a transverse division to form outer primary
micropyle is at the distal end and the micropyle, parietal cell and inner primary sporogenous
the funicle and the chalaza lie in one straight cell. The parietal cell may remain undivided or
vertical line. Examples: Piperaceae, Polygonaceae divide by few periclinal and anticlinal divisions
to embed the primary sporogenous cell deep
Anatropous: The body of the ovule becomes
into the nucellus. The primary sporogenous
completely inverted so that the micropyle
cell functions as a megaspore mother cell. The
and funiculus come to lie very close to each
megaspore mother cell (MMO) undergoes
other. This is the common type of ovules
meiotic division to form four haploid megaspores.
found in dicots and monocots. Based on the number of megaspores that develop
Hemianatropous: In this, the body of the into the Embryo sac, we have three basic types
ovule is placed transversely and at right angles of development: monosporic, bisporic and
to the funicle. Example: Primulaceae. tetrasporic. The megaspores are usually arranged
Campylotropous: The body of the ovule at the in a linear tetrad. Of the four megaspores formed,
micropylar end is curved and more or less bean usually the chalazal one is functional and other
shaped. The embryo sac is slightly curved. All the three megaspores degenerate. The functional
three, hilum, micropyle and chalaza are adjacent megaspore forms the female gametophyte
to one another, with the micropyle oriented or embryo sac. This type of development is
towards the placenta. Example: Leguminosae called monosporic development (Example:
Polygonum). Of the four megaspores formed
In addition to the above main types there are
if two are involved in Embryo sac formation
two more types of ovules they are,
the development is called bisporic (Example:
Amphitropous: The distance between hilum
Allium). If all the four megaspores are involved
and chalaza is less. The curvature of the ovule
in Embryo sac formation the development
leads to horse-shoe shaped nucellus. Example:
is called tetrasporic (Example: Peperomia).
some Alismataceae.
An ovule generally has a single embryo sac.
Circinotropous: Funiculus is very long and The development of monosporic embryo sac
surrounds the ovule. Example: Cactaceae (Polygonum type) is given in Figure 1.9.
Megasporogenesis Development of Monosporic embryo sac.
The process of development of a megaspore To describe the stages in embryo sac development
from a megaspore mother cell is called and organization the simplest monosporic type
megasporogenesis. of development is given below.
(a) Orthotropous (b) Anatropous (c) Hemianatropous (d) Campylotropous (e) Amphitropous (f) Circinotropous
Figure 1.8 Types of ovule

www.tntextbooks.in
The functional megaspore is the first cell of that help to attract the pollen tube. The special
the embryo sac or female gametophyte. The cellular thickening called filiform apparatus of
megaspore elongates along micropylar- chalazal synergids help in the absorption, conduction of
axis. The nucleus Filiform apparatus nutrients from the nucellus to embryo sac. It
undergoes a Synergids also guides the pollen tube into the egg. Thus, a
mitotic division. Egg apparatus 7 celled with 8 nuclei embryo sac is formed. The
Wall formation Egg structure of embryo sac is given in Figure 1.10.
does not follow the Polar nucleus
1.4.3 Pollination
nuclear division. A
large central Pollination is a wonderful mechanism which
vacuole now provides food,
appears between shelter etc., for
the two daughter
Antipodal cell the pollinating
Figure 1.10 Structure animals. Many
nuclei. The vacuole
of Embryo sac plants are
expands and
pushes the nuclei towards the opposite poles of pollinated by
the embryo sac. Both the nuclei divide twice a particular
mitotically, forming four nuclei at each pole. At animal species
this stage all the eight nuclei are present in a and the flowers are modified accordingly and
common cytoplasm (free nuclear division). thus there exists a co-evolution between plants
After the last nuclear division the cell undergoes and animals. Let us imagine if pollination fails.
appreciable elongation, assuming a sac-like Do you think there will be any seed and fruit
appearance. This is followed by cellular formation? If not what happens to pollinating
organization of the embryo sac. Of the four organisms and those that depend on these
nuclei at the micropylar end of the embryo sac, pollinating organism for the food? Here lies the
three organize into an egg apparatus, the fourth significance of the process of pollination.
one is left free in the cytoplasm of the central The pollen grains produced in the anther
cell as the upper polar nucleus. Three nuclei of will germinate only when they reach the stigma
the chalazal end form three antipodal cells of the pistil. The reproductive organs, stamens
whereas the fourth one functions as the lower and pistil of the flower are spatially separated, a
polar nucleus. Depending on the plant the 2 mechanism which is essential for pollen grains
polar nuclei may remain free or may fuse to to reach the stigma is needed. This process of
form a secondary nucleus (central cell). The transfer of pollen grains from the anther to a
egg apparatus is made up of a central egg cell stigma of a flower is called pollination.
and two synergids, one on each side of the egg Pollination is a characteristic feature
cell. Synergids secrete chemotropic substances of spermatophyte (Gymnosperms and
Archesporial cell
Synergid
Egg
polar nucleus
Antipodal
Nucellus
Megaspore Functional 2-nucleate stage
megaspore 4-nucleate stage 8-nucleate stage
mother cell
Figure 1.9 Development of ovule and embryo sac (Polygonum type).

www.tntextbooks.in
Angiosperms). Pollination in gymnosperms

is said to be direct as the pollens are deposited
directly on the exposed ovules, whereas in
angiosperms it is said to be indirect, as the
pollens are deposited on the stigma of the
pistil. In majority of angiosperms, the flower
opens and exposes its mature anthers and
stigma for pollination. Such flowers are called
chasmogamous and the phenomenon is Chasmogamous flower
chasmogamy. In other plants, pollination occurs

without opening and exposing their sex organs.
Such flowers are called cleistogamous and the
phenomenon is cleistogamy. Cleistogamous flower
Based upon the flower on which the pollen of a
flower reaches, the pollination is classified into
two kinds, namely, self-pollination (Autogamy) Figure 1.11 Commelina with Cleistogamous
Figure 2.8 Commelina with cleistogamous and chasmogamous flower
and cross-pollination(Allogamy). and Chasmogamous flowers

pollination to occur. Example: Mirabilis jalapa,
A.
Self-pollination or Autogamy (Greek
Catharanthus roseus
Auto = self, gamos = marriage):
3. Incomplete dichogamy: In dichogamous
According to a majority of Botanists, the
flowers the stamen and stigma of a flower mature at
transfer of pollen on the stigma of the same
different time. Sometimes , the time of maturation
flower is called self-pollination or Autogamy.
of these essential organs overlap so that it becomes
Self-pollination is possible only in those plants
favourable for self-pollination.
which bear bisexual flowers. In order to promote
self- pollination the flowers of the plants have B. Cross - pollination
several adaptations or mechanisms. They are: It refers to the transfer of pollens on the stigma
1. Cleistogamy: In cleistogamy (Greek Kleisto of another flower. The cross-pollination is of two
= closed. Gamos = marriage) flowers never open types:
and expose the reproductive organs and thus the i. Geitonogamy: When the pollen deposits on
pollination is carried out within the closed flower. another flower of the same individual plant, it
Commelina, Viola, Oxalis are some examples is said to be geitonogamy. It usually occurs in
for cleistogamous flowers. In Commelina plants which show monoecious condition. It is
benghalensis, two types of flowers are produced- functionally cross-pollination but is generally
aerial and underground flowers. The aerial similar to autogamy because the pollen comes
flowers are brightly coloured, chasmogamous from same plant.
and insect pollinated. The underground flowers ii. Xenogamy: When the pollen (genetically
are borne on the subterranean branches of the different) deposits on another flower of a different
rhizome that are dull, cleistogamous and self plant of the same species , it is called as xenogamy.
pollinated and are not dependent on pollinators Contrivances of cross-pollination
for pollination.(Figure 1.11). The flowers have several mechanisms that
promote cross-pollination which are also called
2. Homogamy: When the stamens and
contrivances of cross-pollination or outbreeding
stigma of a flower mature at the same time
devices. It includes the following.
it is said to be homogamy. It favours self-

www.tntextbooks.in
1. Dicliny or Unisexuality becomes impossible. For example in Gloriosa

When the flowers are unisexual only cross- superba, the style is reflexed away from the
pollination is possible. There are two types. stamens and in Hibiscus the stigmas project
i. Monoecious: Male and female flowers on far above the stamens (Figure 1.13).
the same plant. Coconut, Bitter gourd. In plants
like castor and maize, autogamy is prevented but
geitonogamy takes place.
ii. Dioecious : Male and female flowers on different Stigma
plants. Borassus, Carica and phoenix. Here both
autogamy and geitonogamy are prevented.
Figure 1.13 Herkogamy - Gloriosa
2. Monocliny or Bisexuality
Flowers are bisexual and the special adaptation of iii. Heterostyly: Some plants produce two
the flowers prevents self-pollination. or three different forms of flowers that are
different in their length of stamens and style.
i. Dichogamy: In bisexual flowers anthers and
Pollination will take place only between organs
stigmas mature at different times, thus checking
of the same length.(Figure 1.14)
self-pollination. It is of two types.
a. Distyly: The plant produces two forms
a. Protandry: The stamens mature earlier than
of flowers, Pin or long style, long stigmatic
the stigmas of the flowers. Examples: Helianthus,
papillae, short stamens and small pollen grains;
Clerodendrum (Figure 1.12 a).
Thrum-eyed or short style, small stigmatic
b. Protogyny: The stigmas mature earlier than
papillae, long stamens and large pollen grains.
the stamens of the flower. Examples: Scrophularia
Example: Primula (Figure 1.14a). The stigma of
nodosa and Aristolochia bracteata (Figure 1.12 b).
the Thrum-eyed flowers and the anther of the
Stamens pin lie in same level to bring out pollination.
Style
Stamens Style Similarly the anther of Thrum-eyed and stigma
of pin ones is found in same height. This helps
in effective pollination.
(a) Protandry - Clerodendrum
Stigma
Style Stamens Long style Short style
Style
a) Distyly - Primula
i) Pin-eyed flower ii) Thrum-eyed flower
Figure 2.11 Heterostyly

a) Distyly - Primula vulgaris
(b) Protogyny - Scrophularia

Figure 1.12 Dichogamy
ii. Herkogamy: In bisexual flowers the
Long style Normal style Short style
essential organs, the stamens and stigmas, are
b) Tristyly - Lythrum
Fig 2.11b Tristyly - Lythrum
arranged in such a way that self-pollination

Figure 1.14 Heterostyly

www.tntextbooks.in
b. Tristyly: The plant produces three kinds of • The perianth is absent or highly reduced.
flowers, with respect to the length of the style • The flowers are small, inconspicuous,
and stamens. Here,the pollen from flowers of colourless, not scented, do not secrete nectar.
one type can pollinate only the other two types • The stamens are numerous, filaments are
but not their own type. Example : Lythrum long, exerted and versatile.
(Figure 1.14b).
• Anthers produce enormous quantities of
iv. Self sterility/ Self- incompatibility: In pollen grains compared to number of ovules
some plants, when the pollen grain of a flower available for pollination. They are minute,
reaches the stigma of the same, it is unable to light and dry so that they can be carried to
germinate or prevented to germinate on its long distances by wind.
own stigma. Examples: Abutilon, Passiflora. It
• In some plants anthers burst violently and
is a genetic mechanism.
release the pollen into the air. Example:
Agents of pollination Urtica.
Pollination is effected by many agents like • Stigmas are comparatively large, protruding,
wind, water, insects etc. On the basis of the sometimes branched and feathery, adapted
agents that bring about pollination, the mode to catch the pollen grains. Generally single
of pollination is divided into abiotic and biotic. ovule is present.
The latter type is used by majority of plants.
• Plant produces flowers before the new leaves
Abiotic agents
appear, so the pollen can be carried without
1. Anemophily - pollination by Wind
hindrance of leaves.
2. Hydrophily - pollination by Water
Pollination in Maize (Zea mays): The maize
Biotic agents is monoecious and unisexual. The male
3. Zoophily inflorescence (tassel) is borne terminally and
female inflorescence (cob) laterally at lower
Zoophily refers to pollination through animals
levels. Maize pollens are large and heavy and
and pollination through insects is called
cannot be carried by light breeze. However,
Entomophily.
the mild wind shakes the male inflorescence to
1. Anemophily: Pollination by wind. The wind
release the pollen which falls vertically below.
pollinated flowers are called anemophilous.
The female inflorescence has long stigma (silk)
The wind pollinated plants are generally
measuring upto 23 cm in length, which projects
situated in wind exposed regions. Anemophily
beyond leaves. The pollens drop from the tassel
is a chance event. Therefore, the pollen may
is caught by the stigma (Figure 1.15).
not reach the target flower effectively and are
wasted during the transit from one flower Male inflorescence (Tassel)
to another. The common examples of wind
Female inflorescence (Cob)
pollinated flowers are - grasses, sugarcane,
bamboo, coconut, palm, maize etc.,
Silk
Anemophilous plants have the following (Stigma
characteristic features: and Style)
• The flowers are produced in pendulous,

catkin-like or spike inflorescence.
• The axis of inflorescence elongates so that
the flowers are brought well above the leaves. Figure 1.15 Pollination in Zea mays

www.tntextbooks.in
2. Hydrophily: Pollination by water is called

hydrophily and the flowers pollinated by water are Activity
said to be hydrophilous (Example: Vallisneria, Visit to a nearby park and observe the
Hydrilla). Though there are a number of aquatic different flowers. Record the adaptations
plants, only in few plants pollination takes place or modifications found in the flowers for
by water. The floral envelop of hydrophilous different types of pollination.
plants are reduced or absent. In water plants
like Eichhornia and water lilly pollination takes 3. Zoophily: Pollination by the agency of animals
place through wind or by insects. There are is called zoophily and flowers are said to be
two types of hydrophily, Epihydrophily and zoophilous. Animals that bring about pollination
Hypohydrophily. In most of the hydrophilous may be birds, bats, snails and insects. Of these,
flowers, the pollen grains possesses mucilage insects are well adapted to bring pollination.
covering which protects them from wetting. Larger animals like primates (lemurs), arboreal
rodents, reptiles (gecko lizard and garden lizard)
a. Epihydrophily: Pollination occurs at the
have also been reported as pollinators.
water level. Examples: Vallisneria spiralis,
Elodea. A. Ornithophily: Pollination by birds is called
Pollination in Vallisneria spiralis: It is a Ornithophily. Some common plants that are
dioecious, submerged and rooted hydrophyte. pollinated by birds are Erythrina, Bombax,
The female plant bears solitary flowers which rise Syzygium, Bignonia, Sterlitzia etc., Humming
to the surface of water level using a long coiled birds, sun birds, and honey eaters are some
stalk at the time of pollination. A small cup of the birds which regularly visit flowers and
shaped depression is formed around the female bring about pollination.
flower on the surface of the water. The male plant The ornithophilous flowers have the
produces male flowers which get detached and following characteristic features:
float on the surface of the water. As soon as a • The flowers are usually large in size.
male flowers comes in contact with the female • The flowers are tubular, cup shaped or urn-
flower and pollination takes place, Stalk of the shaped.
female flower coils and goes under water where • The flowers are brightly coloured, red,
fruits are produced. (Figure 1.16). scarlet, pink, orange, blue and yellow which
attracts the birds.
Male flower
• The flowers are scentless and produce nectar
Female flower
in large quantities. Pollen and nectar form
the floral rewards for the birds visiting the
flowers.
Ribbon • The floral parts are tough and leathery to
shaped leaves withstand the powerful impact of the visitors.
B. Cheiropterophily: Pollination carried out
Male inflorescence by bats is called cheiropterophily. Some of the
Root common cheiropterophilous plants are Kigelia
africana, Adansonia digitata, etc.,
Figure 1.16 Pollination in Vallisneria
C. Malacophily: Pollination by slugs and
b. Hypohydrophily: Pollination occurs snails is called malacophily. Some plants of
inside the water. Examples: Zostera marina and Araceae are pollinated by snails. Water snails
Ceratophyllum. crawling among Lemna pollinate them.

www.tntextbooks.in
POLLINATION
Self-Pollination Cross-Pollination
(Autogamy) (Xenogamy or Allogamy)
Abiotic Agencies
1. Anemophily (Wind) Biotic Agencies
2. Hydrophily (Water)
Cantharophily Phalaenophily Mellitophily Psychophily Malacophily Ornithophily Chieropterophily Myrmecophily

(Beetle) (Moths) (Bees) (Snails) (Birds) (Bats) (Ants)
D. Entomophily: Pollination by insects is • Flowers pollinated by flies and beetles

called Entomophily. Pollination by ant is called produce foul odour to attract pollinators.
myrmecophily. Insects that are well adapted to • In some flowers juicy cells are present which
bring pollination are bees, moths, butterflies, are pierced and the contents are sucked by
flies, wasps and beetles. Of the insects, bees the insects.
are the main flower visitors and dominant Pollination in Salvia (Lever mechanism):
pollinators. Insects are chief pollinating agents The flower is protandrous and the corolla is
and majority of angiosperms are adapted for
RECURRENT bilabiate with 2 stamens. A lever mechanism
insect pollination. It is the most commonAPOMIXIS
type
helps in pollination. Each anther has an upper
of pollination.
fertile lobe and lower sterile lobe which is
The characteristic features of entomophilous separated by a long connective which helps
flowers are as follows: the anthers to swing freely. When a bee visits
Vegetative
• Flowers are generally large or if small they a flower, it sits on the lower lip which acts as a
Agamospermy
reproduction
are aggregated in dense inflorescence. platform. It enters the flower to suck the nectar
Example: Asteraceae flowers. by pushing its head into the corolla. During
Adventive
• Flowers are brightly coloured. The adjacent embryony
the entry of the bee into the flower the body
parts of the flowers may also be brightly strikes against the sterile end of the connective.
Diplospory
coloured to attract insect. For example This makes the fertile part of the stamen to
Apospory
in Poinsettia and Bougainvillea the bracts descend and strike at the back of the bee.
become coloured. The pollen gets deposited on the back of the
• Flowers are scented and produce nectar. bee. When it visits another flower, the pollen
• Flowers in which there is no secretion of gets rubbed against the stigma and completes
nectar, the pollen is either consumed as the act of pollination in Salvia (Figure 1.17).
food or used in building up of its hive by the Some of the other interesting pollination
honeybees. Pollen and nectar are the floral mechanisms found in plants are a) Trap
rewards for the visitors. mechanism (Aristolochia);Pit fall mechanism
(Arum);Clip or translator mechanism

www.tntextbooks.in
(Asclepiadaceae) and Piston mechanism

(Papilionaceae). Pollination – A composite
event
Pollination provides
Pistil
Anther Pollen gets dusted
on the body of
information about
the insect evolution, ecology, animal learning and
(i) (ii) foraging behaviour. Flowers not only supply
nectar but also provide microclimate, site and
Stigma
Pollen gets
transferred shelter for egg laying insects. The association
to the stigma
of insects benefits the flower by getting
pollinated and ensures the propagation
(iii) (iv)
of its own progeny. The floral parts are
Figure 1.17 Pollination in Salvia - Lever well modified in shape, size to attract the
mechanism pollinators to accomplish pollination .
1.5 Fertilization The relationship between Yucca and
The fusion of male and female moth (Tegeticula yuccasella) is an example
gamete is called fertilization. for obligate mutualism. The moth bores a
hole in the ovary of the flower and lays eggs
Double fertilization is seen in
in it. Then it collects pollen and pushes it
angiosperms.
in the form of balls down the hollow end
Events of fertilization of the stigma. Fertilization takes place and
The stages involved in double seeds develop. Larvae
fertilization are:- germination feed on developing seeds.
Some seeds remain
of pollen to form pollen tube
unconsumed for the
in the stigma; growth of pollen
propagation of the plant
tube in the style; direction
species. It is interesting
of pollen tube towards the micropyle of the that the moth cannot
ovule; entry of the pollen tube into one of the survive without Yucca
synergids of the embryo sac, discharge of flowers and the plant fails
male gametes; syngamy and triple fusion. The to reproduce sexually Bee Orchid
events from pollen deposition on the stigma to without the moth.
the entry of pollen tube in to the ovule is called Similarly in Amorphophallus, flowers
pollen- pistil interaction. It is a dynamic apart from providing floral rewards, also
process which involves recognition of pollen forms safe site for laying eggs. Many visitors
and to promote or inhibit its germination and consume pollen and nectar and do not help
growth. in pollination. They are called pollen / nectar
robbers.
Pollen on the stigma
In Bee orchid (Ophrys) the morphology
In nature, a variety of pollens fall on the receptive
of the flower mimics that of female wasp
stigma, but all of them do not germinate and (Colpa). The male wasp mistakes the flowers
bring out fertilization. The receptive surface for a female wasp and tries to copulate. This
of the stigma receives the pollen. If the pollen act of pseudocopulation helps in polli nation.
is compatible with the stigma it germinates to The pollination in Fig (Ficus carica) by the
form a tube. This is facilitated by the stigmatic Wasp (Blastophaga psenes) is also an example
fluid in wet stigma and pellicle in dry stigma. for similar Plant – insect interaction.
These two also decide the incompatibility and

www.tntextbooks.in
compatibility of the pollen through recognition- Solid style (Closed type): It is common among
rejection protein reaction between the pollen dicots. It is characterized by the presence of
and stigma surface. Sexual incompatibility may central core of elongated, highly specialised
exist between different species (interspecific) cells called transmitting tissue.This is equivalent
or between members of the same species to the lining cells of hollow style and does the
(intraspecific).The latter is called self- same function. Its contents are also similar
incompatibility. The first visible change in the to the content of those cells. The pollen tube
pollen, soon after it lands on stigma is hydration. grows through the intercellular spaces of the
The pollen wall proteins are released from the transmitting tissue.
surface. During the germination of pollen its Semi-solid style (half closed type): This is
entire content moves into the pollen tube. The intermediate between solid and open type.
growth is restricted to the tip of the tube and There is a difference of opinion on the
all the cytoplasmic contents move to the tip nature of transmitting tissue. Some authors
region. The remaining part of the pollen tube consider that it is found only in solid styles
is occupied by a vacuole which is cut off from while others consider the lining cells of hollow
the tip by callose plug. The extreme tip of pollen style also has transmitting tissue.
tube appears hemispherical and transparent
Entry of pollen tube into the ovule: There
when viewed through the microscope. This
are three types of pollen tube entry into the
is called cap block. As soon as the cap block
ovule(Figure 1.18).
disappear the growth of the pollen tube stops.
Porogamy: when the pollen tube enters
Pollen tube in the style through the micropyle.
After the germination the pollen tube enters into
Pollen tube
the style from the stigma. The growth of the pollen
tube in the style depends on the type of style.
Types of style
There are three types of style a) Hollow or
open style b)solid style or closed style c) semi-
solid or half closed style.
Pollen tube Pollen tube
Hollow style (Open style): It is common
a) Porogamy b) Chalazogamy c) Mesogamy
among monocots. A hollow canal running from
the stigma to the base of the style is present. Figure 1.18 Path of pollen tube entry into the ovule
The canal is lined by a single layer of glandular Chalazogamy: when the pollen tube enters
canal cells (Transmitting tissue).They secrete through the chalaza.
mucilaginous substances. The pollen tube grows
Mesogamy: when the pollen tube enters
on the surface of the cells lining the stylar canal.
through the integument.
The canal is filled with secretions which serve
Entry of pollen tube into embryo sac:
as nutrition for growing pollen tubes and also
Irrespective of the place of entry of pollen
controlling incompatibility reaction between
tube into ovule, it enters the embryo sac at the
the style and pollen tube. The secretions contain
micropylar end. The pollen enters into embryo
carbohydrates, lipids and some enzymes
sac directly into one of the synergids.
like esterases, acid phosphatases as well as
compatibility controlling proteins. The growth of pollen tube towards the ovary,
ovule and embryo sac is due to the presence of

www.tntextbooks.in
chemotropic substances. The pollen tube after fuses with the egg nucleus (syngamy) to form
travelling the whole length of the style enters Zygote. (Figure 1.19)
into the ovary locule where it is guided towards Pollen grain Ovule
the micropyle of the ovule by a structure called
Antipodal (n)
obturator (See Do you know). After reaching the Secondary
nucleus (2n)
embryo sac, a pore is formed in pollen tube wall at Vegetative
Egg (n)
tube nucleus (n)
its apex or just behind the apex. The content of the
pollen tube (two male gametes, vegetative nucleus Male nuclei (n)
and cytoplasm) are discharged into the synergids
into which pollen tube enters. The pollen tube
does not grow beyond it, in the embryo sac. The
tube nucleus disorganizes.
(n) (n) (n) (2n)
1.5.1 Double fertilization and triple fusion
Zygote (2n)
Endosperm(3n)
S.G. Nawaschin and L.Guignard in 1898 and
Embyo
1899, observed in Lilium and Fritillaria that
both the male gametes released from a male
gametophyte are involved in the fertilization.
They fertilize two different components of
Seed
the embryo sac. Since both the male gametes Figure 1.19 Fertilization in Angiosperms
are involved in fertilization, the phenomenon
The second gamete migrates to the central cell
is called double fertilization and is unique
where it fuses with the polar nuclei or their
to angiosperms. One of the male gametes
Endosperm
Embryo
Petal
Stigma
Style
Shrivelling
petal & sepal
Ovary
Ovule
Fruit
Sepal
Seed
Seed
Plumule
Cotyledon
Testa
Radicle
Figure 1.20 Post Ferilization changes in the flower of an angiosperm

www.tntextbooks.in
fusion product, the secondary nucleus and Depending upon the mode of development
forms the primary endosperm nucleus (PEN). three types of endosperm are recognized in
Since this involves the fusion of three nuclei, angiosperms. They are nuclear endosperm,
this phenomenon is called triple fusion. This cellular endosperm and helobial endosperm
act results in endosperm formation which (Figure 1.21).
forms the nutritive tissue for the embryo. Nuclear endosperm: Primary Endosperm
Nucleus undergoes several mitotic divisions
1.6 Post Fertilization structure without cell wall formation thus a free nuclear
and events condition exists in the endosperm. Examples:
After fertilization, several changes take place in Coccinia, Capsella and Arachis
the floral parts up to the formation of the seed Cellular endosperm: Primary endosperm
(Figure 1.20). nucleus divides into 2 nuclei and it is
The events after fertilization (endosperm, immediately followed by wall formation.
embryo development, formation of seed, fruits) Subsequent divisions also follow cell wall
are called post fertilization changes. formation. Examples: Adoxa, Helianthus and
Scoparia
Parts before Transformation after
fertilization fertilization
Sepals, petals, stamens, Usually wither and fall off
style and stigma
Ovary Fruit
Ovule Seed
endosperm
Egg Zygote Free nuclei
endosperm
Funicle Stalk of the seed (a) Nuclear (b) Cellular
(c) Helobial
endosperm endosperm
Micropyle (ovule) Micropyle of the endosperm
seed(facilitates O2 and
water uptake) Ruminate
Nucellus Perisperm endosperm
Outer integument of Testa (outer seed coat) d) Ruminate endosperm (Areca catechu)
ovule Figure 1.21 Types of Endosperm

Inner integument Tegmen (inner seed coat)
Synergid cells Degenerate
Helobial endosperm: Primary Endosperm
Nucleus moves towards base of embryo sac and
Secondary nucleus Endosperm
divides into two nuclei. Cell wall formation
Antipodal cells Degenerate takes place leading to the formation of a large
micropylar and small chalazal chamber. The
Endosperm nucleus of the micropylar chamber undergoes
The primary endosperm nucleus (PEN) several free nuclear division whereas that
divides immediately after fertilization but of chalazal chamber may or may not divide.
before the zygote starts to divide, to form Examples : Hydrilla and Vallisneria.
the endosperm. The primary endosperm
nucleus is the result of triple fusion (two The endosperms may either be completely
polar nuclei and one sperm nucleus) and consumed by the developing embryo or it may
thus has 3n number of chromosomes. It is persist in the mature seeds. Those seeds without
a nutritive tissue and regulatory structure endosperms are called non- endospermous or
that nourishes the developing embryo. ex- albuminous seeds. Examples: Pea, Groundnut

www.tntextbooks.in
and Beans. Those seeds with endosperms are cell and lower or basal cell. Further divisions
called endospermous or albuminous seeds. The in the zygote during the development lead to
endosperms in these seeds supply nutrition to the formation of embryo. Embryo undergoes
the embryo during seed germination. Examples: globular, heart shaped stages before reaching a
Paddy, Coconut and Castor. mature stage. The mature embryo has a radicle,
two cotyledons and a plumule.
Aleurone tissue consists
of highly specialised cells Activity
of one or few layers which
Collect the fruits of Tridax (Cypsella). Using
are found around the
endosperm of cereals (barley and maize). a needle dissect out the content, separate
Aleurone grain contains sphaerosomes. the embryo and observe different stages
During seed germination cells secrete of dicot embryo – globular, torpedo, heart
certain hydrolytic enzymes like amylases, shaped under a dissection microscope.
proteases which digest reserved food
material present in the endosperm cells. Seed
The fertilized ovule is called seed and possesses
Ruminate endosperm: The endosperm with
an embryo, endosperm and a protective coat.
irregularity and unevenness in its surface forms
ruminate endosperm. Examples :Areca catechu, Seeds may be endospermous (wheat, maize,
Passiflora and Myristica barley and sunflower) or non endospermous.
(Bean, Mango, Orchids and cucurbits).
Functions of endosperm:
• It is the nutritive tissue for the developing Fresh weight of an
embryo. orchid seed may be
• In majority of angiosperms, the zygote 20.33 microgram and
divides only after the development of that of double coconut
endosperm.
(Lodoicea maldivica) is about 6 kg.
• Endosperm regulates the precise mode of
embryo development.
Cicer seed (example for Dicot seed)
Coconut milk is a basic
nutrient medium which The mature seeds are attached to the fruit
induces the differentiation wall by a stalk called funiculus. The funiculus
of embryo (embryoids) disappears leaving a scar called hilum. Below
and plantlets from various plant tissues. the hilum a small pore called micropyle is
Coconut water from tender coconut is free- present. It facilitates entry of oxygen and
nuclear endosperm and white kernel part water into the seeds during germination.
is cellular. Each seed has a thick outer covering called
seed coat. The seed coat is developed from
Development of Dicot embryo integuments of the ovule. The outer coat is
The Stages involved in the development called testa and is hard whereas the inner coat
of Dicot embryo (Capsella bursa-pastoris – is thin, membranous and is called tegmen.
Onagrad or crucifer type) is given in Figure In Pea plant the tegmen and testa are fused.
1.22. The embryo develops at micropylar Two cotyledons laterally attached to the
end of embryo sac. The zygote undergoes embryonic axis and store the food materials
transverse division to form upper or terminal in pea whereas in other seeds like castor the

www.tntextbooks.in
Embryonal mass
Hypophysis
Terminal cell
Suspensor
Basal cell
(a) (b) (c) (d)

Zygote 2- celled proembryo 4 celled proembryo Globular embryo
Cotyledon
Plumule
Embryonal mass
Hypophysis
Hypophysis Cotyledons
Radicle
Suspensor Radicle
Root cap
Suspensor Root cap
(f) Heart shaped embryo (g) Mature embryo (h) Mature embryo in a seed
Figure 1.22 Development of Dicot embryo (Capsella bursa-pastoris)
Testa
Radicle
Oryza seed (example for Monocot seed)
The seed of paddy is one seeded and is called
Testa Caryopsis. Each seed remains enclosed by
a brownish husk which consists of glumes
Seed entire
arranged in two rows. The seed coat is a
Plumule
Cotyledon
brownish, membranous layer closely adhered to
the grain. Endosperm forms the bulk of the grain
Testa
and is the storage tissue. It is separated from
embryo by a definite layer called epithelium.
Radicle
Seed cut opened The embryo is small and consists of one shield-
Figure 1.23(a) Dicot
a) Dicot seed seed - Cicer arientinum
(Cicer arientinum) shaped cotyledon known as scutellum present
endosperm contains reserve food and the towards lateral side of embryonal axis.
cotyledons are thin. The portion of embryonal A short axis with plumule and radicle protected
Fruit (Caryopsis) entire
axis projecting beyond the cotyledons is by the root cap is present. The plumule is
called radicle or embryonic root. The other surrounded by a protective sheath called
end of the axis called embryonic shoot is coleoptile. The radicle including root cap
the plumule. Embryonal axis above the is also covered by a protective sheath called
Endosperm
level of cotyledon is called epicotyl whereas coleorhiza. The scutellum supplies the growing
the cylindrical region between Scutellum the level of
embryo with food material absorbed from the
cotyledon is called hypocotyl(Figure
Coleoptile
1.23 a). endosperm with the help of the epithelium
Shoot apex
(Figure 1.23 b).
Radicle
Root cap
Coleorhiza Asexual and Sexual Reproduction in Plants 23
L.s. of fruit
b) Monocot seed (Oryza sativa)

Figure 2.25 Structure of seed
Testa
www.tntextbooks.in
Radicle
Seed cut opened
a) Dicot seed (Cicer arientinum)
RECURRENT
APOMIXIS
Fruit (Caryopsis) entire
Vegetative
Agamospermy
reproduction
Endosperm
Adventive embryony
Diplospory
Scutellum Apospory
Coleoptile
Shoot apex Vegetative reproduction: Plants propagate by
any part other than seeds
Radicle
Root cap Bulbils – Fritillaria imperialis; Bulbs –
Coleorhiza Allium; Runner – Mentha arvensis; Sucker -
L.s. of fruit
Chrysanthemum
Figure
b) 1.23(b)
Monocot Monocot seed
seed (Oryza - Oryza sativa
sativa) Agamospermy: It refers to processes by which
Figure 2.25 Structure of seed
Activity Embryos are formed by eliminating meiosis and
syngamy.
Soak seeds of green gram for three hours.
Drain the water and place few seeds in a Adventive embryony
clean tray containing moist cotton or filter An Embryo arises directly from the diploid
paper. Allow the seeds to sprout. Collect sporophytic cells either from nucellus or
the sprouted seeds, cut open and observe integument. It is also called sporophytic
the parts. Record your observation. budding because gametophytic phase is
completely absent. Adventive embryos are found
in Citrus and Mangifera
1.7 Apomixis
Diplospory (Generative apospory): A diploid
Reproduction involving fertilization in
embryo sac is formed from megaspore mother
flowering plants is called amphimixis and
cell without a regular meiotic division Examples.
wherever reproduction does not involve union
Eupatorium and Aerva.
of male and female gametes is called apomixis.
Apospory: Megaspore mother cell (MMC)
The term Apomixis was introduced by
undergoes the normal meiosis and four
Winkler in the year 1908. It is defined as
megaspores formed gradually disappear. A
the substitution of the usual sexual system
nucellar cell becomes activated and develops into
(Amphimixis) by a form of reproduction which
a diploid embryo sac. This type of apospory is also
does not involve meiosis and syngamy.
Maheswari (1950) classified Apomixis into called somatic apospory. Examples Hieracium
two types - Recurrent and Non recurrent and Parthenium.
Recurrent apomixis: It includes vegetative 1.8 Polyembryony
reproduction and agamospermy Occurrence of more than one embryo in a
Non recurrent apomixis: Haploid embryo seed is called polyembryony (Figure 1.24).
sac developed after meiosis, develops into a The first case of polyembryony was reported
embryo without fertilization. in certain oranges by Anton von Leeuwenhoek
The outline classification of Recurrent in the year 1719. Polyembryony is divided into
apomixis is given below. four categories based on its origin.

www.tntextbooks.in
Significance
Zygotic embryo • The seedless fruits have great significance
in horticulture.
• The seedless fruits have great commercial
importance.
Endosperm • Seedless fruits are useful for the preparation
of jams, jellies, sauces, fruit drinks etc.
• High proportion of edible part is available
in parthenocarpic fruits due to the absence
Antipodal embryo
of seeds.
Summary
Figure 1.24 : Polyembryony – Embryo sac
Reproduction is one of the attributes of
of Ulmus glabra showing zygotic and
living things. Lower plants, microbes and
antipodal embryo
animals reproduce by different methods
(fragmentation, gemma, binary fission,
a. Cleavage polyembryony (Example: Orchids)
budding, regeneration). Organisms reproduce
b. Formation of embryo by cells of the Embryo through asexual and sexual methods. Asexual
sac other than egg (Synergids – Aristolochia; methods in angiosperms occur through natural
antipodals – Ulmus and endosperm – or artificial methods. The natural methods
Balanophora) take place through vegetative propagules or
c. Development of more than one Embryo sac diaspores. Artificial method of reproduction
within the same ovule. (Derivatives of same involves cutting, layering and grafting.
MMC, derivatives of two or more MMC – Micropropagation is a modern method used
Casuarina) to raise new plants.
d. Activation of some sporophytic cells of the Sexual reproduction includes
ovule (Nucellus/ integuments-Citrus and gametogenesis and fertilization. External
Syzygium). fertilization occurs in lower plants like algae
but in higher plants internal fertilization
Practical applications
takes place. A flower is a modified shoot
The seedlings formed from the nucellar tissue
meant for reproduction. Stamen is the male
in Citrus are found better clones for Orchards.
reproductive part and produces pollen grains.
Embryos derived through polyembryony are
The development of microspore is called
found virus free.
microsporogenesis. The microspore mother
1.9 Parthenocarpy cell undergoes meiotic division to produce
As mentioned earlier, the ovary becomes the four haploid microspores. In majority of
fruit and the ovule becomes the seed after Angiosperms the anther is dithecous and
fertilization. However in a number of cases, are tetrasporangiate. It possesses epidermis,
fruit like structures may develop from the endothecium, middle layers and tapetum.
ovary without the act of fertilization. Such The hygroscopic nature of endothecial cell
fruits are called parthenocarpic fruits. along with thin walled stomium helps in the
Invariably they will not have true seeds. dehiscence of anther. Tapetum nourishes the
Many commercial fruits are made seedless. microspores and also contributes to the wall
Examples: Banana, Grapes and Papaya. materials of the pollen grain. Pollen grain is

www.tntextbooks.in
derived from the microspore and possesses egg and 2 Synergids) and two polar nucleus
thin inner intine and thick outer exine. fused to form secondary nucleus. Thus, a
Sporopollenin is present in exine and is resistant 7 celled 8 nucleated Embryo sac is present.
to physiological and biological decomposition. The transfer of pollen grains to the
Microspore is the first cell of male gametophyte. stigma of a flower is called pollination. Self-
The nucleus of the microspore divides to form pollination and cross-pollination are two
a vegetative nucleus and a generative nucleus. types of pollination. Double fertilization
The generative nucleus divides to form and triple fusion are characteristic features
two male nuclei. Gynoecium is the female of angiosperms. After fertilization the ovary
reproductive part of a flower and it represents transforms into a fruit and the ovule becomes
one or more pistils. The ovary bears ovules a seed. Endosperm is triploid in angiosperms
which are attached to the placenta. There are and is of three types – Nuclear, cellular, helobial.
six major types of ovules. The development Reproduction which doesn’t involve meiosis
of megaspore from megaspore mother cell and syngamy is called apomixis. Occurrence
is called megasporogenesis. A monosporic of more than one embryo in a seed is called
embryo sac (Polygonum type) possesses three polyembryony. Formation of fruit without the
antipodals in chalazal end, Three cells in the act of fertilization is called parthenocarpy.
micropylar end constituting egg apparatus(1
Evaluation 6. First cell of male gametophyte in

1. Choose the correct angiosperm is
statement from the a) Microspore b) megaspore
following c) Nucleus d) Primary Endosperm Nucleus
a) Gametes are involved in
asexual reproduction 7. Match the following
b) Bacteria reproduce I) External fertilization i) pollen grain
asexually by budding II) Androecium ii)anther wall
c) Conidia formation is a method of III) Male gametophyte iii)algae
sexual reproduction IV) Primary parietal layer iv)stamens
d) Yeast reproduce by budding
a)I-iv;II-i;III-ii;IV-iii
2. An eminent Indian embryologist is
b)I-iii;II-iv;III-i;IV-ii
a) S.R.Kashyap b) P.Maheswari c)I-iii;II-iv;III-ii,IV-i
c) M.S. Swaminathan d) K.C.Mehta d)I-iii;II-i;III-iv;IV-ii
3. Identify the correctly matched pair
8. Arrange the layers of anther wall from
a) Tuber - Allium cepa
locus to periphery
b) Sucker - Pistia
a) Epidermis,middle layers, tapetum,
c) Rhizome - Musa
endothecium
d) Stolon - Zingiber
b) Tapetum, middle layers, epidermis,
4. Pollen tube was discovered by
endothecium
a) J.G.Kolreuter b) G.B.Amici
c) Endothecium, epidermis, middle
c) E.Strasburger d) E.Hanning
layers, tapetum
5. Size of pollen grain in Myosotis d) Tapetum, middle layers endothecium
a) 10 micrometer b) 20 micrometer epidermis
c) 200 micrometer d) 2000 micrometer

www.tntextbooks.in
9. Identify the incorrect pair 16. A Plant called X possesses small flower with
a) sporopollenin - exine of pollen grain reduced perianth and versatile anther. The
b) tapetum – nutritive tissue for probable agent for pollination would be
developing microspores a)water b)air
c) Nucellus – nutritive tissue for c)butterflies d)beetles
developing embryo
d) obturator – directs the pollen tube into 17. Consider the following statement(s)
micropyle i) In Protandrous flowers pistil matures
10. Assertion : Sporopollenin preserves earlier
pollen in fossil deposits ii) In Protogynous flowers pistil matures
Reason : Sporopollenin is resistant earlier
to physical and biological iii) Herkogamy is noticed in unisexual flowers
decomposition iv) Distyly is present in Primula
a) assertion is true; reason is false a) i and ii are correct
b) assertion is false; reason is true b) ii and iv are correct
c) Both Assertion and reason are not true c) ii and iii are correct
d) Both Assertion and reason are true. d) i and iv are correct
11. Choose the correct statement(s) about 18. Coelorhiza is found in
tenuinucellate ovule
a)Paddy b)Bean
a) Sporogenous cell is hypodermal
c)Pea d)Tridax
b) Ovules have fairly large nucellus
19. Parthenocarpic fruits lack
c) sporogenous cell is epidermal
d) ovules have single layer of nucellus tissue a)Endocarp b)Epicarp
c)Mesocarp d) seed
12. Which of the following represent
20. In majority of plants pollen is liberated at
megagametophyte
a) 1 celled stage b) 2 celled stage
a) Ovule b)Embryo sac
c) 3 celled stage d) 4 celled stage
c)Nucellus d)Endosperm 21. What is reproduction?
22. Mention the contribution of Hofmeister
13. In Haplopappus gracilis, number of
towards Embryology.
chromosomes in cells of nucellus is 4.
23. List out two sub-aerial stem modifications
What will be the chromosome number in
with example.
Primary endosperm cell?
24. What is layering?
a)8 b)12 c)6 d)2 25. What are clones?
14. Transmitting tissue is found in 26. A detached leaf of Bryophyllum produces
new plants. How?
a) Micropylar region of ovule
27. Differentiate Grafting and Layering.
b) Pollen tube wall
28. “Tissue culture is the best method for
c) Stylar region of gynoecium
propagating rare and endangered plant
d) Integument
species”- Discuss.
29. Distinguish mound layering and air layering.
15. The scar left by funiculus in the seed is
30. Explain the conventional methods adopted
a)tegmen b)radicle in vegetative propagation of higher plants.
c)epicotyl d)hilum

www.tntextbooks.in
31. Highlight the milestones from the history of Monocot seed.

plant embryology. 53. Give a detailed account on
32. Discuss the importance of Modern methods parthenocarpy. Add a note on its
in reproduction of plants. significance.
33. What is Cantharophily.
Glossary
34. List any two strategy adopted by bisexual
Apospory: The process of embryo sac formation
flowers to prevent self-pollination.
from diploid cells of nucellus as a result of
35. What is endothelium. mitosis
36. “The endosperm of angiosperm is Budding: A method of asexual reproduction
different from gymnosperm”. Do you where small outgrowth(Bud) from a parent cell
agree. Justify your answer. are produced
37. Define the term Diplospory. Callus: Undifferentiated mass of cells obtained
38. What is polyembryony. How it can through tissue culture.
commercially exploited. Clone: Genetically identical individuals.
39. Why does the zygote divides only after Endothecium: A single layer of hygroscopic,
the division of Primary endosperm cell. radially elongated cells found below the epidermis
of anther which helps in dehiscence of anther.
40. What is Mellitophily?
Fertilization: The act of fusion of male and
41. “Endothecium is associated with
female gamete
dehiscence of anther” Justify the
statement. Grafting: Conventional method of reproduction
where stock and scion are joined to produce
42. List out the functions of tapetum. new plant.
43. Write short note on Pollen kitt. Horticulture: Branch of plant science that
44. Distinguish tenuinucellate and deals with the art of growing fruits, vegetables,
crassinucellate ovules. flowers and ornamental plants.
45. ‘Pollination in Gymnosperms is different Nucellus: The diploid tissue found on the inner
from Angiosperms’ – Give reasons. part of ovule next to the integuments.
46. Write short note on Heterostyly. Pollenkitt: A sticky covering found on the
surface of the pollen that helps to attract insects.
47. Enumerate the characteristic features of
Regeneration: Ability of organisms to replace
Entomophilous flowers
or restore the lost parts.
48. Discuss the steps involved in
Sporopollenin: Pollen wall material derived
Microsporogenesis.
from carotenoids and is resistant to physical
49. With a suitable diagram explain the and biological decomposition.
structure of an ovule.
Tapetum: Nutritive tissue for the developing
50. Give a concise account on steps involved sporogenous tissue
in fertilization of an angiosperm plant.
Transmitting tissue: A single layer of glandular
51. What is endosperm. Explain the types. canal cells lining the inner part of style.
52. Differentiate the structure of Dicot and

www.tntextbooks.in
APPENDIX
Flower
Microspore
mother cell
Anther
is
os
ei
M
Megaspore Megaspore
mother cell Pollen (n)
(n)
Sporophyte (2n)
Embyo sac
Egg (n) Male

gametes (n)
Embryo (2n)
Endosperm Endosperm
(3n) nucleus (3n) Syngamy
Zygote
Double fertilization
(2n)
Pollen calendar shows the production of pollen by

plants during different seasons. This benefits the
allergic persons. Pollen grains cause allergic reactions
like asthma, bronchitis, hay fever, allergic rhinitis etc.,
Parthenium hysterophorus L. (Family-Asteraceae)
is commonly called Carrot grass is a native of tropical
America and was introduced into India as a contaminant
along with cereal wheat. The pollen of this plant cause
Allergy.

www.tntextbooks.in
• The receptacle becomes fleshy and edible into a fleshy structure

around the fruit enclosing the seeds as in Pyrus called caruncle. (Ricinus
malus (apple) communis).
• The calyx may persist and • The funiculus develops Ricinus - Caruncle
enlarge (Solanum melongena) into a fleshy structure
or may cover the fruit which is often very colourful and called aril.
(Physalis minima) (Myristica and Pithecellobium)
Physalis - Persistent calyx
• The flower stalk or axis
below the gynoecium
enlarges into a juicy pear Aril
shaped body which is edible
Myristica Pithecellobium
(Anacardium occidentale).
The Perianth becomes • The nucellar tissue is either absorbed completely
Anacardium -
fleshy as in Jack fruit. pedicel (edible) by the developing embryo sac and embryo or
small portion may remain as storage tissue. Thus
• The cells present at the tip of the outer
the remnant of nucellar tissue in the seed is called
integument around the micropyle develop
perisperm. Example: Black pepper and beet root

www.tntextbooks.in
UNIT VII: Genetics

Chapter
2 Classical Genetics
Genetics is the study of how living

Learning Objectives things receive common traits from previous
generations. No field of science has changed the
The Learner will be able to world more, in the past 50 years than genetics.

Differentiate The scientific and technological advances in
classical and genetics have transformed agriculture, medicine
modern genetics. and forensic science etc.

Understand Genetics – The Science of heredity (Inheritance)
the concepts - “Genetics” is the branch of biological science
of principles of which deals with the mechanism of transmission
of characters from parents to offsprings. The term
inheritance.
Genetics was introduced by W. Bateson in 1906.

Describe the extensions of Mendelism.
The four major subdisciplines of genetics are

Explain polygenic inheritance and
1. Transmission Genetics / Classical Genetics
Pleiotropy. – Deals with the transmission of genes

Analyze extra chromosomal from parents to offsprings. The foundation
inheritance in cytoplasmic organelles. of classical genetics came from the study
of hereditary behaviour of seven genes by
Gregor Mendel.
Chapter outline
2. Molecular Genetics – Deals with the
structure and function of a gene at molecular
2.1 Heredity and Variation level.
2.2 Mendelism 3. Population Genetics – Deals with heredity
2.3 L aws of Mendelian Inheritance in groups of individuals for traits which is
2.4 Monohybrid, Dihybrid, cross, determined by a few genes.
Backcross and Testcross 4. Quantitative Genetics – Deals with heredity
of traits in groups of individuals where
2.5 Interaction of Genes -Intragenic
the traits are governed by many genes
and Intergenic Incomplete
simultaneously.
dominance, Lethal genes, Epistasis
2.6 Polygenic inheritance in Wheat What is the reason for similarities, differences
of appearance and skipping of generations?
kernel colour, Pleiotropy –
Pisum sativum Genes – Functional Units of inheritance:
The basic unit of heredity (biological
2.7 Extra chromosomal inheritance-
information) which transmits biochemical,
Cytoplasmic inheritance in anatomical and behavioural traits from
Chloroplast. parents to offsprings.
Classical Genetics 31

www.tntextbooks.in
2.1 Heredity and variation ey help the individuals to adapt

• Th
themselves to the changing environment.
Genetics is often described as a science which
deals with heredity and variation. • I t provides the genetic material for natural
selection
Heredity: Heredity is the transmission of
ariations allow breeders to improve better
• V
characters from parents to offsprings.
yield, quicker growth, increased resistance
Variation: The organisms belonging to the and lesser input.
same natural population or species that They constitute the raw materials for
•
shows a difference in the characteristics is evolution.
called variation. Variation is of two types (i)
Discontinuous variation and (ii) Continuous 2.2 Mendelism
variation The contribution of Mendel to Genetics is called
1. Discontinuous Variation: Mendelism. It includes all concepts brought out
by Mendel through his original research on
Within a population there are some
plant hybridization. Mendelian genetic concepts
characteristics which show a limited form of
are basic to modern genetics. Therefore, Mendel
variation. Example: Style length in Primula,
is called as Father of Genetics.
plant height of garden pea. In discontinuous
variation, the characteristics are controlled by 2.2.1
Father of Genetics – Gregor
one or two major genes which may have Johann Mendel (1822 – 1884)
two or more allelic forms. These variations are The first Geneticist,
genetically determined by inheritance factors. Gregor Johann
Individuals produced by this variation show Mendel unraveled
differences without any intermediate form the mystery of
between them and there is no overlapping heredity. He was
between the two phenotypes. The phenotypic born on 22nd July
expression is unaffected by environmental 1822 in Heinzendorf
conditions. This is also called as qualitative Silesia (now Hyncice,
Figure 2.1: Gregor
inheritance. Czechoslovakia),
Johann Mendel
2. Continuous Variation: Austria. After school
education, later he studied botany, physics and
This variation may be due to the combining mathematics at the University of Vienna.He
effects of environmental and genetic factors. then entered a monastery of St.Thomas at Brunn
In a population most of the characteristics in Austria and continued his interest in plant
exhibit a complete gradation, from one extreme hybridization.In 1849 Mendel got a temporary
to the other without any break. Inheritance position in a school as a teacher and he performed
of phenotype is determined by the combined a series of elegant experiments with pea plants
effects of many genes, (polygenes) and in his garden. In 1856, he started his historic
environmental factors. This is also known as studies on pea plants. 1856 to 1863 was the
quantitative inheritance. Example: Human period of Mendel’s hybridization experiments
height and skin color. on pea plants. Mendel discovered the principles
Importance of variations of heredity by studying the inheritance of seven
ariations make some individuals better
• V pairs of contrasting traits of pea plant in his
fitted in the struggle for existence. garden. Mendel crossed and catalogued 24,034
plants through many generations. His paper

www.tntextbooks.in
entitled “Experiments on Plant Hybrids” was experiments with several true-breeding lines of
presented and published in The Proceedings of pea plants. A true breeding lines (Pure-breeding
the Brunn Society of Natural History in 1866. strains) means it has undergone continuous
Mendel was the first systematic researcher in self pollination having stable trait inheritance
the field of genetics. from parent to offspring. Matings within pure
Mendel was successful because: breeding lines produce offsprings having specific
parental traits that are constant in inheritance
He applied mathematics and statistical
•
and expression for many generations. Pure line
methods to biology and laws of probability
breed refers to homozygosity only. Fusion of
to his breeding experiments.
male and female gametes produced by the same
He followed scientific methods and kept
• individual i.e pollen and egg are
6WHSVLQFURVVSROOLQDWLRQRISHDIORZHUV
accurate and detailed records that include
quantitative data of the outcome of his :KLWHIORZHU
crosses.
His experiments were carefully planned
• 3ROOHQPDOHVH[
RUJDQLVFXWRII
and he used large samples. UHPRYHG
The pairs of contrasting characters which

• 3ROOHQ
were controlled by factor (genes)were 3LVWLO 3ROOHQRIZKLWH

IORZHULVWDNHQDQG
present on separate chromosomes. (Figure 3XUSOHIORZHU WUDQVIHUUHGWRSLVWLO
RISXUSOHIORZHU
2.4) 3DUHQWDO3
7KHIHUWLOL]HGSLVWLOJHWV
The parents selected by Mendel were pure
• PDWXUHDQGEHFRPHVSRGV
breed lines and the purity was tested by self

crossing the progeny for many generations. 6HHGVLQHDFK
SRGDUHUHDG\
WREHSODQWHG
Mendel’s Experimental System – The

$OORIIVSULQJV
Garden pea. DUHSXUSOH
He chose pea plant because, )JHQHUDWLRQV
• It is an annual plant and has clear

contrasting characters that are controlled
by a single gene separately.
Self-fertilization occurred under normal
• Figure 2.2: Steps in cross pollination of pea
conditions in garden pea plants. Mendel flowers
used both self-fertilization and cross- derived from the same plant is known as self-
fertilization. fertilization. Self pollination takes place in
The flowers are large hence emasculation
• Mendel’s peas. The experimenter can remove
and pollination are very easy for the anthers (Emasculation) before fertilization
hybridization. and transfer the pollen from another variety of
2.2.2 Mendel’s experiments on pea plant pea to the stigma of flowers where the anthers
are removed. This results in cross-fertilization,
Mendel’s theory of inheritance, known as the which leads to the creation of hybrid varieties
Particulate theory, establishes the existence of with different traits. Mendel’s work on the
minute particles or hereditary units or factors, study of the pattern of inheritance and the
which are now called as genes. He performed principles or laws formulated, now constitute
artificial pollination or cross pollination the Mendelian Genetics.

www.tntextbooks.in
The First Model Organism in Genetics – Garden Peas

(Pisum sativum) – Seven characters studied by Mendel. Can you identify Mendel’s gene for
regulating white colour in peas? Let us find
&KDUDFWHU *HQH 'RPLQDQW7UDLW 5HFHVVLYH7UDLW
the molecular answer to understand the
gene function. Now the genetic mystery of
6WHP /H
OHQJWK
7DOO 'ZDUI
Mendel’s white flowers is solved.
It is quite fascinating to trace the Mendel’s
3RG 9
genes. In 2010, the
,Q G
,QIODWHG &R
&
&RQVWULFWHG
VKDSH gene responsible
6HHG
VKDSH
5 G
5RXQG :ULQNOHG for regulating
flower colour
6HHG , <HOORZ
FRORXU *UHHQ in peas were
identified by an Figure 2.5: Purple flower
)ORZHU )D $[LDO 7HUPLQDO
international team of Pea with Pea Gene A
SRVLWLRQ
of researchers. and White flower of Pea
It was called
:KLWH
)ORZHU
FRORXU
$ 3XUSOH Pea Gene A which encodes a protein
that functions as a transcription factor
3RG
FRORXU
*3 Q
*UHHQ <HOORZ which is responsible for the production of
anthocyanin pigment. So the flowers are
Figure 2.3:
Seven characters of Pisum purple. Pea plants with white flowers do not
sativum studied by Mendel. have anthocyanin, even though they have
Table 2.1 Seven characters of Pisum sativum the gene that encodes the enzyme involved
with genes in anthocyanin synthesis.
Researchers delivered normal copies of
)ORZHU 3RG
FRORXU VKDSH
3RG
FRORXU gene A into the cells of the petals of white
3ODQW
KHLJKW 6HHG flowers by the gene gun method. When
VKDSH
Gene A entered in a small percentage of
cells of white flowers it is expressed in those
6HHG
)ORZHU
SRVLWLRQ
particular cells, accumulated anthocyanin
FRORXU
pigments and became purple.
In white flowers the gene A sequence showed
a single-nucleotide change that makes
&KURPRVRPHQXPEHU
the transcription factor inactive. So the
Figure 2.4: Mendel’s seven characters in Garden mutant form of gene A do not accumulate
Peas, shown on the plant’s seven chromosomes anthocyanin and hence they are white.
Mendel worked at the rules of inheritance
three biologists, Hugo de Vries of Holland, Carl
and arrived at the correct mechanism before any
Correns of Germany and Erich von Tschermak
knowledge of cellular mechanism, DNA, genes,
of Austria.
chromosomes became available. Mendel insights
and meticulous work into the mechanism of 2.2.3 Terminology related to Mendelism
inheritance played an important role which led Mendel noticed two different expressions of
to the development of improved crop varieties a trait – Example: Tall and dwarf. Traits are
and a revolution in crop hybridization. expressed in different ways due to the fact that a
Mendel died in 1884. In 1900 the work of gene can exist in alternate forms (versions) for
Mendel’s experiments were rediscovered by the same trait is called alleles.

www.tntextbooks.in
If an individual has two identical alleles of 2.3 Monohybrid cross

a gene, it is called as homozygous(TT). An
Monohybrid inheritance is the inheritance of a
individual with two different alleles is called
single character i.e. plant height.It involves the
heterozygous(Tt). Mendels non-true breeding
inheritance of two alleles of a single gene. When
plants are heterozygous, called as hybrids.
the F1 generation was selfed Mendel noticed that
When the gene has two alleles the dominant 787 of 1064 F2 plants were tall, while 277 of 1064
allele is symbolized with capital letter and the were dwarf. The dwarf trait disappeared in the F1
recessive with small letter. When both alleles are generation only to reappear in the F2 generation.
recessive the individual is called homozygous The term genotype is the genetic constitution
recessive (tt) dwarf pea plants. An individual of an individual. The term phenotype refers to
with two dominant alleles is called homozygous the observable characteristic of an organism. In
dominant (TT) tall pea plants. One dominant a genetic cross the genotypes and phenotypes
allele and one recessive allele (Tt) denotes non- of offspring, resulting from combining gametes
true breeding tall pea plants heterozygous tall. during fertilization can be easily understood with
2.2.4 Mendelian inheritance – Mendel’s the help of a diagram called Punnett’s Square named
Laws of Heredity after a British Geneticist Reginald C.Punnett.
Mendel proposed two rules based on his It is a graphical representation to calculate the
observations on monohybrid cross, today these Tall
P generation Dwarf
rules are called laws of inheritance The first law (True - breeding) (True - breeding)
TT tt
is The Law of Dominance and the second law
is The Law of Segregation. These scientific laws
play an important role in the history of evolution.
X
The Law of Dominance: The characters are
controlled by discrete units called factors which
occur in pairs. In a dissimilar pair of factors one T t
member of the pair is dominant and the other Tt
F1 generation T (tall) t
is recessive. This law gives an explanation to the Tt Tt
All tall (Selfed) (tall) (tall)
monohybrid cross (a) the expression of only one Tt
of the parental characters in F1 generation and (b) (tall)
the expression of both in the F2 generation. It also

F2 generation T
explains the proportion of 3:1 obtained at the F2 T
gametes gametes
The Law of Segregation (Law of Purity of Homozygous
tall plant
gametes): Alleles do not show any blending, t t
(TT)
both characters are seen as such in the F2 Heterozygous Heterozygous
tall plant tall plant
generation although one of the characters is not (Tt) (Tt)
seen in the F1 generation. During the formation Homozygous
dwarf plant
of gametes, the factors or alleles of a pair separate (tt)
and segregate from each other such that each Offspring (F2)
gamete receives only one of the two factors. A genotypes TT Tt tt
homozygous parent produces similar gametes Genotypic Ratio 1 : 2 : 1

and a heterozygous parent produces two kinds
Phenotypes Tall Dwarf
of gametes each having one allele with equal
Phenotypic Ratio 3 : 1
proportion. Gametes are never hybrid.
Figure 2.6: Monohybrid Cross

www.tntextbooks.in
probability of all possible genotypes of offsprings known as empirical laws.

in a genetic cross.The Law of Dominance and the 2. 3.2 Test cross
Law of Segregation give suitable explanation to Test cross is crossing an individual of unknown
Mendel’s monohybrid cross. genotype with a homozygous recessive.
In Mendel’s monohybrid cross all the plants
Reciprocal cross – In one experiment, the
are tall in F1 generation. In F2 tall and dwarf plants
tall pea plants were pollinated with the pollens
were in the ratio of 3:1.Mendel self pollinated
from a true-breeding dwarf plants, the result
dwarf F2 plants and got dwarf plants in F3 and F4
was all tall plants. When the parental types were generations. So he concluded that the genotype of
reversed, the pollen from a tall plant was used to dwarf was homozygous (tt). The genotypes of tall
pollinate a dwarf pea plant which gave only tall plants TT or Tt from F1and F2 cannot be predicted.
plants. The result was the same - All tall plants. But how we can tell if a tall plant is homozygous
Tall ( ) x Dwarf ( ) and Tall ( ) x Dwarf ( ) or heterozygous? To determine the genotype of a
matings are done in both ways which are called tall plant Mendel crossed the plants from F2 with
reciprocal crosses.The results of the reciprocal the homozygous recessive dwarf plant. This he
crosses are the same. So it was concluded that the called a test cross. The progenies of the test cross
trait is not sex dependent. The results of Mendel’s can be easily analysed to predict the genotype of
monohybrid crosses were not sex dependent. the plant or the test organism. Thus in a typical test
cross an organism (pea plants) showing dominant
The gene for plant height has two alleles: Tall
phenotype (whose genotype is to be determined)
(T) x Dwarf (t). The phenotypic and genotypic
is crossed with the recessive parent instead of self
analysis of the crosses has been shown by crossing. Test cross is used to identify whether
Checker board method or by Forkline method. an individual is homozygous or heterozygous for
2.3.1 Mendel’s analytical and empirical dominant character.
approach If heterozygous tall test cross
Mendel chose two contrasting traits for each Parental (P) F1 Heterozygous tall x Homozygous dwarf
Phenotypes
character. So it seemed logical that two distinct Tt tt
Genotypes
factors exist. In F1 the recessive trait and its
factors do not disappear and they are hidden or Gametes T t t t
masked only to reappear in ¼ of the F2 generation.
He concluded that tall and dwarf alleles of F1 Offspring (F1)
Tt tt
heterozygote segregate randomly into gametes. genotypes
Mendel got 3:1 ratio in F2 between the dominant Genotypic Ratio 1 : 1

and recessive trait. He was the first scientist to use
Phenotypes Tall Dwarf
this type of quantitative analysis in a biological
experiment. Mendel’s data is concerned with the Phenotypic Ratio 1 : 1
proportions of offspring.
Mendel’s analytical approach is truly an t t
outstanding scientific achievement. His meticulous gametes Homozygous gametes
work and precisely executed breeding experiments dwarf plant
T (tt)
t
proposed that discrete particulate units of heredity
are present and they are transmitted from one Heterozygous Homozygous
tall plant dwarf plant
generation to the other. Now they are called as (tt)
(Tt)
genes. Mendel’s experiments were well planned to Heterozygous
determine the relationships which govern hereditary tall plant
traits. This rationale is called an empirical approach. (Tt)
Laws that were arrived from an empirical approach is

www.tntextbooks.in
If homozygous tall test cross

Why Mendel’s pea plants are tall and dwarf?
Parental (P) F1 Homozygous tall x Homozygous dwarf
Phenotypes Find out the molecular explanation.
Genotypes TT tt
Molecular characterization of Mendel’s
gene for plant height.
Gametes T T t t
The plant height is controlled by a single gene
Offspring (F1) with two alleles. The reason for this difference
Tt Tt
genotypes in plant height is due to the following facts:
Phenotypes Tall Tall (i) the cells of the pea plant have the ability to
All tall plants convert a precursor molecule of gibberellins
into an active form (GA1) (ii) Tall pea plants
T t
have one allele (Le) that codes for a protein
gametes Heterozygous gametes
(functional enzyme) which functions normally
tall plant
T (Tt)
t in the gibberellin-synthesis pathway and
Heterozygous catalyzes the formation of gibberellins (GA1).
Heterozygous
tall plant
tall plant The allele is dominant even if it is two (Le Le)
(Tt)
(Tt) or single (Le le), it produces gibberellins and
Heterozygous the pea plants are tall. Dwarf pea plants have
tall plant
two recessive alleles (le le) which code for
(Tt)
non-functional protein, hence they are dwarf.
Gene for plant height in Peas
Figure 2.7: Test cross
2.3.3 Back cross
Back cross is a cross of F1 hybrid with any
•
one of the parental genotypes. The back
cross is of two types; they are dominant
back cross and recessive back cross.
It involves the cross between the F1 offspring
• Tall pea plants Dwarf pea plant
with either of the two parents. (Le Le / Le le) (le le)
When the F1offsprings are crossed with
•
Gibberellin GA1 Gibberellin Gibberellins
the dominant parents all the F2 develop are not
Active Precursor
dominant character and no recessive Precursor produced
molecule gibberellins molecule
individuals are obtained in the progeny.
Le allele codes for le allele codes for
If the F1 hybrid is crossed with the recessive
• functional enzyme GA1 nonfunctional enzyme
parent individuals of both the phenotypes
Figure 2.8: Gene for plant height in Peas
appear in equal proportion and this cross is
specified as test cross. is the inheritance of two separate genes each
with two alleles.
The recessive back cross helps to identify
•
the heterozygosity of the hybrid. Law of Independent Assortment – When
two pairs of traits are combined in a hybrid,
2.3.4 Dihybrid cross segregation of one pair of characters is
It is a genetic cross which involves individuals independent to the other pair of characters. Genes
differing in two characters. Dihybrid inheritance that are located in different chromosomes assort

www.tntextbooks.in
independently during meiosis. Many possible P Generation Parent 1 Parent 2

combinations of factors can occur in the gametes. Parental Round yellow cotyledon X Wrinkled green cotyledon
phenotype
Homozygous Homozygous
Round seeds Wrinkled seeds Diploid
Yellow x Green parental
cotyledon cotyledon genotype
RR YY rr yy
Parental RRYY rryy R r

Meiosis Meiosis Haploid X
gametes Y y
Gametes
RY ry
F1 generation R Y
F1 generation RrYy y
r
Heterozygous
F1 phenotype : All round-yellow cotyledon
F1 genotypes : All Rr Yy
Round seeds
Yellow cotyledon
F1 Generation Parent 1 Parent 2
RrYy x RrYy
(selfed)
Round yellow cotyledon X Round yellow cotyledon
Gametes RY Ry rY ry RY Ry rY ry
Selfed – Genes are present on separate chromosomes and random

assortment takes place. So four different types of gametes in
equal proportions are formed. Law of Independent Assortment.
Rr Yy Rr Yy
Figure 2.9:
Dihybrid cross – Segregation
Haploid
of gametes F1 gametes
RY Ry rY ry RY Ry rY ry
Independent assortment leads to genetic
F1 gametes
diversity. If an individual produces genetically
1/4 1/4 1/4 1/4
dissimilar gametes it is the consequence of
independent assortment. Through independent F2 Generation RY Ry rY ry
assortment, the maternal and paternal members

1/4
of all pairs were distributed to gametes, so all RY RR YY RR Yy Rr YY Rr Yy
possible chromosomal combinations were 1/4
produced leading to genetic variation. In sexually F1 RR Yy RR yy Rr Yy Rr yy

Ry
reproducing plants / organisms, due to independent gametes
1/4
assortment, genetic variation takes place which is

Rr YY Rr Yy rr YY rr Yy
important in the process of evolution. The Law of rY
Segregation is concerned with alleles of one gene 1/4
Rr Yy Rr yy rr Yy rr yy
but the Law of Independent Assortment deals with ry
Phenotypic Ratio 9:3:3:1
the relationship between genes.
Figure 2.10: Dihybrid Cross in Garden peas
The crossing of two plants differing in two
breeding round yellow parent is represented by
pairs of contrasting traits is called dihybrid
the genotype RRYY and the pure breeding green
cross. In dihybrid cross, two characters (colour
wrinkled parent is represented by the genotype
and shape) are considered at a time. Mendel
rryy. During gamete formation the paired genes
considered the seed shape (round and wrinkled)
of a character assort out independently of the
and cotyledon colour (yellow & green) as the two
other pair. During the F1 x F1 fertilization each
characters. In seed shape round (R) is dominant
zygote with an equal probability receives one of
over wrinkled (r) ; in cotyledon colour yellow
the four combinations from each parent. The
(Y) is dominant over green (y). Hence the pure

www.tntextbooks.in
resultant gametes thus will be genetically different

How does the wrinkled gene make
and they are of the following four types:
Mendel’s peas wrinkled? Find out the
molecular explanation. 1) Yellow round (YR) - 9/16
2) Yellow wrinkled (Yr) - 3/16
The protein called starch branching
3) Green round (yR) - 3/16
enzyme (SBEI) is encoded by the wild-type
allele of the gene (RR) which is dominant. 4) Green wrinkled (yr) - 1/16
When the seed matures, this enzyme SBEI These four types of gametes of F1 dihybrids
catalyzes the formation of highly branched unite randomly in the process of fertilization and
starch molecules. Normal gene (R) has produce sixteen types of individuals in F2 in the
become interrupted by the insertion of extra ratio of 9:3:3:1 as shown in the figure. Mendel’s
piece of DNA (0.8 kb) into the gene, resulting 9:3:3:1 dihybrid ratio is an ideal ratio based on the
in r allele. In the homozygous mutant form of probability including segregation, independent
the gene (rr) which is recessive, the activity of assortment and random fertilization. In sexually
the enzyme SBEI is lost resulting in wrinkled reproducing organism / plants from the garden
peas. The wrinkled seed accumulates more
peas to human beings, Mendel’s findings laid the
sucrose and high water content. Hence the
foundation for understanding inheritance and
osmotic pressure inside the seed rises. As
revolutionized the field of biology. The dihybrid
a result, the seed absorbs more water and
when it matures it loses water as it dries. So cross and its result led Mendel to propose a second
it becomes wrinkled at maturation. When set of generalisations that we called Mendel's Law
the seed has atleast one copy of normal of independent assortment.
dominant gene heterozygous, the dominant
2.3.5 The Dihybrid test cross
allele helps to synthesize starch, amylopectin
an insoluble carbohydrate, with the osmotic The Dihybrid test cross
balance which minimises the loss of water The F1 hybrid plant (round yellow peas) is crossed with
resulting in smooth structured round seed. homozygous double recessive genotype, wrinkled green
peas (rryy). This is called dihybrid test cross with the
ratio of 1:1:1:1.
The wrinkled gene make Mendel’s
Parental (P) Heterozygous Homozygous
peas wrinkled Phenotypes F round peas Wrinkled peas
1
Yellow x Green
cotyledon cotyledon
Round Peas & Wrinkled Peas

RR rr
Genotypes RrYy x rryy
Dominant allele RR Active enzyme SBE - I
Linear Gametes RY Ry rY ry ry ry ry ry
Branched
unbranched Round
starch
starch Converted peas Gametes RY Ry rY ry
amylopectin
amylose to RrYy Rryy rrYy rryy
Recessive allele rr Inactive enzyme all ry Round Round Wrinkled Wrinkled

Yellow Green Yellow Green
Linear Linear Genotypes RrYy Rryy rrYy rryy
unbranched unbranched Genotypic
No Wrinkled ratio 1 : 1 : 1 : 1
starch starch peas round round Wrinkled Wrinkled
amylose conversion amylose Phenotypes
Yellow Green Yellow Green
Phenotypic
ratio 25% 25% 25% 25%
Figure 2.11: Molecular explanation of
round and wrinkled peas. Figure 2.12: Dihybrid test cross

www.tntextbooks.in
2.3.7 Extensions of Mendelian Genetics interactions are possible between the genes.
Apart from monohybrid, dihybrid and This gene interaction concept was introduced
trihybrid crosses, there are exceptions to and explained by W. Bateson. This concept
Mendelian principles, i.e. the occurrence of is otherwise known as Factor hypothesis or
different phenotypic ratios. The more complex Bateson’s factor hypothesis. According to
patterns of inheritance are the extensions of Bateson’s factor hypothesis, the gene interactions
Mendelian Genetics. There are examples where can be classified as
phenotype of the organism is the result of the • Intragenic gene interactions or Intra allelic
interactions among genes. or allelic interactions
• Intergenic gene interactions or inter allelic
Gene interaction – A single phenotype is
or non-allelic interactions
controlled by more than one set of genes, each of
which has two or more alleles. This phenomenon 2.4 Intragenic interactions
is called Gene Interaction. Many Interactions take place between the alleles of
characteristics of the organism the same gene i.e., alleles at the same locus is
including structural and chemical called intragenic or intralocus gene interaction.
which constitute the phenotype are It includes the following:
the result of interaction between 1) Incomplete dominance (2) Codominance
two or more genes. (3) Multiple alleles (4) Pleiotropic genes are
Gene interactions common examples for intragenic interaction.
2.4.1. Incomplete dominance – No blending
of genes
Intralocus Interlocus
interactions interactions The German Botanist Carl Correns’s (1905)
Experiment - In 4 O’ clock plant, Mirabilis
(Allelic (Non-allelic
interactions) interactions) jalapa when the pure breeding homozygous
red (R1R1) parent is crossed with homozygous
white (R2R2), the phenotype of the F1 hybrid is
Epistatic / Additive /
heterozygous pink (R1R2). The F1 heterozygous
Non-epistatic Polygenic
interactions interactions phenotype differs from both the parental
homozygous phenotype. This cross did not
I. Dominant relationship exhibit the character of the dominant parent but
a) Complete dominance Example: Tall and an intermediate colour pink. When one allele
dwarf pea plants is not completely dominant to another allele
b) Incomplete dominance
it shows incomplete dominance. Such allelic
c) Codominance d) Over dominance
II. Lethal genes interaction is known as incomplete dominance.
a) Dominant lethals b) Recessive lethals F1 generation produces intermediate phenotype
c) Conditional lethals d) Sex linked lethals pink coloured flower. When pink coloured
e) Balanced lethals plants of F1 generation were interbred in F2 both
III. Multiple alleles phenotypic and genotypic ratios were found to
Figure 2.13: Gene Interaction be identical as 1 : 2 : 1(1 red : 2 pink : 1 white).
Genotypic ratio is 1 R1R1 : 2 R1R2 : 1 R2R2.From
Mendelian experiments prove that a
this we conclude that the alleles themselves
single gene controls one character. But in the
remain discrete and unaltered proving the
post Mendelian findings, various exception
Mendel’s Law of Segregation. The phenotypic
have been noticed, in which different types of

www.tntextbooks.in
and genotypic ratios are the same. There is no

blending of genes. In the F2 generation R1 and How are we going to interpret the lack of
dominance and give explanation to the
R2 genes segregate and recombine to produce
intermediate heterozygote phenotype?
red, pink and white in the ratio of 1 : 2 : 1. R1
allele codes for an enzyme responsible for the How will you explain incomplete
formation of red pigment. R2 allele codes for dominance at the molecular level?
defective enzyme. R1 and R2 genotypes produce Gene expression is explained in a quantitative
only enough red pigments to make the flower way. Wild-type allele which is a functional
pink. Two R1R1 are needed for producing red allele when present in two copies (R1 R1)
flowers. Two R2R2 genes are needed for white produces an functional enzyme which
flowers. If blending had taken place, the original synthesizes red pigments. The mutant allele
pure traits would not have appeared and all F2 which is a defective allele in two copies (R2 R2)
plants would have pink flowers. It is very clear produces an enzyme which cannot synthesize
necessary red pigments. The white flower is
that Mendel’s particulate inheritance takes
due to the mutation causing complete loss
place in this cross which is confirmed by the
of function. The F1 intermediate phenotype
reappearance of original phenotype in F2. heterozygote (R1R2) has one copy of the allele
555HG 55:KLWH R1. R1 produces 50% of the functional protein
resulting in half of the pigment of red flowered
3JHQHUDWLRQ plant and so it is pink. The intermediate
phenotype pink heterogyzote with 50% of
functional protein is not enough to create the
55VHOIHG red phenotype homozygous, which makes
)JHQHUDWLRQ ,QWHUPHGLDWH
SKHQRW\SH
100% of the functional protein.
3LQN+HWHUR]\JRWH
IB alleles of I gene are codominant which follows
5 5
Mendels law of segregation. The codominance
5 5
was demonstrated in plants with the help of
5 5 electrophoresis or chromatography for protein
or flavonoid substance. Example: Gossypium
5 5 5 5
hirsutum and Gossypium sturtianum, their F1
hybrid (amphiploid) was tested for seed proteins
5 5
)JHQHUDWLRQ by electrophoresis. Both the parents have
different banding patterns for their seed proteins.
555555
In hybrids, additive banding pattern was noticed.
Figure 2.14:
Incomplete dominance in
Their hybrid shows the presence of both the
4 O’ clock plant
types of proteins similar to their parents.
2.4.2. Codominance (1 : 2 : 1) The heterozygote genotype gives rise to a
This pattern occurs due to simultaneous phenotype distinctly different from either of the
(joint) expression of both alleles in the homozygous genotypes. The F1 heterozygotes
heterozygote - The phenomenon in which two produce a F2 progeny in a phenotypic and
alleles are both expressed in the heterozygous genotypic ratios of 1 : 2 : 1.
individual is known as codominance. Example: 2.4.3. Lethal genes
Red and white flowers of Camellia, inheritance
An allele which has the potential to cause
of sickle cell haemoglobin, ABO blood group
the death of an organism is called a “Lethal
system in humanbeings. In humanbeings, IA and

www.tntextbooks.in
Allele”. In 1907, E. Baur reported a lethal gene in characters simultaneously and such genes
snapdragon (Antirrhinum sp.). It is an example are called pleiotropic gene. were crossed with
for recessive lethality. In snapdragon there are a variety of peas having white flowers, light
three kinds of plants. coloured seeds and no spot on the axils of the
1. Green plants with chlorophyll. (CC) leaves, the three traits for flower colour, seed
2. Yellowish green plants with carotenoids are colour and a leaf axil spot all were inherited
referred to as pale green, golden or aurea together as a single unit. Another example is:
plants (Cc) sickle cell anemia.
3. White plants without any chlorophyll. (cc) 2.5 Intergenic gene interactions
The genotype of the homozygous green Interlocus interactions take
plants is CC. The genotype of the homozygous place between the alleles at
white plant is cc. different loci i.e between
The aurea plants have the genotype Cc alleles of different genes.It
because they are heterozygous of green and includes the following:
white plants. When two such aurea plants Dominant Epistasis – It
are crossed the F1 progeny has identical is a gene interaction in which
phenotypic and genotypic ratio of 1 : 2 : 1 (viz. two alleles of a gene at one locus interfere and
1 Green (CC) : 2 Aurea (Cc) : 1 White (cc)) suppress or mask the phenotypic expression
Since the white plants lack chlorophyll of a different pair of alleles of another gene at
pigment, they will not survive. So the F2 another locus. The gene that suppresses or masks
ratio is modified into 1 : 2. In this case the the phenotypic expression of a gene at another
homozygous recessive genotype (cc) is lethal. locus is known as epistatic. The gene whose
expression is interfered by non-allelic genes and
Antirrhinum Antirrhinum
F1 Heterozygote
aurea
x
aurea
prevents from exhibiting its character is known
Cc x Cc as hypostatic. When both the genes are present
F2
together, the phenotype is determined by the
1CC : 2 Cc : 1 cc
Green Aurea White (lethal) epistatic gene and not by the hypostatic gene.
Figure: 2.15: Lethal genes In the summer squash the fruit colour locus
has a dominant allele ‘W’ for white colour and a
The term “lethal” is applied to those recessive allele ‘w’ for coloured fruit. ‘W’ allele is
changes in the genome of an organism which
dominant that masks the expression of any colour.
produces effects severe enough to cause death.
In another locus hypostatic allele ‘G’ is for yellow
Lethality is a condition in which the death of
fruit and its recessive allele ‘g’ for green fruit. In the
certain genotype occurs prematurely. The fully
dominant or fully recessive lethal allele kills first locus the white is dominant to colour where
the carrier individual only in its homozygous as in the second locus yellow is dominant to green.
condition. So the F2 genotypic ratio will be 2 : 1 When the white fruit with genotype WWgg is
or 1 : 2 respectively. crossed with yellow fruit with genotype wwGG,
the F1 plants have white fruit and are heterozygous
2.4.4. Pleiotropy – A single gene affects (WwGg). When F1 heterozygous plants are crossed
multiple traits they give rise to F2 with the phenotypic ratio of 12
In Pleiotropy, the single gene affects multiple white : 3 yellow : 1 green.
traits and alter the phenotype of the organism.
The Pleiotropic gene influences a number of

www.tntextbooks.in
Inter-genic or non-allelic interaction

Parent
generation White fruit Yellow fruit F2 Ratio
S. Epistatic
WW gg X ww GG Example Phenotypic
No. interaction
ratio
Gametes Wg wG 1 Dominant Fruit colour 12 : 3 : 1
epistasis in summer
White fruit squash
F1 (selfed)
WwGg 2 Recessive Flower colour 9:3:4
epistasis of Antirrhinum
spp.
F2 WG Wg wG wg
3 Duplicate genes Fruit shape 9:6:1
WWGG WWGg WwGG WwGg with cumulative in summer
WG White White White White effect squash
Wg
WWGg WWgg WwGg Wwgg 4 Complementary Flower colour 9:7
White White White White genes in sweet peas
WwGG WwGg wwGG wwGg 5 Supplementary Grain colour 9:3:4
wG
White White Yellow Yellow genes in Maize
WwGg Wwgg wwGg wwgg 6 Inhibitor genes Leaf colour in 13 : 3
wg
White White Yellow Green rice plants
7 Duplicate genes Seed capsule 15 : 1
shape (fruit
Phenotypes shape) in
White fruit Yellow fruit Green fruit shepherd’s
Phenotypic 12 : 3 : 1 purse Bursa
ratio bursa-pastoris
Figure 2.16: Dominant epistasis in summer squash Table 2.3: Inter-genic interaction
Since W is epistatic to the alleles ‘G’ and 2.6 Polygenic Inheritance in Wheat
‘g’, the white which is dominant, masks the (Kernel colour)
effect of yellow or green. Homozygous Polygenic inheritance - Several genes combine
recessive ww genotypes only can give the to affect a single trait.
coloured fruits (4/16). Double recessive
A group of genes that together determine
‘wwgg’ will give green fruit (1/16). The Plants
(contribute) a characteristic of an organism
having only ‘G’ in its genotype (wwGg or
wwGG) will give the yellow fruit(3/16). is called polygenic inheritance. It gives
explanations to the inheritance of continuous
Intra –genic or allelic interaction traits which are compatible with Mendel’s Law.
F2
The first experiment on polygenic
S. Gene
Example Phenotypic inheritance was demonstrated by Swedish
No. interaction
ratio Geneticist H. Nilsson - Ehle (1909) in wheat
1 Incomplete Flower colour 1:2:1 kernels. Kernel colour is controlled by two
Dominance in Mirabilis genes each with two alleles, one with red kernel
jalapa. 1:2:1
colour was dominant to white. He crossed the
Flower colour
in snapdragon
two pure breeding wheat varieties dark red
(Antirrhinum and a white. Dark red genotypes R1R1R2R2 and
spp.) white genotypes are r1r1r2r2. In the F1 generation
2 Codominance ABO Blood 1:2:1 medium red were obtained with the genotype
group system in R1r1R2r2. F1 wheat plant produces four types of
humans gametes R1R2, R1r2, r1R2, r1r2. The intensity of
Table 2.2: Intra- genic interaction

www.tntextbooks.in
the red colour is determined by the number of R Parents R1 R1 R2 R2 X r1 r1 r2 r2
genes in the F2 generation. Dark red White
Four R genes: A dark red kernel colour is F1 R1 r1 R2 r2 Medium red

obtained.Three R genes: Medium - dark red F2 Genotype Phenotype
kernel colour is obtained.Two R genes: Medium- 1 R1 R1 R2 R2 Dark red
red kernel colour is obtained.One R gene: Light
2 R1 R1 R2 r2 Medium-dark red
red kernel colour is obtained.Absence of R 2
4
R1 r1 R2 R2 Medium-dark red
gene:Results in White kernel colour. 4 R1 r1 R2 r2 Medium red 15 red
Medium red to
1 6
The R gene in an additive manner produces the 1
R1 R1 r2 r2
r1 r1 R2 R2
Medium red 1 white
red kernel colour. The number of each phenotype 2

4
R1 r1 r2 r2 Light red
Light red
is plotted against the intensity of red kernel 2 r1 r1 R2 r2
colour which produces a bell shaped curve. This 1 r1 r1 r2 r2 White
represents the distribution of phenotype. Other

Figure 2.17 (b) : The genetic control of
example: Height and skin colour in humans are
colour in wheat kernels.
controlled by three pairs of genes.
Dark Red White Conclusion:
Parent R 1 R 1R 2R 2 r1 r1 r2 r2
X
generation Finally the loci that was studied by Nilsson –
Medium Red Ehle were not linked and the genes assorted
F1 generation
R1r1R2r2 independently.
Later, researchers discovered the third gene
F1 generation (selfed)
that also affect the kernel colour of wheat. The
R1r1R2r2 R1r1R2r2 three independent pairs of alleles were involved
X
in wheat kernel colour. Nilsson – Ehle found
R 1 R2 R 1 r2 r1R2 r1 r2
the ratio of 63 red : 1 white in F2 generation –
R1R1R2R2 R1R1R2r2 R1r1R2R2 R1r1R2r2
R 1R 2 1 : 6 : 15 : 20 : 15 : 6 : 1 in F2 generation.
R1R1R2r2 R1R1r2r2 R1r1R2r2 R1r1r2r2

R 1 r2 Parents AABBCC aabbcc
Dark red X White
F2 generation
R1r1R2R2 R1r1R2r2 r1r1R2R2 r1r1R2r2 Wheat Kernel Wheat Kernel
r1 R 2
AaBbCc
R1r1R2r2 R1r1r2r2 r1r1R2r2 r1r1r2r2 F1 Intermediate red
r1 r2
(Selfed)
The data produce a bell F2

shaped curve. which 1 6 15 20 15 6 1
demonstrate continuous Dark Moderate Intermediate Light Very light
Red red White
variation in wheat red red red red
kernel from dark red to
63 Red (many shades) : 1 White
white in F2
1 4 6 4 1
Figure 2.18: Polygenic inheritance in
Wheat kernel
From the above results Nilsson – Ehle
Dark White
showed that the blending inheritance was
Red Wheat kernel colour
not taking place in the kernel of wheat. In F2
Figure 2.17 (a): Polygenic inheritance in wheat generation plants have kernels with wide range
kernel colour

www.tntextbooks.in
of colour variation. This is due to the fact that

the genes are segregating and recombination
takes place. Another evidence for the absence
of blending inheritance is that the parental
Pale Green Dark Green Dark Green Pale Green
phenotypes dark red and white appear again leaved Plant x leaved Plant leaved Plant x leaved Plant
in F2. There is no blending of genes, only the (Male) (Female) (Male) (Female)
phenotype. The cumulative effect of several pairs

of gene interaction gives rise to many shades of
kernel colour. He hypothesized that the two loci
must contribute additively to the kernel colour
of wheat. The contribution of each red allele to F1 Dark Green F1 Pale Green
the kernel colour of wheat is additive. leaved leaved
2.7 Extra Chromosomal Inheritance Figure 2.19: Chloroplast inheritance

or Extra Nuclear Inheritance This inheritance is not through nuclear
(Cytoplasmic Inheritance) gene. It is due to the chloroplast gene found in
DNA is the universal genetic material. Genes the ovum of the female plant which contributes
located in nuclear chromosomes follow the cytoplasm during fertilization since the
Mendelian inheritance. But certain traits male gamete contribute only the nucleus but
are governed either by the chloroplast or not cytoplasm.
mitochondrial genes. This phenomenon is
known as extra nuclear inheritance. It is a kind
of Non-Mendelian inheritance. Since it involves
cytoplasmic organelles such as chloroplast and 9DULHJDWHG
mitochondrion that act as inheritance vectors, /HDI
it is also called Cytoplasmic inheritance. It is

based on independent, self-replicating extra
chromosomal unit called plasmogene located
in the cytoplasmic organelles, chloroplast and
mitochondrion.
$OOZKLWH
Chloroplast Inheritance FKORURSODVWV
It is found in 4 O’ Clock plant (Mirabilis jalapa). *UHHQ

RU
In this, there are two types of variegated leaves &KORURSODVWV
namely dark green leaved plants and pale green 1XFOHXV :KLWH
$OOJUHHQ
FKORURSODVWV
leaved plants. When the pollen of dark green &KORURSODVWV
leaved plant (male) is transferred to the stigma of

Figure 2.21: A cellular explanation of the variegated
pale green leaved plant (female) and pollen of pale
phenotype of the leaves in Mirabilis jalapa
green leaved plant is transferred to the stigma of
dark green leaved plant, the F1 generation of both Recently it has been discovered that
the crosses must be identical as per Mendelian cytoplasmic genetic male sterility is common in
inheritance. But in the reciprocal cross the F1 plant many plant species. This sterility is maintained
differs from each other. In each cross, the F1 plant by the influence of both nuclear and cytoplasmic
reveals the character of the plant which is used as genes. There are commonly two types of
female plant. cytoplasm N (normal) and S (sterile). The genes

www.tntextbooks.in
for these are found in mitochondrion. There are of Mendel’s gene for monohybrid cross, dihybrid
also restores of fertility (Rf) genes. Even though cross were explained. Extension of Mendelian
these genes are nuclear genes, they are distinct Genetics was dealt with examples for interaction
from genetic male sterility genes of other plants. among genes. Incomplete dominance is not an
Because the Rf genes do not have any expression example for blending inheritance. Incomplete
of their own, unless the sterile cytoplasm is dominance exhibits a phenotypic heterozygote
present. Rf genes are required to restore fertility intermediate between the two homozygous. In
in S cytoplasm which is responsible for sterility. plants codominance can be demonstrated by the
methods of electrophoresis or chromatography
So the combination of N cytoplasm with rfrf
for protein or flavonoid substances. Lethal genes
and S cytoplasm with RfRf produces plants
with an example are explained. Pleiotropy a single
with fertile pollens, while S cytoplasm with rfrf
gene which affects multiple traits was explained
produces only male sterile plants.
with an example of Pisum sativum. Dominant
Atavism epistatis in summer squash with 12 : 3 : 1 ratio was
Atavism is a modification of a biological discussed. Polygenic inheritance is an example
structure whereby an ancestral trait reappears for inheritance of continuous traits which is
after having been lost through reemergence compatible with Mendel’s laws. The inheritance
of sexual reproduction in the flowering plant of mitochondrial and chloroplast genes were
Hieracium pilosella is the best example for explained with examples which does not follow
Atavism in plants. the rules of nuclear genes.
Summary Evaluation
Gregor Johann Mendel, father of Genetics 1. Extra nuclear
unraveled the mystery of heredity through his inheritance is a
experiments on garden peas. Mendel’s laws, consequence of presence
analytical and empirical reasoning endure till of genes in
now guiding geneticists to study variation. The
a) Mitrochondria and
monohybrid cross of Mendel proved his particulate
chloroplasts
theory of inheritance. In F2 the alternative traits
were expressed in the ratio of 3 dominant and 1 b)
Endoplasmic reticulum and
recessive. The characteristic 3 : 1 segregation is mitrochondria
referred to as Mendelian ratio. Parents transmit c) Ribosomes and chloroplast
discrete information about the traits to their d) Lysososmes and ribosomes
offspring which Mendel called it as “factors”. To 2. In order to find out the different types of
test his experimental results Mendel devised a gametes produced by a pea plant having
powerful procedure called the test cross. Test cross the genotype AaBb, it should be crossed
is used to determine the genotype of an individual to a plant with the genotype
when two genes are involved. In Mendel’s dihyrbid
a) aaBB b) AaBB
cross, the two pairs of factors were inherited
independently. From the results of dihybrid cross c) AABB d) aabb
Mendel gave the Law of Independent Assortment. 3. How many different kinds of gametes
Mendel’s dihybrid ratio of 9 : 3 : 3 : 1 with the will be produced by a plant having the
representation of two new recombinations genotype AABbCC?
appeared in the progeny, i.e. round green peas a) Three b) Four
or wrinkled yellow peas. Molecular explanation
c) Nine d) Two

www.tntextbooks.in
4. Which one of the following is an example 9. Select the correct statement from the ones
of polygenic inheritance? given below with respect to dihydrid cross
a) Flower colour in Mirabilis Jalapa a) Tightly linked genes on the same
chromosomes show very few
b) Production of male honey bee
combinations
c) Pod shape in garden pea
b) Tightly linked genes on the
d) Skin Colour in humans same chromosomes show higher
5. In Mendel’s experiments with garden pea, combinations
round seed shape (RR) was dominant over c) Genes far apart on the same chromosomes
wrinkled seeds (rr), yellow cotyledon show very few recombinations
(YY) was dominant over green cotyledon d) Genes loosely linked on the
(yy). What are the expected phenotypes same chromosomes show similar
in the F2 generation of the cross RRYY x recombinations as the tightly linked
rryy? ones
a) Only round seeds with green cotyledons 10. Which Mendelian idea is depicted by a
b)
Only wrinkled seeds with yellow cross in which the F1 generation resembles
cotyledons both the parents
c)
Only wrinkled seeds with green a) Incomplete dominance
cotyledons b) Law of dominance
d) Round seeds with yellow cotyledons an c) Inheritance of one gene
wrinkled seeds with yellow cotyledons d) Co-dominance
6. Test cross involves 11. Fruit colour in squash is an example of
a) Crossing between two genotypes with a) Recessive epistatsis
recessive trait
b) Dominant epistasis
b) Crossing between two F1 hybrids
c) Complementary genes
c) Crossing the F1 hybrid with a double
d) Inhibitory genes
recessive genotype
12. In his classic experiments on Pea plants,
d) Crossing between two genotypes with
Mendel did not use
dominant trait
a)Flowering position b) Seed colour
7. In pea plants, yellow seeds are dominant
to green. If a heterozygous yellow seed c) Pod length d) Seed shape
pant is crossed with a green seeded plant, 13. The epistatic effect, in which the dihybrid
what ratio of yellow and green seeded cross 9:3:3:1 between AaBb Aabb is
plants would you expect in F1 generation? modified as
a) 9:1 b) 1:3 a) Dominance of one allele on another
b) 3:1 d) 50:50 allele of both loci
8. The genotype of a plant showing the b)
Interaction between two alleles of
dominant phenotype can be determined different loci
by c)
Dominance of one allele to another
a) Back cross b) Test cross alleles of same loci
c) Dihybrid corss d) Pedigree d) Interaction between two alleles of some
analysis loci

www.tntextbooks.in
14. In a test cross involving F1 dihybrid a) Dominance b) Inheritance

flies, more parental type offspring were c) Codominance d) Heredity
produced than the recombination type 20. The dominant epistatis ratio is
offspring. This indicates a) 9:3:3:1 b) 12:3:1
a) The two genes are located on two c) 9:3:4 d) 9:6:1
different chromosomes 21. Select the period for Mendel’s
b) Chromosomes failed to separate during hybridization experiments
meiosis a) 1856 - 1863 b) 1850 - 1870
c) The two genes are linked and present c) 1857 - 1869 d) 1870 - 1877
on the some chromosome 22. Among the following characters which
d) B oth of the characters are controlled by one was not considered by Mendel in his
more than one gene experimentation pea?
15. The genes controlling the seven pea a) Stem – Tall or dwarf
characters studied by Mendel are known b) Trichomal glandular or non-glandular
to be located on how many different c) Seed – Green or yellow
chromosomes? d) Pod – Inflated or constricted
a) Seven b) Six 23. Name the seven contrasting traits of
c) Five d) Four Mendel.
16. Which of the following explains how 24. What is meant by true breeding or pure
progeny can posses the combinations of breeding lines / strain?
traits that none of the parent possessed? 25. Give the names of the scientists who
rediscovered Mendelism.
a) Law of segregation
26. What is back cross?
b) Chromosome theory 27. Define Genetics.
c) Law of independent assortment 28. What are multiple alleles
d) Polygenic inheritance 29. What are the reasons for Mendel’s
17. “Gametes are never hybrid”. This is a successes in his breeding experiment?
statement of 30. Explain the law of dominance in
a) Law of dominance monohybrid cross.
b) Law of independent assortment 31. Differentiate incomplete dominance and
c) Law of segregation codominance.
d) Law of random fertilization 32. What is meant by cytoplasmic inheritance
18. Gene which suppresses other genes 33. Describe dominant epistasis with an
activity but does not lie on the same locus example.
is called as 34. Explain polygenic inheritance with an
example.
a) Epistatic b) Supplement only
35. Differentiate continuous variation with
c) Hypostatic d) Codominant discontinuous variation.
19. Pure tall plants are crossed with pure 36. Explain with an example how single
dwarf plants. In the F1 generation, all genes affect multiple traits and alleles the
plants were tall. These tall plants of F1 phenotype of an organism.
generation were selfed and the ratio of 37. Bring out the inheritance of chloroplast
tall to dwarf plants obtained was 3:1. This gene with an example.
is called

www.tntextbooks.in
Glossary Heterozygous: Diploid organisms that have

two different allels at a specific gene locus are
Alleles: Alternative forms of a gene.
said to be heterozygous.
Back Cross: Crosses between F1 off-springs with
Homozygous: A diploid organism in which
either of the two parents (hybrid) are known as
both alleles are the same at a given gene locus is
back cross
said to be homozygous.
F1 / First Filial Generation: The second stage
Hybrid Vigour or Heterosis: The superiority of
of Mendel’s experiment is called F1 generation
hybrid over either of its parents in one or more
Gene: The determinant of a characteristic of an traits.
organism (Mendelian factor). Gene symbols are
Locus: The site or position of a particular gene
underlined or italicized.
on a chromosome.
Genetic Code: The set of 64 triplets of bases
(codons) corresponding to the twenty amino Phenotype: The physical expression of an
acids in proteins and the signals for initiation individuals gene. The physical observable
and termination of polypeptide synthesis. characteristics of an organism.
Genotype: The types of alleles in a single Punnett Square / Checkerboard: A sort

individual is called genotype of cross-multiplication matrix used in the
Genome: The total complement of genes prediction of the outcome of a genetic cross,
contained in a cell. in which male and female gametes and their
frequencies are arranged along the edges.

www.tntextbooks.in
UNIT VII: Genetics

Chapter
3 Chromosomal Basis of
Inheritance
unrecognized till 1900. Three scientists

Learning Objectives (de Vries, Correns and Tschermak)
independently rediscovered Mendel’s results
The Learner will be able to
on the inheritance of characters. Various

Understand chromosomal
cytologists also observed cell division due
theory of inheritance.
to advancements in microscopy. This led to

Analyze the three-point the discovery of structures inside nucleus.
test crosses and appreciate In eukaryotic cells, worm-shaped structures
results in linkage map construction. formed during cell division are called

Differentiate mutation types with chromosomes (colored bodies, visualized
examples. by staining). An organism which possesses
two complete basic sets of chromosomes are
known as diploid. A chromosome consists
Chapter outline
of long, continuous coiled piece of DNA in
3.1 C hromosomal theory of Inheritance which genes are arranged in linear order.
Each gene has a definite position (locus) on
3.2 inkage - Eye colour in Drosophila
L
and Seed colour in Maize a chromosome. These genes are hereditary
units. Chromosomal theory of inheritance
3.3 C rossing over, Recombination and
states that Mendelian factors (genes) have
Gene mapping
specific locus (position) on chromosomes and
3.4 Multiple alleles
they carry information from one generation
3.5 M utation-types, mutagenic agents to the next generation.
and their significance.
3.1.1 Historical development of
In the previous chapter you have learned chromosome theory
about Mendelian genetics, now you are going to The important cytological findings related
be study with deviations of concepts related to to the chromosome theory of inheritance are
Mendelian genetics and chromosomal theory given below.
of inheritance. You must recall the structure of � Wilhelm Roux (1883) postulated that the
chromosome and cell division from eleventh chromosomes of a cell are responsible for
standard. transferring heredity.
3.1 C
hromosomal Theory of � Montgomery (1901) was first to
Inheritance suggest occurrence of distinct pairs of
G. J. Mendel (1865) studied the chromosomes and he also concluded that
inheritance of well-defined characters of maternal chromosomes pair with paternal
pea plant but for several reasons it was chromosomes only during meiosis.
50 Chromosomal Basis of Inheritance

www.tntextbooks.in
�
T. Boveri (1902) supported the same genetic complement. The behaviour of
idea that the chromosomes contain chromosomes during meiosis not only explains
genetic determiners, and he was Mendel’s principles but leads to new and
largely responsible for developing the different approaches to study about heredity.
chromosomal theory of inheritance. Homologous
chromosomes
� W.S. Sutton (1902), a young American
student independently recognized a
parallelism (similarity) between the
behaviour of chromosomes and Mendelian
factors during gamete formation.
Sutton and Boveri (1903) independently Chromosome 1 Chromosome 2 Chromosome 3
proposed the chromosome theory of Same genes,
Non homologous chromosomes
same order
inheritance. Sutton united the knowledge of Genes
Genes
chromosomal segregation with Mendelian
principles and called it chromosomal theory
of inheritance.
3.1.2 Salient features of the Chromosomal
Different
theory of inheritance DNA sequences
�
Somatic cells of organisms are derived GCATTCGAGTCCATAAGCGATGA GCATTCGAGTCTATAAGCGATGA
Allele-A Allele-a
from the zygote by repeated cell division
(mitosis). These consist of two identical Figure 3.2: C
omparison of chromosome
sets of chromosomes. One set is received and gene behaviour
from female parent (maternal) and
Mendelian factors Chromosomes behaviour
the other from male parent (paternal). 1. Alleles of a factor Chromosomes occur
These two chromosomes constitute the occur in pair in pairs
homologous pair. 2. Similar or dissimilar The homologous
� Chromosomes retain their structural alleles of a factor chromosomes separate
uniqueness and individuality throughout separate during the during meiosis
the life cycle of an organism. gamete formation
3. Mendelian The paired
�
E ach chromosome carries specific
factors can assort chromosomes can
determiners or Mendelian factors which independently separate independently
are now termed as genes. during meiosis but the
� The behaviour of chromosomes during linked genes in the
the gamete formation (meiosis) provides same chromosome
evidence to the fact that genes or factors normally do not assort
are located on chromosomes. independently.
Table 3.1: P
arallelism between Mendelian factors
3.1.4 Comparison between gene and and chromosomal behaviour.
chromosome behaviour
Around twentieth century cytologists Thomas Hunt Morgan (1933)
established that, generally the total number of received Nobel Prize in
chromosomes is constant in all cells of a species.
Physiology or Medicine for his
A diploid eukaryotic cell has two haploid sets
discoveries concerning the role
of chromosomes, one set from each parent.
played by chromosomes in heredity.
All somatic cells of an organism carry the
Chromosomal Basis of Inheritance 51

www.tntextbooks.in
Organism Number of F2 progenies did not exhibit in 1:1:1:1 ratio

chromosomes (2n) as expected with independent assortment. A
Adder’s tongue fern greater number of F2 plants had purple flowers
1262 and long pollen or red flowers and round
(Ophioglossum)
Horsetail (Equisetum) 216 pollen. So they concluded that genes for purple
Giant sequoia 22 colour and long pollen grain and the genes for
Arabidopsis 10 red colour and round pollen grain were found
Sugarcane 80 close together in the same homologous pair
Apple 34 of chromosomes. These genes do not allow
Rice 24
themselves to be separated. So they do not
Potato 48
assort independently. This type of tendency
Maize 20
Onion 16 of genes to stay together during separation of
Haplopappus gracilis 4 chromosomes is called Linkage.
Table 3.2 : Number of Chromosomes

Fossil Genes: Some of the Gene 1
Gene 1
junk DNA is made up of pseudo
genes, the sequences presence in Gene 1
that was once working genes. They lost their Gene 2 Gene 2
Gene 2
ability to make proteins. They tell the story of Linked genes Unlinked genes Unlinked genes
evolution through fossilized parts.
Figure 3.3: Arrangement of linked and
3.2 Linkage unlinked genes on chromosome
The genes which determine the character of Genes located close together on the
an individual are carried by the chromosomes. same chromosome and inherited together are
The genes for different characters may be called linked genes. But the two genes that are
present either in the same chromosome or in sufficiently far apart on the same chromosome are
different chromosomes. When the genes are called unlinked genes or syntenic genes (Figure
present in different chromosomes, they assort 3.3). Such condition is known as synteny. It is to
independently according to Mendel’s Law of be differentiated by the value of recombination
Independent Assortment. Biologists came frequency. If the recombination frequency value
across certain genetic characteristics that did is more than 50 % the two genes show unlinked.
not assort out independently in other organisms when the recombination frequency value is less
after Mendel’s work. One such case was reported than 50 %, they show linked. Closely located
in Sweet pea (Lathyrus odoratus) by William genes show strong linkage, while genes widely
Bateson and Reginald C. Punnet in 1906. located show weak linkages.
They crossed one homozygous strain of sweet
peas having purple flowers and long pollen 3.2.1 Coupling and Repulsion theory
grains with another homozygous strain having The two dominant alleles or recessive alleles
red flowers and round pollen grains. All the occur in the same homologous chromosomes,
F1 progenies had purple flower and long pollen tend to inherit together into same gamete are
grains indicating purple flower long pollen called coupling or cis configuration (Figure:
(PL/PL) was dominant over red flower round 3.5 ). If dominant or recessive alleles are present
pollen (pl/pl). When they crossed the F1 with on two different, but homologous chromosomes
double recessive parent (test cross) in results, they inherit apart into different gamete are called

www.tntextbooks.in
repulsion or trans configuration (Figure: 3. 6). $OOHOHVLQUHSXOVLRQRUWUDQVFRQILJXUDWLRQ
Cis AB/ab Trans Ab/aB 3XUSOHIORZHU UHGIORZHU

3JHQHUDWLRQ URXQGSROOHQ /RQJSROOHQ
3O3O ; S/S/
&URVVHV
$ D $ D EHWZHHQ
KRPR]\JRXV
3
O
3
O
S
/
S
/
SDUHQWV
% E E %
3 S
*DPHWHIRUPDWLRQ O /
Figure 3.4: Cis-Trans arrangement of genes
3XUSOHIORZHU
$OOHOHVLQFRXSOLQJRUFLVFRQILJXUDWLRQ /RQJSROOHQ
3OS/
3XUSOHIORZHU UHGIORZHU
URXQGSROOHQ
)*HQHUDWLRQ
/RQJSROOHQ 3 S
3JHQHUDWLRQ
O /
3/3/ ; SOSO
&URVVHV
EHWZHHQ 3 3 S S 3XUSOHIORZHU UHGIORZHU
KRPR]\JRXV / / O O 7HVWFURVV /RQJSROOHQ URXQGSROOHQ
SDUHQWV
+HWHUR]\JRXV)
&URVVHVZLWK 3 S S S
3 O / ;
S GRXEOHUHFHVVLYH O O
*DPHWHIRUPDWLRQ / O SDUHQW
)*DPHWHVIRUPDWLRQ
3XUSOHIORZHU
/HVVFKDQFHRI
/RQJSROOHQ 3 3 S S S
FURVVLQJRYHU
3/SO GXHWROLQNHG / O / O O
)*HQHUDWLRQ JHQHV
3 S
)HUWLOL]DWLRQ
/ O
3 3 3 S S S S S
)๜*HQHUDWLRQ / O O O / / O O
3XUSOHIORZHU UHGIORZHU
7HVWFURVV 3XUSOH 3XUSOH UHG UHG
/RQJSROOHQ URXQGSROOHQ /RQJ URXQG /RQJ URXQG
+HWHUR]\JRXV)
:LWKOLQNHGJHQHV 5HFRPELQDQW 3DUHQWDO 5HFRPELQDQW
FURVVHVZLWK 3 S S S
GRXEOHUHFHVVLYH ; QRQUHFRPELQDQW SURJHQ\ SURJHQLHV SURJHQ\
/ O O O SURJHQLHVDUH
SDUHQW
SUHGRPLQDQW
)*DPHWHVIRUPDWLRQ
2EVHUYHGUDWLR
/HVVFKDQFHRI
3 3 S S S ([SHFWHGUDWLR
FURVVLQJRYHU
GXHWROLQNHG / O / O O
JHQHV Figure 3.6: Alleles in repulsion or trans
)HUWLOL]DWLRQ configuration
)*HQHUDWLRQ 3
/
S 3
O O
S
O
S
/
S S
O O
S
O
3.2.2 Kinds of Linkage
3XUSOH 3XUSOH UHG UHG T.H. Morgan found two types of linkage. They
/RQJ URXQG /RQJ URXQG
are complete linkage and incomplete linkage
3DUHQWDO 5HFRPELQDQW 3DUHQWDO
:LWKOLQNHGJHQHV
QRQUHFRPELQDQW
SURJHQ\ SURJHQLHV SURJHQ\ depending upon the absence or presence of
SURJHQLHVDUH
SUHGRPLQDQW
new combination of linked genes.

2EVHUYHGUDWLR Complete Linkage
([SHFWHGUDWLR
If the chances of separation of two linked
Figure 3.5:
Alleles in coupling or cis genes are not possible those genes always remain
configuration together as a result, only parental combinations

www.tntextbooks.in
are observed. The linked genes are located 3. It reduces It increases variability
very close together on the same chromosome new gene by forming new gene
such genes do not exhibit crossing over. This combinations combinations. lead
phenomenon is called complete linkage. It is to formation of new
rare but has been reported in male Drosophila. organism
C.B Bridges (1919) discovered that crossing Table 3.4: D
ifferences between linkage and
over is completely absent in some species of crossing over
male Drosophila.
3.3 Crossing Over
Incomplete Linkage Crossing over is a biological process that
If two linked genes are sufficiently apart, produces new combination of genes by inter-
the chances of their separation are possible. As a changing the corresponding segments between
result, parental and non-parental combinations non-sister chromatids of homologous pair of
are observed. The linked genes exhibit some chromosomes. The term 'crossing over' was
crossing over. This phenomenon is called coined by Morgan (1912). It takes place during
incomplete linkage. This was observed in pachytene stage of prophase I of meiosis. Usually
maize. It was reported by Hutchinson. crossing over occurs in germinal cells during
gametogenesis. It is called meiotic or germinal
3.2.3 Linkage Groups crossing over. It has universal occurrence and
The groups of linearly arranged linked genes has great significance. Rarely, crossing over
on a chromosome are called Linkage groups. occurs in somatic cells during mitosis. It is
In any species the number of linkage groups called somatic or mitotic crossing over.
corresponds to the number haploid set of
3.3.1 Mechanism of Crossing Over
chromosomes. Example:
Crossing over is a precise process that includes
Name of organism Linkage groups stages like synapsis, tetrad formation, cross over
Mucor 2 and terminalization.
Drosophila 4
Sweet pea 7 (i) Synapsis
Neurospora 7 Intimate pairing between two homologous
Maize 10 chromosomes is initiated during zygotene
Table 3.3 : Linkage groups in some organisms stage of prophase I of meiosis I. Homologous
Linkage and crossing over are two processes chromosomes are aligned side by side resulting
that have opposite effects. Linkage keeps in a pair of homologous chromosomes called
particular genes together but crossing over bivalents. This pairing phenomenon is called
mixes them. The differences are given below. synapsis or syndesis. It is of three types,
1. Procentric synapsis: Pairing starts from
Linkage Crossing over middle of the chromosome.
1. The genes present It leads to separation of 2. Proterminal synapsis: Pairing starts from
on chromosome linked genes the telomeres.
stay close 3. R andom synapsis: Pairing may start from
together anywhere.
2. It involves same It involves exchange
chromosome of segments between (ii) Tetrad Formation
of homologous non-sister chromatids Each homologous chromosome of a
chromosome of homologous bivalent begin to form two identical sister
chromosome. chromatids, which remain held together by a

www.tntextbooks.in
centromere. At this stage each bivalent has four (iv) Terminalisation

chromatids. This stage is called tetrad stage. After crossing over, chiasma starts to move
(iii) Cross Over towards the terminal end of chromatids. This is
After tetrad formation, crossing over occurs in known as terminalisation. As a result, complete
separation of homologous chromosomes
pachytene stage. The non-sister chromatids of
occurs. (Figure 3.10)
homologous pair make a contact at one or more
points. These points of contact between non-
Activity: Solve this
sister chromatids of homologous chromosomes
are called Chiasmata (singular-Chiasma). At Consider two hypothetical recessive
chiasma, cross-shaped or X-shaped structures autosomal genes a and b, where a
are formed, where breaking and rejoining of heterozygote is testcrossed to a double
two chromatids occur. This results in reciprocal homozygous mutant. Predict the phenotypic
exchange of equal and corresponding segments ratios under the following conditions:
between them.
Sister chromatid 1
(a)
a and b are located on separate
+
Sister chromatid 2
Synaptonemal
complex autosomes.
Synaptonemal
complex
Sister chromatid 3
Recombination (b)
a and b are linked on the same
+ nodules
Sister chromatid 4 autosome but are so far apart that a
crossover occurs between them.
Figure 3.9:
Structure of Synaptonemal (c)
a and b are linked on the same
Complex autosome but are so close together that
a crossover almost never occurs.
1RQVLVWHU
3URSKDVH, FKURPDWLGVRI 3.3.3 Importance of Crossing Over
RIPHLRVLV KRPRORJRXV
$ $D D
% %E E FKURPRVRPH Crossing over occurs in all organisms like
7HWUDG bacteria, yeast, fungi, higher plants and animals.
Its importance is
�
Exchange of segments leads to new gene
3DFK\WHQH
VWDJHRI $
D
$ D &KLDVPDDVLWH combinations which plays an important
SURSKDVH,
% E% E RIFURVVLQJRYHU
role in evolution.
�
Studies of crossing over reveal that genes
are arranged linearly on the chromosomes.
0HWDSKDVH, �
Genetic maps are made based on the
$ $D D
% E% E
frequency of crossing over.
� Crossing over helps to understand the
nature and mechanism of gene action.
0HWDSKDVH,, � If a useful new combination is formed it
$ $
% E
D D
% E can be used in plant breeding.
5HFRPELQDQWV 3.3.4 Recombination
Crossing over results in the formation of new
'DXJKWHU combination of characters in an organism
FHOOV $
%
$
E
D
%
D
E called recombinants. In this, segments of DNA
are broken and recombined to produce new
3DUHQWDOW\SH 3DUHQWDOW\SH
combinations of alleles. This process is called
Figure 3.10: Mechanism of crossing over Recombination.

www.tntextbooks.in
Calculation of Recombination Frequency (RF) overall genetic complexity of particular

The percentage of recombinant progeny organism.
in a cross is called recombination frequency.
The recombination frequency (cross over 3.4 Multiple alleles
frequency) (RF) is calculated by using the A given phenotypic trait of an individual
following formula. The data is obtained from depends on a single pair of genes, each of which
alleles in coupling configuration. occupies a specific position called the locus on
homologous chromosome. When any of the
3.3.5 Genetic Mapping three or more allelic forms of a gene occupy
Genes are present in a linear order along the the same locus in a given pair of homologous
chromosome. They are present in a specific chromosomes, they are said to be called
location called locus (plural: loci). The multiple alleles.
diagrammatic representation of position of
genes and related distances between the adjacent Check your Grasp
genes is called genetic mapping. It is directly There may be multiple alleles within the
proportional to the frequency of recombination population, but individuals have only two of
between them. It is also called as linkage map. those alleles. Why?
The concept of gene mapping was first developed
by Morgan’s student Alfred H Sturtevant in 3.4.1 Characteristics of multiple alleles
1913. It provides clues about where the genes lies • M ultiple alleles of a series always occupy
on that chromosome. the same locus in the homologous
chromosome. Therefore, no crossing over
Map distance
occurs within the alleles of a series.
The unit of distance in a genetic map
• Multiple alleles are always responsible for
is called a map unit (m.u). One map unit is
the same character.
equivalent to one percent of crossing over
(Figure 4. ). One map unit is also called a • The wild type alleles of a series exhibit
centimorgan (cM) in honour of T.H. Morgan. dominant character whereas mutant
100 centimorgan is equal to one Morgan (M). type will influence dominance or an
For example: A distance between A and B genes intermediate phenotypic effect.
is estimated to be 3.5 map units. It is equal to 3.5 • When any two of the mutant multiple
centimorgans or 3.5 % or 0.035 recombination alleles are crossed the phenotype is always
frequency between the genes. mutant type and not the wild type
A B C D 3.4.2 Self-sterility in Nicotiana
In plants, multiple alleles have been reported
3.5 cM 7.5 cM 5.5 cM
in association with self-sterility or self-
incompatibility. Self-sterility means that the
Uses of genetic mapping pollen from a plant is unable to germinate on its
�
It is used to determine gene order, identify own stigma and will not be able to bring about
the locus of a gene and calculate the fertilization in the ovules of the same plant. East
distances between genes. (1925) observed multiple alleles in Nicotiana
which are responsible for self-incompatibility
�
They are useful in predicting results of
or self-sterility. The gene for self-incompatibility
dihybrid and trihybrid crosses.
can be designated as S, which has allelic series
�
It allows the geneticists to understand the S1, S2, S3, S4 and S5 (Figure 3.17).

www.tntextbooks.in
Pollen and S2S4. Some combinations are showed in

S3 S4 S3 S1 S2 S1 the table-3.5.
Style
3.5.3 Sex determination in maize

Pollen tube
Zea mays (maize) is an example for monoecious,
Ovary
which means male and female flowers are
S1S2 S1S2 S1S2 present on the
same plant. There
are two types of Tassel
Figure: 3.17 The self-incompatibility in relation inflorescence.

to its genotype in tobacco The terminal
The cross-fertilizing tobacco plants inflorescence
were not always homozygous as S1S1 or S2S2, which bears
but all plants were heterozygous as S1S2, staminate florets
S3S4, S5S6. When crosses were made between develops from Ear
different S1S2 plants, the pollen tube did not shoot apical
develop normally. But effective pollen tube meristem called
development was observed when crossing was tassel. The Inflorescence of Zea mays
made with other than S1S2 for example S3S4. lateral inflorescence which develop pistillate
florets from axillary bud is called ear or cob.
Male parent (Pollen Unisexuality in maize occurs through the
Female parent source) selective abortion of stamens in ear florets
(Stigma spot)
S1S2 S2S3 S3S4 and pistils in tassel florets. A substitution
of two single gene pairs 'ba' for barren plant
Self S3S2 S3S1
and 'ts' for tassel seed makes the difference
Sterile S3S1 S3S2
S1S2 between monoecious and dioecious (rare)
S4S1
S4S2 maize plants. The allele for barren plant (ba)
when homozygous makes the stalk staminate
S1S2 Self S4S2
S2S3 by eliminating silk and ears. The allele for
S1S3 Sterile S4S3
tassel seed (ts) transforms tassel into a
S1S3 S2S3 Self pistillate structure that produce no pollen. The
S1S4 S2S4 Sterile table-3.7 is the resultant sex expression based
S3S4 on the combination of these alleles. Most of
S2S3
S2S4 these mutations are shown to be defects in
gibberellin biosynthesis. Gibberellins play an
Table: 3.5. Different combinations of progeny
important role in the suppression of stamens
in self-incompatibility
in florets on the ears.
When crosses were made between seed
Genotype Dominant/ Modification Sex
parents with S1S2 and pollen parents with S2S3, recessive
two kinds of pollen tubes were distinguished. ba/ba Double Lacks silk Rudimentary
Pollen grains carrying S2 were not effective, ts/ts recessive on the female
but the pollen grains carrying S3 were stalk, but
capable of fertilization. Thus, from the cross transformed
S1S2XS3S4, all the pollens were effective and tassel to
four kinds of progeny resulted: S1S3, S1S4, S2S3 pistil

www.tntextbooks.in
ba/ba Recessive Lacks silk Male 3.6.1 Types of mutation

ts+/ts+ and and have Let us see the two general classes of gene
dominant tassel mutation:
ba+/ba+ Double Have both Monoecious
utations affecting single base or base
• M
ts+/ts+ dominant tassel and
cob
pair of DNA are called point mutation
ba+/ba+ Dominant Bears cob Normal utations altering the number of copies
• M
ts/ts and and lacks female of a small repeated nucleotide sequence
recessive tassel within a gene
Table 3.7: Sex determination in Maize a) No mutation
(Superscript (+) denotes dominant character) DNA
5' TGT TCA CCA T 3'
3' ACA AGT GGT A 5'
Wild-type protein
3.5 Mutation mRNA
Transcription
produced.
UGU UCA CCA U
Genetic variation among Translation
individuals provides the raw Protein Thr Ser Gly
material for the ultimate b) Transition mutation changes a purine

source of evolutionary 5' TGT TCG CCA T 3' nucleotide to another
changes. Mutation and 3' ACA AGC GGT A 5' purine or pyrimidine
to another pyrimidine
recombination are the two major processes
responsible for genetic variation. A sudden c) Transversion mutation
Single purine
5' TGT TCT CCA T 3'
change in the genetic material of an organisms 3' ACA TGA GGT A 5'
changed to pyrimidine
or vice versa.
is called mutation. The term mutation was
d) Missense mutation
introduced by Hugo de Vries (1901) while he
5' TGT T T A CCA T 3' The new codon
has studying on the plant, evening primrose 3' ACA A A T GGT A 5' encodes a different
(Oenothera lamarkiana) and proposed Thr Leu Gly
amino acid due to
transtion mutation
‘Mutation theory’. There are two broad
types of changes in genetic material. They are e) Non-Sense mutation
The new codon is a
5' TGT T A A CCA T 3'
point mutation and chromosomal mutations. 3' ACA A T T GGT A 5' stop codon (UAA) due
Mutational events that take place within UAA to transition mutation,
it leads to premature
individual genes are called gene mutations or Thr Stop
termination translation.
point mutation, whereas the changes occur in
f) Silent mutation
structure and number of chromosomes is called 5' TGT T C G CCA T 3' The new codon
chromosomal mutation. Agents which are 3' ACA A G C GGT A 5' encodes the same
amino acid after
responsible for mutation are called mutagens, Thr Ser Gly transition mutation
that increase the rate of mutation. Mutations
can occur either spontaneously or induced. g) Frame shift mutation
i) Addition mutation
The production of mutants through exposure 5' TGT C T C ACC AT 3'
Addition or Deletion of
one nucleotide, change
of mutagens 3' ACA G A G TGG TA 5'
the reading frame
is called Thr Glu Arg
results completely
mutagenesis, different translation
ii) Deletion mutation
and the 5' TGT C A C CAT 3'
3' ACA G T G GTA 5'
organism is
said to be Thr Val Val
mutagenized. Figure: 3.19 Types of point mutation

Mutant Leaf

www.tntextbooks.in
Basis of
S.No Major types of mutations Major features
classification
1. Origin Spontaneous Occurs in the absence of known mutagen
Induced Occurs in the presence of known mutagen
2. Cell type Somatic Occurs in non-reproductive cells
Germ-line Occurs in reproductive cells
3. Effect on Loss-of-function (knockout, Eliminates normal function
function null)
Hypomorphic (leaky) Reduces normal function
Hypermorphic Increases normal function
Gain-of-function (ectopic Expressed at incorrect time or inappropriate
expression) cells
4. Molecular Nucleotide substitution A base pair in DNA duplex is replaced with a
change different base pair
• Transition Purine to purine(A G)or pyrimidine to
pyrimidine(T C)
• Transversion Purine to pyrimidine(A T) or pyrimidine
to purine(C G)
• Insertion One or more extra nucleotides are present
• Deletion One or more nucleotides are missing
5. Effect on • Silent (synonymous) No change in amino acid encoded
translation
• Missense (non- Change in amino acid encoded
synonymous)
• Nonsense (termination) Creates translational termination codon
(UAA, UAG, or UGA)
• Frameshift Shifts triplet reading of codons out of correct
phase
Table 3.8: Major types of mutations
Point mutation one base pair is replaced by another (Figure:

It refers to alterations of single base pairs 3.17). It can be divided into two subtypes:
of DNA or of a small number of adjacent base transitions and transversions. Addition or
pairs deletion mutations are actually additions or
deletions of nucleotide pairs and also called
Types of point mutations base pair addition or deletions. Collectively,
Point mutation in DNA are categorised they are termed indel mutations (for
into two main types. They are base pair insertion-deletion).
substitutions and base pair insertions or Substitution mutations or indel mutations
deletions. Base substitutions are mutations in affect translation. Based on these different types
which there is a change in the DNA such that of mutations are given below.

www.tntextbooks.in
The mutation that changes one codon for chromatids in irradiated cells. Non-ionizing
an amino acid into another codon for that same radiation, UV rays have longer wavelengths
amino acid are called Synonymous or silent and carry lower energy, so they have lower
mutations. The mutation where the codon penetrating power than the ionizing radiations.
for one amino acid is changed into a codon It is used to treat unicellular microorganisms,
for another amino acid is called Missense or spores, pollen grains which possess nuclei
non-synonymous mutations. The mutations located near surface membrane.
where codon for one amino acid is changed Sharbati Sonora
into a termination or stop codon is called
Nonsense mutation. Mutations that result in Sharbati Sonora is a mutant variety of wheat,
the addition or deletion of a single base pair which is developed from Mexican variety
of DNA that changes the reading frame for (Sonora 64) by irradiating of gamma rays. It
the translation process as a result of which is the work of Dr. M.S.Swaminathan who is
there is complete loss of normal protein known as ‘Father of Indian green revolution’
structure and function are called Frameshift and his team.
mutations (Figure: 3.19). Castor Aruna
3.6.2 Mutagenic agents Castor Aruna is mutant variety of castor which

The factors which cause genetic mutation is developed by treatment of seeds with thermal
are called mutagenic agents or mutagens. neutrons in order to induce very early maturity
Mutagens are of two types, physical mutagen (120 days instead of 270 days as original variety).
and chemical mutagen. Muller (1927) was the Chemical mutagens:
first to find out physical mutagen in Drosophila. Chemicals which induce mutation are
Physical mutagens: called chemical mutagens. Some chemical
mutagens are mustard gas, nitrous acid,
Scientists are using temperature and
ethyl and methyl methane sulphonate (EMS
radiations such as X rays, gamma rays, alfa rays,
and MMS), ethyl urethane, magnous salt,
beta rays, neutron, cosmic rays, radioactive
formaldehyde, eosin and enthrosine. Example:
isotopes, ultraviolet rays as physical mutagen to
Nitrous oxide alters the nitrogen bases of DNA
produce mutation in various plants and animals.
and disturb the replication and transcription
Temperature: Increase in temperature that leads to the formation of incomplete and
increases the rate of mutation. While rise defective polypeptide during translation.
in temperature, breaks the hydrogen bonds
Mustard gas (Dichloro ethyl sulphide) used as
between two DNA nucleotides which affects the
chemical weapon in world war I.
process of replication and transcription.
H J Muller (1928) first time used X rays to
Radiation: The electromagnetic spectrum induce mutations in fruit fly.
contains shorter and longer wave length rays
L J Stadler reported induced mutations in
than the visible spectrum. These are classified
plants by using X rays and gamma rays.
into ionizing and non-ionizing radiation.
Ionizing radiation are short wave length and Chemical mutagenesis was first reported by
carry enough higher energy to ionize electrons C. Auerback (1944).
from atom. X rays, gamma rays, alfa rays, Comutagens
beta rays and cosmic rays which breaks the
The compounds which are not having
chromosomes (chromosomal mutation) and
own mutagenic properties but can enhance

www.tntextbooks.in
the effects of known mutagens are called of plants and animals are having identical
comutagens. number of chromosomes, they will not be
similar in character. Hence the number
Example: Ascorbic acid increase the damage
of chromosomes will not differentiate the
caused by hydrogen peroxide.
character of species from one another but
Caffeine increase the toxicity of methotrexate the nature of hereditary material (gene) in
chromosome that determines the character of
3.6.3 Chromosomal mutations species.
The genome can also be modified on a larger
Sometimes the chromosome number of
scale by altering the chromosome structure or
somatic cells are changed due to addition or
by changing the number of chromosomes in
elimination of individual chromosome or basic
a cell. These large-scale variations are termed
set of chromosomes. This condition in known
as chromosomal mutations or chromosomal
as numerical chromosomal aberration or
aberrations. Gene mutations are changes that
ploidy. There are two types of ploidy.
take place within a gene, whereas chromosomal
mutations are changes to a chromosome region (i). Ploidy involving individual chromosomes
consisting of many genes. It can be detected within a diploid set (Aneuploidy)
by microscopic examination, genetic analysis, (ii).
Ploidy involving entire sets of
or both. In contrast, gene mutations are never chromosomes (Euploidy) (Figure 3.20)
detectable microscopically. Chromosomal
mutations are divided into two groups: changes (i) Aneuploidy
in chromosome number and changes in It is a condition in which diploid number
chromosome structure. is altered either by addition or deletion
I. Changes in chromosome number of one or more chromosomes. Organisms
showing aneuploidy are known as aneuploids
Each cell of living organisms possesses or heteroploids. They are of two types,
fixed number of chromosomes. It varies in
Hyperploidy and Hypoploidy (Figure 3.21).
different species. Even though some species
Ploidy
Aneuploidy Euploidy
Hyperploidy Hypoploidy
Double Double Double Nullisomy Double

Trisomy Tetrasomy Pentasomy Monosomy
Trisomy Tetrasomy Monosomy (2n-2) Nullisomy
(2n+1) (2n+2) (2n+3) (2n-1)
(2n+1+1) (2n+2+2) (2n-1-1) (2n-2-2)
Haploidy (n) Diploidy (2n) Polyploidy

(2n+n+n...)
Monoploidy (x) Autopolyploidy Allopolyploidy
Autotriploid Autotetraploid
Figure 3.20 Types of Ploidy

www.tntextbooks.in
1. Hyperploidy two pairs of homologous chromosomes from

Addition of one or more chromosomes to the diploid set are called Nullisomy (2n-2) and
diploid sets are called hyperploidy. Diploid double Nullisomy (2n-2-2) respectively. Selfing
set of chromosomes represented as Disomy. of monosomic plants produce nullisomics. They
Hyperploidy can be divided into three types. are usually lethal.
They are as follows,
(a) Trisomy
Addition of single chromosome to diploid set
Disomy Monosomy Double Nullisomy
is called Simple trisomy(2n+1). Trisomics were (normal) (2n – 1) Monosomy (2n – 2)
first reported by Blackeslee (1910) in Datura (2n) (2n – 1– 1)
stramonium (Jimson weed). But later it was

reported in Nicotiana, Pisum and Oenothera.
Sometimes addition of two individual
chromosome from different chromosomal Trisomy Double Tetrasomy Pentasomy
pairs to normal diploid sets are called Double (2n + 1) Trisomy
(2n + 1 + 1)
(2n + 2) (2n + 3)
trisomy (2n+1+1).
Figure 3.21 Types of aneuploidy
(b) Tetrasomy
(ii) Euploidy
Addition of a pair or two individual pairs of
chromosomes to diploid set is called tetrasomy Euploidy is a condition where the organisms
(2n+2) and Double tetrasomy (2n+2+2) possess one or more basic sets of chromosomes.
respectively. All possible tetrasomics are Euploidy is classified as monoploidy, diploidy
available in Wheat. and polyploidy. The condition where an
organism or somatic cell has two sets of
(c) Pentasomy chromosomes are called diploid (2n). Half the
Addition of three individual chromosome from number of somatic chromosomes is referred
different chromosomal pairs to normal diploid as gametic chromosome number called
set are called pentasomy (2n+3). haploid(n). It should be noted that haploidy (n)
is different from a monoploidy (x). For example,
2. Hypoploidy
the common wheat plant is a polyploidy
Loss of one or more chromosome from the (hexaploidy) 2n=6x=72 chromosomes. Its
diploid set in the cell is called hypoploidy. It haploid number (n) is 36, but its monoploidy
can be divided into two types. They are (x) is 12. Therefore, the haploid and diploid
(a) Monosomy condition came regularly one after another and
the same number of chromosomes is maintained
Loss of a single chromosome from the diploid
from generation to generation, but monoploidy
set are called monosomy(2n-1). However
condition occurs when an organism is under
loss of two individual or three individual
polyploidy condition. In a true diploid both the
chromosomes are called double monosomy
monoploid and haploid chromosome number
(2n-1-1) and triple monosomy (2n-1-1-1)
are same. Thus a monoploid can be a haploid
respectively. Double monosomics are observed
but all haploids cannot be a monoploid.
in maize.
Polyploidy
(b) Nullisomy
Polyploidy is the condition where an
Loss of a pair of homologous chromosomes or
organism possesses more than two basic sets of

www.tntextbooks.in
chromosomes. When there are three, four, five n=9
or six basic sets of chromosomes, they are called Gametes

triploidy (3x) tetraploidy (4x), pentaploidy (5x)
n=9
and hexaploidy (6x) respectively. Generally,
polyploidy is very common in plants but
rarer in animals. An increase in the number Parents Sterile F1
hybrid
Fertile
amphidiploid
Raphanus Brassica
X
of chromosome sets has been an important 2n=18 2n=18
n + n = 9+9
Raphanobrassica
(2n) = (18) 2n = 4x = 36
factor in the origin of new plant species. But
higher ploidy level leads to death. Polyploidy Figure 3. 22 Rhaphanobrassica
is of two types. They are autopolyploidy and Example:1 Raphanobrassica, G.D.
allopolyploidy Karpechenko (1927) a Russian geneticist,
1. Autopolyploidy crossed the radish (Raphanus sativus, 2n=18)
and cabbage (Brassica oleracea, 2n=18) to
The organism which possesses more than two
produce F1 hybrid which was sterile. When he
haploid sets of chromosomes derived from doubled the chromosome of F1 hybrid he got
within the same species is called autopolyploid. it fertile. He expected this plant to exhibit the
They are divided into two types. Autotriploids root of radish and the leaves like cabbage, which
and autotetraploids. would make the entire plant edible, but the case
Autotriploids have three set of its own was vice versa, so he was greatly disappointed.
genomes. They can be produced artificially by Example: 2 Triticale, the successful first man
crossing between autotetraploid and diploid made cereal. Depending on the ploidy level
species. They are highly sterile due to defective Triticale can be divided into three main groups.
gamete formation. Example: The cultivated
Tetraploidy: Crosses between diploid
(i).
banana are usually triploids and are seedless
wheat and rye.
having larger fruits than diploids. Triploid sugar
beets have higher sugar content than diploids (ii). Hexaploidy: Crosses between tetraploid wheat
and are resistant to moulds. Common doob grass Triticum durum (macaroni wheat) and rye
(Cyanodon dactylon) is a natural autotriploid. (iii).
Octoploidy: Crosses between hexaploid
Seedless watermelon, apple, sugar beet, tomato, wheat T. aestivum (bread wheat) and rye
banana are man made autotriploids. Hexaploidy Triticale hybrid plants demonstrate
Autotetraploids have four copies of its own characteristics of both macaroni wheat and rye.
genome. They may be induced by doubling the For example, they combine the high-protein
chromosomes of a diploid species. Example: rye, content of wheat with rye’s high content of the
grapes, alfalfa, groundnut, potato and coffee. amino acid lysine, which is low in wheat. It can
be explained by chart below (Figure: 3.23).
2. Allopolyploidy
An organism which possesses two or more Colchicine , an alkaloid
basic sets of chromosomes derived from two is extracted from root
different species is called allopolyploidy. It and corms of Colchicum
can be developed by interspecific crosses and autumnale, when applied
fertility is restored by chromosome doubling in low concentration to
with colchicine treatment. Allopolyploids are the growing tips of the
plants it will induce polyploidy. Surprisingly
formed between closely related species only.
it does not affect the source plant Colchicum,
(Figure 3.22)
due to presence of anticolchicine.

www.tntextbooks.in
(P) Triticum durum X Secale cereale deletion of a part of chromosome leading to

Generation
rearrangement of genes is called structural
chromosomal aberration. It occurs due to
ionizing radiation or chemical compounds. On
2n = 4x = 28 2n = 2x = 14
the basis of breaks and reunion in chromosomes,
Tetraploidy Diploidy
there are four types of aberrations. They are
classified under two groups.
Gametes n = 2x = 14 n=x=7
A. Changes in the number of the gene loci
1. Deletion or Deficiency
F1 hybrid 2n = 3x = 21
(sterile)
(Triploidy)
2. Duplication or Repeat
Chromosome
doubling by Colchicine B. Changes in the arrangement of gene loci
2n = 6x = 42 3. Inversion
4. Translocation
1. Deletion or Deficiency
Triticale (Hexaploidy)
Loss of a portion of chromosome is called
Figure 3.23 Triticale
deletion. On the basis of location of breakage
on chromosome, it is divided into terminal
Activity: Solve this
deletion and intercalary deletion. It occurs
When two plants (A and B) belonging to the due to chemicals, drugs and radiations. It is
same genus but different species are crossed, observed in Drosophila and Maize. (Figure 3.24)
the F1 hybrid is viable and has more ornate
flowers. Unfortunately, this hybrid is sterile 2. Duplication or Repeat
and can only be propagated by vegetative The process of arrangement of the same order
cuttings. Explain the sterility of the hybrid of genes repeated more than once in the same
and what would have to occur for the chromosome is known as duplication. Due to
sterility of this hybrid to be reversed. duplication some genes are present in more than
two copies. It was first reported in Drosophila
Significance of Ploidy by Bridges (1919) and other examples are Maize
• M any polyploids are more vigorous and and Pea. It is three types.
more adaptable than diploids. 4. Translocation
• Many ornamental plants are autotetraploids
and have larger flowers and longer flowering The transfer of a segment of chromosome
duration than diploids. to a non-homologous chromosome is called
• Autopolyploids usually have higher in fresh translocation. Translocation should not
weight due to more water content. be confused with crossing over, in which
• Aneuploids are useful to determine the an exchange of genetic material between
phenotypic effects of loss or gain of different homologous chromosome takes place.
chromosomes. Translocation occurs as a result of interchange
• Many angiosperms are allopolyploids and of chromosome segments in non-homologous
they play a role in the evolution of plants. chromosomes. There are three types
II Structural changes in chromosome i. Simple translocation

(Structural chromosomal aberration) ii. Shift translocation
Structural variations caused by addition or iii. Reciprocal translocation

www.tntextbooks.in
A Duplications
B A A A A A
B
B B B B
C Deletion of Deletion of B
segment C segment C C C C
D A D C D B C D
D
E C B E
E E
F D D F
E G
F F G
E E
H
G F G B
I F F
H G H G G C
I H I H H H
I I I I
Terminal Normal Intercalary Normal Tandem Reverse Displaced

deletion Chromosome deletion chromosome tandem tandem
Figure 3.24 Deletion Figure 3.25 Duplication
Summary alleles. They are m, M1 and M2 of a single

Chromosomal theory of inheritance states gene. Mutational events that take place within
that Mendelian factors have specific locus on individual genes are called gene mutations or
chromosomes and they carry information point mutation, whereas the changes that occur
from one generation to the next generation. in structure and number of chromosomes are
Genes located close together on the same called chromosomal mutation. The agents
chromosome and inherited together are called which are responsible for mutation is called
linked genes the phenomenon is called Linkage. mutagens.
Two types of linkage are complete linkage and
Evaluation
incomplete linkage. The groups of linearly
1. An allohexaploidy
arranged linked genes are called Linkage
contains
groups. Crossing over is a biological process
that produces new combination of genes by a) Six different genomes
inter-changing the corresponding segments b) Six copies of three different genomes
between non-sister chromatids of homologous c) Two copies of three different genomes
pair of chromosomes. In this segments of d) Six copies of one genome
DNA are broken and recombined to produce 2. The A and B genes are 10 cM apart on a
new combinations of alleles a process is chromosome. If an AB/ab heterozygote
called Recombination. The diagrammatic is testcrossed to ab/ab, how many of each
representation of distances between the progeny class would you expect out of 100
adjacent genes which is directly proportional total progeny?
to the frequency of recombination between a) 25 AB, 25 ab, 25 Ab, 25 aB
them is called genetic mapping. When any of b) 10 AB, 10 ab
the three or more allelic forms of a gene occupy c) 45 AB, 45 ab
the same locus in a given pair of homologous d) 45 AB, 45 ab, 5 Ab, 5aB
chromosomes, they are said to be multiple

www.tntextbooks.in
3. Match list I with list II 8. The point mutation sequence for transition,
List I List II transition, transversion and transversion in
A. A pair of chromosomes i) monosomy DNA are
extra with diploid a) A to T, T to A, C to G and G to C
B. One chromosome extra to ii) tetrasomy
b) A to G, C to T, C to G and T to A
the diploid
c) C to G, A to G, T to A and G to A
C. One chromosome loses iii) trisomy
from diploid d) G to C, A to T, T to A and C to G
D. Two individual iv) double 9. If haploid number in a cell is 18. The
chromosomes lose from monosomy double monosomic and trisomic number
diploid will be
a) A-i, B-iii, C-ii, D-iv b) A-ii, B-iii, C-iv, D-i a) 35 and 37 b) 34 and 35
c) A-ii, B-iii, C-i, D-iv d) A-iii, B-ii, C-i, D-iv c) 37 and 35 d) 17 and 19
4. Which of the following sentences are 10. Changing the codon AGC to AGA
correct? represents
1. The offspring exhibit only parental a) missense mutation b) nonsense
combinations due to incomplete linkage mutation
2. The linked genes exhibit some crossing c) frameshift mutation d) deletion
over in complete linkage mutation
3. The separation of two linked genes are 11. Assertion (A): Gamma rays are generally
possible in incomplete linkage use to induce mutation in wheat varieties.
4. Crossing over is absent in complete
Reason (R): Because they carry lower
linkage
energy to non-ionize electrons from atom
a) 1 and 2 b) 2 and 3
a) A is correct. R is correct explanation of A
c) 3 and 4 d) 1 and 4
b) A is correct. R is not correct explanation
5. Accurate mapping of genes can be done by of A
three point test cross because increases c) A is correct. R is wrong explanation of A
a) Possibility of single cross over d) A and R is wrong
b) Possibility of double cross over 12. How many map units separate two alleles
c) Possibility of multiple cross over A and B if the recombination frequency is
d) Possibility of recombination frequency 0.09?
6. Due to incomplete linkage in maize, the a) 900 cM b) 90 cM c) 9 cM d) 0.9 cM
ratio of parental and recombinants are 13. When two different genes came from same
a) 50:50 b) 7:1:1:7 c) 96.4: 3.6 d) 1:7:7:1 parent they tend to remain together.
i) What is the name of this phenomenon?
7. Genes G S L H are located on same
ii) Draw the cross with suitable example.
chromosome. The recombination
iii) Write the observed phenotypic ratio.
percentage is between L and G is 15%, S
and L is 50%, H and S are 20%. The correct 14. If you cross dominant genotype PV/PV
order of genes is male Drosophila with double recessive
a) GHSL b) SHGL c) SGHL d) HSLG female and obtain F1 hybrid. Now you cross

www.tntextbooks.in
F1 male with double recessive female. Glossary

i) What type of linkage is seen?
Branch Migration: The process in which base
ii) Draw the cross with correct genotype.
pairs on homologous strands are consequently
iii) What is the possible genotype in F2
exchanged at a Holliday junction, moving the
generation?
branch up or down the DNA sequence.
15.
S. no Gamete types Number of progenies Cis configuration: The presence of dominant

alleles of two or more pairs on one chromosome
1. ABC 349
2. Abc 114 and the recessive alleles on the homologous
3. abC 124 chromosome.
4. AbC 5
5. aBc 4 Feminizing Masculinizing: To induce
6. aBC 116 female characteristics in male To induce male
7. ABc 128 characteristics in female
8. abc 360
i) What is the name of this test cross? Heteroduplex: A double stranded molecule
ii) How will you construct gene mapping of nucleic acid originated through genetic
from the above given data? recombination from different sources
iii) Find out the correct order of genes.
16. What is the difference between missense Self incompatibility: A genetic mechanism
and nonsense mutation? which prevent self fertilization thus encourage
outcross.
17. A B C D E F G H I
C B
From the above figure identify the type of Synapsis: The pairing of two homologous
mutation and explain it. chromosomes that occurs during meiosis.
18. Write the salient features of Sutton and
Boveri concept. Tassel seed: Feminization of the tassel
19. Explain the mechanism of crossing over.
Trans configuration: An arrangement in which
20. Write the steps involved in molecular the dominant allele of one pair of genes and the
mechanism of DNA recombination with recessive allele of another pair are on the same
diagram. chromosome
21. How is Nicotiana exhibit self-
incompatibility. Explain its mechanism. Transesterification: A reaction that breaks and
makes chemical bonds in a coordinated transfer,
22. How sex is determined in monoecious
so that no energy is required.
plants. write their genes involved in it.
23. What is gene mapping? Write its uses. Vestigial: Rudimentary organ of body become
24. Draw the diagram of different types of functionless in the course of evolution
aneuploidy.
25. Mention the name of man-made cereal.
How it is formed?

www.tntextbooks.in

Chapter
4 Principles and Processes of

Biotechnology
Biotechnology is the
Learning Objectives science of applied
biological processes. In
The learner will be able to other words it is science

Apply the knowledge of traditional of development and
and modern biotechnology in day to utilization of biological
day life. processes, forms and
Karl Ereky
A
ppreciate the uses of fermentation systems for the benefit
process. of mankind and other life forms. The term
A
cquire the knowledge on the process biotechnology was coined by Karl Ereky, a
of genetic engineering Hungarian Engineer in 1919 and has been
extended to include any process in which

Analyse the uses
organisms, tissues, cells, organelles or isolated
and limitations of
molecules such as enzymes are used to convert
genetically modified
biological or other raw materials to products of
plants
greater value.

Cognize the terms
of bio prospecting 4.1 Development of Biotechnology
and bio piracy. Biotechnology has developed by leaps
and bounds during the past century and its
development can be well understood under two
Chapter outline
main heads namely conventional or traditional
biotechnology and modern biotechnology
4.1
Development of Biotechnology
1. Conventional or traditional
4.2 Methods of Biotechnology biotechnology: This is the kitchen technology
4.2
Advancements in Modern developed by our ancestors, and it is as old as
Biotechnology human civilization. It uses bacteria and other
4.4
Tools for Genetic Engineering microbes in the daily usage for preparation of
Methods of Gene transfer
4.5 dairy products like curd, ghee, cheese and in
preparation of foods like idli, dosa, nan, bread
4.6
Screening for Recombiants
and pizza. This conventional biotechnology
4.7
Transgenic Plants / Genetically also extends to preparation of alcoholic
Modified Crops beverages like beer, wine, etc.
4.8
Applications of Biotechnology. With the advancement of the science and
technology during the 18th century, these kitchen
technologies gained scientific validation.
68 Principles and Processes of Biotechnology

www.tntextbooks.in
2. Modern biotechnology 4.3. Methods of Biotechnology

There are two main features of this technology, 4.3.1 Fermentation
that differentiated it from the conventional
The word fermentation is derived from the
technology they are i) ability to change the
Latin verb ‘fervere’ which means ‘ to boil’.
genetic material for getting new products with
Fermentation refers to the metabolic process
specific requirement through recombinant
in which organic molecules (normally glucose)
DNA technology ii) ownership of the newly
are converted into acids, gases, or alcohol in
developed technology and its social impact.
the absence of oxygen or any electron transport
Today, biotechnology is a billion dollar business
chain. The study of fermentation, its practical
around the world, where in pharmaceutical
uses is called zymology and originated in
companies, breweries, agro industries and
1856, when French chemist Louis Pasteur
other biotechnology based industries apply
demonstrated that fermentation was caused
biotechnological tools for their product
by yeast. Fermentation occurs in certain types
improvement.
of bacteria and fungi that require an oxygen-
Modern biotechnology embraces all methods free environment to live. The processes of
of genetic modification by recombinant DNA fermentation are valuable to the food and
and cell fusion technology. The major focus of beverage industries, with the conversion
biotechnology are of sugar into ethanol to produce alcoholic
w• Fermentation for production of acids, beverages, the release of CO2 by yeast used in the
enzymes, alcohols, antibiotics, fine leavening of bread, and with the production of
chemicals, vitamins and toxins organic acids to preserve and flavor vegetables
• Biomass for bulk production of single cell and dairy products.
protein , alcohol, and biofuel
Bioreactor ( Fermentor)
• Enzymes as biosensors, in processing
Bioreactor (Fermentor) is a vessel or a
industry
container that is designed in such a way that
• Biofuels for production of hydrogen, it can provide an optimum environment in
alcohol, methane which microorganisms or their enzymes
• Microbial inoculants as biofertiliser, and interact with a substrate to produce the
nitrogen fixers required product. In the bioreactor aeration,
• Plant and animal cell culture for production agitation, temperature and pH are controlled.
of secondary metabolites, monoclonal Fermentation involves two process namely
antibodies upstream and downstream process.
• Recombinant DNA technology for i. Upstream process
production of fine chemicals, enzymes, All the process before starting of the fermenter
vaccines, growth hormones, antibiotics, and such as sterilization of the fermenter,
interferon preparation and sterilization of culture
• Process engineering – tools of medium and growth of the suitable inoculum
biotechnology is used for effluent treatment, are called upstream process.
water recycling.
ii. Downstream process
This unit will reveal the various aspects of All the process after the fermentation process
modern biotechnology, its products and is known as the downstream process. This
applications. process includes distillation, centrifuging,
Principles and Processes of Biotechnology 69

www.tntextbooks.in
filtration and solvent extraction. Mostly useful to man and animals. These compounds
this process involves the purification of the called metabolites, can be grouped into two
desired product. categories:
Motor a. Primary metabolites: Metabolites
Pressure
nutrient or guage produced for the maintenance of life
inoculant process of microbes are known as primary
Sterile nutrient metabolites Eg. Ethanol, citric, acid, lactic
medium
Impeller acid, acetic acid.
pH probe
Oxygen
concentration probe Temperature b. Secondary metabolites: Secondary
probe
Cooling metabolites are those which are not
jacket
required for the vital life process of
Sparger
microbes, but have value added nature, this
Steam includes antibiotics e.g -Amphotericin-B
(Streptomyces nodosus), Penicillin
(Penicillium chryosogenum) Streptomycin
Figure 4.2: Bioreactor (S. grises) , Tetracycline (S. aureofacins),
Procedure of Fermentation alkaloids, toxic pigments, vitamins etc.
Depending upon the type of product,
a. 3. Microbial enzymes
bioreactor is selected. When microbes are cultured, they secrete
b. A suitable substrate in liquid medicine is some enzymes into the growth media. These
added at a specific temperature, pH and enzymes are industrially used in detergents,
then diluted. food processing, brewing and pharmaceuticals.
The organism (microbe, animal/plant
c. Eg. protease, amylase, isomerase, and lipase.
cell, sub-cellular organelle or enzyme) is 4. Bioconversion, biotransformation or
added to it. modification of the substrate
Then it is incubated at a specific
d. The fermenting microbes have the capacity to
temperature for the specified time. produce valuable products, eg. conversion of
e. The incubation may either be aerobic or ethanol to acetic acid (vinegar), isopropanol to
anaerobic. acetone, sorbitol to sorbose (this is used in the
f. Withdrawal of product using downstream manufacture of vitamin C), sterols to steroids.
processing methods 4.3.2 Single Cell Protein (SCP)
Application of fermentation in industries Single cell proteins are dried cells of
microorganism that are used as protein
Fermentation has industrial application such as:
supplement in human foods or animal
1. Microbial biomass production feeds. Single Cell Protein (SCP) offers
Microbial cells (biomass) like algae, bacteria, an unconventional but plausible solution
yeast, fungi are grown, dried and used as to protein deficiency faced by the entire
source of a complete protein called ‘single cell humanity. Although single cell protein has
protein (SCP)’ which serves as human food or high nutritive value due to their higher
animal feed. protein, vitamin, essential amino acids and
lipid content, there are doubts on whether it
2. Microbial metabolites
could replace conventional protein sources
Microbes produce compounds that are very

www.tntextbooks.in
due to its high nucleic acid content and 4.4 Advancements in Modern
slower in digestibility. Microorganisms used Biotechnology
for the production of Single Cell Protein are Modern biotechnology embraces all the
as follows: genetic manipulations, protoplasmic fusion
• Bacteria - Methylophilus methylotrophus, techniques and the improvements made in
Cellulomonas, Alcaligenes the old biotechnological processes. Some
• Fungi - Agaricus campestris, Saccharomyces of the major advancements in modern
cerevisiae (yeast), Candida utilis biotechnology are described below.
• Algae - Spirulina, Chlorella, Chlamydomonas 4.4.1 Genetic Engineering
The single cell protein forms an important Genetic engineering or recombinant DNA
source of food because of their protein content, technology or gene cloning is a collective term
carbohydrates, fats, vitamins and minerals. It is that includes different experimental protocols
used by Astronauts and Antarctica expedition resulting in the modification and transfer of
scientists. DNA from one organism to another.
Spirulina can The definition for conventional
be grown easily on recombination was already given in Unit
materials like waste II. Conventional recombination involves
water from potato exchange or recombination of genes between
processing plants homologous chromosomes during meiosis.
(containing starch), Figure 4.3: Spirulina Recombination carried out artificially using
straw, molasses, products modern technology is called recombinant
animal manure and DNA technology (r-DNA technology). It is
even sewage, to produce large quantities and also known as gene manipulation technique.
can serve as food rich in protein, minerals, fats, This technique involves the transfer of DNA
carbohydrate and vitamins. Such utilization coding for a specific gene from one organism
also reduces environmental pollution. 250 g into another organism using specific
of Methylophilus methylotrophus, with a high agents like vectors or using instruments
rate of biomass production and growth, can like electroporation, gene gun, liposome
be expected to produce 25 tonnes of protein. mediated, chemical mediated transfers and
microinjection.
Applications of Single-Cell Protein
• It is used as protein supplement 4.4.2 Steps involved in Recombinant
• It is used in cosmetics products for healthy DNA Technology
hair and skin The steps involved in recombinant DNA
• It is used as the excellent source of protein technology are:
for feeding cattle, birds, fishes etc. • Isolation of a DNA fragment containing
•
It is used in food industry as aroma a gene of interest that needs to be cloned.
carriers, vitamin carrier, emulsifying agents This is called an insert.
to improve the nutritive value of baked PCR: Polymerase Chain Reaction is a common
products, in soups, in ready-to-serve-meals, laboratory technique used to make copies
in diet recipes (millions) of a particular region of DNA.
• It is used in industries like paper processing,
leather processing as foam stabilizers. • Generation of recombinant DNA (rDNA)
molecule by insertion of the DNA fragment

www.tntextbooks.in
Bacterium
1 Isolation of plasmid DNA
are necessary. The basic tools
Cell containing gene
and DNA containing gene of interest are enzymes, vectors and host
of interest
organisms. The most important
2 Gene inserted
Bacterial Plasmid into plasmid enzymes required for genetic
chromosome
Recombinant Gene of engineering are the restriction
DNA (plasmid) interest enzymes, DNA ligase and
DNA of chromosome alkaline phosphatase.
3 Plasmid put into
bacterial cell 4.5.1 Restriction Enzymes
The two enzymes responsible
Recombinant for restricting the growth of
bacterium
bacteriophage in Escherichia coli
4 Cells cloned with gene of interest
were isolated in the year 1963.
One was the enzyme which added
5 Identification of desired clone
methyl groups to DNA, while the
Copies of
gene other cut DNA. The latter was
called restriction endonuclease.
A restriction enzyme
or restriction endonuclease is
6 Various applications
an enzyme that cleaves DNA
Basic
Gene used to alter bacteria research into fragments at or near
on gene Gene for pest resistance
for cleaning up toxic waste
inserted into plants specific recognition sites
within the molecule known
Figure 4.4: Steps involved in r-DNA Technology as restriction sites. Based on
into a carrier molecule called a vector that their mode of action restriction
can self-replicate within the host cell. enzymes are classified into Exonucleases and
• Selection of the transformed host cells is Endonucleases.
carrying the rDNA and allowing them to a. Exonucleases are enzymes which remove
multiply thereby multiplying the rDNA nucleotides one at a time from the end of a
molecule. DNA molecule. e.g. Bal 31, Exonuclease III.
• The entire process thus generates either a b. Endonucleases are enzymes which break
large amount of rDNA or a large amount the internal phosphodiester bonds within a
of protein expressed by the insert.
Restriction Recognition
• Wherever vectors are not involved enzyme
Microbial source sequence Fragments
the desired gene is multiplied Arthrobacter 5’AG/CT3’ A-G C-T Blunt
Alu I 3’TC/GA5’
by PCR technique. The multiple luteus T-C G-A ends
copies are injected into the host cell Bacillus 5’G/GATCC3’ G G-A-T-C-C Sticky
BamHI
amyloliquefaciens 3’CCTAG/G5’ C-C-T-A-G G ends
protoplast or it is shot into the host
G A-A-T-T-C
cell protoplast by shot gun method. EcoRI Escherichia coli 5’G/AATTC3’ Sticky
3’CCTAG/G5’ C-T-T-A-A G ends
Haemophilus 5’GG/CC3’ G-G C-C Blunt
4.5 Tools for Genetic HaeIII
aegyptus 3’CC/GG5’ C-C G-G ends
Engineering Haemophilus 5’A/AGCTT3’ A A-G-C-T-T Sticky
HindIII
3’TTCGA/A5’ ends
In order to generate recombinant influenza T-T-C-G-A A
DNA molecule, certain basic tools Table 4.1: Type II restriction enzyme with source,
recognition and cleavage site.

www.tntextbooks.in
DNA molecule. e.g. Hind II, EcoRI, Pvul, indicating the order of discovery. For example,
BamHI, TaqI. EcoRI is from Escherichia (E) coli (co), strain RY
Restriction endonucleases: Molecular scissors 13 (R) and first endonuclease (I) to be discovered.
The restriction enzymes are called as molecular The exact kind of cleavage produced by a
scissors. These act as foundation of recombinant restriction enzyme is important in the design
DNA technology. These enzymes exist in of a gene cloning experiment. Some cleave both
many bacteria where they function as a part strands of DNA through the centre resulting
of their defence mechanism called restriction- in blunt or flush end. These are known as
modification system. symmetric cuts. Some enzymes cut in a way
There are three main classes of restriction producing protruding and recessed ends known
endonucleases: Type I, Type II and Type III, as sticky or cohesive end. Such cut are called
which differ slightly by their mode of action. staggered or asymmetric cuts.
Only type II enzyme is preferred for use in 5’ – GAATTC – 3’ Eco RI 5’ – G AATTC – 3’
recombinant DNA technology as they recognise 3’ – CTTAAG – 5’ Digest 3’ – CTTAA G – 5’
5’ sticky-ends
and cut DNA within a specific sequence
typically consisting of 4-8 bp. Examples of 5’ – CCCGGG – 3’ SmaI 5’ – CCC GGG – 3’
certain enzymes are given in table 5.1. 3’ – GGGCCC – 5’ Digest
3’ – GGG CCC – 5’
Blunt ends
The restriction enzyme Hind II always cut Figure 4.5: Sticky and Blunt ends
DNA molecules at a point of recognising a
specific sequence of six base pairs. This sequence Two other enzymes that play an important
is known as recognition sequence. Today role in recombinant DNA technology are
more than 900 restriction enzymes have been DNA ligase and alkaline phosphatase
isolated from over 230 strains of bacteria with 4.5.2 DNA Ligase
different recognition sequences. This sequence DNA ligase enzyme joins the sugar and
is referred to as a restriction site and is generally phosphate molecules of double stranded
–palindromic which means that the sequence in DNA (dsDNA) with 5’-PO4 and a 3’-OH in
both DNA strands at this site read same in 5’ – 3’ an Adenosine Triphosphate (ATP) dependent
direction and in the 3’-5’ direction reaction. This is isolated from T4 phage.
Example: MALAYALAM: This phrase is DNA Ligase Reaction
read the same in either of the directions. O
DNA strand 3’ OH + –O P O 5’ DNA strand

Palindromic repeats: A symmetrical
–O
repeated sequence in DNA strands
DNA ligase
5’ ... CATTATATAATG ... 3’ 2Pi PPi ATP (or NAD+) AMP
3’ ... GTAATATATTAC ... 5’ O
Note: That the sequence of the base pairs in DNA strand 3’ O P O 5’ DNA strand
the reverse direction when compare to the –O
first sequence. New 3’ – 5’ Phosphodiester bond

Figure 4.6: DNA ligase reaction
Restriction endonucleases are named by a
standard procedure. The first letter of the enzymes 4.5.3 Alkaline Phosphatase
indicates the genus name, followed by the first It is a DNA modifying enzyme and adds
two letters of the species, then comes the strain or removes specific phosphate group at 5’
of the organism and finally a roman numeral terminus of double stranded DNA (dsDNA) or

www.tntextbooks.in
single stranded DNA (ssDNA) or RNA. Thus it antibiotic resistance, to permit its detection
prevents self ligation. This enzyme is purified in transformed host cell.
from bacteria and calf intestine. • Vector should have unique target sites for
P
OH DNA integration with DNA insert and should
Plasmid ligase
cut open Recircularization have the ability to integrate with DNA
(linear DNA) P OH of plasmid
(Self ligation) insert it carries into the genome of the host
cell. Most of the commonly used cloning
2Pi Alkaline phosphatase
vectors have more than one restriction site.
OH DNA
HO ligase
These are Multiple Cloning Site (MCS) or
X No reaction
polylinker. Presence of MCS facilitates the
HO OH
use of restriction enzyme of choice.
Ho P
P Ho
DNA ligase Formation of recombinant DNA
Foreign DNA
fragment Plasmid EcoRl Foreign DNA
GA
CT A
T
TT G
GAATTC GAATTC
AA
C
CTTAAG CTTAAG
EcoRl
Figure 4.7: Action of Alkaline Phosphatase The plasmid and

the foreign DNA
are cut by the same
4.5.4 Vectors restriction enzyme-in
this case, EcoRl
Another major component of a gene cloning G
CTT
AA
experiment is a vector such as a plasmid. A AATTC G
G CTTAA
Vector is a small DNA molecule capable of Complementary
stricky ends
self-replication and is used as a carrier and When mixed, the
sticky ends anneal,
AA
transporter of DNA fragment which is inserted

TT G
C
joining the foreign
into it for cloning experiments. Vector is DNA and plasmid.
also called cloning vehicle or cloning DNA.

GAA
Vectors are of two types: i) Cloning Vector, and CTT T
AA
T
C
ii) Expression Vector. Cloning vector is used for the

G
cloning of DNA insert inside the suitable host cell.

CT AT
Expression vector is used to express the DNA insert

GA
TA
AG
TC
for producing specific protein inside the host.
DNA ligase
Properties of Vectors GAA
T
CTT T Nicks in the
Vectors are able to replicate autonomously to AA
C
sugar-phosphate
G
produce multiple copies of them along with bonds are sealed

by DNA ligase.
their DNA insert in the host cell.
CT AT
GA
TA
AG
• It should be small in size and of low molecular TC
weight, less than 10 Kb (kilo base pair) in size

so that entry/transfer into host cell is easy. The foreign DNA fragement can be inserted into
• Vector must contain an origin of replication a plasmid with the use of restriction enzymes
so that it can independetly replicate within
the host. The following are the features that are required
to facilitate cloning into a vector.
• It should contain a suitable marker such as

www.tntextbooks.in
Origin of replication (ori): This is a

1. plasmid, Band R respectively the names of
sequence from where replication starts scientist Boliver and Rodriguez who developed
and piece of DNA when linked to this this plasmid. The number 322 is the number
sequence can be made to replicate within of plasmid developed from their laboratory. It
the host cells. contains ampR and tetR two different antibiotic
resistance genes and recognition sites for several
Unique restriction enzyme cleavage sites
restriction enzymes. (Hind III, EcoRI, BamH
BamHl Sall
Pstl I, Sal I, Pvu II, Pst I, Cla I), ori and antibiotic
1. A cloning EcoRl
vector must contain resistance genes. Rop codes for the proteins
an orgin of replication ori (orgin of Hindlll
recongnized in the replication) involved in the replication of the plasmid.
host cell so that it is Selectable 3. A cloning
replicated along with marker (FR5, +LQG,,,
vector needs
the DNA that it carries.
a single %DP+,
cleavage DPS5 WHW5 DPS5 $PSLFLOOLQ5HVLVWDQFH*HQH
2. It should carry selectable site for each
S%5
markers-traits that enable cells of one or more WHW5 7HWUDF\FOLQH5HVLVWDQFH*HQH
containing the vector to be restriction RUL URS
selected or identified enzyme used.
3YX,,
Figure 4.8: Properties of Vector Figure 4.10: pBR 322

Selectable marker: In addition to ori the
2. Ti Plasmid Bacteria
vector requires a selectable marker, which Ti plasmid is found Cytokinin
Auxin Opine
helps in identifying and eliminating non in Agrobacterium
transformants and selectively permitting tumefaciens, a bacteria
T-DNA Region
the growth of the transformants. responsible for Opine
Catabolism
Cloning sites: In order to link the alien

3. inducing tumours Virulence
Region Orgin of
DNA, the vector needs to have very few, in several dicot Replication (ORI)
preferably single, recognition sites for the plants. The plasmid Figure 4.11: Ti Plasmid
commonly used restriction enzymes. carries transfer (tra)
gene which help to transfer T- DNA from one
Types of vector bacterium to other bacterial or plant cell. It has
Few types of Onc gene for oncogenecity, ori gene for origin
vectors are for replication and inc gene for incompatibility.
discussed in detail T-DNA of Ti-Plasmid is stably integrated with
below: plant DNA. Agrobacterium plasmids have been
Nucleoid Plasmids
Plasmid Bacterial
chromosome (circular)
used for introduction of genes of desirable traits
Plasmids are extra into plants.
Figure 4.9: Bacterial
c h r o m o s o m a l , chromosome and plasmids 4.5.5 Competent Host (For
self replicating ds Transformation with Recombinant DNA)
circular DNA molecules, found in the bacterial The propagation of the recombinant DNA
cells in addition to the bacterial chromosome. molecules must occur inside a living system or
Plasmids contain Genetic information for their host. Many types of host cells are available for
own replication. gene cloning which includes E.coli, yeast, animal
BR 322 Plasmid
p or plant cells. The type of host cell depends
pBR 322 plasmid is a reconstructed plasmid upon the cloning experiment. E.coli is the most
and most widely used as cloning vector; it widely used organism as its genetic make-up
contains 4361 base pairs. In pBR, p denotes has been extensively studied, it is easy to handle

www.tntextbooks.in
and grow, can accept a range of Cell membrane

vectors and has also been studied Nucleus
for safety. One more important Proteoglycan

Escape from DNA
feature of E.coli to be preferred as Endocytosis endosome
a host cell is that under optimal Lipoplex
growing conditions the cells divide DNA
every 20 minutes. Endosome with

lipid mixing
Since the DNA is a hydrophilic
Lipoplex Endosomal
molecule,it cannot pass through Endosome maturation
cell membranes, In order to force DNA
DNA
fragmentation
bacteria to take up the plasmid, Liposome
the bacterial cells must first be Lysosome
made competent to take up DNA. Figure 4.15: Liposome mediated method of Gene Transfer
This is done by treating them with
4.6.1 Direct or Vectorless Gene Transfer
a specific concentration of a divalent cation
In the direct gene transfer methods, the foreign
such as calcium. Recombinant DNA can then
gene of interest is delivered into the host plant
be forced into such cells by incubating the cells
without the help of a vector. The following are
with recombinant DNA on ice, followed by
some of the common methods of direct gene
placing them briefly at 420C (heatshock) and
transfer in plants.
then putting them back on ice. This enables
a. Chemical mediated gene transfer:
bacteria to take up the Recombinant DNA.
Certain chemicals like polyethylene glycol
For the expression of eukaryotic proteins, (PEG) and dextran sulphate induce DNA
eukaryotic cells are preferred because to produce uptake into plant protoplasts.
a functionally active protein it should fold b. Microinjection: The DNA is directly injected
properly and post translational modifications into the nucleus using fine tipped glass needle
should also occur, which is not possible by or micro pipette to transform plant cells.
prokaryotic cell (E.coli). The protoplasts are immobilised on a solid
4.6 Methods of Gene Transfer support (agarose on a microscopic slide) or
held with a holding pipette under suction.
The next step after a recombinant DNA molecule
c. Electroporation Methods of Gene
has been generated is to introduce it into a
Transfer: A pulse of high voltage is applied
suitable host cell. There are many methods to
to protoplasts, cells or tissues which makes
introduce recombinant vectors and these are
transient pores in the plasma membrane
dependent on several factors such as the vector
through which uptake of foreign DNA
type and host cell.
occurs.
For achieving genetic transformation in
Before Pulse During E-field After Pulse
plants, the basic pre-requisite is the construction Cell membrane Introduce Cell heals with
of a vector which carries the gene of interest -
+
genes/drugs gene/drug inside
+
+
flanked by the necessary controlling sequences, + + -
- - + -
- +
- + - -
- -+ + --- + +
-- + - + +
i.e., the promoter and terminator, and deliver the - +
- + -
- -
+
+
+ --- +++ - +
- + - -
-
+
genes into the host plant. There are two kinds of +
- +
+
- +
Electric field induces a
gene transfer methods in plants. It includes: voltage across cell membrane
• Direct or vectorless gene transfer Figure 4.14: Electroporation Methods of

Gene Transfer
• Indirect or vector – mediated gene transfer

www.tntextbooks.in
L iposome mediated method of Gene

d. to regenerate plants from the transformed
Transfer: Liposomes the artificial cells.(Figure 4.16)
phospholipid vesicles are useful in gene
transfer. The gene or DNA is transferred
from liposome into vacuole of plant 4.6.2 Indirect or Vector-Mediated Gene
cells. It is carried out by encapsulated Transfer
DNA into the vacuole. This technique Gene transfer is mediated with the help of a
is advantageous because the liposome plasmid vector is known as indirect or vector
protects the introduced DNA from being mediated gene transfer. Among the various
damaged by the acidic pH and protease vectors used for plant transformation, the
enzymes present in the vacuole. Liposome Ti-plasmid from Agrobacterium tumefaciens
and tonoplast of vacuole fusion resulted has been used extensively. This bacterium
in gene transfer. This process is called has a large size plasmid, known as Ti
lipofection. plasmid (Tumor inducing) and a portion
Gene gun barrel of it referred as T-DNA (transfer DNA) is
transferred to plant genome in the infected
cells and cause plant tumors (crown gall).
Plastic disc with Since this bacterium has the natural ability
DNA-coated
gold particles to transfer T-DNA region of its plasmid into
plant genome, upon infection of cells at the
Disc stopped
by screen
wound site, it is also known as the natural
DNA-pcoated genetic engineer of plants.
gold particles
The foreign gene (e.g. Bt gene for insect
resistance) and plant selection marker
gene, usually an antibiotic gene like npt
Target plant cells II which confers resistance to antibiotic
Figure 4.16: Gene gun method of Gene Transfer
kanamycin are cloned in the T DNA region
Biolistics: The foreign DNA is coated onto
e. of Ti-plasmid in place of unwanted DNA
the surface of minute gold or tungsten sequences.(Figure 4.17)
particles (1-3 µm) and bombarded onto
the target tissue or cells using a particle gun 4.7 Screening for Recombinants
(also called as gene gun/micro projectile After the introduction of r-DNA into a suitable
gun/shotgun). Then the bombarded cells host cell, it is essential to identify those cells
or tissues are cultured on selected medium which have received the r-DNA molecule. This
Agrobacterium T DNA carrying

DNA containing
tumefaciens new gene within plant
gene for desired trait
chromosome
Plant cell
Ti 1 2 3 3
plasmid Recombinant
Insertion of Ti plasmid Introduction The plant cells
gene into plasmid into plant Regeneration
T DNA are grown in Plant with
using restriction cells of plant
culture new trait
Restriction enzyme and DNA ligase
cleavage site
Figure 4.17: Agrobacterium mediated gene transfer in plants

www.tntextbooks.in
process is called screening. The vector or foreign contain genes encoding resistance to antibiotics
DNA present in recombinant cells expresses the such as ampicillin, chloro amphenicol,
characters, while the non-recombinants do not tetracycline or kanamycin, etc., while others
express the characters or traits. For this some of may not be able to grow in these media, hence it
the methods are used and one such method is is considered useful selectable marker.
Blue-White Colony Selection method. 4.7.3. Replica plating technique
4.7.1 Insertional Inactivation - Blue- A technique in which the pattern of colonies
White Colony Selection Method growing on a culture plate is copied. A sterile
It is a powerful method used for screening filter plate is pressed against the culture plate
of recombinant plasmid. In this method, a and then lifted. Then the filter is pressed against
reporter gene lacZ is inserted in the vector. a second sterile culture plate. This results in the
The lacZ encodes the enzyme β-galactosidase new plate being infected with cell in the same
and contains several recognition sites for relative positions as the colonies in the original
restriction enzyme. plate. Usually, the medium used in the second
β-galactosidase breaks a synthetic substrate plate will differ from that used in the first. It may
called X-gal (5-bromo-4-chloro-indolyl-β- include an antibiotic or exclude a growth factor.
D-galacto-pyranoside) into an insoluble blue In this way, transformed cells can be selected.
coloured product. If a foreign gene is inserted Ampicillin sensitive colonies
into lacZ, this gene will be inactivated.
Therefore, no-blue colour will develop (white) Incubate
because β-galactosidase is not synthesized due
to inactivation of lacZ. Therefore, the host Lacks ampicillin Contains ampicillin
cell containing r-DNA form white coloured

Master plate Replicate on
colonies on the medium contain X-gal, whereas fresh media
the other cells containing non-recombinant
DNA will develop the blue coloured colonies.
On the basis of colony colour, the recombinants
can be selected.
Sterile velvet on a block Imprints of all colonies
a lac promoter Multiple E %OXH
Figure 4.19: Replica plating technique
QRLQVHUW
Ampicilin cloning
resistance site :KLWH
FRQWDLQLQVHUW
4.7.4 Molecular Techniques - Isolation of
(amp) pUC 18 lacZ
$PSLFLOOLQ,37*;JDOSODWH
Genetic Material and Gel Electrophoresis
Electrophoresis is a separating technique used
Ori
Figure 4.18: a. Plasmid vector designed for to separate different biomolecules with positive
blue-white screening b. Blue-white colony and negative charges.
selection method Principle
4.7.2 Antibiotic resistant markers By applying electricity (DC) the molecules
An antibiotic resistance marker is a gene migrate according to the type of charges
that produces a protein that provides cells they have. The electrical charges on different
with resistance to an antibiotic. Bacteria molecules are variable.
with transformed DNA can be identified by will move
+ve charged Cations –ve Cathode
growing on a medium containing an antibiotic. towards
Recombinants will grow on these media as they –ve charged Anions
will move
+ve Anode
towards

www.tntextbooks.in
Agarose GEL Electrophoresis 4.7.5 Nucleic Acid Hybridization -

It is used mainly for the purification of specific Blotting Techniques
DNA fragments. Agarose is convenient for Blotting techniques are widely used analytical
separating DNA fragments ranging in size tools for the specific identification of desired
from a few hundred to about 20000 base DNA or RNA fragments from larger number
pairs. Polyacrylamide is preferred for the of molecules. Blotting refers to the process of
purification of smaller DNA fragments. The gel immobilization of sample nucleic acids or solid
is complex network of polymeric molecules. support (nitrocellulose or nylon membranes.)
DNA molecule is negatively charged molecule The blotted nucleic acids are then used as target
- under an electric field DNA molecule in the hybridization experiments for their
migrates through the gel. The electrophoresis specific detection.
is frequently performed with marker DNA Types of Blotting Techniques
fragments of known size which allow accurate Southern Blotting: The transfer of DNA from
size determination of an unknown DNA agarose gels to nitrocellulose membrane.
molecule by interpolation. The advantages of
Northern Blotting: The transfer of RNA to
agarose gel electrophoresis are that the DNA
nitrocellulose membrane.
bands can be readily detected at high sensitivity.
Western Blotting: Electrophoretic transfer of
The bands of DNA in the gel are stained with
Proteins to nitrocellulose membrane.
the dye Ethidium Bromide and DNA can be
detected as visible fluorescence illuminated in Southern Blotting Techniques - DNA
UV light will give orange fluorescence, which The transfer of denatured DNA from Agarose
can be photographed. gel to Nitrocellulose Blotting or Filter Paper
technique was introduced by Southern in 1975
and this technique is called Southern Blotting
Technique.
Steps
a b The transfer of DNA from agarose gel to
Figure 4.20: a. Bands of DNA in Agarose gel nitrocellulose filter paper is achieved by
b. Gel Electrophoresis Instrument Capillary Action.
A buffer Sodium Saline Citrate (SSC) is
Agricultural diagnostics refers to a variety of tests used, in which DNA is highly soluble, it can be
that are used for detection of pathogens in plant
drawn up through the gel into the Nitrocellulose
tissues. Two of the most efficient methods are
membrane.
1. ELISA (Enzyme Linked Immumo Sorbent
By this process ss-DNA becomes ‘Trapped’
Assay)
in the membrane matrix.
Elisa is a diagnostic tool for identification of
pathogen species by using antibodies and This DNA is hybridized with a nucleic acid
diagnostic agents. Use of ELISA in plant pathology and can be detected by autoradiography.
especially for weeding out virus infected plants Autoradiography - A technique that captures
from large scale planting is well known. the image formed in a photographic emulsion
2. DNA Probes due to emission of light or radioactivity from
DNA Probes, isotopic and non-isotopic (Northern a labelled component placed together with
and Southern blotting) are popular tools for unexposed film.
identification of viruses and other pathogens

www.tntextbooks.in
Weight
Glass plate 1. DNA is cleaved by
restriction enzymes and
transferred to an agarose
Paper tissues gel. The fragments are
separated by gel
Filter paper electrophoresis.
Membrane
Gel
Filter paper wick 2. The gel is soaked in an
Plastic alkali solution to denature the
Support block tray double-stranded DNA and
Transfer then placed on a platform in a
buffer Blotting dish containing buffer.
paper
Figure 4.21: Diagrammatic representation Weight
3. A membrane is positioned
on top of the gel.
of a typical blotting apparatus
Nitrocellulose
Northern Blot or other membrane
Gel
It was found that RNA is not binding to cellulose Blotting paper
nitrate. Therefore, Alwin et al. (1979) devised a Alkali solution
procedure in which RNA bands are transferred
Platform 4. Buffer drawn up into the top
from the agarose gel into nitrocellulose filter layer of blotting paper passes
paper. This transfer of RNA from gel to special through the gel, carrying DNA
onto the membrane.
filter paper is called Northern Blot hybridization.
The filter paper used for Northern blot is Amino Membrane
DNA
Benzyloxymethyl Paper which can be prepared
from Whatman 540 paper.
5. DNA on the
Western Blot membrane is fixed....
Refers to the electrophoretic transfer of proteins 6. ....placed in a

to blotting papers. Nitrocellulose filter paper can hybridization bottle with
solution that contains a
be used for western blot technique. A particular radioactively lablled
protein is then identified by probing the blot probe, and gently rotated.
with a radio-labelled antibody which binds on Radioactive probe

7. The probe binds to
the specific protein to which the antibody was complementary DNA fragments
prepared. on the membrane,...
4.7.6 Bioassay for Target Gene Effect

Size
Target gene is target DNA, foreign DNA, standards
passenger DNA, exogenous DNA, gene of
interest or insert DNA that is to be either Auto radiography
cloned or specifically mutated. Gene targeting

experiments have been targeting the nuclei
8. ...and autoradiography detects
and this leads to ‘gene knock-out’. For this fragments with probe attached.
purpose, two types of targeting vectors are used.
Figure 4.22: Steps involved in southern
They are insertion vectors and replacement or
blotting technique
transplacement vectors.
1. Insertion vectors are entirely inserted into
targeted locus as the vectors are linearized vectors are circular but during insertion,
within the homology region. Initially, these become linear. It leads to duplication of
sequences adjacent to selectable markers.

www.tntextbooks.in
Differences between Blotting Techniques

Southern blotting Northern blotting Western blotting
Name Southern name of the inventor Northern a misnomer Western a misnomer
Separation of DNA RNA Proteins
Denaturation Needed Not needed Needed
Membrane Nitrocellulose/ nylon Amino Nitrocellulose
benzyloxymethyl
Hybridisaiton DNA-DNA RNA-DNA Protein-antibody
Visualising Autoradiogram Autoradiogram Dark room
Table 4.2: Difference between Blotting Techniques
2 The replacement vector has the homology between different plant taxa is assessed using
region and it is co-linear with target. This DNA content as well as the similarities and
vector is linearized prior to transfection differences in the DNA sequence (sequence
outside the homology region and then homology). Based on such analysis the taxa and
consequently a crossing over occurs to their relationship are indicated in cladogram.
replace the endogenous DNA with the Which will show the genetic distance between
incoming DNA. two taxa. It also shows antiquity or modernity
of any taxon with respect to one another (See
Transfection: Introduction of foreign also Unit-2, Chapter-5 of XI Std.)
nucleic acids into cells by non-viral methods.
Barcode: You might have
4.7.7. Genome Sequencing and Plant
seen in all books barcoding
Genome Projects
and also in items you buy
The whole complement of genes that determine in supermarket. This will
all characteristics of an organism is called reveal the identity of the book or item as well
genome. Which may be nuclear genome, the details like prize. Similarily, Barcode in
mitochondrial genome or plastid genome. genetic term refer to the identify of the taxon
Genome of many plants contain both functional based on its genetic makeup. In practice, it
and non-expressive DNA proteins. Genome is an optical, machine-
project refers to a project in which the whole readable representation
genome of plant is analysed using sequence of data which describes
analysis and sequence homology with other about the characters
plants. Such genome projects have so far of any plants or any
been undertaken in Chlamydomonas(algae), objects.
Arabidopsis thaliana, rice and maize plants.
Genome content of an organism is expressed in 4.7.9 Genome editing and CRISPR -
terms of number of base pairs or in terms of the Cas9
content of DNA which is expressed as c-value.
Genome editing or gene editing is a group of
4.7.8 Evolutionary pattern assessed technologies that has the ability to change an
using DNA. organism’s DNA. These technologies allow
In recent years the evolutionary relationship genetic material to be added, removed, or

www.tntextbooks.in
altered at particular locations in the genome. A simplified model for the RNAi pathway
Several approaches to genome editing have is based on two steps, each involving
been developed. A recent one is known ribonuclease enzyme. In the first step, the
as CRISPR-Cas9, which is short form of trigger RNA (either dsRNA or miRNA primary
Clustered Regularly Interspaced Short transcript) is processed into a short interfering
Palindromic Repeats and CRISPR-associated RNA (siRNA) by the RNase II enzymes
protein 9. The CRISPR-Cas9 system has called Dicer and Drosha. In the second step,
siRNAs are loaded into the effector complex
generated a lot of excitement in the scientific
RNA-induced silencing complex (RISC). The
community because it is faster, cheaper,
siRNA is unwound during RISC assembly
more accurate, and more efficient than other
and the single-stranded RNA hybridizes with
existing genome editing methods. mRNA target. This RNAi is seen in plant
Rice, was among the first plants to be used feeding nematodes.
to demonstrate the feasibility of CRISPR- RISC complex with
unzipped SiRNA
mediated targeted mutagenesis and gene
Plant cell Cleaved mRNA
replacement. The gene editing tool CRISPR n
can be used to make hybrid rice plants that dsRNA

can clone their seed. Imtiyaz Khand and Dicer
Venkatesan Sundaresan and Interaction

siRNA Target
of Dicer
colleagues reported in a new with ds uptake mRNA
RNA by the Root-knot
study which clearly shows nematode nematode
one can re-engineer rice to siRNAs
switch it from a sexual to an Figure 4.23: RNA Interference
asexual mode. 4.8 Transgenic Plants / Genetically
4.7.10 RNA Interference (RNAi) Modified Crops (Gm Crops)
All characters of organism are the result 4.8.1 Herbicide Tolerant – Glyphosate
of expression of different genes which are
Weeds are a constant problem in crop fields.
regions of nuclear DNA. This expression
Weeds not only compete with crops for
involves transcription and translation.
Transcription refers to the copying of sunlight, water, nutrients and space but also
genetic information from one strand of the acts as a carrier for insects and diseases. If left
DNA (called sense strand) by RNA. This uncontrolled, weeds can reduce crop yields
RNA, as soon as it formed cannot be straight significantly.
away sent to the cytoplasm to undertake the
Transgenic plants contain a novel DNA
process of translation. It has to be edited and
made suitable for translation which brings introduced into the genome.
about protein synthesis. One of the main
Glyphosate herbicide produced by Monsanto,
items removed from the RNA strand are the
USA company under the trade name ‘Round
introns. All these changes before translation
normally take place whereby certain regions up’ kills plants by blocking the 5-enopyruvate
of DNA are silence. However, there is an shikimate-3 phosphate synthase (EPSPS)
(RNAi) pathway. RNA interference is a enzyme, an enzyme involved in the biosynthesis
biological process in which RNA molecules of aromatic amino acids, vitamins and many
inhibit gene expression or translation. secondary plant metabolites. There are several
This is done by neutralising targetd mRNA ways by which crops can be modified to be
molecules. glyphosate-tolerant.

www.tntextbooks.in
One strategy is to incorporate a soil bacterium The genes are encoded for toxic crystals in the
gene that produces a glyphosate tolerant form Cry group of endotoxin. When insects attack
of EPSPS. Another way is to incorporate a and eat the cotton plant the Cry toxins are
different soil bacterium gene that produces a dissolved in the insect’s stomach.
glyphosate degrading enzyme. The epithelial membranes of the gut block
Advantages of Herbicide Tolerant Crops certain vital nutrients thereby sufficient
regulation of potassium ions are lost in the
• Weed control improves higher crop yields;
insects and results in the death of epithelial cells
• Reduces spray of herbicide; in the intestine membrane which leads to the
Reduces
• competition between crop plant death of the larvae.
and weed; Advantages
Use
• of low toxicity compounds which do The advantages of
not remain active in the soil; and Bt cotton are:
The
• ability to conserve soil structure and • Yield of cotton
microbes. is increased
due to effective
4.8.2 Herbicide Tolerant - Basta
control of
Trade name ‘Basta’ refers to a non-selective
bollworms. Figure 4.25: Bt Cotton
herbicide containing the chemical compound
• Reduction in
phosphinothricin. Basta herbicide tolerant
gene PPT (L-phosphinothricin) was isolated insecticide use in the cultivation of Bt cotton
from Medicago sativa plant. It inhibits the • Potential reduction in the cost of cultivation.
enzyme glutamine synthase which is involved Disadvantages
in ammonia assimilation. The PPT gene Bt cotton has some limitations:
was introduced into tobacco and transgenic • Cost of Bt cotton seed is high.
tobacco produced was resistant to PPT. Similar • Effectiveness up to 120 days after that
enzyme was also isolated from Streptomyces efficiency is reduced
hygroscopicus with bar gene encodes for PAT
• Ineffective against sucking pests like jassids,
(Phosphinothricin acetyl transferase) and was
aphids and whitefly.
introduced into crop plants like potato and
• Affects pollinating insects and thus yield.
sugar-beet and transgenic crops have been
developed. ii. Bt Brinjal
4.8.3 Insect resistance - Bt Crops: The Bt brinjal is another

transgenic plant created
i. Bt Cotton by inserting a crystal
Bt cotton is a genetically modified organism protein gene (Cry1Ac)
(GMO) or genetically modified pest resistant from the soil bacterium
plant cotton variety, which produces an Bacillus thuringiensis Figure 4.26: Bt Brinjal
insecticide activity to bollworm. into the genome of
Strains of the bacterium Bacillus thuringiensis various brinjal cultivars. The insertion of the
produce over 200 different Bt toxins, each gene, along with other genetic elements such
harmful to different insects. Most Bt toxins as promoters, terminators and an antibiotic
are insecticidal to the larvae of moths and
resistance marker gene into the brinjal plant is
butterflies, beetles, cotton bollworms and
accomplished using Agrobacterium- mediated
gatflies but are harmless to other forms of life.

www.tntextbooks.in
genetic transformation. The Bt brinjal has transfer mechanism of introducing an antisense

been developed to give resistance against gene which interferes with the production of
Lepidopberan insects, in particular the Brinjal the enzyme polygalacturonase, which help in
Fruit and Shoot Borer (Leucinodes orbonalis). delaying the ripening process of tomato during
iii. Dhara Mustard Hybrid (DMH) long storage and transportation.
DMH -11 is transgenic 4.8.6 Golden rice - Biofortification

mustard developed by Golden rice is a variety of Oryza sativa (rice)
a team of scientists at produced through genetic engineering of
the Centre for Genetic biosynthesized beta-carotene, a precursor of
Manipulation of Crop Figure 4.27: Vitamin-A in the edible parts of rice developed
Plants Delhi University Dhara Mustard by Ingo Potrykus and his group. The aim is
under Government to produce a fortified food to be grown and
sponsored project. It is genetically modified consumed in areas with a shortage of dietary
variety of Herbicide Tolerant (HT) mustard. Vitamin-A. Golden rice differs from its parental
It was created by using “barnase/barstar” strain by the addition of three beta-carotene
technology for genetic modification by adding biosynthesis genes namely ‘psy’ (phytoene
genes from soil bacterium that makes mustard, synthase) from daffodil plant Narcissus
a self-pollinating plant. DMH -11 contains pseudonarcissus and ‘crt-1’ gene from the
three genes viz. Bar gene, Barnase and Barstar soil bacterium Erwinia auredorora and ‘lyc’
sourced from soil bacterium. The bar gene had (lycopene cyclase) gene from wild-type rice
made plant resistant to herbicide named Basta. endosperm.
4.8.4 Virus Resistance The endosperm of normal rice, does not contain
Many plants are affected by virus attack beta-carotene. Golden-rice has been genetically
resulting in series loss in yield and even death. altered so that the endosperm now accumulates
Biotechnological intervention is used to Beta-carotene. This has been done using
introduce viral resistant genes into the host plant Recombinant DNA technology. Golden rice can
so that they can resist the attack by virus. This control childhood blindness - Xerophthalmia.
is by introducing genes that produce resistant
enzymes which can deactivate viral DNA.
4.8.5 FlavrSavr Tomato

Agrobacterium mediated
genetic engineering
technique was followed
to produce Flavr-Savr
tomato, i.e., retaining the Figure 4.29: Golden rice
Figure 4.28:
natural colour and flavor FlavrSavr Tomato GM Food - Benefits
of tomato.
• High yield without pest
Through genetic engineering, the ripening
process of the tomato is slowed down and thus • 70% reduction of pesticide usage
prevent it from softening and to increase the • Reduce soil pollution problem
shelf life. The tomato was made more resistant • Conserve microbial population in soil
to rotting by Agrobacterium mediated gene

www.tntextbooks.in
Risks - believed to catalysts like tin octoate in solution. The metal-

• Affect liver, kidney function and cancer catalyzed reaction results in equal amount of d
• Hormonal imbalance and physical disorder and polylactic acid.
• Anaphylactic shock (sudden hypersensitive
4.8.9 Green Fluorescent Protein (GFP)
reaction) and allergies.
• Adverse effect in immune system because of The green fluorescent protein (GFP) is a protein
bacterial protein. containing 238 amino acid residues of 26.9 kDa
• Loss of viability of seeds seen in terminator that exhibits bright green fluorescence when
seed technology of GM crops. exposed to blue to ultraviolet range (395 nm).
GFP refers to the protein first isolated from the
4.8.7 Polyhydroxybutyrate (PHB) jellyfish Aequorea victoria. GFP is an excellent
Synthetic polymers are non-degradable and tool in biology due to its ability to form internal
pollute the soil and when burnt add dioxin in chromophore without requiring any accessory
the environment which cause cancer. So, efforts cofactors, gene products, enzymes or substrates
were taken to provide an alternative eco-friendly other than molecular oxygen. In cell and
biopolymers. Polyhydroxyalkanoates (PHAs) molecular biology, the GFP gene is frequently
and polyhydroxybutyrate (PHB) are group of used as a reporter of expression. It has been
degradable biopolymers which have several used in modified forms to make biosensors.
medical applications such as drug delivery,
4.8.10 Biopharming
scaffold and heart valves. PHAs are biological
macromolecules and thermoplastics which are Biopharming also known as molecular
biodegradable and biocompatible. pharming is the production and use of
transgenic plants genetically engineered to
Several microorganisms have been utilized
produce pharmaceutical substances for use of
to produce different types of PHAs including
human beings. This is also called “molecular
Gram-positive like Bacillus megaterium,
farming or pharming”. These plants are
Bacillussubtilis and Corynebacterium
different from medicinal plants which are
glutamicum, Gram-negative bacteria like group
naturally available. The use of plant systems
of Pseudomonas sp. and Alcaligenes eutrophus.
as bioreactors is gaining more significance in
4.8.8 Polylactic acid (PLA) modern biotechnology. Many pharmaceutical
Polylactic acid or substances can be produced using transgenic
polylactide (PLA) plants. Example: Golden rice
is a biodegradable 4.8.11 Bioremediation
and bioactive
It is defined as the use of microorganisms or
thermoplastic. It is
plants to manage environmental pollution. It
an aliphatic polyester
Figure 4.30: Polylactic is an approach used to treat wastes including
derived from
acid product wastewater, industrial waste and solid waste.
renewable resources,
Bioremediation process is applied to the
such as corn starch,
removal of oil, petrochemical residues,
cassava root, chips or starch or sugarcane. For
pesticides or heavy metals from soil or ground
the production of PLA, two main monomers
water. In many cases, bioremediation is less
are used: lactic acid, and the cyclic diester,
expensive and more sustainable than other
lactide. The most common route is the ring-
physical and chemical methods of remediation.
opening polymerization of lactide with metal
An eco-friendly approach and can deal with

www.tntextbooks.in
lower concentrations of contaminants more Bioremediation

• processes must be
effectively. The strategies for bioremediation in specifically made in accordance to the
soil and water can be as follows: conditions at the contaminated site.
Use
• of indigenous microbial population Small-scale tests on a pilot scale must be
•
as indicator species for bioremediation performed before carrying out the procedure
at the contaminated site.
process.
The use of genetic engineering technology to
•
Bioremediation with the addition of adapted
•
create genetically modified microorganism
or designed microbial inoculants.
or a consortium of microbes for
Use
• of plants for bioremediation - green bioremediation process has great potential.
technology.
4.8.12 Biofuel: Algal Biofuel
Some examples of bioremediation
Algal fuel, also known as algal biofuel, or
technologies are:
algal oil is an alternative to liquid fossil fuels,
Phytoremediation
• - use of plants to bring the petroleum products. This is also used as a
about remediation of environmental source of energy-rich oils. Also, algal fuels are
pollutants. an alternative to commonly known biofuel
Mycoremediation
• - use of fungi to bring sources obtained from corn and sugarcane.
about remediation of environmental The energy crisis and the world food crisis have
pollutants. initiated interest in algal culture (farming algae)
for making biodiesel and other biofuels on lands
Bioventing
• a process that increases
unsuitable for agriculture. Botryococcus braunii
the oxygen or air flow to accelerate the is normally used to produce algal biofuel.
degradation of environmental pollutants. Oil Extaction
Bioleaching
• use of microorganisms in
Protien
solution to recover metal pollutants from Residue
contaminated sites.
Sun Energy
Bioaugmentation
• a addition of selected
microbes to speed up degradation process. Biodiesel
production
Composting
• process by which the solid
Algae
waste is composted by the use of microbes (Renewable resource)
into manure which acts as a nutrient for

CO2
plant growth.
Glycerin
Rhizofiltration
• uptake of metals or products
degradation of organic compounds by Existing Renewable

rhizosphere microorganisms. Technology Fuel
Rhizostimulation
• stimulation of plant Figure 4.31: Algal Biofuel
growth by the rhizosphere by providing Biological hydrogen production by algae
better growth condition or reduction in The biological hydrogen production with
toxic materials. algae is a method of photo biological water
splitting. In normal photosynthesis the alga,
Limitations
Chlamydomonas reinhardtii releases oxygen.
• Only biodegradable contaminants can When it is deprived of sulfur, it switches to the
be transformed using bioremediation production of hydrogen during photosynthesis
processes. and the electrons are transported to ferredoxins.

www.tntextbooks.in
[Fe]-hydrogenase enzymes combine them into the European Patent Office (EPO) on the “method
the production of hydrogen gas. for controlling of diseases on plants by the aid of
CO2 Fixation H2 Production extracted hydrophobic neem oil”. The patenting
of the fungicidal and antibacterial properties
FNR H2 ase
of Neem was an example of biopiracy but the
-O2 + CO2 -O2 - CO2
Fd traditional knowledge of the Indians was protected
in the end.
Cytb6f
PQ PSI
PSII PQ Biopiracy of Turmeric
PC
The United States Patent and Trademark Office, in
Mn
the year 1995 granted patent to the method of use
2H2O O2 + 4H+ + 4e- of turmeric as an antiseptic agent. Turmeric has
Figure 4.32: Hydrogen production by algae been used by the Indians as a home remedy for the
quick healing of the wounds and also for purpose
4.8.13 Bioprospecting of healing rashes. The journal article published by
Bioprospecting is the process of discovery and the Indian Medical Association, in the year 1953
commercialization of new products obtained wherein this remedy was mentioned. Therefore, in
from biological resources. Bioprospecting this way it was proved that the use of turmeric as
may involve biopiracy, in which indigenous an antiseptic is not new to the world and is not a
knowledge of nature, originating with new invention, but formed a part of the traditional
indigenous people, is used by others for profit, knowledge of the Indians. The objection in this
case US patent and trademark office was upheld
without authorization or compensation to the
and traditional knowledge of the Indians was
indigenous people themselves.
protected. It is another example of Biopiracy.
Biopiracy Biopiracy of Basmati
Biopiracy can be defined as the manipulation of On September 2, 1997, the U.S. Patent and
intellectual property rights laws by corporations Trademarks Office granted Patent on “basmati
to gain exclusive control over national genetic rice lines and grains” to the Texas-based company
resources, without giving adequate recognition RiceTec. This broad patent gives the company
or remuneration to the original possessors of several rights, including exclusive use of the term
those resources. Examples of biopiracy include 'basmati', as well proprietary rights on the seeds and
recent patents granted by the U.S. Patent and grains from any crosses. The patent also covers the
Trademarks Office to American companies on process of breeding RiceTec’s novel rice lines and
turmeric, ‘neem’ and, most notably, ‘basmati’ the method to determine the cooking properties
rice. All three products are indigenous to the and starch content of the rice grains.
Indo-Pak subcontinent.
India had periled the United States to take the
Biopiracy of Neem matter to the WTO as an infringement of the
The people of India used neem and its oil in many TRIPS agreement, which could have resulted
ways to controlling fungal and bacterial skin in major embarrassment for the US. Hence
infections. Indian’s have shared the knowledge voluntarily and due to few decisions take by the
of the properties of the neem with the entire US patent office, Rice Tec had no choice but to
world. Pirating this knowledge, the United States lose most of the claims and most importantly
Department of Agriculture (USDA) and an the right to call the rice “Basmati”. In the year
American MNC (Multi Nation Corporation) 2002, the final decision was taken. Rice Tec
W.R.Grace in the early 90’s sought a patent from dropped down 15 claims, resulting in clearing

www.tntextbooks.in
the path of Indian Basmati rice exports to the Summary

foreign countries. The Patent Office ordered the Biotechnology is the science of applied biological
patent name to be changed to ‘Rice lines 867’. process in which there is a controlled use of
biological agents such as microorganisms
4.9 Applications of Biotechnology
or cellular components for beneficial use. A
• Biotechnology is one of the most important
Hungarian Engineer, Karl Ereky (1919) coined
applied interdisciplinary sciences of the 21st
the term biotechnology. Biotechnology broadly
century. It is the trusted area that enables us
categorized into traditional practices and modern
to find the beneficial way of life.
practices. Traditional biotechnology includes our
•
Biotechnology has wide applications in ancient practices such as fermentation. Single
various sectors like agriculture, medicine, Cell Protein (SCP) organisms are grown in large
environment and commercial industries. quantities to produce goods rich in protein,
• This science has an invaluable outcome like minerals, fats, carbohydrates and vitamins. The
transgenic varieties of plants e.g. transgenic modern biotechnology embraces all the genetic
cotton (Bt-cotton), rice, tomato, tobacco, manipulations. The recombinant DNA technology
cauliflower, potato and banana. is a technique of modern biotechnology in which
• The development of transgenics as pesticide transfer of DNA coding for a specific gene
resistant, stress resistant and disease from one organism is introduced into another
resistant varieties of agricultural crops is the organism using specific agents like vectors or
immense outcome of biotechnology. using instruments like electroporation, gene
The synthesis of human insulin and
• gun, liposome mediated, chemical mediated and
blood protein in E.coli and utilized for micro injection. Other tools are enzymes and host
insulin deficiency disorder in human is organisms. The enzyme restriction endonuclease
a breakthrough in biotech industries in is a molecular scissor that cleaves DNA into
medicine. fragments at or near specific recognition sites with
the molecule known as restriction sites. Other
•
The synthesis of vaccines, enzymes,
enzymes are DNA ligase and alkaline phosphatase.
antibiotics, dairy products and beverages
DNA ligase enzyme joins the sugar and phosphate
are the products of biotech industries.
molecules of double stranded DNA. Alkaline
Biochip based biological computer is one of
•
phosphatase is an enzyme which adds or removes
the successes of biotechnology.
specific phosphate group of double stranded DNA.
•
Genetic engineering involves genetic
A vector is a small DNA molecule capable of
manipulation, tissue culture involves aseptic
self replication and used as a carrier of DNA
cultivation of totipotent plant cell into
inserted in the host cell. Few examples of vectors
plant clones under controlled atmospheric
are plasmid – pBR 322, cosmid – Lambda phage,
conditions.
M13, Phagmid , BAC, YAC, transposon, shuttle
Single cell protein from Spirulina is utilized
• vector and expression vector.
in food industries.
After production of recombinant DNA molecule
• Production of secondary metabolites, has been generated is introduced into a suitable
biofertilizers, biopesticides and enzymes. host cell. Type of host cell depends upon the
•
Biomass energy, biofuel, Bioremediation, cloning experiment. E.coli is the most widely
phytoremediation for environmental used host organism. There are two kinds of gene
biotechnology. transfer methods in plants. They are direct or
vectorless gene transfer and indirect or vector

www.tntextbooks.in
mediated gene transfer. Direct gene transfer 3. EcoRI cleaves DNA at

includes chemical mediated gene transfer, micro a. AGGGTT b. GTATATC
injection, electroporation. Gene gun method and c. GAATTC d. TATAGC
Liposome mediated method of gene transfer. 4. Genetic engineering is
Indirect or vector mediated gene transfer is a. making artificial genes.
a method of gene transfer with the help of a b. hybridization of DNA of one organism
plasmid vector. In this method Ti-plasmid to that of the others.
from Agrobactirum tumefeciens has been used c.
production of alcohol by using micro
extensively for vector mediated gene transfer. organisms.
After the introduction of rDNA into a host d. making artificial limbs, diagnostic
cell, it is essential to identify those cells which instruments such as ECG, EEG etc.,
have received the rDNA molecule. This process
5. Consider the following statements:
is called screening. One of the method of
I. Recombinant DNA technology is
recombinant screening is blue white selection
popularly known as genetic engineering
method Replica plating technique in which the
is a stream of biotechnology which
pattern of colonies growing on a culture plate is
deals with the manipulation of genetic
copied. Electrophoresis is a separating technique
materials by man invitro
used to separate different biomolecules.
II. pBR322 is the first artificial cloning
Blotting techniques are widely used tools for vector developed in 1977 by Boliver
identification of desired DNA or RNA fragments and Rodriguez from E.coli plasmid
from larger number of molecules. Some of the III. Restriction enzymes belongs to a class
genetically modified crops are herbicide tolerant of enzymes called nucleases.
– Basta, Dhara mustard, insects resistance Choose the correct option regarding above
– Bt crops, flavrSavr – Tomato, Golden rice. statements
Biopolymers are polyhydroxybutyrate (PHB), a. I & II b. I & III
polylactic acid (PLA) and green fluorescent c. II & III d. I,II & III
protein (GFP) is used to make biosensors. Other 6. The process of recombinant DNA
applications are biopharming, bioprospecting, technology has the following steps
biomedication and biofuel, etc. I. amplication of the gene
II. Insertion of recombinant DNA into
Evaluation
the host cells
1. Restriction enzymes are
III. Cutting of DNA at specific location
a. Not always required in
using restriction enzyme .
genetic engineering
IV. Isolation of genetic material (DNA)
b. Essential tools in
Pick out the correct sequence of step
genetic engineering
for recombinant DNA technology.
c. Nucleases that cleave
a. II, III, IV, I b. IV, II, III, I
DNA at specific sites
c. I, II, III, IV d. IV, III, I, II
d. both b and c
7. Which one of the following palindromic
2. Plasmids are
base sequence in DNA can be easily cut
a. circular protein molecules
at about the middle by some particular
b. required by bacteria
restriction enzymes?
c. tiny bacteria
a. 5 CGTTCG 3 3 ATCGTA 5
d. confer resistance to antibiotics

www.tntextbooks.in
b. 5 GATATG 3 3 CTACTA 5 reason is not correct explanation of

c. 5 GAATTC 3 3 CTTAAG 5 assertion.
d. 5 CACGTA 3 3 CTCAGT 5 c) Assertion is true, but reason is false.
8. pBR 322, BR stands for d) Assertion is false, but reason is true.
a. Plasmid Bacterial Recombination e) Both assertion and reason are false.
b. Plasmid Bacterial Replication 13 Which one of the following is not correct
c. Plasmid Boliver and Rodriguez statement.
d. Plasmid Baltimore and Rodriguez a) Ti plasmid causes the bunchy top disease
9. Which of the following one is used as a b) Multiple cloning site is known as
Biosensors? Polylinker
a. Electrophoresis b. Bioreactors c) Non viral method transfection of
c. Vectors d. Electroporation Nucleic acid in cell
d) Polylactic acid is a kind of biodegradable
10. Match the following : and bioactive thermoplastic.
Column A Column B 14 An analysis of chromosomal DNA using the
1 Exonuclease a. add or remove phosphate
southern hybridisation technique does not use
2 Endonuclease b. binding the DNA
a) Electrophoresis
fragments
3 Alkaline c. cut the DNA at terminus b) Blotting
Phosphatase c) Autoradiography
4 Ligase d. cut the DNA at middle d) Polymerase Chain Reaction
1 2 3 4 15 An antibiotic gene in a vector usually helps
A) a b c d in the selection of
B) c d b a a) Competent cells b) Transformed cells
C) a c b d c) Recombinant cells d) None of the above
D) c d a b 16 Some of the characteristics of Bt cotton are
11 In which techniques Ethidium Bromide is a) Long fibre and resistant to aphids
used? b) Medium yield, long fibre and resistant
a. Southern Blotting techniques to beetle pests
b. Western Blotting techniques c) high yield and production of toxic protein
c. Polymerase Chain Reaction crystals which kill dipteran pests.
d. Agrose Gel Electroporosis d) High yield and resistant to ball worms
12 Assertion : Agrobacterium tumifaciens How do you use the biotechnology in
17.
is popular in genetic engineering because modern practice?
this bacteriumis associated with the root What are the materials used to grow
18.
nodules of all cereals and pulse crops microorganism like Spirulina?
Reason: A gene incorporated in the 19. You are working in a biotechnology lab
bacterial chromosomal genome gets with a becterium namely E.coli. How will
atomatically transferred to the cross with you cut the nucleotide sequence? explain it.
which bacterium is associated. 20. What are the enzymes you can used to
a) Both assertion and reason are true. But cut terminal end and internal phospho di
reason is correct explanation of assertion. ester bond of nucleotide sequence?
b) B oth assertion and reason are true. But

www.tntextbooks.in
21. Name the chemicals used in gene transfer. complementary extension of phage lambda (l)
What do you know about the word
22. DNA.
pBR332? DNA Polymerase: An enzyme that catalyses the
23. Mention the application of Biotechnology. phosphodiester bond in the formation of DNA.
24.
What are restriction enzyme. Mention
Endonucleases: An enzyme that catalyses the
their type with role in Biotechnology.
cleavage of DNA at internal position, cutting
25.
Is their any possibilities to transfer a DNA at specific sites.
suitable desirable gene to host plant
without vector? Justify your answer. Genome: The entire complement of genetic
26. How will you identify a vectors? material of an organism.
27.
Compare the various types of Blotting Insert DNA: A DNA molecule incorporated
techniques. into a cloning vector.
28. Write the advantages of herbicide tolerant
Ligase: An enzyme used in genetic engineering
crops.
experiment to join the cut ends of dsDNA.
29. Write the advantages and disadvantages of
Bt cotton. M-13: AssDNA bacteriophage used as vector
for DNA sequencing.
30.
What is bioremediation? give some
examples of bioremediation. Phagemid: A cloning vector that contains
31. Write the benefits and risk of Genetically components derived from both phage DNA and
Modified Foods. plasmid.
Glossary Plasmid: Extrachromosomal, self-replicating,

circular dsDNA containing some non-essential
3’ Hydroxy end: The hydroxyl group attached
genes.
to 3’ carbon atom of sugar of the terminal
nucleotide of a nucleic acid. Restriction map: A linear array of sites on DNA
cleaved by various restriction enzymes.
Bacterial artificial chromosomes (BAC): A
cloning vector for isolation of genomic DNA Shuttle Vector: A plasmid cloning vector
constructed on the basis of F-factor. that can replicate in two different organisms
due to the presence of two different origin of
Chimeric DNA: A recombinant DNA molecule
replication OriEUK and OriE. coli
containing unrelated genes.
Taq polymerase: A heat stable DNA polymerase
Cleave: To break phosphodiester bonds of
isolated from a thermophilic bacterium Thermus
dsDNA, usually with a restriction enzyme.
aquaticus.
Cloning site: A location on a cloning vector
Vectors: Vehicles for transferring DNA from
into which DNA can be inserted.
one cell to another.
Cloning: Incorporation of a DNA molecule
Biofuel: Fuels like hydrogen, ethanol and
into a chromosomal site or a cloning vector.
methanol produced from a biological source by
Cloning Vector: A small, self-replicating DNA the action of microorganisms.
inserted in a cloning gene.
Bioleaching: Process of using microorganisms
COS sites: The 12-base, single strand, to recover metals from their ores or contaminant

www.tntextbooks.in
environment Recombinant: Cell / Organism formed by a

recombination of genes.
Bioremediation: Process of using organisms
to remove or reduce pollutants from the Transformation: Process of transferring
environment. a foreign DNA into a cell and changing its
genome.
Green Technology: Pollution-free technology
in which pollution is controlled at source. Vector: Agent used in recombinant DNA
technique to carry new genes into foreign cells.
Phytoremediation: Use of certain plants to
remove contaminants or pollutants from the Wild Type: Natural form of organisms.
environment (soil, water or air).
APPENDIX
Interdisciplinarity Fields of Biotechnology

Biotechnology is one of the most important applied interdisciplinary sciences of the 21st century. It is the
trusted area that enables us to find the beneficial way of life. Biotechnology has wide applications in various
sectors like agriculture, medicine, environment and commercial industries.
*HQHWLFV 0ROHFXODU ,PPXQRORJ\ 0LFURELRORJ\ &HOO%LRORJ\ %LRFKHPLVWU\ %LRLQIRUPDWLFV %LRSK\VLFV
%LRORJ\
6FLHQFHRI 6WXG\RI 6WXG\RI 6WXG\RI 6WXG\RI 0DQDJHPHQW $SSOLFDWLRQ
KHUHGLW\DQG 6WXG\RI ERG\¶VGHIHQFH PLFURRUJDQLVPV FHOOVDQGWKHLU FKHPLFDO RIELRORJLFDO RISK\VLFDO
9DULDWLRQVLQ ELRORJ\DW PHFKDQLVPV DQGWKHLU LQWHUDFWLRQ 3URFHVVHV LQIRUPDWLRQ SULQFLSOHV
RUJDQLVPV PROHFXODU HIIHFWRQ ZLWK LQOLYLQJ ZLWKWKHKHOS DQGPHWKRGV
OHYHO KXPDQV HQYLURQPHQW V\VWHPV RIFRPSXWHU WRELRORJLFDO
WHFKQRORJ\ SUREOHPV
$FXOWLYDWHGSODQWJURZQ
&URS
02'(51%,27(&+12/2*< FRPPHUFLDOO\LQDODUJHVFDOH
'LDJQRVWLF &KDUDFWHULVWLFRULQGLFDWLYHRIDGLVHDVH
1DQRELRWHFKQRORJ\ %LRPHGLFDO 7LVVXH &KHPLFDO(QJLQHHULQJ 'UXJRUPHGLFLQHXVHG

(QJLQHHULQJ (QJLQHHULQJ 3KDUPDFHXWLFDOV
1DQRWHFKQRORJ\ &RQYHUVLRQRIUDZ LQPHGLFDOWUHDWPHQW
$SSOLFDWLRQRI 6WXG\RI
ZLWKELRORJLFDO PDWHULDOVLQWR $Q\DQWLJHQDQWLERG\WKDWFRQIHUV
HQJLQHHULQJ ELRPDWHULDOVDQG YDOXDEOHIRUPVZLWK
DQG%LRFKHPLFDO 9DFFLQH
SULQFLSOHVDQG VWHPFHOOVWRUHSDLU WKHDSSOLFDWLRQRI LPPXQLW\WRDSDUWLFXODUGLVHDVH
DSSOLFDWLRQV WHFKQLTXHVWRWKH RUUHSODFHERG\ SK\VLFDODQG 'RPHVWLFDWHGDQLPDOVNHSWWR
PHGLFDOILHOG WLVVXHRUJDQ OLIHVFLHQFH /LYHVWRFN
SURGXFHFRPPRGLWLHVRUIDYRXULWHV
Figure 4.1: Interdisciplinarity Fields of Biotechnology

www.tntextbooks.in
4.2 Historical Perspective

The major historical events for the development of Biotechnology, as an interdisciplinary
field with multidisciplinary applications are listed below:
Before Common Era 1978 – Production of human insulin in E.Coli
6000 BC – 3000 BC – Bread making,
1979 – Development of Artificial gene –
fermentation of fruit juices and plant exudates functioning within the living cells by
to produce alcoholic beverages using yeast. H.G. Khorana
1982 – U.S approved humulin ( human insulin)
Pre – 20th Century
the first pharmaceutical product of
1770 – Antoine Lavoisier gave chemical basis rDNA technology, for human use.
of alcoholic fermentation.
1983 – Use of Ti plasmids to genetically
1798 – Edward Jenner uses first viral vaccine transform plants
to inoculate a child from smallpox.
1986 – Development of Polymerase Chain
1838 – Protein discovered, named and Reaction (PCR) technology by Kary
recorded by Gerardus Johannes Mullis.
Mulder and Jons Jacob Berzelius.
1987 –
Gene transfer by biolistic
1871 –
Ernst Hoppe, Seyler discovered transformation
enzyme invertase, which is still used
1992 –
First chromosomes of yeast is
for making artificial sweeteners.
sequenced
1876 –
Louis Pasteur identified role of
1994 –
U.S approved the first Genetically
microorganisms in fermentation.
Modified food: Flavr Savr tomato.
1997 – The first transgenic animal,
20th Century mammalian sheep, Dolly developed
1919 – The term biotechnology was coined by nuclear cloning by Ian Wilmet.
by Karl Ereky 2000 – First plant Genome of Arabidopsis
1928 – Discovery of Penicillin by Alexander thaliana sequenced
Fleming
1941 – Experiment with Neurospora crassa 21st Century
resulting in one gene one enzyme
hypothesis by George Beadle and 2001 – Human genome Project creates a draft
Edward Tatum. of the human genome sequence.
1944 – Identification of DNA as the genetic 2002 – First crop plant genome sequenced
material Avery–MacLeod–McCarty in Oryza sativa
1953 – Discovery of double helix structure of 2003 – Human genome project is
DNA by James Watson and Francis Crick. completed, providing information on
the locations and sequence of human
1972 – Discovery of Restriction enzymes by genes on all 46 chromosomes.
Arber, Smith and Nathans.
2010 – Sir Robert G. Edwards developed in
1973 – Fragmentation of DNA-combined with vitro fertilization in animal.
Plasmid DNA, r-DNA technology -
Genetic engineering -Modified gene 2016 – Stem cells injected into stroke patients re-
by Stanley Cohen, Annie Chang, enable patient to walk – Stem cell therapy
Robert Helling and Herbert Boyer. 2017 – Blood stem cells grown in lab.
1975 – Production of Monoclonal antibodies 2018 – James Allison and TasukuHonjo
by Kohler and Milstein discovered protein found in immune
1976 –
Sanger and Gilbert developed cells. This found a new role in cancer
techniques to sequence DNA therapy.

www.tntextbooks.in
More vectors to know
3RO\OLQNHU
Cosmid
$PSU FRVPLG
Cosmids are plasmids containing the ‘cos’ - Cohesive
&RVVLWH
Terminus, the sequence having cohesive ends. They are
hybrid vectors derived from plasmids having a fragment of
&RO(
RUL lambda phage DNA with its Cos site and a bacterial plasmid.
Bacteriophage Vectors FO 5HSOLFDWLRQ

JHQHV
Bacteriophages are viruses that infect bacteria. The most
/\VLV
commonly used E. coli phages are l phage (Lambda phage) 5HVWULFWLRQ
VLWH JHQHV
and M13 phage. Phage vectors are more efficient than (VVHQWLDO /DPEGD
JHQH JHQRPH
plasmids - DNA upto 25 Kb can be inserted into phage vector. /\VRJHQLF
JHQHV
Lambda genome: Lambda phage is a temperate bacteriophage &RDW
JHQHV
that infects Escherichia coli. The genome of lambda-Phage is
5HVWULFWLRQ
48502 bp long, i.e. 49Kb and has 50 genes. VLWH
6HFUHDWLRQVLJQDO &RDWSURWHLQ
3URPRWHU 'LVSOD\HGSHSWLGH Phagemid Vectors
Phagemids are reconstructed plasmid vectors, which contain
$PSU
their own origin - ‘ori’ gene and also contain origin of
3KDJHPLG
replication from a phage. pBluescript SK (+/–) is an example
GV'1$RQ
of phagemid vector.
IRUL
1RW, +LQG,,,
Bacterial Artificial Chromosome (BAC) Vector %DP+,
7 1RW,
KH
BAC is a shuttle plasmid vector, created for cloning large-sized SDU%
6S
foreign DNA. BAC vector is one of the most useful cloning &0
SDU$
vector in r-DNA technology they can clone DNA inserts of
UHS(
upto 300 Kb and they are stable and more user-friendly. RQ6
&HQ
VXSRFKUH
$56
&ORQLQJVLWH Yeast Artificial chromosome (YAC vector)
WUS
DPSU
S<$& XUD YAC plasmid vector behaves like a yeast chromosome, which occurs
S0%25,
in two forms, i.e. circular and linear. The circular YAC multiplies in
7HORPHUH 7HORPHUH
%DP+, %DP+, Bacteria and linear YAC multiplies in Yeast Cells.
KLV
Shuttle Vectors <HDVW

%DFWHULDO
UHSOLFDWLRQ RULJLQRI
The shuttle vectors are plasmids designed to replicate in cells of JHQHV UHSOLFDWLRQ
two different species. These vectors are created by recombinant $QWLELRWLF

UHVLVWDQFH 6KXWWOH /HXFLQH
ELRV\QWKHVH
techniques. The shuttle vectors can propagate in one host and JHQH YHFWRU JHQH
<HDVW
then move into another host without any extra manipulation. 0XOWLSOH
FORQLQJVLWH FHQWURPHUH
VHTXHQFH
Most of the Eukaryotic vectors are Shuttle Vectors.

www.tntextbooks.in
ICT Corner
Principles and Processes of Biotechnology
BIO TECH STUDY APP
Let us know about

the information Bio
Technology through
this activity.
Steps
• Type the URL or scan the QR code to open the activity page.
• Click on the topic to know in detail.
• To know the sub topics in detail click on the dots in top right corner.
Step 1 Step 2 Step 3 Step 4
URL:
https://play.google.com/store/apps/details?id=info.therithal.brainkart.
biotechstudyapp
* Pictures are indicative only

www.tntextbooks.in

Chapter
5 Plant Tissue Culture
Learning Objectives Growing plant

protoplasts, cells, tissues
The learner will be able to or organs away from

Perceive the concepts of tissue culture. their natural or normal

Cognize the steps of tissue culture environment, under
techniques and its types. artificial condition, is

Understand the protoplast culture in known as Tissue Culture.
detail. It is also known as in vitro Gottlieb
(In vitro is a Latin word, Haberlandt

Elicit the list of secondary metabolites
it means that - in glass
obtained through cell suspension
or in test-tube) growth of plant protoplasts,
culture.
cells, tissues and organs. A single explant can

Learn plant regeneration pathway. be multiplied into several thousand plants in

Appreciate the uses of micro a short duration and space under controlled
propagation, somatic hybridization, conditions.
shoot meristem culture and germplasm Tissue culture techniques are often used
conservation. for commercial production of plants as well as

Acquire the knowledge of patenting for plant research. Plant tissue culture serves
Biosafety and Bioethics. as an indispensable tool for regeneration of
transgenic plants. Apart from this some of
Chapter outline the main applications of Plant tissue culture
are clonal propagation of elite varieties,
5.1 Basic concepts in conservation of endangered plants, production
plant disuse culture of virus-free plants, germplasm preservation,
5.2 Plant tissue culture industrial production of secondary metabolites.
techniques and types etc., In this chapter let us discuss the history ,
5.3 Plant regeneration techniques, types , applications of plant tissue
pathway culture and get awareness on ethical issues.
5.4 Applications of plant tissue culture Gottlieb Haberlandt (1902) the German
5.5 Conservation of plant genetic Botanist proposed the concept Totipotency
resources and he was also the first person to culture plant
5.6 Intellectual rights of property (IPR), cells in artificial conditions using the mesophyll
Biosafety and Bioethics cells of Lamium purpureum in culture medium
5.7 Future Biotechnology and obtained cell proliferation. He is regarded
as the father of tissue culture.

www.tntextbooks.in
5.2 Basic concepts of Tissue Culture 5.3 Plant Tissue Culture (PTC)
Basic concepts of plant tissue culture are Plant tissue culture is used to describe the in
totipotency, differentiation, dedifferentiation vitro and aseptic growth of any plant part on a
and redifferentiation. tissue culture medium. This technology is based
Totipotency on three fundamental principles:
• The plant part or explant must be selected
The property of live plant cells that they
have the genetic potential when cultured in and isolated from the rest of plant body.
• The explant must be maintained in controlled
nutrient medium to give rise to a complete
individual plant. physically (environmental) and chemically
defined (nutrient medium) conditions.
Differentiation • Aseptic condition must be maintained,
The process of biochemical and structural Explant: The tissue taken from a selected
which requires high degree of cleanliness in
changes by which cells become specialized in plant transferred to a culture medium often
the laboratory.
form and function. to establish a new plant.
Explant
5.3.1 Laboratory Facilities for PTC
For PTC, the laboratory must have the following
facilities:
Explant in
Nutrient medium
Callus
Plantlet
Early
Late
Embryo
Embryo
Figure 5.1: Totipotency

Figure 5.2: Tissue culture lab
Redifferentiation • Washing facility for glassware and ovens for
The further differentiation of already drying glassware.
differentiated cell into another type of cell. • Medium preparation room with autoclave,
For example, when the component cells of electronic balance and pH meter.
callus have the ability to form a whole plant in
• Transfer area sterile room with laminar
a nutrient medium, the phenomenon is called
air-flow bench and a positive pressure
redifferentiation.
ventilation unit called High Efficiency
Dedifferentiation Particulate Air (HEPA) filter to maintain
The phenomenon of the reversion of mature aseptic condition.
cells to the meristematic state leading to the • Culture facility: Growing the explant
formation of callus is called dedifferentiation. inoculated into culture tubes at 22-28° C
These two phenomena of redifferentiation and with illumination of light 2400 lux, with a
dedifferentiation are the inherent capacities of photoperiod of 8-16 hours and a relative
living plant cells or tissue. This is described as humidity of about 60%.
totipotency.
Plant Tissue Culture 97

www.tntextbooks.in
5.3.2 Technique Involved in PTC iv. Sterilization of Explants: The plant

materials to be used for tissue culture should be
1. Sterilization: surface sterilized by first exposing the material
Sterilization is the technique employed to get in running tap water and then treating it in
rid of microbes such as bacteria and fungi in the surface sterilization agents like 0.1% mercuric
culture medium, vessels and explants. chloride, 70% ethanol under aseptic condition
i. Maintenance of Aseptic Environment: inside the Laminar Air Flow Chamber.
During in vitro tissue culture maintenance of
2. Media Preparation
aseptic environmental condition should be
The success of tissue culture lies in the
followed, i.e., sterilization of glassware, forceps,
composition of the growth medium, plant
scalpels, and all accessories in wet steam
growth regulators and culture conditions
sterilization by autoclaving at 15 psi (121°C)
such as temperature, pH, light and humidity.
for 15 to 30 minutes or dipping in 70% ethanol
No single medium is capable of maintaining
followed by flaming and cooling.
optimum growth of all plant tissues. Suitable
ii. Sterilization of culture room: Floor and
nutrient medium as per the principle of tissue
walls are washed first with detergent and then
culture is prepared and used.
with 2% sodium hypochlorite or 95% ethanol.
MS nutrient medium (Murashige and Skoog
The cabinet of laminar airflow is sterilized by
1962) is commonly used. It has carbon sources,
clearing the work surface with 95% ethanol and
with suitable vitamins and hormones. The media
then exposure of UV radiation for 15 minutes.
formulations available for plant tissue culture
iii. Sterilization of Nutrient Media: Culture
other than MS are B5 medium (Gamborg.et.al
media are dispensed in glass containers, plugged
1968), White medium (white 1943), Nitsch’s
with non-absorbent cotton or sealed with plastic
medium (Nitsch & Nitsch 1969). A medium may
closures and then sterilized using autoclave at
be solid or semisolid or liquid. For solidification,
15 psi (121°C) for 15 to 30 minutes. The plant
a gelling agent such as agar is added.
extracts, vitamins, amino acids and hormones
are sterilized by passing through Millipore filter
Agar: A complex mucilaginous polysaccharide
with 0.2 mm pore diameter and then added
to sterilized culture medium inside Laminar obtained from marine algae (sea weeds) used
Airflow Chamber under sterile condition. as solidifying agent in media preparation.
8QGLIIHUHQWLDWHG
%XG &DOOXVIRUPHG
/HDI 7LVVXHVDPSOH
6WHP
&DOOXV
5RRW &DOOXVVHSDUDWHG
DQGVLQJOHFHOO
)XUWKHUFXOWXULQJ
FXOWXUHG
UHJHQHUDWHGQHZ
Figure 5.3: Basic steps in Plant tissue culture technology SODQWOHW

www.tntextbooks.in
3. Culture condition 6. Hardening

pH The plantlets developed in vitro require a
The pH of medium is normally adjusted between hardening period and so are transferred to
5.6 to 6.0 for the best result. greenhouse or hardening chamber and then to
normal environmental conditions.
Temperature
The cultures should be incubated normally at Hardening is the gradual exposure of in vitro
constant temperature of 25°C ± 2°C for optimal developed plantlets in humid chambers in
growth. diffused light for acclimatization so as to enable
them to grow under normal field conditions.
Humidity and Light Intensity
The cultures require 50-60% relative humidity 5.3.3 Types of Plant tissue cultures
and 16 hours of photoperiod by the illumination Based on the type of explants other plant tissue
of cool white fluorescent tubes of approximately culture types are
1000 lux. 1. Organ culture
Aeration 2. Meristem culture
Aeration to the culture can be provided by 3. Protoplast culture
shaking the flasks or tubes of liquid culture on 4. Cell suspension culture.
automatic shaker or aeration of the medium by 1. Organ culture
passing with filter-sterilized air.
3ODQW
4. Induction of Callus
Explant of 1-2 cm
sterile segment
selected from leaf,
stem, tuber or /HDI ,VRODWHGFHOOV
root is inoculated
,VRODWHG
(transferring the FHOOV
explants to sterile Figure 5.4: &HOOVFXOWXUHGLQ
FXOWXUHPHGLXP
glass tube containing Induction of callus
nutrient medium)
in the MS nutrient medium supplemented 5DLVLQJRISODQWOHWV 3ODQWOHW +DUGHQLQJWRQDWXUDO
with auxins and incubated at 25°C ± 2°C in an HQYLURQPHQW
alternate light and dark period of 12 hours to Figure 5.6: Organ Culture
induce cell division and soon the upper surface
The culture of embryos, anthers, ovaries, roots,
of explant develops into callus. Callus is a mass
shoots or other organs of plants on culture media.
of unorganized growth of plant cells or tissues
in in vitro culture medium. 2. Meristem Culture:
5. Embryogenesis The culture of any plant meristematic tissue on
The callus cells undergoes culture media.
differentiation and produces
somatic embryos, known as
Embryoids. The embryoids
are sub-cultured to produce Figure 5.5:
plantlets. Embryogenesis

www.tntextbooks.in
whole plants from single cells and also develop

somatic hybrids. The steps involved in protoplast
culture.
2OGHUOHDYHVDUH
VDUH
RPD
UHPRYHGIURPD
i. Isolation of protoplast: Small bits of plant
QDWLRQ
FXWWLQJRIFDUQDWLRQ tissue like leaf tissue are used for isolation of
protoplast. The leaf tissue is immersed in 0.5%
Macrozyme and 2% Onozuka cellulase enzymes
dissolved in 13% sorbitol or mannitol at pH 5.4.
0DJQLILHGYLHZRI
DJQLILHGYLHZRI 6KRRWWLSZLWKJURZLQJ
6KRRWWLSZ
VKRRWWLSDIWHUUHPRYDO WLSDIWHUUHPRYDORI
It is then incubated over-night at 25°C. After a
RIODUJHUOHDYHV HQFORVLQJOHDYHV gentle teasing of cells, protoplasts are obtained,
and these are then transferred to 20% sucrose
solution to retain their viability. They are then
centrifuged to get pure protoplasts as different
from debris of cell walls.
ii. Fusion of protoplast: It is done through the
3DSHUZLFN &DOOXV 3ODQWOHWV
use of a suitable fusogen. This is normally PEG
(Polyethylene Glycol). The isolated protoplast
Figure 5.7: Meristem Culture
are incubated in 25 to 30% concentration of
3. Protoplast Culture: PEG with Ca++ ions and the protoplast shows
Protoplasts are cells without a cell wall, but agglutination (the formation of clumps of cells)
bound by a cell membrane or plasma membrane. and fusion.
Using protoplasts, it is possible to regenerate iii. Culture of protoplast: MS liquid medium
is used with some modification in
3ODQWOHWGHULYHG
IURPSURWRSODVW droplet, plating or micro-drop array
/HDI
VWHULOL]DWLRQ techniques. Protoplast viability is
tested with fluorescein diacetate
before the culture. The cultures
are incubated in continuous light
(SLGHUPLV
'LIIHUHQWLDWLRQ
<RXQJSODQW
SHHOLQJ
1000-2000 lux at 25°C. The cell
RIFDOOXV wall formation occurs within 24-
WLVVXH
3HHOHGOHDI 48 hours and the first division of
&DOOXV VHJPHQWV
WLVVXH new cells occurs between 2-7 days
of culture.
3ODVPRO\VHG
FHOOV iv. Selection of somatic hybrid
&OXPS
RIFHOOV cells: The fusion product of
protoplasts without nucleus of
&HOOVLQ
&HOOZDOO HQ]\PHPL[WXUH different cells is called a cybrid.
UHJHQHUDWLRQ Following this nuclear fusion take
3ODWLQJRI :DVKLQJRI place. This process is called somatic
SURWRSODVWV SURWRSODVW
hybridization.
&HOOZDOOGLJHVWLRQ
DQGUHOHDVHRI 4. Cell Suspension Culture
,VRODWHG
SURWRSODVW
SURWRSODVW
3URWRSODVW
'HEULV The growing of cells including
the culture of single cells or small
Figure 5.8: Protoplast Culture

www.tntextbooks.in
aggregates of cells in vitro in liquid medium 5.4 Plant Regeneration Pathway

is known as cell suspension culture. The cell From the explants, plants can be regenerated by
suspension is prepared by transferring a somatic embryogenesis or organogenesis.
portion of callus to the liquid medium and
([SODQW
agitated using rotary shaker instrument. The
cells are separated from the callus tissue and 0HULVWHP
9LUXVIUHHSODQWOHWV
used for cell suspension culture.
6KRRWDSH[
Production of Secondary Metabolites 0XOWLSOHVKRRWLQGXFWLRQ
Cell suspension culture can be useful for the 6WHP 1RGH 0LFURSURSDJDWLRQ
production of secondary metabolites like
/HDI 5RRWLQGXFWLRQ
alkaloids, flavonoids, terpenoids, phenolic
compounds and recombinant proteins. 5RRW 3ODQWOHWV
Secondary metabolites are chemical compounds
that are not required by the plant for normal &DOOXV ,QGLUHFW +DUGHQLQJ
HPEU\RJHQHVLV
growth and development but are produced in
the plant as ‘byproducts’ of cell metabolism. For 7UDQVIHUWRILHOG
'LUHFW 6KRRWLQGXFWLRQ
Example: Biosynthesis and isolation of indole HPEU\RJHQHVLV
5RRWLQGXFWLRQ
alkaloids from Catharanthus roseus plant cell
(PEU\RLGV
culture.
3ODQWOHWV
The process of production of secondary 3ODQWOHWV
metabolites can be scaled up and automated +DUGHQLQJ
using bio-reactors for commercial production. +DUGHQLQJ
7UDQVIHUWRILHOG
Many strategies such as biotransformation,
7UDQVIHUWRILHOG
elicitation and immobilization have been
used to make cell suspension cultures more Figure 5.9: Flow chart of Plant
efficient in the production of secondary regeneration pathway
metabolites. Few examples of industrially
important plant secondary metabolites 'LUHFW
RUJDQRJHQHVLV
are listed below in the table: 5RRWLQJ
Secondary
Plant source Uses 5RRW
metabolites RUJDQRJHQHVLV
&DOOXV ,QGLUHFW
RUJDQRJHQHVLV
Digitalis ([SODQWV
Digoxin Cardiac tonic
purpurea 6KRRW
RUJDQRJHQHVLV
Papaver 5RRWLQJ
3ODQWOHWV
Codeine Analgesic
somniferum
'LUHFW ,QGLUHFW6RPDWLF
6RPDWLF HPEU\RJHQHVLV
Capsicum Rheumatic HPEU\RJHQHVLV 6RPDWLF
HPEU\R
Capsaicin
annuum pain treatment
Figure 5.10: Plant Regeneration Pathway
Catharanthus Anti-
Vincristine
roseus carcinogenic
Cinchona
Quinine Antimalarial
officinalis
Table 5.1: Secondary metabolites
and its plant resources

www.tntextbooks.in
5.4.1 Somatic Embryogenesis in conservation of plant biodiversity.

Somatic embryogenesis is the formation of iii.
Production of disease resistant plants
embryos from the callus tissue directly and through meristem and shoot tip culture.
these embryos are called Embryoids or from iv. Production of stress resistant plants like
the in vitro cells directly form pre-embryonic herbicide tolerant, heat tolerant plants.
cells which differentiate into embryoids. v. Micropropagation technique to obtain
large numbers of plantlets of both crop and
Applications
tree species useful in forestry within a short
• Somatic embryogenesis provides potential
span of time and all through the year.
plantlets which after hardening period can
vi. Production of secondary metabolites from
establish into plants.
cell culture utilized in pharmaceutical,
• Somatic embryoids can be be used for the
cosmetic and food industries.
production of synthetic seeds.
• Somatic embryogenesis is now reported Somaclonal variations: Somatic variations
in many plants such as Allium sativum, found in plants regenerated in vitro (i.e.
Hordeum vulgare, Oryza sativa, Zea mays variations found in leaf, stem, root, tuber or
and this possible in any plant. propagule)
Gametoclonal variations: Gametophytic
Synthetic seeds are produced by encapsulation variations found in plants regenerated in
of embryoids in agarose gel or calcium alginate. vitro gametic origin (i.e. variations found in
5.4.2 Organogenesis gametes and gametophytes)
The morphological changes occur in the callus 5.5.1 Micropropagation of Banana
leading to the formation of shoot and roots is Micropropagation of plants at industrial level
called organogenesis. maintains high standards of homogeneity in
Shoots (Caulogenesis) plants like pineapple, banana, strawberry and
potato.
Callus Differentiation Plantlets
Roots (Rhizogenesis)
• Organogenesis can be induced in vitro by

introducing plant growth regulators in the MS
medium.
• Auxin and cytokinins induce shoot and root
Figure 5.11: Micropropagation of Banana
formation.
5.5.2 Artificial Seed
5.5 Applications of Plant Tissue Culture
Artificial seeds or synthetic seeds (synseeds)
Plant tissue culture techniques have several are produced by using embryoids (somatic
applications such as: embryos) obtained through in vitro culture.
i. Improved hybrids production through They may even be derived from single cells
somatic hybridization. from any part of the plant that later divide to
ii.
Somatic embryoids can be encapsulated form cell mass containing dense cytoplasm,
into synthetic seeds (synseeds). These large nuclceus, starch grains, proteins, and oils
encapsulated seeds or synthetic seeds help etc., To prepare the artificial seeds different

www.tntextbooks.in
inert materials are used for coating the somatic to produce virus-free plants, because the shoot
embryoids like agrose and sodium alginate. meristem tip is always free from viruses.
Artificial seed coat 5.6 Conservation of plant genetic
Artificial endosperm resources
Somatic Embryo
5.6.1 Germplasm Conservation
Germplasm conservation refers to the
conservation of living genetic resources like
pollen, seeds or tissue of plant material
maintained for the purpose of selective plant
breeding, preservation in live condition and
Figure 5.12: Artificial seeds
used for many research works.
Advantages of Artificial seeds
Germplasm conservation resources is a
Artificial seeds have many advantages over the
part of collection of seeds and pollen that are
true seeds
stored in seed or pollen banks, so as to maintain
• Millions of artificial seeds can be produced their viability and fertility for any later use
at any time at low cost. such as hybridization and crop improvement.
• They provide an easy method to produce Germplasm conservation
genetically engineered plants with desirable may also involve a
traits. gene bank, DNA bank
• It is easy to test the genotype of plants. of elite breeding lines
• They can potentially stored for long time of plant resources for
under cryopreservation method. the maintenance of
• Artificial seeds produce identical plants biological diversity and
• The period of dormancy of artificial seeds is also for food security. Figure 5.15: Seed bank
greatly reduced, hence growth is faster with
a shortened life cycle. 5.6.2 Cryopreservation (–195.C)
Cryopreservation, also known as Cryo-
5.5.3 Virus-free plants
conservation, is a
process by which
protoplasts,
cells, tissues,
organelles, organs,
extracellular
matrix, enzymes Figure 5.16: Cryopreservation
or any other
biological materials are subjected to preservation
Figure 5.13: Shoot tip - Apical Meristem by cooling to very low temperature of –196°C
The field grown plants like perennial crops, using liquid nitrogen. At this extreme low
usually are infected by variety of pathogens temperature any enzymatic or chemical activity
like fungi, bacteria, mycoplasma, viruses which of the biological material will be totally stopped
cause considerable economic losses. Chemical and this leads to preservation of material in
methods can be used to control fungal and dormant status. Later these materials can be
bacterial pathogens, but not viruses generally. activated by bringing to room temperature slowly
Shoot meristem tip culture is the method for any experimental work.

www.tntextbooks.in
Protective agents like dimethyl sulphoxide, through legislation for trading new articles.
glycerol or sucrose are added before • A patent is a personal property which
cryopreservation process. These protective can be licensed or sold by the person or
agents are called cryoprotectants, since they organisation just like any other property.
protect the cells, or tissues from the stress of • Patent terms give the inventor the rights to
freezing temperature. exclude others from making, using or selling
his invention.
5.7 Intellectual Property Right (IPR)
5.7.2 Biosafety and Bioethics
Intellectual property right (IPR) is a category
Advances in biotechnology and their
of rights that includes intangible creation of
applications deals with genetic manipulation.
the human intellect, and primarily consists
of copyrights, patents, and trademarks. It also Biosafety
includes other types of rights, such as trade Biosafety is the prevention of large-scale
secrets, publicity rights, moral rights, and rights loss of biological integrity, focusing both on
against unfair competition. ecology and human health. These prevention
mechanisms include conduction of regular
Patent
reviews of the biosafety in laboratory settings,
Trade as well as strict guidelines to follow. Many
Trademark
Secrets laboratories handling biohazards employ an
ongoing risk management assessment and
IPR IN
enforcement process for biosafety. Failures to
Geographical INDIA Copyright
Indication follow such protocols can lead to increased risk
of exposure to biohazards or pathogens.
Plant
Utility/Model Breeders
Design right Bioethics - Ethical, Legal and Social
Implications (ELSI)
Figure 5.17: IPR in India Bioethics refers to the study of ethical issues
• In biotechnology, the transformed emerging from advances in biology and
microorganisms and plants and technologies medicine. It is also a moral discernment
for the production of commercial products as it relates to medical policy and practice.
are exclusively the property of the discoverer. Bioethicists are concerned with the ethical
• The discoverer has the full rights on his questions that arise in the relationships among
property. It should not be neglected by the life sciences, biotechnology and medicine. It
others without legal permission. includes the study of values relating to primary
• The right of discoverer must be protected care and other branches of medicine.
and it does by certain laws framed by a The scope of bioethics is directly related to
country. biotechnology, including cloning, gene therapy,
• The IPR is protected by different ways life extension, human genetic engineering,
like patents, copyrights, trade secrets and astroethics life in space, and manipulation of
trademarks, designs and geographical basic biology through altered DNA, RNA and
indications. proteins. These developments in biotechnology
will affect future evolution, and may require new
5.7.1 Patents principles, such as biotic ethics, that values life
• It is a special right to the discoverer/inventor and its basic biological characters and structures.
that has been granted by the government The Ethical, Legal, and Social Implications

www.tntextbooks.in
(ELSI) program was founded in 1990 as an to culture plant cells in artificial medium,
integral part of the Human Genome Project. The hence he was regarded as father of Tissue
mission of the ELSI program was to identify and culture. Tissue culture mainly based on
address issues raised by genomic research that the concepts totipotency, differentiation,
would affect individuals, families, and society. redifferentiation and dedifferentiation. Plant
A percentage of the Human Genome Project tissue culture technique involves selection
budget at the National Institutes of Health and of explants, sterilization, media preparation,
the U.S. Department of Energy was devoted to maintaining culture condition, callus formation,
ELSI research. embryogenesis or organgenesis and hardening.
Based on the explants chosen the types of tissue
Genetic Engineering Appraisal Committee
culture are organ culture, meristem culture,
(GEAC)
protoplast culture and cell suspension culture.
GEAC is an apex body under Ministry of From the explants, plants can be regenerated
Environment, Forests and Climate change for by somatic embryogenesis or organgenesis is
regulating manufacturing, use, import, export said to be plant regeneration pathway. Some
and storage of hazardous microbes or genetically of the main applications of tissue culture are
modified organisms (GMOs) and cells in the production of somatic hybrids, artificial seeds,
country. It was established as an apex body to accord disease resistant and stress resistant plants,
approval of activities involving large scale use of germplasm conservation, micropropagation
hazardous microorganisms and recombinants in and production of secondary metabolites.
research and industrial production. The GEAC is Intellectual Property Right (IPR) is primarily
also responsible for approval of proposals relating aimed at patents, copyrights, trade secret and
to release of genetically engineered organisms trademark given to the discoverer / inventor
and products into the environment including for the commercial production of transformed
experimental field trials. micro organisms or plants. Biosafety is the
5.8 Future of Biotechnology prevention mechanism to protect harmful
Biotechnology has become a comprehensive incidents due to biohazards or pathogens.
scientific venture from the point of academic Bioethics dealt with ethical issue emerging from
and commercial angles, within a short time with biotechnological advancement. ELSI program
the sequencing of human genome and genome addresses issues related to genenomic research.
of some important organisms. The future GEAC (Genetic Engineering Appraisal
developments in biotechnology will be exciting. Committee) is a regulatory authority for release
Thus the development in biotechnology will lead of genetically modified products or organisms
to a new scientific revolution that would change into the environment.
the lives and future of people. Like industrial
Evaluation
and computer revolution, biotechnological
Choose the correct answer
revolution will also promise major changes in
from the given option:
many aspects of modern life.
1. Totipotency refers to
Summary a)
capacity to generate
Tissue culture is the in vitro asceptic culture of genetically identical
cells, tissues or organs into whole plants under plants.
controlled nutritional and environmental b) capacity to generate a whole plant from
conditions. A German physiologist Gotllieb any plant cell / explant.
Haberlant in 1902 for the first time attempted

www.tntextbooks.in
c) capacity to generate hybrid protoplasts. 6. Select the incorrect statement from given
d) recovery of healthy plants from diseased statement
plants. a) A tonic used for cardiac arrest is obtained
2. Micro propagation involves from Digitalis purpuria
vegetative multiplication of plants by
a) b) Medicine used to treat Rheumatic pain
using micro-organisms. is extracted from Capsicum annum
b) vegetative multiplication of plants by c) An anti malarial drug is isolated from
using small explants. Cinchona officinalis.
vegetative multiplication of plants by
c) d) Anti-cancinogenic property is not seen in
using microspores. Catharanthus roseus.
d) Non-vegetative multiplication of plants 7. Virus free plants are developed from
by using microspores and megaspores. a) Organ culture
3. Match the following : b) Meristem culture
Column A Column B c) Protoplast culture
1) Totipotency A) Reversion of mature d) Cell suspension culture
cells into meristerm 8. The prevention of large scale loss of
2) Dedifferentiation B) Biochemical and biological interity
structural changes of cells
a) Biopatent b) Bioethics
3) Explant C) Properties of living c) Biosafety d) Biofuel
cells develops into entire
plant 9. Cryopreservation means it is a process to
4) Differentiation D) Selected plant tissue preserve plant cells, tissues or organs
transferred to culture a) at very low temperature by using ether.
medium b) at very high temperature by using liquid
1 2 3 4
nitrogen
a) C A D B
c) at very low temperature of -196 by using
b) A C B D
liquid nitrogen
c) B A D C
d) D B C A d) at very low temperature by using liquid
nitrogen
4. The time duration for sterilization process
by using autoclave is ______ minutes and 10. Solidifying agent used in plant tissue
the temperature is _______ culture is
a) 10 to 30 minutes and 125° C a) Nicotinic acid b) Cobaltous chloride
b) 15 to 30 minutes and 121° C c) EDTA d) Agar
c) 15 to 20 minutes and 125° C 11. What is the name of the process given
d) 10 to 20 minutes and 121° C below? Write its 4 types.
5. Which of the following statement is correct %XG
/HDI 7LVVXHVDPSOH
8QGLIIHUHQWLDWHG
&DOOXVIRUPHG
a) Agar is not extracted from marine algae 6WHP
such as seaweeds.
&DOOXV
b) Callus undergoes differentiation and 5RRW &DOOXVVHSDUDWHG

DQGVLQJOHFHOO
produces somatic embryoids. FXOWXUHG
)XUWKHUFXOWXULQJ
UHJHQHUDWHGQHZ
SODQWOHW
c) Surface sterilization of explants is done

12. How will you avoid the growing of microbes
by using mercuric bromide
in nutrient medium during culture process?
d) PH of the culture medium is 5.0 to 6.0
What are the techniques used to remove the

www.tntextbooks.in
microbes? Glossary
13. Write the various steps involved in cell Aseptic condition: Preparation of materials
suspension culture. free from microbes in in vitro cultures.
14. What do you mean Embryoids? Write its
application. Cell Culture: Growing of cells in vitro, including
15. Give the examples for micro propagation the culture of single cells or small aggregates of
performed plants . cells in a liquid medium.
16. Explain the basic concepts involved in plant
Chemically defined medium: A nutritive
tissue culture.
medium used for culturing cells or tissue; each
17. Based on the material used, how will you
chemical of this medium is known and defined;
classify the culture technology? Explain it.
18. Give an account on Cryopreservation. Cybrid: Cytoplasmic hybrid obtained by
19. What do you know about Germplasm the fusion of cytoplasm of cells of different
conservation. Describe it. parental sources; a term applied to the fusion of
20. Write the protocol for artificial seed cytoplasms of two different protoplasts;
preparation.
Organogenesis: The process of initiation and
development of shoot or root though in vitro
culture particularly from callus
APPENDIX
Composition of MS (Murashige and Skoog) Medium
Macronutrients: Iron stock

Ammonium nitrate (NH4NO3) 1650.0 mg/l Na EDTA 37.25 mg/l
Potassium nitrate (KNO3) 1900.0 mg/l Ferrous Sulphate (FeSO4 7H2O) 27.85 mg/l
Calcium chloride (CaCl2 2H2O) 440.0 mg/l
Magnesium sulphate (MgSO4 6H2O) 370.0 mg/l
Vitamins
Potassium dihydrogen phosphate
Glycine 2.0 mg/l
(KH2PO4) 170.0 mg/l
Nicotinic acid 0.5 mg/l
Pyridoxin HCl 0.5 mg/l
Micronutrients: Thaiamine HCl 0.1 mg/l
Manganese sulphate (MnSO4 4H2O) 22.3 mg/l
Zinc sulphate (ZnSO4 4H2O) 8.6 mg/l Growth Hormones
Boric acid (H3BO3) 6.2 mg/l IAA 1.30 mg/l
Potassium iodide (KI) 0.83 mg/l Kinetin 0.4–10.0 mg/l
Myo-inositol 100.0 mg/l
Minor nutrient: Sucrose 30.0 g/l
Sodium molybdate (Na2 MO4 2H2O)0.250 mg/l
Cupric sulphate (CuSO4 5H2O) 0.025 mg/l
Solidifying Agent
Cobaltous chloride (CoCl2 6H2O) 0.025 mg/l
Agar 8.0 g/l

www.tntextbooks.in
5.1 Milestones in Plant Tissue Culture
Haberlandt (1902) Yamada et al. (1963)
cultured plant cells in artificial condition produced calli and free cells in tissue
called in vitro (inside glass) in culture culture of Tradescantia reflexa.
medium (Knop’s salt solution) containing
glucose and peptone and developed callus Guha and Maheshwari (1964)
(unorganized growth of cells and tissue) and
proposed the concept Totipotency, it means developed in vitro production of haploid
the development of whole plant from isolated embryos from anthers of Datura.
cells or tissue in in vitro condition.
Vasil and Hildbrandt (1965)
P.R.White (1934) achieved differentiation of tobacco
developed root cultures, used Knop’s solution plants from single, isolated cells in micro
along with three vitamins like pyridoxine, propagation.
thiamine and nicotinic acid
Takebe et al. (1971)
F.C. Steward (1948) regenerated tobacco plants from isolated
used coconut water in plant tissue culture mesophyll protoplasts.
work and obtained cell proliferation from
carrot explants (Cellular totipotency ). Carlson
and co-workers obtained protoplast fusion
Morel and Martin (1952, 1955)
between Nicotiana glauca and Nicotiana
developed virus-free Dahlia and potato longsdorffii and developed first interspecific
plants using shoot meristem culture. somatic hybrid in 1971.
Murashige and Skoog (1962) Melchers and co-workers in 1978

developed intergenic hybrid between potato
formulated tissue culture medium, a land
and tomato called pomato.
mark in plant tissue culture and it is the
most frequently used medium for all kinds of
tissue culture work. Chilton (1983)
produced transformed tobacco plants from

Kanta et al. (1962) single cell transformation and gene insertion.
Horsh et al. (1984)
produced test-tube fertilization in
developed transgenic tobacco by
flowering plants.
Agrobacterium mediated gene transfer.
Knop’s solution: Nutrient solution used in growth experiments of plants which contains:
Calcium nitrate 3.0 g Potassium nitrate 1.0 g Sucrose 50.0 g (optimal)
Magnesium sulfate 1.0 g Dibasic Potassium phosphate 1.0 g Deionized water 1000.0 ml

www.tntextbooks.in

Chapter
6 Principles of Ecology
Learning Objectives • How soil, climate and other physical features

affect the flora and fauna or vice versa?
The learner will be able to
These questions can be better answered with
Understand the interaction between the study of ecology.
organisms and their
Ecology is essentially a practical science
environment.
involving experiments, continuous
Describe biotic and observations to predict how organisms react
abiotic factors that to particular environmental circumstances
influence the dynamics of and understanding the principles involved in
populations. ecology.
Describe how organisms
adapt themselves to environmental changes. 6.1 Ecology
Learn the structure of various fruits and The term “ecology”
seeds related to their dispersal mechanism. (oekologie) is derived from
two Greek words – oikos
(meaning house or dwelling
Chapter outline place and logos meaning
study) It was first proposed by R. Misra
6.1 Ecology
Reiter (1868). However, the
6.2 Ecological factors
most widely accepted definition of ecology was
6.3 Ecological adaptations given by Ernest Haeckel (1869).
6.4 Dispersal of seeds and fruits
Alexander von Humbolt - Father of Ecology
Ecology is a division of biology which deals Eugene P. Odum - Father of modern Ecology
with the study of environment in relation to
R. Misra - Father of Indian Ecology
organisms. It can be studied by considering
individual organisms, population, community,
biome or biosphere and their environment. 6.1.1 Definitions of ecology
While observing our different environments, “The study of living organisms, both plants and
one can ask questions like animals, in their natural habitats or homes.”
- Reiter (1885)
• Why do plants or animals vary with places?
“Ecology is the study of the reciprocal
•
What are the causes for variation in relationship between living organisms and their
biological diversity of different places? environment.” - Earnest Haeckel (1889)
Principles of Ecology 109

www.tntextbooks.in
6.1.2 Ecological hierarchy habitat and niche of any organism is called

The interaction of Ecotope
Biosphere
organisms with their
The differences between habitat and niche are
environment results in Biome as follows.
the establishment of
grouping of organisms Landscape
Habitat Niche
which is called ecological 1. A specific A functional space
hierarchy or ecological Ecosystem physical space occupied by an
levels of organization. occupied by organism in the same
The basic unit of an organism eco-system
Community
ecological hierarchy is an (species)
individual organism. The 2. Same habitat A single niche is
Population
hierarchy of ecological may be shared by occupied by a single
systems is illustrated many organisms species
Individual organism
below: (species)
3. Habitat Organisms may
6.1.3 Branches of Ecology:
specificity is change their niche
Ecology is mainly divided into two branches, exhibited by with time and season.
they are autecology and synecology. organism.
1. Autecology is the ecology of an individual Table 6.1: Difference between habitat and niche
species and is also called species ecology.
2. Synecology is the ecology of a population or Applied ecology or
community with one or more species and also environmental technology :
called as community ecology. Application of the
Many advances and developments in the field Science of ecology is
ecology resulted in various new dimensions otherwise called as Applied ecology or
and branches. Some of the advanced fields are Environmental technology. It helps us to
Molecular ecology, Eco technology, Statistical manage and conserve natural resources,
ecology and Environmental toxicology. particularly ecosystems, forest and wild
6.1.4 Habitat and Niche life conservative and management.
Environmental management involves
Habitat Bio-diversity conservation, Ecosystem
Habitat is a specific physical place or locality restoration, Habitat management,
occupied by an organism or any species which Invasive species management, Protected
has a particular combination of abiotic or areas management and also help us plan
environmental factors. But the environment of landscapes and environmental impact
any community is called Biotope. designing for the futuristic ecology.
Niche
An ecological niche refers to an organism’s place 6.1.5 Ecological equivalents
in the biotic environment and its functional Taxonomically different species occupying
role in an ecosystem. The term was coined by similar habitats (Niches) in different geographical
the naturalist Roswell Hill Johnson but Grinell regions are called Ecological equivalents.
(1917) was probably first to use this term. The

www.tntextbooks.in
Examples:
Certain species of epiphytic orchids of
• Sun light
Western Ghats of India differ from the Precipitation
epiphytic orchids of South America. But

they are epiphytes.
Carbon
• Species of the grass lands of Western Ghats dioxide and
Water vapour Climatic factors
of India differ from the grass species of Wind
temperate grass lands of Steppe in North
America. But they are all ecologically
primary producers and fulfilling similar
roles in their respective communities. Biotic factors
Grazing animals
Birds
Rodents
6.2 Ecological factors Insects
Man
Plant Pathogens
Epiphytes
Many organisms, co-exist in an environment. Soil slope Edaphic factors
The environment (surrounding) includes Soil water Minerals
physical, chemical and biological components.

Physical nature
When a component surrounding an organism of the soil
Soil air
affects the life of an organism, it becomes a
factor. All such factors together are called Figure 6.1: Environmental factors affecting a plant
environmental factors or ecological factors. a. Light
These factors can be classified into living Light is a well known factor needed for the
(biotic) and non-living (abiotic) which make basic physiological processes of plants, such as
the environment of an organism. However the photosynthesis, transpiration, seed germination
ecological factors are meaningfully grouped and flowering. The portion of the sunlight which
into four classes, which are as follows: can be resolved by the human eye is called
i. Climatic factors visible light. The visible part of light is made-
ii. Edaphic factors up of wavelength from about 400 nm (violet)
to 700 nm (red). The rate of photosynthesis is
iii. Topographic factors
maximum at blue (400 – 500 nm) and red (600 –
iv. Biotic factors 700 nm). The green (500 – 600 nm) wave length
We will discuss the above factors in a concise of spectrum is less strongly absorbed by plants.
manner.
Effects of light on plants
Flowers of poppy, chicory,
dog rose and many other
esis Light regulates St
nth
plants, blossom before the Pho
t osy
Le
af
for
em
an
d ma d
an a
break of dawn (4 – 5 am), g at tio
eds
nin m
n
to n
rmatio
e s
Op
f se
evening primrose open up with the onset of

Ru
Pr
ing
ts
od
nn
no
en
os
uc
Cl
fo
er
em
of dusk (5 – 6 pm) due to diurnal rhythm.

atio
tio
n
Tuber
ov
Floweri
n
in
M
rm
Ge
6.2.1 Climatic Factors

Climate is one of the important natural factors
controlling the plant life. The climatic factors
includes light, temperature, water, wind and Figure 6.2: Various effects of light upon a
fire. green plant

www.tntextbooks.in
Based on the tolerance to intensities of light, 1. Eurythermal: Organisms which can tolerate
the plants are divided into two types. They are a wide range of temperature fluctuations.
1. Heliophytes - Light loving plants. Example: Zostera (A marine Angiosperm) and

Example: Angiosperms. Artemisia tridentata.
2. Sciophytes - Shade loving plants. 2. Stenothermal: Organisms which can

Example: Bryophytes and Pteridophytes. tolerate only small range of temperature
variations. Example: Mango and Palm
In deep sea (>500m), the environment is (Terrestrial Angiosperms).
dark and its inhabitants are not aware of the
Mango plant does not grow in temperate
existence of celestial source of energy called
Sun. What, then is their source of energy? countries like Canada and Germany.
Thermal Stratification
Palaeoclimatology–Helps to It is usually found in aquatic habitat. The
reconstruct past climates of change in the temperature profile with
our planet and flora, fauna increasing depth in a water body is called
and ecosystem in which they thermal stratification. There are three levels
lived. Example: Air bubbles trapped in ice of thermal stratifications.
for tens of thousands of years with fossilized
pollen, coral, plant and animal debris.
Epilimnion
b. Temperature
Metalimnion
Temperature is one of the important factors
which affect almost all the metabolic activities Hypolimnion
of an organism. Every physiological process in
an organism requires an optimum temperature
at which it shows the maximum metabolic rate. Figure 6.3: Thermal stratification of pond
Three limits of temperature can be recognized 1. Epilimnion – The upper layer of warmer
for any organism. They are water.
Minimum temperature - Physiological
1. 2. Metalimnion – The middle layer with a
activities are lowest. zone of gradual decrease in temperature.
Optimum temperature - Physiological
2. 3. Hypolimnion - The bottom layer of colder
activities are maximum. water.
Maximum temperature - Physiological
3.
Temperature based zonation
activities will stop.
Variations in latitude and altitude do affect the
Based on the temperature prevailing in
temperature and the vegetation on the earth
an area, Raunkiaer classified the world’s
surface. The latitudinal and altitudinal zonation
vegetation into the following four types. They
of vegetation is illustrated below:
are megatherms, mesotherms, microtherms
and hekistotherms. In thermal springs and deep Latitude: Latitude is an angle which ranges
sea hydrothermal vents the average temperature from 00 at the equator to 900 at the poles.
exceed 100oc.
Altitude: How high a place is located above
Based on the range of thermal tolerance,
organisms are divided into two types. the sea level is called the altitude of the place.

www.tntextbooks.in
c. Water
Water is one of the most important climatic
Ice/ Tund
r
factors. It affects the vital processes of all living
Snow a
organisms. It is believed that even life had
st s
re ou
e
lin
originated only in water during the evolution of

fo er
s
nif
e
ou
Tre
Co
i du st Earth. Water covers more than 70% of the earth’s

ec e
D for
and surface. In nature, water is available to plants in
ssl rt
Gra dese three ways. They are atmospheric moisture,
or
EQUATOR
ical
Trop rest precipitation and soil water.
f o
rain
Figure 6.4: Latitudinal zonation of vegetation Evergreen forests – Found

type where heavy rainfall occurs
throughout the year.
14,500' Snow
12,000' Tundra
13,000' Sclerophyllous forests –
10,000'
Found where heavy rainfall occurs during
Coniferous
forest
winter and low rainfall during summer.
7500'
6500'
Deciduous forest The productivity and distribution of plants depend
4000' 3000'
1800' Grassland or desert 1300' upon the availability of water. Further the quality
Tropical rain forest of water is also important especially for the aquatic
Figure 6.5: Altitudinal zonation of vegetation organisms. The total amount of water salinity in
different water bodies are :i).5% in inland water
Timber line / Tree line : It is an imaginary (Fresh water) ii).30 – 35% in sea water and iii).
line in a mountain or higher areas of land More than 100% in hypersaline water (Lagoons)
that marks the level above which trees do Based on the range of tolerance of salinity,
not grow. The altitudinal limit of normal tree organisms are divided into two types.
growth is about 3000 to 4000m. 1. Euryhaline: Organisms which can live in
water with wide range of salinity. Examples:
Effects of temperature
Marine algae and marina angiosperms
The following physiological processes are
2. Stenohaline: Organisms which can withstand
influenced by temperature:
only small range of salinity. Example: Plants of
Temperature affects the enzymatic action
• estuaries.
of all the bio-chemical reactions in a plant Environmental
body. Terminology
factor
It influences CO2 and O2 solubility in the
• Stenothermal Eurythermal Temperature
biological systems. Increases respiration Stenohaline Euryhaline Salinity
and stimulates growth of seedlings. Stenoecious Euryoecious Habitat selection
Low temperature with high humidity can
• (niche)
cause spread of diseases in plants.
Stenohydric Euryhydric Water
The varying temperature with moisture
•
Stenophagic Euryphagic Food
determines the distribution of the
Stenobathic Eurybathic Depth of water /
vegetation types.
habitat
Table 6.2: Tolerance of Environmental factor

www.tntextbooks.in
Examples of tolerance to toxicity Effects of wind

i. Soyabean and tomato manage to tolerate • Wind is an important factor for the
presence of cadmium poisoning by isolating formation of rain
cadmium and storing into few group of cells • Causes wave formation in lakes and ocean,
and prevent cadmium affecting other cells . promotes aeration of water
ii. Rice and Eichhornia (water hyacinth ) tolerate • Strong wind causes soil erosion and reduces
cadmium by binding it to their proteins. soil fertility
These plants otherwise can also be used to • Increases the rate of transpiration
remove cadmium from contaminated soil ,this • Helps in pollination in anemophilous plants
is known as Phytoremediation. • It also helps in
dispersal of many
d. Wind
fruits, seeds, spores,
Air in motion is called wind. It is also a
etc.
vital ecological factor. The atmospheric air
• Strong wind may
contains a number of gases, particles and
cause up-rooting of
other constituents. The composition of gases
big trees
in atmosphere is as follows: Nitrogen -78% ,
• Unidirectional
Oxygen -21%, Carbon-di-oxide -0.03%, Argon
wind stimulates the
and other gases - 0.93%. The other components
development of flag Figure 6.6: Flag
of wind are water vapour, gaseous pollutants,
forms in trees. form in trees
dust, smoke particles, microorganisms,
pollen grains, spores, etc. Anemometer is the e. Fire
instrument used to measure the speed of wind. Fire is an exothermic factor caused due to the
chemical process of combustion, releasing heat
Green House Effect
and light. It is mostly man-made and some-
Albedo Effect
times develops naturally due to the friction
Gases let out to atmosphere between the tree surfaces. Fire is generally
causes climatic change. divided into
Emission of dust and aerosols (small solids 1. Ground fire – Which is flameless and
or liquid particles in suspension in the subterranean.
atmosphere) from industries, automobiles, 2. Surface fire – Which consumes the herbs
forest fire, So2 and DMS (dimethyl sulphur) and shrubs.
play an important role in disturbing the 3. Crown fire – Which burns the forest canopy.
temperature level of any region. Aerosols Effects of fire
with small particles is reflecting the
• Fire has a direct lethal effect on plants
solar radiation entering the atmosphere.
• Burning scars are the suitable places for the
This is known as Albedo effect. So it
entry of parasitic fungi and insects
reduces the temperature (cooling) limits,
• It brings out the alteration of light, rainfall,
photosynthesis and respiration. The
nutrient cycle, fertility of soil, pH, soil flora
sulphur compounds are responsible for
and fauna
acid rain due to acidification of rain water
and destroy the ozone. • Some fungi which grow in soil of burnt areas
called pyrophilous.
Example: Pyronema confluens.

www.tntextbooks.in
Soil types
Indicators of fire – Pteris ( fern ) and
Pyronema (fungus) indicates the burnt up Based on soil formation (pedogenesis),
and fire disturbed areas. So they are called the soils are divided into
indicators of fire. 1. Residual soils –These are soils formed by
weathering and pedogenesis of the rock.
Fire break – It is a gap made in the vegetation
2. Transported soils – These are transported
that acts as a barrier to slow down or stop the
by various agencies.
progress of fire.
The important edaphic factors which affect
A natural fire break may occur when there vegetation are as follows:
is a lack of vegetation such as River, lake and
1. Soil moisture: Plants absorbs rain water
canyon found in between vegetation may act
and moisture directly from the air
as a natural fire break.
2. Soil water: Soil water is more important
Rhytidome: It is the structural defense by than any other ecological factors affecting the
plants against fire .The outer bark of trees distribution of plants. Rain is the main source
which extends to the last formed periderm is of soil water. Capillary water held between
called Rhytidome. It is composed of multiple pore spaces of soil particles and angles
layers of suberized periderm, cortical and between them is the most important form of
phloem tissues. It protects the stem against water available to the plants.
fire , water loss, invasion of insects and 3. Soil reactions: Soil may be acidic or
prevents infections by microorganisms. alkaline or neutral in their reaction. pH value
of the soil solution determines the availability
6.2.2 Edaphic factors of plant nutrients. The best pH range of the soil
Edaphic factors, the abiotic factors related for cultivation of crop plants is 5.5 to 6.8.
to soil, include the physical and chemical 4. Soil nutrients: Soil fertility and productivity
composition of the soil formed in a particular is the ability of soil to provide all essential
area. The study of soils is called Pedology. plant nutrients such as minerals and organic
The soil nutrients in the form of ions.
Soil is the weathered superficial layer of the 5. Soil temperature: Soil temperature of an
Earth in which plants can grow. It is a complex area plays an important role in determining
composite mass consisting of soil constituents, the geographical distribution of plants. Low
soil water, soil air and soil organisms, etc. temperature reduces use of water and solute
absorption by roots.
Soil formation
6. Soil atmosphere: The spaces left between
Soil originates from rocks and develops gradually soil particles are called pore spaces which
at different rates, depending upon the ecological contains oxygen and carbon-di-oxide.
and climatic conditions. Soil formation is
7. Soil organisms: Many organisms existing
initiated by the weathering process. Biological
in the soil like bacteria, fungi, algae,
weathering takes place when organisms like
protozoans, nematodes,
bacteria, fungi, lichens and plants help in the
insects, earthworms, etc. are
breakdown of rocks through the production of
called soil organisms.
acids and certain chemical substances.

www.tntextbooks.in
Horizon Description
O–Horizon It consists of fresh or partially decomposed
(Organic horizon) organic matter.
Humus O1 – Freshly fallen leaves, twigs, flowers and fruits
O2 – Dead plants, animals and their excreta
decomposed by micro-organisms.
Usually absent in agricultural and deserts.
A–Horizon It consists of top soil with humus, living creatures
(Leached horizon) and in-organic minerals.
Topsoil - Often rich in A1 – Dark and rich in organic matter because of
humus and minerals. mixture of organic and mineral matters.
A2 – Light coloured layer with large sized mineral
particles.
B-Horizon It consists of iron, aluminium and silica rich clay
(Accumulation horizon) organic compounds.
(Subsoil-Poor in humus,
rich in minerals)
C - Horizon (Partially It consists of parent materials of soil, composed
weathered horizon) of little amount of organic matters without life
Weathered rock forms.
Fragments - Little or no
plant or animal life.
R – Horizon It is a parent bed rock upon which underground
(Parent material) water is found .
Bedrock
Figure 6.7: Soil Profile
Soil Profile
Loamy soil is ideal soil for cultivation. It
Soil is commonly stratified into horizons at
consists of 70% sand and 30% clay or silt or both.
different depth. These layers differ in their
physical, chemical and biological properties. It ensures good retention and proper drainage
This succession of super-imposed horizons is of water. The porosity of soil provides adequate
called soil profile. aeration and allows the penetration of roots.
Types of soil particles Based on the water retention, aeration and
Based on the relative proportion of soil particles, mineral contents of soil, the distribution of
four types of soil are recognized. vegetation is divided into following types.
Soil type Size Relative proportion 1. Halophytes: Plants living in saline soils
1 Clayey Less than 50% clay and 50% 2. Psammophytes: Plants living in sandy soils
soil 0.002 silt ( cold / heavy 3. Lithophytes: Plants living on rocky surface
mm soil )
4. Chasmophytes: Plants living in rocky crevices
2 Silt soil 0.002 to 90% silt and 10%
0.02mm sand 5. Cryptophytes: Plants living below the soil
3 Loamy 0.002 to 70% sand and 30 surface
soil 2mm % clay / silt or both 6. Cryophytes: Plants living on surface of ice
(Garden soil) 7. Oxylophytes: Plants living in acidic soil
4 Sandy 0.2 to 2 85% sand and 15% 8. Calciphytes: Plants living in calcium rich
soil mm clay ( light soil )
alkaline soil.
Table 6.3: Types of soil particles

www.tntextbooks.in
Holard –Total soil water content Ecotone - The transition zone between two
Chresard –Water available to plants ecosystems. Example: The border between
Echard – Water not available to plants forest and grassland.
Edge effect – Spices found in ecotone areas
6.2.3 Topographic factors are unique due to the effect of the two
The surface features of earth are called habitats. This is called edge effect. Example:
topography. Topographic influence on the Owl in the ecotone area between forest and
climate of any area is determined by the grassland.
interaction of solar radiation, temperature,
The two faces of the mountain or hill receive
humidity, rainfall, latitude and altitude. It affects
different amount of solar radiation, wind action
the vegetation through climatic variations in
and rain. Of these two faces, the windward region
small areas (micro climate ) and even changes
possesses good vegetation due to heavy rains and
the soil conditions. Topographic factors include
the leeward region possesses poor vegetation due
latitude, altitude, direction of mountain,
to rain shadows (rain deficit).
steepness of mountain etc.
Similarly in the soil of aquatic bodies like
a. Latitudes and altitudes ponds the center and edge possess different
Latitudes represent distance from the equator. depth of water due to soil slope and different
Temperature values are maximum at the equator wave actions in the water body. Therefore,
and decrease gradually towards poles. Different different parts of the same area may possess
types of vegetation occur from equator to poles different species of organisms.
which are illustrated below.
c. Steepness of the mountain
The steepness of the mountain or hill allows
the rain to run off. As a result the loss of water
causes water deficit and quick erosion of the top
soil resulting in poor vegetation. On the other
hand, the plains and valley are rich in vegetation
due to the slow drain of surface water and better
retention of water in the soil.
Clouds
Figure 6.8: Latitudinal and Altitudinal Vegetation
Height above the sea level forms the
altitude. At high altitudes, the velocity of wind
remains high, temperature and air pressure
Moist
decrease while humidity and intensity of light Rain winds
increases. Due to these factors, vegetation at
tation
different altitudes varies, showing distinct

Ric
vege
zonation.
hv
eg
Poor
eta
b. Direction of Mountain
t
ion
Sea
North and south faces of mountain or hill possess
different types of flora and fauna because they
differ in their humidity, rainfall, light intensity,
light duration and temperature regions. Figure 6.9: Steepness of mountain

www.tntextbooks.in
6.2.4 Biotic factors Other examples:

Nodules
The interactions among living organisms • Water fern
such as plants and animals are called biotic (Azolla) and Root hair
factors, which may cause marked effects upon Nitrogen fixing

vegetation. The effects may be direct and indirect Cyanobacterium Bacteria
and modifies the environment. The plants (Anabaena ).

mostly which lives together in a community Anabaena
•
and influence one another. Similarly, animals in present in Figure 6.10:
association with plants also affect the plant life c or a l l oi d A nodulated legume
in one or several ways. The different interactions roots of Cycas. plant root with bacteria
among them can be classified into following two (Gymnosperm)
types they are positive interaction and negative • Cyanobacterium (Nostoc) found in the
interaction thalloid body of Anthoceros.(Bryophytes)
Positive interactions • Wasps present in fruits of fig.
When one or both the participating species are • Lichen is a mutual association of an alga
benefited, it is positive interaction. Examples; and a fungus.
Mutualism and Commensalism.
•
Roots of terrestrial plants and fungal
a. Mutualism: It is an interaction between hyphae- Mycorrhiza
two species of organisms in which both are
b. Commensalism: It is an interaction between
benefitted from the obligate association. The
two organisms in which one is benefitted and
following are common examples of mutualism.
the other is neither benefitted nor harmed.
Nitrogen fixation The species that derives benefit is called the
Rhizobium (Bacterium) forms nodules in the commensal, while the other species is called the
roots of leguminous plants and lives symbiotically. host. The common examples of commensalism
The Rhizobium obtains food from leguminous are listed below:
plant and in turn fixes atmospheric nitrogen into
nitrate, making it available to host plants.
Interaction type Combination Effects Examples

1.Positive interaction
1 Mutualism (+) (+) Both species benefitted Lichen, Mycorrhiza etc.
2 Commensalism (+) (0) One species is benefitted and orchids, Lianas etc.
the other species is neither
benefitted nor harmed
2.Negative interaction
4 Predation (+) (-) One species benefitted, the Drosera, Nepenthes etc.
other species are harmed
5 Parasitism (+) (-) One species benefitted, the Cuscuta, Duranta,
other species are harmed Viscum etc.
6 Competition (-) (-) Harmful for both Grassland species
7 Amensalism (-) (0) Harmful for one, but the Penicillium and
other species are unaffected Staphylococcus
(+) Benefitted, (-) Harmed (0)Unaffected
Table 6.4: Different interactions of plant

www.tntextbooks.in
Epiphytes Examples:
The plants Leaves A
• number of
which are found plants like Drosera Lamina
growing on Supporting (Sun dew Plant), Lid
other plants plant Nepenthes (Pitcher Tendril
without harming Clinging Plant), Dionaea Pitcher
root
them are called (Venus fly trap), Insect
Arial absorping root
epiphytes. They Utricularia (Bladder Fluid
Figure 6.11:
are commonly wort) and Sarracenia
An epiphytic plant-Vanda
found in tropical are predators which Figure 6.12: Pitcher
rain forest. consume insects and plant – with insect
The epiphytic higher plant (Orchid) gets other small animals
its nutrients and water from the atmosphere for their food as a source of nitrogen. They
with the help of the hygroscopic roots which are also called as insectivorous plants.
contain special type of spongy tissue called
Sensitive hair
Velamen. It prepares its own food and does Capsule wall
not depend on the host. Using the host plant
only they support and does not harm it in any Valve Insect larva
Absorptive
hairs
way.
• Many orchids, ferns, lianas, hanging mosses, Section view
Peperomia, money plant and Usnea (Lichen)
are some of the examples of epiphytes.
• Spanish Moss –Tillandsia grows on the bark Natural form
Bladder
of Oak and Pine trees.
Figure 6.13: Insectivorous plant Utricularia
Proto Cooperation Many herbivores are predators. Cattles,
•
An interaction between Camels, Goats etc., frequently browse on
organisms of different the tender shoots of herbs, shrubs and
species in which both trees. Generally annuals suffer more than
organisms benefit but neither is dependent the perennials. Grazing and browsing may
on the relationship. Example: Soil bacteria / cause remarkable changes in vegetation.
fungi and plants growing in the soil. Nearly 25 percent of all insects are known
as phytophagous(feeds on plant sap and
Negative interactions other parts of plant)
When one of the interacting species is benefitted • Many defense mechanisms are evolved to
and the other is harmed, it is called negative avoid their predations by plants. Examples:
interaction . Examples: predation, parasitism, Calotropis produces highly poisonous cardiac
competition and amensalism. glycosides, Tobacco produces nicotine, coffee
a. Predation: It is an interaction between two plants produce caffeine, Cinchona plant
species, one of which captures, kills and eats produces quinine. Thorns of Bougainvillea,
up the other. The species which kills is called spines of Opuntia, and latex of cacti also
a predator and the species which is killed is protect them from predators.
called a prey. The predator is benefitted while
the prey is harmed.

www.tntextbooks.in
b. Parasitism: It is an interaction between two Hemiparasites

different species in which the smaller partner The organisms which derive only water
(parasite) obtains food from the larger partner and minerals from their host plant while
(host or plant). So the parasitic species is synthesizing their own food by photosynthesis
benefited while the host species is harmed. Based are called Hemiparasites. They are also called
on the host-parasite relationship, parasitism is partial parasites.
classified into two types they are holoparasite Examples:
and hemiparasite.
Viscum and Loranthus are partial stem
•
Holoparasites parasites.
The organisms which are dependent upon the Santalum (Sandal Wood) is a partial root
•
host plants for their entire nutrition are called parasite.
Holoparasites. They are also called total The parasitic plants produce the haustorial
parasites. roots inside the host plant to absorb nutrients
from the vascular tissues of host plants.
T.S of host along with Cuscuta Cuscuta on the host
c. Competition: It is an interaction between
a) Parasite
two organisms or species in which both the
organisms or species are harmed. Competition
Haustoria
is the severest in population that has irregular
Host distribution. Competition is classified into
Xylem intraspecific and interspecific.
1. Intraspecific competition: It is an interaction
Phloem
between individuals of the same species. This
competition is very severe because all the
b) c)
members of species have similar requirements of
Flower
Parasite food, habitat, pollination etc. and they also have
similar adaptations to fulfill their needs.
Host
Root Tuber
2. Interspecific competition: It is an interaction
Haustoria
Host between individuals of different species. In
grassland, many species of grasses grow well as
there is little competition when enough nutrients
Figure 6.14: a) Holoparasite – Cuscuta and water is available. During drought shortage
b) A Partial stem parasite – Viscum
of water occurs . A life and death competition
c) Root parasite on the brinjal root Orobanche spp.
starts among the different species of grass lands.
Survival in both these competitions is determined
Examples: by the quantity of nutrients, availability of water
• Cuscuta is a total stem parasite of the and migration to new areas. Different species of
herbivores, larvae and grass hopper competing
host plant Acacia, Duranta and many
for fodder or forage plants. Trees, shrubs and
other plants. Cuscuta even gets flower
herbs in a forest struggle for sunlight, water and
inducing hormone from its host plant.
nutrients and also for pollination and dispersal of
• Balanophora, Orobanche and Rafflesia fruits and seeds. The Utricularia (Bladderwort)
are the total root parasites found on competes with tiny fishes for small crustaceans
higher plants. and insects.

www.tntextbooks.in
d. Amensalism: It is an interspecific interaction • Phyllium frondosum – leaf insect, another

in which one species is inhibited while the other example of protective mimicry.
species is neither benefitted nor harmed. The ii. Myrmecophily: Sometimes, ants take their
inhibition is achieved by the secretion of certain shelter on some trees such as Mango, Litchi,
chemicals called allelopathic substances. Jamun, Acacia etc. These ants act as body
Amensalism is also called antibiosis. guards of the plants against any disturbing
Penicillium notatum produces penicillin to
• agent and the plants in turn provide food
inhibit the growth of a variety of bacteria and shelter to these ants. This phenomenon
especially Staphylococcus. is known as Myrmecophily. Example: Acacia
Trichoderma inhibits the growth of fungus
• and acacia ants.
Aspergillus.
• Roots and hulls of Black Walnut Juglans Ant
nigra secretes an alkaloid Juglone which
inhibits the growth of seedlings of Apple,
Tomato and Alfalfa around it.
Interspecific interactions/ Co-evolutionary
dynamics
i. Mimicry: It is a phenomenon in which
living organism modifies its form, appearance,
Figure 6.16: Myrmecophily
structure or behavior and looks like another
living organism as a self defence and increases iii. Co-evolution: The interaction between
the chance of its survival. Floral mimicry is organisms, when continues for generations,
for usually inviting pollinators but animal involves reciprocal changes in genetic and
mimicry is often protective. Mimicry is a result morphological characters of both organisms.
of evolutionary significance due to shape and This type of evolution is called Co-evolution.
sudden heritable mutation and preservation by It is a kind of co- adaptation and mutual
natural selection. change among interactive species.
Examples:
a) b)
Figure 6.15: Mimicry

a) Phyllium frondosum b) Carausium morosus Figure 6.17: Co-evolution
Example: •
Corolla length and proboscis length of
• The plant, Ophrys an orchid, the flower looks butterflies and moths ( Habenaria and Moth ).
like a female insect to attract the male insect • Bird’s beak shape and flower shape and size.
to get pollinated by the male insect and it is •
More examples: Horn bills and birds
otherwise called ‘floral mimicry ‘. of Scrub jungles ,Slit size of pollinia of
• Carausium morosus – stick insect or Apocynaceae members and leg size of
walking stick. It is a protective mimicry. insects.

www.tntextbooks.in
6.3 Ecological adaptations a) b)

Lamina
Floating leaves
The modifications in the structure of Inflated petiole
organisms to survive successfully in an Stolen

Fibrous roots Offset
environment are called adaptations of Water Fibrous roots

Root pocket
organisms. Adaptations help the organisms to i) Free floating hydrophyte
Root pockets
exist under the prevailing ecological habitat. a) Eichhornia b) Pistia

Based on the habitats and the corresponding c) d)
adaptations of plants, they are classified Flower
Leaf lets
as hydrophytes, xerophytes, mesophytes, Lamina
Petiole
epiphytes and halophytes.
Petiole
Hydrophytes Flower bud

Water
Water
The plants which are living in water or wet Young leaf
Rhizome
places are called hydrophytes. According to Root
Rhizome
Roots
their relation to water and air, they are sub- Mud Mud
divided into following categories: i) Free ii) Rooted floating hydrophyte

floating hydrophytes, ii) Rooted- floating c) Nymphaea d) Marsilea
hydrophytes, iii) Submerged floating e) f)
hydrophytes, iv) Rooted -submerged Water Stem Submerged leaves
hydrophytes, v) Amphibious hydrophytes.

i. Free floating hydrophytes: These plants
float freely on the surface of water. They
remain in contact with water and air, but not
with soil. Examples: Eichhornia, Pistia and iii) Submerged floating hydrophyte
Wolffia (smallest flowering plant). e) Ceratophyllum f) Utricularia
g) h)
ii. Rooted floating hydrophytes: In these Female plant Male plant
Flower
Female flower
plants, the roots are fixed in mud, but their Water Whorls of
submerged
leaves and flowers are floating on the surface leaves
of water. These plants are in contact with soil, Male flower

Water
water and air. Examples: Nelumbo, Nymphaea, Stolen Branch

Potomogeton and Marsilea. Roots
Mud
Roots
Mud
Lotus seeds show highest longevity in plant iv) Rooted - submerged hydrophyte
kingdom. g) Vallisneria h) Hydrilla
i) Flower j)
iii. Submerged floating hydrophytes: These Emergent
Flowers
plants are completely submerged in water and leaves Emergent or

aerial leaves
not in contact with soil and air. Examples: Stem
Ceratophyllum and Utricularia.

Submerged Submerged
iv. Rooted- submerged hydrophytes: These leaves dissected
leaves
plants are completely submerged in water Stolen Water
Roots
and rooted in soil and not in contact with air. Roots
Mud
Mud
Examples: Hydrilla, Vallisneria and Isoetes. v) Rooted emergent hydrophyte-Heterophylly
v. Amphibious hydrophytes (Rooted emergent i) Sagittaria j) Ranunculus
hydrophytes): These plants are adapted to both Figure 6.18: Hydrophytes

www.tntextbooks.in
aquatic and terrestrial modes of life. They grow • Single layer of epidermis is present
in shallow water. Examples: Ranunculus, Typha • Cortex is well developed with aerenchyma
and Sagittaria.
• Vascular tissues are poorly developed. In
Hygrophytes: The plants which can grow emergent forms vascular elements are well
developed.
in moist damp and shady places are called
hygrophytes. Examples: Habenaria (Orchid), Mechanical tissues are generally absent
•
Mosses (Bryophytes), etc. except in some emergent forms. Pith cells
are sclerenchymatous.
Morphological adaptations of Hydrophytes: Epidermis

In root Hypodermis
• Roots are totally absent in Wolffia and Air chambers

Salvinia or poorly developed in Hydrilla or Cortex
well developed in Ranunculus.
• The root caps are replaced by root pockets. Endodermis
Example: Eichhornia
Pericycle
In stem Xylem cavity
Sieve tubes
• The stem is long, slender, spongy and flexible Parenchyma
Phloem
in submerged forms. T.s of Hydrilla stem
• In free floating forms the stem is thick, short Figure 6.19: T.S. of Hydrilla stem
stoloniferous and spongy; and in rooted
floating forms, it is a rhizome . Physiological adaptations of Hydrophytes:
• Vegetative propagation is through runners, • Hydrophytes have the ability to withstand

stolon, stem and root cuttings , tubers, anaerobic conditions .
dormant apices and offsets. • They possess special aerating organs.
In leaves Xerophytes
• The leaves are thin, long and ribbon shaped in The plants which are living in dry or xeric
Vallisneria or long and linear in Potamogeton condition are known as Xerophytes. Xerophytic
or finely dissected in Ceratophyllum habitat can be of two different types. They are:
• The floating leaves are large and flat as in a. Physical dryness: In these habitats, soil has a
Nymphaea and Nelumbo. In Eichhornia and little amount of water due to the inability of the
Trapa petioles become swollen and spongy. soil to hold water because of low rainfall.
• In emergent forms, the leaves show b. Physiological dryness: In these habitats,

heterophylly (Submerged leaves are water is sufficiently present but plants are unable
dissected and aerial leaves are entire). to absorb it because of the absence of capillary
Example: Ranunculus, Limnophila spaces. Example: Plants in salty and acidic soil.
heterophylla and Sagittaria Based on adaptive characters xerophytes
Anatomical adaptations are classified into three categories. They are
• Cuticle is either completely absent or if Ephemerals, Succulents and Non succulent
present it is thin and poorly developed plants.

www.tntextbooks.in
i. Ephemerals:
In xerophytic plants with the leaves and
These are also
stem are covered with hairs are called
called drought
escapers or trichophyllous plants . Example: Cucurbits
drought evaders. (Melothria and Mukia )
These plants In stem
complete their
Figure 6.20: • Stems are mostly hard and woody. They may
life cycle within
be aerial or underground
a short period Argemone mexicana-Ephemerals
(single season). • The stems and leaves are covered with wax
These are not true xerophytes. Examples: coating or covered with dense hairs.
Argemone, Mollugo, Tribulus and Tephrosia. • In some xerophytes all the internodes in the
ii. Succulents: These are also called drought stem are modified into a fleshy leaf structure
enduring plants. These plants store water in called phylloclades (Opuntia) .
their plant parts during the dry period. These • In some of the others single or occasionally
plants develop certain adaptive characters to two internodes modified into fleshy green
resist extreme drought conditions. Examples: structure called cladode (Asparagus).
Opuntia, Aloe, Bryophyllum and Begonia. In some the petiole is modified into a fleshy
iii. Non succulents: These are also called leaf like structure called phyllode (Acacia
drought resistant plants ( true xerophytes). melanoxylon).
They face both external and internal dryness.
a) b)
They have many adaptations to resist dry Flower
conditions. Examples: Casuarina, Nerium, Spines
Stipular
Zizyphus and Acacia. Phylloclade spine
a) b)
Marginal Stem
spines
Leaf
Succulent c d)
c) Petiole
leaves 3
2
Leaves
Scale
leaves 1
Rhizome Stipular
Roots spines
Stem 4 Phyllode
Figure 6.21: a)Succulent xerophyte – Aloe 1,2,3 and 4 the gradual development
Spine
b) Non succulent perennial - Ziziphus of phyllodes in Acacia
Figure 6.22: Xerophytes

Morphological Adaptations
a) A succulent xerophyte: Phylloclade – opuntia
In root
b) Non succulent: Perennial - Capparis
• Root system is well developed and is greater
than that of shoot system. c) Cladode of Asparagus
d) Phyllode – Acacia
• Root hairs and root caps are also well
developed.

www.tntextbooks.in
In leaves Physiological adaptations

• Leaves are generally leathery and shiny to • Most of the physiological processes are
reflect light and heat. designed to reduce transpiration.
• In some plants like Euphorbia, Acacia, • Life cycle is completed within a short
Ziziphus and Capparis, the stipules are period (Ephemerals).
modified into spines. Mesophytes
• The entire leaves are modified into spines The plants which are living in moderate
(Opuntia ) or reduced to scales (Asparagus). conditions (neither too wet nor too dry) are
Anatomical adaptations known as mesophytes. These are common land
• Presence of multilayered epidermis with plants. Example: Maize and Hibiscus.
heavy cuticle to prevent water loss due to Morphological adaptations
transpiration. • Root system is well developed with root
• Hypodermis is well developed with caps and root hairs
sclerenchymatous tissues. • Stems are generally aerial, stout and highly
• Sunken stomata are present only in the lower branched.
epidermis with hairs in the sunken pits. • Leaves are generally large, broad, thin with
• Scotoactive type of stomata found in different shapes.
succulent plants . Anatomical adaptations
• Vascular bundles are well developed with • Cuticle in aerial parts are moderately
several layered bundle sheath. developed.
• Mesophyll is well differentiated into • Epidermis is well developed and stomata are
palisade and spongy parenchyma. generally present on both the epidermis.
• In succulents the stem possesses a water • Mesophyll is well differentiated into palisade
storage region. and spongy parenchyma.
Thick cuticle
Multi-layered epidermis
• Vascular and mechanical tissues are fairly
developed and well differentiated.
Palisade parenchyma
Physiological adaptations
Spongy parenchyma
Stomata • All physiological processes are normal.
Guard cells
Pit (Cavity)
• Temporary wilting takes place at room
Trichomes (Hairs) temperature when there is water scarcity.
Lower epidermis
Cuticle Tropophytes are plants which behave
Figure 6.23: T.S. of Nerium leaf
as xerophytes at summer and behave as
mesophytes (or) hydrophytes during rainy
season.
Upper epidermis
Water storage cells
Palisade parenchyma
Epiphytes
Spongy parenchyma Epiphytes are plants which grow perched on
Lower epidermis other plants (Supporting plants). They use
Figure 6.24: A Succulent leaf of Peperomia (T.S.) the supporting plants only as shelter and not
(lateral wing portion only) for water or food supply. These epiphytes

www.tntextbooks.in
are commonly seen in tropical rain forests. Physiological adaptations

Examples: Orchids, Lianas, Hanging Mosses Special absorption processes of water by
and Money plant. velamen tissue .
Morphological adaptations Halophytes
• Root system is extensively developed. These There are special type of Halophytic plants
roots may be of two types. They are Clinging which grow on soils with high concentration
roots and Aerial roots. of salts. Examples: Rhizophora, Sonneratia and
Clinging roots fix the epiphytes firmly on Avicennia.
the surface of the supporting objects. Halophytes are usually found near the sea-
shores and Estuaries. The soils are physically
Aerial roots are green coloured roots which
wet but physiologically dry. As plants cannot use
may hang downwardly and absorb moisture
salt water directly they require filtration of salt
from the atmosphere with the help of a
using physiological processes. This vegetation is
spongy tissue called velamen. also known as mangrove forest and the plants
• Stem of some epiphytes are succulent and are called mangroves.
develop pseudobulb or tuber.
Morphological adaptations
• Generally the leaves are lesser in number
and may be fleshy and leathery • The temperate halophytes are herbaceous
but the tropical halophytes are mostly bushy
• Myrmecophily is a common occurrence
in the epiphytic vegetation to prevent the • In addition to the normal roots, many stilt
predators. roots are developed
• The fruits and seeds are very small and • A special type of negatively geotropic
usually dispersed by wind, insects and birds. roots called pneumatophores with
pneumathodes to get sufficient aeration
Anatomical adaptations
are also present. They are called breathing
• Multilayered epidermis is present. Inner to roots. Example: Avicennia
the velamen tissue, the peculiar exodermis
layer is present. Pneumathode
Pneumatophores Pneumatophores (or) Lenticel
• Presence of thick cuticle and sunken stomata
greatly reduces transpiration.
• Succulent epiphytes contain well developed
parenchymatous cells to store water.
Roots
Epidermis
Velamen Figure 6.26a: Pneumatophores of mangrove plant

Exodermis • Presence of thick cuticle
on the aerial parts of the
Cortex
plant body
• Leaves are thick,
Endodermis
Pith Pericycle entire, succulent and
Metaxylem Conjuctive tissue
Protoxylem glossy. Some species Figure 6.26b:
Phloem
are aphyllous (without Succulent
Figure 6.25: T.S. of an aerial root of Orchid leaves). halophyte -
showing velamen tissue Salicornia

www.tntextbooks.in
• Viviparous mode of seed germination is found protective covering called seed coat. As seeds
in halophytes contain miniature but dormant future plants,
their dispersal is an important criterion for
distribution and establishment of plants over
a wide geographical area. The dissemination of
Calyx Leaf seeds and fruits to various distances from the
Fruit parent plant is called seed and fruit dispersal.
Radicle
It takes place with the help of ecological factors
such as wind, water and animals.
Seed dispersal is a regeneration process
Hypocotyl
of plant populations and a common means of
Water colonizing new areas to avoid seedling level
Mud
competition and from natural enemies like
herbivores, frugivores and pathogens.
Figure 6.27: Viviparous type of seed germination Fruit maturation and seed dispersal is
influenced by many ecologically favourable
Anatomical adaptations conditions such as Season (Example: Summer),
• Epidermal cells of stem is heavy cutinized, suitable environment, and seasonal availability
almost squarish and are filled with oil and of dispersal agents like birds, insects etc.
tannins. Seeds require agents for dispersal which
• ‘Star’ shaped sclereids and ‘H’ shaped heavy are crucial in plant community dynamics in
thickened spicules that provide mechanical many ecosystems around the globe. They offer
many benefits to communities such as food and
strength to cortex are present in the stem.
nutrients, migration of seeds across habitats
• The leaves may be dorsiventral or isobilateral and helps spreading plant genetic diversity.
with salt secreting glands.
6.4.1 Dispersal by Wind (Anemochory)
Physiological adaptations
The individual seeds or the whole fruit may be
High osmotic pressure exists in some
• modified to help for the dispersal by wind. Wind
plants . dispersal of fruits and seeds is quite common in
• Seeds germinate in the fruits while on the tall trees. The adaptation of the wind dispersed
mother plant (Vivipary). plants are
Minute seeds: Seeds are minute, very
•
Out of three districts of Tamil
small, light and with inflated covering.
Nadu (Nagapattinam, Thanjavur
Example: Orchids.
and Thiruvarur), Muthupet
Wings: Seeds or whole fruits are flattened to
•
(Thiruvarur district) was less damaged by
Gaja cyclone ( November 2018) due to the form a wing. Examples: Maple, Gyrocarpus,
presence of mangrove forest. Dipterocarpus and Terminalia
6.4 Dispersal of Fruits and Seeds

Both fruits and seeds possess attractive colour,
odour, shape and taste needed for the dispersal
by birds, mammals, reptiles, fish, ants and
insects even earthworms. The seed consists
of an embryo, stored food material and a Figure 6.28: Asclepias Figure 6.29: Gyrocarpus

www.tntextbooks.in
Feathery Appendages: Seeds or fruits may

• beings and get dispersed.
have feathery appendages which greatly ii. Sticky fruits and seeds:
increase their buoyancy to disperse to high a. Some fruits have sticky glandular hairs by
altitudes. Examples: Vernonia and Asclepias. which they adhere to the fur of grazing animals.
C ensor mechanisms: The fruits of many
• Example: Boerhaavia and Cleome.
plants open in such a way that the seeds b. Some fruits have viscid layer which adhere to
can escape only when the fruit is violently the beak of the bird which eat them and when
shaken by a strong wind. Examples: they rub them on to the branch of the tree, they
Aristolochia and Poppy. disperse and germinate. Example: Cordia and
Guess!! Who am I…….? I am dispersed by Alangium
ant and I have caruncle. iii. Fleshy fruits: Some fleshy fruits with
conspicuous colours are dispersed by human
6.4.2 Dispersal by Water (Hydrochory) beings to distant places after consumption.
Dispersal of seeds and fruits by water usually Example: Mango and Diplocyclos
occurs in those plants which grow in or near
water bodies . Adaptation of hydrochory are
•
Obconical receptacle with prominent air
spaces. Example: Nelumbo.
•
Presence of fibrous mesocarp and light
pericarp. Example: Coconut.
• Seeds are light, small, provided with aril Figure 6.32: Sunflower Figure 6.33: Papaya
which encloses air.Example: Nymphaea. 6.4.3 Dispersal by Explosive Mechanism
The fruit may be inflated. Examples:
• (Autochory)
Heritiera littoralis. Some fruits burst suddenly with a force
• Seeds by themselves would not float may be enabling to throw seeds to a little distance away
carried by water current. Example: Coconut. from the plant. Autochory shows the following
adaptations.
• Mere touch of some plants causes the
ripened fruit to explode suddenly and seeds
are thrown out with great force. Example:
Impatiens (Balsam), Hura.
• Some fruits when they come in contact with
Figure 6.30: Nelumbo Figure 6.31: Coconut water particularly after a shower of rain,
burst suddenly with a noise and scatter the
6.4.3 Dispersal by Animals (Zoochory)
seeds.Examples: Ruellia and Crossandra.
Birds and mammals, including human beings • Certain long pods explode with a loud
play an efficient and important role in the noise like cracker, scattering the seeds in
dispersal of fruit and seeds. They have the all directions. Example: Bauhinia vahlii
following devices. (Camel’s foot climber)
i. Hooked fruit: The surface of the fruit or seeds • As the fruit matures, tissues around seeds are
have hooks,(Xanthium), barbs (Andropogon), converted into a mucilaginous fluid, due to
spines (Aristida) by means of which they adhere which a high turgor pressure develops inside
to the body of animals or clothes of human the fruit which leads to the dispersal of seeds.

www.tntextbooks.in
Example: Ecballium elatrium (Squirting •

Seed dispersal by animals help in
cucumber) Gyrocarpus and Dipterocarpus. conservation of many species even in
human altered ecosystems.
• Understanding of fruits and seed dispersal
acts as a key for proper functioning and
establishment of many ecosystems from
deserts to evergreen forests and also for the
maintenance of biodiversity conservation
Figure 6.34: Ecballium Figure 6.35: Impatents and restoration of ecosystems.
Human aided seed dispersal Summary

Seed Ball : Seed ball Ecology is a division of biology and deals
is an ancient Japanese with the study of environment in relation to
technique of encasing organisms. Ecology is mainly divided into
seeds in a mixture of two branches Autecology and Synecology. The
clay and soil humus environment (surrounding) includes physical,
(also in cow dung) and chemical and biological components. These
Figure 6.36: Seed ball factors can be classified into living (biotic)
scattering them on to
suitable ground, not planting of trees manually. and non-living (abiotic), which make the
This method is suitable for barren and degraded environment of an organism. The ecological
lands for tree regeneration and vegetation before factors are meaningfully grouped into four
monsoon period where the suitable dispersal classes, which are as follows: 1. Climatic factors
agents become rare. 2. Edaphic factors 3. Topographic factors 4.
Biotic factors.
Guess? what is atelochory or Achory? Climate is one of the important natural
factors controlling the plant life. The climatic
Ecologically important days
factors includes light, temperature, water,
March 21 - World forest day
wind, fire, etc. Edaphic factors, the abiotic
April 22 - Earth day
factors related to soil, include the physical and
May 22 - World bio diversity day
chemical composition of the soil formed in a
June 05 - World environment day
particular area. The surface features of earth
July 07 - Van Mohostav day
are called topography. Topographic influence
September 16 - International Ozone day
on the climate of any area is determined by
Advantages of seed dispersal: the interaction of solar radiation, temperature,
Seeds escape from mortality near the
• humidity ,rainfall, latitude and altitude. The
parent plants due to predation by animals interactions among living organisms, the plants
or getting diseases and also avoiding and animals are called biotic factors, which may
competition. cause marked effects upon vegetation.
• Dispersal also gives a chance to occupy The modifications in the structure of
favourable sites for growth. organisms to survive successfully in an
• It is an important process in the movement environment are called adaptations of
of plant genes particularly this is the only organisms. Based on the habitats and the
method available for self-fertilized flowers corresponding adaptations of plants, they are
and maternally transmitted genes in classified into 1) Hydrophytes 2) Xerophytes
outcrossing plants. 3) Mesophytes 4) Epiphytes and 5) Halophytes.

www.tntextbooks.in
The dissemination of seeds and fruits to various c) ii and iii only d) i and ii only
distances from the parent plant is called seed 5. Which of the given plant produces cardiac
and fruit dispersal. It takes place with the help glycosides?
of ecological factors such as wind, water and a) Calotropis b) Acacia
animals.
c) Nepenthes d) Utricularia
Evaluation
6. Read the given statements and select the
1.
Arrange the correct correct option.
sequence of ecological i) Loamy soil is best suited for plant growth as
hierarchy starting from it contains a mixture of silt, sand and clay.
lower to higher level. ii) The process of humification is slow in
a) Individual organism → case of organic remains containing a
Population Landscape large amount of lignin and cellulose.
→ Ecosystem iii)
Capillary water is the only water
b) Landscape → Ecosystem → Biome → available to plant roots as it is present
Biosphere inside the micropores.
c) community → Ecosystem → Landscape → iv) Leaves of shade plant have more total
Biome chlorophyll per reaction centre, low
d) Population → organism → Biome → ratio of chl a and chl b are usually
Landscape thinner leaves.
2. Ecology is the study of an individual species a) i, ii and iii only b) ii, iii and iv only
is called c) i, ii and iv only d) ii and iii only
i) Community ecology ii) Autecology
7. Read the given statements and select the
iii) Species ecology iv) Synecology
correct option.
a) i only b) ii only Statement A : Cattle do not graze on weeds
c) i and iv only d) ii and iii only of Calotropis.
3. A specific place in an ecosystem, where an Statement B : Calotropis have thorns and
organism lives and performs its functions is spines, as defense against herbivores.
a) habitat b) niche a) Both statements A and B are incorrect.
c) landscape d) biome b) Statement A is correct but statement B is
4. Read the given statements and select the incorrect.
correct option. c) Both statements A and B are correct but
i) Hydrophytes possess aerenchyma to statement B is not the correct explanation
support themselves in water. of statement A.
ii) Seeds of Viscum are positively d) Both statements A and B are correct and
photoblastic as they germinate only in statement B is the correct explanation of
presence of light. statement A.
iii) Hygroscopic water is the only soil water 8. In soil water available for plants is
available to roots of plant growing in soil a) gravitational water
as it is present inside the micropores. b) chemically bound water
iv) High temperature reduces use of water c) capillary water
and solute absorption by roots. d) hygroscopic water
a) i, ii, and iii only b) ii, iii and iv

www.tntextbooks.in
9. Read the following statements and fill up A B C D

the blanks with correct option. a) (+) Parasitism (-) Amensalism
i) Total soil water content in soil is called b) (-) Mutalism (+) Competition
_________________
c) (+) Competition (0) Mutalism
ii) Soil water not available to plants is called d) (0) Amensalism (+) Parasitism
_________________
iii) Soil water available to plants is called 13. Ophrys an orchid resembling the female of
_________________ an insect so as to able to get pollinated is
due to phenomenon of
(i) (ii) (iii)
a) Myrmecophily b) Ecological equivalents
(a) Holard Echard Chresard
(b) Echard Holard Chresard c) Mimicry d) None of these
(c) Chresard Echard Holard 14. A free living nitrogen fixing cyanobacterium
(d) Holard Chresard Echard which can also form symbiotic association
with the water fern Azolla
Column I represent the size of the soil
10.
a) Nostoc b) Anabaena
particles and Column II represents type of
c) chlorella d) Rhizobium
soil components. Which of the following
is correct match for the Column I and 15. Pedogenesis refers to
Column IL a) Fossils b) Water c) Population d) Soil
Column - I Column - II 16. Mycorrhiza promotes plant growth by
I). 0.2 to 2.00 mm i) Slit soil a) Serving as a plant growth regulators
II) Less than 0.002 mm ii) Clayey soil b) Absorbing inorganic ions from soil
III) 0.002 to 0.02 mm iii) Sandy soil
c) Helping the plant in utilizing atmospheric
IV) 0.002 to 0.2 mm iv) Loamy soil
nitrogen
I II III IV d) Protecting the plant from infection
a) ii iii iv i
17. Which of the following plant has a non-
b) iv i iii ii
succulent xerophytic and thick leathery
c) iii ii i iv leaves with waxy coating
d) None of the above a) Bryophyllum b) Ruscus
c) Nerium d) Calotropis
11. The plant of this group are adapted to live
partly in water and partly above substratum 18. In a fresh water environment like pond,
and free from water rooted autotrophs are
a) Xerophytes b) Mesophytes a) Nymphaea and typha
c) Hydrophytes d) Halophytes b) Ceratophyllum and Utricularia
c) Wolffia and pistia
12 . Identify the A, B, C and D in the given table d) Azolla and lemna
Effects on Effects on 19. Match the following and choose the correct
Interaction
species X species Y combination from the options given below:
Mutualism A (+) Column I Column II (Examples)
B (+) (-) (Interaction)
Competition (-) C I. Mutualism i). Trichoderma and
D (-) 0 Penicillium
II. Commensalism ii). Balanophora,
Orobanche

www.tntextbooks.in
III. Parasitism iii). Orchids and Ferns the fig and wasp and comment on
IV. Predation iv). Lichen and the phenomenon that operates in this
Mycorrhiza relationship.
V. Amensalism v). Nepenthes and
34. Lichen is considered as a good example of
Diaonaea
obligate mutualism. Explain.
I II III IV V
35. What is mutualism? Mention any two
a) i ii iii iv v
example where the organisms involved
b) ii iii iv v i are commercially exploited in modern
c) iii iv v i ii agriculture.
d) iv iii ii v i 36. List any two adaptive features evolved in
20. Strong, sharp spines that get attached to parasites enabling them to live successfully
animal’s feet are found in the fruits of on their host?
a) Argemone b) Ecballium 37. Mention any two significant roles of
predation plays in nature.
c) Heritier d) Crossandra
38. How does an orchid ophrys ensures its
21. Sticky glands of Boerhaavia and Cleome
pollination by bees ?
support
39. Water is very essential for life. Write any
a) Anemochory b) Zoochory
three features for plants which enable them
c) Autochory d) Hydrochory
to survive in water scarce environment.
22. Define ecology.
40. Why do submerged plants receive weak
23. What is ecological hierarchy? Name the
illumination than exposed floating plants
levels of ecological hierarchy.
in a lake?
24. What are ecological equivalents? Give one
41. What is vivipary? Name a plant group
example .
which exhibits vivipary.
25. Distinguish habitat and niche
42. What is thermal stratification? Mention
26. Why are some organisms called as their types.
eurythermals and some others as
43. How is rhytidome act as the structural
stenohaline ?
27. ‘Green algae are not likely to be found in the defence by plants against fire?
deepest strata of the ocean’. Give at least one 44. What is myrmecophily?
reason. 45. What is seed ball?
28. What is Phytoremediation ? 46. How is anemochory differ from zoochory?
29. What is Albedo effect and write their effects? 47. What is co evolution?
30. The organic horizon is generally absent 48. Explain Raunkiaer classification in the
from agricultural soils because tilling, e.g., world’s vegetation based on the temperature.
plowing, buries organic matter. Why is an 49. List out the effects of fire to plants.
organic horizon generally absent in desert 50. What is soil profile? Explain the characters
soils ? of different soil horizons.
31. Soil formation can be initiated by biological 51. Give an account of various types of
organisms. Explain how? parasitism with examples.
32. Sandy soil is not suitable for cultivation. 52. Explain different types of hydrophytes with
Explain why? examples.
33. Describe the mutual relationship between 53. Enumerate the anatomical adaptations of
xerophytes.

www.tntextbooks.in
54. List out any five morphological adaptations Lianes: Twining vines with woody stems,
of halophytes. common in forest of warm climate.
55. What are the advantages of seed dispersal? Megatherms: (Temperature more than 240°C)
56.
Describe dispersal of fruit and seeds by Where high temperature prevails throughout
animals. the year and the dominant vegetation is tropical
Glossary rain forest.
Antibiosis: An association of two organisms Mesotherms: (Temperature ranges between
which is harmful to one of them. 170°C and 240°C) Where high temperature
Biome: A major regional community of alternates with low temperature and the
plants and animals with similar life forms and dominant vegetation is tropical deciduous
environmental conditions. forest.
Biosphere: The envelope containing all living Microtherms: (Temperature ranges between
organisms on earth. 70°C and 170°C) Where low temperature
Community: A group of organism living in the prevails and the dominant vegetation is mixed
same place. coniferous forest.
Flora: The kinds of plants in region Population: A group of individuals of a single

species.
Frugivores: Fruit eating organisms
Scotoactive type of stomata: Stomata opens
Hekistotherms: (Temperature less than 70°C) during night in succulent plants and closes
Where very low temperature prevails and the during the day.
dominant vegetation is alpine vegetation.
Vivipary: When seeds or embryos begin to
Landscape: The visible features of an area of develop before they detach from the parent.
land.
ICT Corner
Principles of Ecology
Steps
• Type the URL or scan the QR code to open
Let us know the activity page then Introduction page
will open.
about the
Environmental • Click on the Content icon in the introduction
page.
Studies-Complete
Reference Guide • Click on the topic you like.
in detail. • To know more applications related to this
title click on More apps.
URL:
https://play.google.com/store/apps/details?id=com.dhavaldev.
EnvironmentalStudies

www.tntextbooks.in

Chapter
7 Ecosystem
Learning Objectives Have you seen lakes, ponds and pools in your
surroundings? They are all called water bodies
with many components in them. Can you list
Learning objectives
out the things which are found in water bodies?
The learner will be able to, Mud, nutrients, clay, dissolved gases, planktons,

Describe the Structure, functions and microorganisms, plants like algae, Hydrilla,
types of ecosystems Nelumbo, Nymphaea and animals like snake,
small fish, large fish, frog, tortoise and crane

Draw ecological pyramids by means are the components of the water bodies which
of number, biomass and energy constitutes ecosystem. Further, we all know

Interpret carbon and phosphorus that plants and animals are prominent living
cycle components in the environment. They interact
with space components such as air, water, soil,

Recognise pond ecosystem as a self- sunlight, etc. For example, you have studied in
sufficient and self-regulating system class XI, one of the life processes, photosynthesis

Analyse ecosystem services and its which utilizes sunlight , water, carbondioxide,
management nutrients from the soil and release oxygen to
the atmosphere. From this, we understand that

Discuss about the importance and
the exchange of materials takes place between
conservation of ecosystem
living and space components. Likewise, you

Explain the types of plant succession can study the structure, function and types of
ecosystem in this chapter. The term ‘ecosystem’
was proposed by A.G. Tansley (1935), who
defined it as ‘the system resulting from the
Chapter outline integration of all the living and nonliving
factors of the environment’. Whereas, Odum
(1962) defined ecosystem ‘as the structural and
7.1 Structure of functional unit of ecology’.
ecosystem
7.2 Functions of Parallel terms for ecosystem coined by
ecosystem various ecologists
• Biocoenosis – Karl Mobius
7.3 Plant succession • Microcosm – S.A. Forbes
• Geobiocoenosis – V. V. Dokuchaev, G.F. Morozov
• Holocoen - Friederichs
• Biosystem – Thienemann
• Bioenert body – Vernadsky
134 Ecosystem

www.tntextbooks.in
7.1 Structure of ecosystem The amount of living materials present

Ecosystem comprises of two major components. in a population at any given time is known
They are: as standing crop, which may be expressed
Abiotic (non-living) components: It
i) in terms of number or biomass per unit area.
includes climatic factors (air, water, Biomass can be measured as fresh weight or
sunlight, rainfall, temperature and dry weight or carbon weight of organisms.
humidity), edaphic factors (soil air, Biotic components are essential to construct the
soil water and pH of soil),topography food chain, food web and ecological pyramids.
(latitude, altitude), organic components 7.2 Functions of ecosystem
(carbohydrates, proteins, lipids and humic
The function of ecosystem include creation of
substances) and inorganic substances (C,
energy creation, sharing of energy and cycling
H, O, N and P ). Abiotic components play
of materials between the living and nonliving
vital role in any ecosystem and hence the
components of an ecosystem.
total inorganic substances present in any
ecosystem at a given time is called standing Before studying the productivity in any
quality (or) standing state. ecosystem, we should understand the essential
role of sunlight used by producers of the first
ii) Biotic (living) components: It includes
trophic level. The quantity of sunlight is directly
all living organisms like plants, animals,
proportional to the production of energy by plants.
fungi and bacteria. They form the trophic
structures of any ecosystem. On the basis 7.2.1 Photosynthetically Active
of nutritional relationships, trophic levels Radiation (PAR)
of an ecosystem have two components. The amount of light available for photosynthesis
(1) autotrophic components and (2) of plants is called Photosynthetically Active
heterotrophic components. Radiation (PAR) which is from of 400-700 nm
(1) Autotrophic components: Autotrophs in wave length. It is essential for photosynthesis
are organisms which can manufacture the and plant growth. PAR is not always constant
organic compounds from simple inorganic because of clouds, tree shades, air, dust particles,
components through a process called seasons, latitudes and length of the daylight
photosynthesis. In most of the ecosystems, availability. Generally plants absorb more blue
green plants are the autotrophs and are also and red light for efficient photosynthesis.
called producers. Of the total sunlight, 34 percent that reaches
(2) Heterotrophic components: Those the atmosphere is reflected back into the
organisms which consume the producers are atmosphere, moreover 10% is held by ozone,
called consumers and can be recognized into water vapours and atmospheric gases and the
macro and micro consumers. Macroconsumers remaining 56% reaches the earth’s surface. Out
refer to herbivores, carnivores and omnivores of this 56%, only 2 – 10% of the solar energy is
(primary, secondary and tertiary consumers). used by green plants for photosynthesis while
Microconsumers are called decomposers. the remaining portion is dissipated as heat.
Decomposers are organisms that decompose PAR is generally expressed in millimoles /
the dead plants and animals to release organic square meter / second by using silicon photo
and inorganic nutrients into the environment voltic detectors which detect only 400 – 700
which are again reused by plants. Example: nm wavelength of light. PAR values range from
Bacteria, Actinomycetes and Fungi. 0 to 3000 millimoles /square meter / second.
Ecosystem 135

www.tntextbooks.in
At night PAR is zero and during midday in net primary productivity. It is also called as
the summer, PAR often reaches 2000 – 3000 apparent photosynthesis. Thus the difference
millimoles /square meter/second. between GPP and respiration is known as NPP.
NPP = GPP – Respiration
Types of Carbon
Green carbon – carbon stored NPP of whole biosphere is estimated to be
in the biosphere (by the process about 170 billion tons (dry weight) per year.
of photosynthesis). Out of which NPP of oceanic producers is
Grey carbon – carbon stored in fossil fuel (coal, only 55 billion tons per year in unit time.
oil and biogas deposits in the lithosphere). 2. Secondary productivity
Blue carbon – carbon stored in the atmosphere The amount of energy stored in the tissues of
and oceans. heterotrophs or consumers is called secondary
Brown carbon – carbon stored in industrialized productivity.
forests (wood used in making commercial a. Gross secondary productivity
articles)
It is equivalent to the total amount of plant
Black carbon – carbon emitted from gas, diesel material is ingested by the herbivores minus
engine and coal fired power plants. the materials lost as faeces.
b. Net secondary productivity
7.2.2 Productivity of an ecosystem Storage of energy or biomass by consumers
per unit area per unit time, after respiratory
The rate of biomass production per unit area loss is called net secondary productivity.
in a unit time is called productivity. It can be
expressed in terms of gm /m2/year or Kcal/m2/ 3. Community productivity
year. It is classified as given bellow. The rate of net synthesis of organic matter
1. Primary productivity (biomass) by a group of plants per unit
2. Secondary productivity area per unit time is known as community
3. Community productivity productivity.
1. Primary productivity: Factors affecting primary productivity

The chemical energy or organic matter Primary productivity depends upon the
generated by autotrophs during the process plant species of an area, their photosynthetic
of photosynthesis and chemosynthesis is capacity, availability of nutrients, solar
called primary productivity. It is the source radiation, precipitation, soil type, topographic
of energy for all organisms, from bacteria to factors (altitude, latitude, direction), and other
human. environmental factors. It varies in different
types of ecosystems.
a. Gross Primary Productivity (GPP)
The total amount of food energy or organic 7.2.3 Concept of trophic level in an ecosystem
matter or biomass produced in an ecosystem by (Greek word ‘ trophic’ = to food or feeding)
autotrophs through the process of photosynthesis A trophic level refers to the position of an
is called gross primary productivity organism in the food chain. The number of
trophic levels is equal to the number of steps
b. Net Primary Productivity (NPP)
in the food chain. The green plants (producers)
The proportion of energy which remains occupying the first trophic level (T1) are
after respiration loss in the plant is called called producers. The energy produced by
136 Ecosystem

www.tntextbooks.in
the producers is utilized by the plant eaters Laws of thermodynamics

(herbivores) they are called primary consumers
The storage and loss of energy in an ecosystem
and occupy the second trophic level (T2).
is based on two basic laws of thermo-dynamics.
Fourth Trophic level (T4) Secondary
(Tertiary consumers) carnivore - Eagle i. First law of thermodynamics
Third Trophic level (T3) Primary
It states that energy can be transmitted from
(Secondary consumers) carnivore - Snake one system to another in various forms. Energy
Second Trophic level (T2)
Herbivore - Rabbit Omnivore cannot be destroyed or created. But it can be
(Primary consumers) - crow
transformed from one form to another. As
First Trophic level (T1)
(Producers)
Autotrophs - Plants
a result, the quantity of energy present in the
universe is constant.
Figure 7.2: Diagrammatic
representation of trophic levels Example:
Herbivores are eaten by carnivores, which occupy In photosynthesis, the product of starch
the third trophic level (T3). They are also called (chemical energy) is formed by the combination
secondary consumers or primary carnivores. of reactants (chlorophyll, H2O, CO2). The
Carnivores are eaten by the other carnivores, energy stored in starch is acquired from the
which occupy the fourth trophic level (T4). They external sources (light energy) and so there is
are called the tertiary consumers or secondary no gain or loss in total energy. Here light energy
carnivores. Some organisms which eat both is converted into chemical energy.
plants and animals are called as omnivores light
(Crow). Such organisms may occupy more than 6 CO2 + 6 H20 C6H1206 + 6 O2
Chlorophyll
one trophic level in the food chain.
Light energy chemical energy
7.2.4 Energy flow
The transfer of energy in an ecosystem between ii. Second law of thermodynamics
trophic levels can be termed as energy flow. It It states that energy transformation results in the
is the key function in an ecosystem. Part of the reduction of the free energy of the system. Usually
energy obtained from the sun by producers is energy transformation cannot be 100% efficient.
transferred to consumers and decomposers As energy is transferred from one organism to
through each trophic level, while some another in the form of food, a portion of it is stored
amount of energy is dissipated in the form of as energy in living tissue, whereas a large part of
heat. Energy flow is always unidirectional in energy is dissipated as heat through respiration.
an ecosystem. The transfer of energy is irreversible natural
Sun
process. Example: Ten percent law
Ten percent law
Heat
Heat Heat
This law was proposed by Lindeman (1942). It
states that during transfer of food energy from
one trophic level to other, only about 10% stored
at every level and rest of them (90%) is lost in
Carnivores
respiration, decomposition and in the form of
Herbivores
heat. Hence, the law is called ten percent law.
Plants
Example: It is shown that of the 1000 Joules of

Solar energy trapped by producers. 100 Joules
Decomposers
Figure 7.3: Diagrammatic

of energy is stored as chemical energy through
representation of energy flow
Ecosystem 137

www.tntextbooks.in
photosynthesis. The remaining 900 Joules would tertiary consumers (eagle) which get their
be lost in the environment. In the next trophic food from secondary consumers.
level herbivores, which feed on producers get
only 10 Joules of energy and the remaining
90 Joules is lost in the environment. Likewise,
in the next trophic level, carnivores, which eat Grass Mouse Snake Eagle
herbivores store only 1 Joule of energy and Primary Secondary Tertiary
Producers
the remaining 9 Joules is dissipated. Finally, Consumers Consumers Consumers
the carnivores are eaten by tertiary consumers Figure 7.5: Diagrammatic representation of
which store only 0.1 Joule of energy and the Grazing food chain
remaining 0.9 Joule is lost in the environment.
2. Detritus food chain:
Thus, at the successive trophic level, only ten
percent energy is stored. This type of food chain begins with dead organic
matter which is an important source of energy.
A large amount of organic matter is derived from
Tertiary
0.9 Joule
Energy lost the dead plants, animals and their excreta. This
consumers
0.1 Joule type of food chain is present in all ecosystems.
1 Joule
9 Joules
Energy lost The transfer of energy from the dead organic
Secondary consumers
10 Joules
matter, is transferred through a series of organisms
90 Joules
Energy lost called detritus consumers (detritivores)- small
Sunlight Primary consumers carnivores - large (top) carnivores with repeated
1000 Joules 900 Joules eating and being eaten respectively. This is called
100 Joules Energy lost
Producers the detritus food chain.
Figure 7.4: Ten percent law
7.2.5 Food chain
The movement of energy from producers upto Fallen leaves Earthworm Black bird Hawk
top carnivores is known as food chain, i.e., in Small Top
Detritus Detritivores
any food chain, energy flows from producers carnivores carnivores
to primary consumers, then from primary Figure 7.6: Diagrammatic representation of

consumers to secondary consumers, and finally Detritus food chain.
secondary consumers to tertiary consumers. 7.2.6 Food Web
Hence, it shows linear network links. Generally,
there are two types of food chain, (1) Grazing Grasshopper Lizard
food chain and (2) Detritus food chain.

Rabbit
1. Grazing food chain
Main source of energy for the grazing food Hawk
chain is the Sun. It begins with the first link, Plants
producers (plants). The second link in the food Mouse

chain is primary consumers (mouse) which
Snake
get their food from producers. The third link Figure 7.7: Diagrammatic representation
in the food chain is secondary consumers of Food web in a grassland ecosystem
(snake) which get their food from primary The inter-locking pattern of a number of food
consumers. Fourth link in the food chain is chain form a web like arrangement called food
138 Ecosystem

www.tntextbooks.in
web. It is the basic unit of an ecosystem, to There are three types: (1) pyramid of number
maintain its stability in nature. Which is also (2) pyramid of biomass (3) pyramid of energy.
called homeostasis. 1. Pyramid of number
Example: In a grazing food chain of a grass A graphical representation of the number of
land, in the absence of a rabbit, a mouse may organisms present at each successive trophic
also eat food grains. The mouse in turn may be level in an ecosystem is called pyramids of
eaten directly by a hawk or by a snake and the number. There are three different shapes of
snake may be directly eaten by hawks. pyramids upright, spindle and inverted.
Hence, this interlocking pattern of food chains
There is a gradual decrease in the number of
is the food web and the species of an ecosystem
organisms in each trophic level from producers
may remain balanced to each other by some
to primary consumers and then to secondary
sort of natural check.
consumers, and finally to tertiary consumers.
Significance of food web Therefore, pyramids of number in grassland
• Food web is constructed to describe species and pond ecosystem are always upright.
interaction called direct interaction. In a forest ecosystem the pyramid of number
• It can be used to illustrate indirect is somewhat different in shape, it is because the
interactions among different species. base (T1) of the pyramid occupies large sized
• It can be used to study bottom-up or top- trees (Producer) which are lesser in number.
down control of community structure. Herbivores (T2) (Fruit eating birds, elephant,
• It can be used to reveal different patterns deer) occupying second trophic level, are more
of energy transfer in terrestrial and aquatic in number than the producers. In final trophic
ecosystems. level (T4), tertiary consumers (lion) are lesser in
7.2.7 Ecological pyramids number than the secondary consumer (T3) (fox
Graphic representation of the trophic structure and snake). Therefore, the pyramid of number
and function at successive trophic levels of an in forest ecosystem looks spindle shaped.
ecosystem is called ecological pyramids. The The pyramid of number in a parasite
concept of ecological pyramids was introduced ecosystem is always inverted, because it
by Charles Elton (1927). Thus they are also starts with a single tree. Therefore there is
called as Eltonian pyramids.
T4
T4
T4 T4
T3 T3
T3 T3 T2
T2
T2 T2
T1
T1 T1
T1
A B C D
T1 - Producers | T2 - Herbivores | T3 - Secondary consumers | T4 - Tertiary consumers
Figure 7.8: Pyramids of numbers ( individuals per unit area) in different types of ecosystems.
Upright-A) Grassland ecosystem B) Pond ecosystem , Spindle shaped -C) Forest ecosystem,
Inverted-D) Parasite ecosystem
Ecosystem 139

www.tntextbooks.in
A B T4 C T3
T4
T2
T3
T3
T2 T2
T1
T1
T1

Figure 7.9: Pyramids of biomass ( dry weight per unit area)in different types of ecosystems.
Upright-A) Grassland ecosystem B) Forest ecosystem, Inverted- C)Pond ecosystem
gradual increase in the number of organisms

in successive tropic levels from producer to
tertiary consumers. Tertiary
consumers
2 Pyramid of biomass
0.1 Joule
1 Joule
A graphical representation of the amount of

Secondary consumers
organic material (biomass) present at each 10 Joules
successive trophic level in an ecosystem is called
pyramid of biomass. Sunlight Primary consumers
In grassland and forest ecosystems, there 1000 Joules

100 Joules
is a gradual decrease in biomass of organisms Producers
at successive trophic levels from producers to
Figure 7.10: Pyramids of energy( Kcal/unit
top carnivores (Tertiary consumer). Therefore,
area/unit time ) in any ecosystem
these two ecosystems show pyramids as upright
pyramids of biomass. 7.2.8 Decomposition:
However, in pond ecosystem, the bottom of Decomposition is a process in which the detritus
the pyramid is occupied by the producers, which (dead plants, animals and their excreta) are
comprise very small organisms possessing breaken down in to simple organic matter by the
the least biomass and so, the value gradually decomposers. It is an essential process for recycling
increases towards the tip of the pyramid. and balancing the nutrient pool in an ecosystem.
Therefore, the pyramid of biomass is always Nature of decomposition
inverted in shape. The process of decomposition varies based
3. Pyramid of energy on the nature of the organic compounds, i.e.,
A graphical representation of energy flow at some of the compounds like carbohydrate, fat
each successive trophic level in an ecosystem and protein are decomposed rapidly than the
is called pyramid of energy. The bottom of the cellulose, lignin, chitin, hair and bone.
pyramid of energy is occupied by the producers. Mechanism of decomposition
There is a gradual decrease in energy transfer Decomposition is a step wise process of
at successive tropic levels from producers to the degradation mediated by enzymatic reactions.
upper levels. Therefore, the pyramid of energy is Detritus acts as a raw material for decomposition.
always upright. It occurs in the following steps.
140 Ecosystem

www.tntextbooks.in
Raw material for

Fragmentation Catabolism
decomposition
Senescence
Leaching
Absorption
by plants
Mineralisation Humification
Figure 7.11: Diagrammatic representation – Process of decomposition and cycling of nutrients.
a. Fragmentation - The breaking down e.

Mineralisation - Some microbes are
of detritus into smaller particles by involved in the release of inorganic
detritivores like bacteria, fungi and earth nutrients from the humus of the soil, such
worm is known as fragmentation. These process is called mineralisation.
detritivores secrete certain substances Factors affecting decomposition
to enhance the fragmentation process
and increase the surface area of detritus Decomposition is affected by climatic factors
particles. like temperature, soil moisture, soil pH ,oxygen
and also the chemical quality of detritus.
b. Catabolism - The decomposers produce
some extracellular enzymes in their 7.2.9
Biogeochemical cycles (Nutrient
surroundings to break down complex cycles)
organic and inorganic compounds in to Exchange of nutrients between organisms and
simpler ones. This is called catabolism their environment is one of the essential aspects
c.
L eaching or Eluviation - The movement of an ecosystem. All organisms require nutrients
of decomposed, water soluble organic and for their growth, development, maintenance
inorganic compounds from the surface to and reproduction. Circulation of nutrients
the lower layer of soil or the carrying away within the ecosystem or biosphere is known as
of the same by water is called leaching or biogeochemical cycles and also called as ‘cycling
eluviation. of materials.’ There are two basic types,
d.
Humification - It is a process by which Gaseous cycle – It includes atmospheric
1.
simplified detritus is changed into dark Oxygen, Carbon and Nitrogen cycles.
coloured amorphous substance called Sedimentary cycle – It includes the cycles
2.
humus. It is highly resistant to microbial of Phosphorus, Sulphur and Calcium -
action, therefore decomposition is very Which are present as sediments of earth.
slow. It is the reservoir of nutrients.
Ecosystem 141

www.tntextbooks.in
Atmospheric CO2 Volcanic eruption

Diffusion
Respiration Forest fire
Combustion Photosynthesis
Diffusion
Transport
(DOM) Photosynthesis
Respiration
Dead organic
matter (DOM)
Decomposition Decomposition
Fossil fuel
Peat
Coal Dead organic matter
Oil and Gas Deposition / Sediments
Figure 7.12: Diagrammatic Sketch showing Carbon cycle
Many of the cycles mentioned above are studied Phosphorus cycle

by you in previous classes. Therefore, in this It is a type of sedimentary cycle. Already
chapter, only the carbon and phosphorous we know that phosphorus is found in the
cycles are explained. biomolecules like DNA, RNA, ATP, NADP and
Carbon cycle phospholipid molecules of living organisms.
Phosphorus is not abundant in the biosphere,
The circulation of carbon between organisms
whereas a bulk quantity of phosphorus is present
and environment is known as the carbon
in rock deposits, marine sediments and guano.
cycle. Carbon is an inevitable part of all
biomolecules and is substantially
impacted by the change in global
climate. Cycling of carbon between
organisms and atmosphere is a PI
consequence of two reciprocal Urban/Industrial Food PI

processes of photosynthesis and izers Agriculture
respiration. The releasing of

l
rti
Fe
Fe
rti
liz
P Weathering P
carbon in the atmosphere increases
ers
I
I
Mining
Phosphate PO
Guano Dead Uptake
due to burning of fossile fuels,
rocks
organic
Death matter Soil
deforestration, forest fire, volcanic PI
Excretion PI
eruption and decomposition of Bacteria
Decomposition
dead organic matters. The details of P = Organic phosphates
Sediments Mineralization
o
carbon cycle are given in the figure. P = Inorganic phosphates

I
Figure 7.13: Diagrammatic sketch showing Phosphorous cycle
142 Ecosystem

www.tntextbooks.in
It is released from these deposits by weathering us to understand the structure and function
process. After that, it circulates in lithosphere of an ecosystem. When rain water gathers in a
as well as hydrosphere. The producers absorb shallow area, gradually over a period of time,
phosphorus in the form of phosphate ions, different kinds of organisms (microbes, plants,
and then it is transferred to each trophic level animals) become part of this ecosystem. This
of food chain through food. Again death of pond ecosystem is a self sustaining and self
the organisms and degradation by the action regulatory fresh water ecosystem, which shows
of decomposers, the phosphorus is released a complex interaction between the abiotic and
back into the lithosphere and hydrosphere to biotic components in it.
maintain phosphorus cycle.
7.2.10 Types of ecosystem

Biosphere consists of different types of Producers
ecosystems, which are as follows:
Ecosystem Consumers
Natural Artificial or Manmade Mud Decomposers

Ecosystem Ecosystem
Abiotic components
(With or (Artifically maintained
by man) Figure 7.15: Diagram shows structure of pond
without
human Example: Rice field and ecosystem with abiotic and biotic components.
interference) Maize field
Activity
Collect few living and nonliving
Terrrestrial Ecosystem Aquatic components from any water body found
Example: Forest ecosystem ecosystem
near by.
Grass land ecosystem (Open
Desert ecosystem water)
Abiotic components
Fresh water ecosystem Marine ecosystem A pond ecosystem consists of dissolved

inorganic (CO2, O2, Ca, N, Phosphate) and
Lotic organic substances (amino acids and humic
Lentic
(Running water (Standing water acid) formed from the dead organic matter. The
bodies) bodies) function of pond ecosystem is regulated by few
Example: River Example: Pond factors like the amount of light, temperature,
Spring and Stream and Lake pH value of water and other climatic conditions.
Figure 7.14: Types of Ecosystem Biotic components

Though there are many types of ecosystems They constitute the producers, variety of
as charted above. Only the pond ecosystem is consumers and decomposers (microorganisms).
detailed below.
a. Producers
Structure of Pond ecosystem A variety of phytoplanktons like Oscillatoria,
It is a classical example for natural, aquatic, Anabaena, Chlamydomonas, Pandorina,
freshwater, lentic type of ecosystem. It helps Eudorina, Volvox and Diatoms. Filamentous
Ecosystem 143

www.tntextbooks.in
algae such as Ulothrix, Spirogyra, Cladophora

and Oedogonium; floating plants Azolla, Limnology
Salvia, Pistia, Wolffia and Eichhornia; sub- It is the study of
merged plants Potamogeton and Phragmitis; biological, chemical,
rooted floating plants Nymphaea and Nelumbo; physical and geological
macrophytes like Typha and Ipomoea, constitute components of inland fresh water aquatic
the major producers of a pond ecosystem. ecosystems (ponds, lakes, etc.).
b. Consumers Oceanography – It is the study of

The animals represent the consumers of a biological, chemical, physical and
pond ecosystem which include zooplanktons geological components of ocean.
like Paramoecium and Daphnia (primary
consumers); benthos (bottom living animals) Stratification of pond ecosystem
like mollusces and annelids; secondary
consumers like water beetles and frogs; and Sun
tertiary consumers (carnivores) like duck ,

crane and some top carnivores which include
large fish, hawk ,man, etc.
LITTORAL ZONE
Sea grasses and LIMNETIC ZONE
mangroves of light
compensation
PROFUNDAL ZONE level
Estuarine and
BENTHIC
coastal ecosystems ZONE
are the most Figure 7.16: Diagrammatic sketch shows

efficient in carbon stratification of Pond ecosystem
sequestration. Hence, these ecosystems are Based on the factors like distance from the
called as “ Blue carbon ecosystems”. They shore, penetration of light, depth of water,
are not properly utilized and maintained types of plants and animals, there may be three
all over the world although they have rich zones, littoral, limnetic and profundal. The
bioresources potential. littoral zone, which is closest to the shore with
shallow water region, allows easy penetration of
c. Decomposers light. It is warm and occupied by rooted plant
species. The limnetic zone refers the open water
They are also called as microconsumers.
of the pond with an effective penetration of
They help to recycle the nutrients in the
light and domination of planktons. The deeper
ecosystem. These are present in mud water and
region of a pond below the limnetic zone is
bottom of the ponds. Example: Bacteria and
called profundal zone with no effective light
Fungi. Decomposers perform the process of
penetration and predominance of heterotrophs.
decomposition in order to enrich the nutrients
The bottom zone of a pond is termed benthic
in the pond ecosystem.
and is occupied by a community of organisms
The cycling of nutrients between abiotic and called benthos (usually decomposers).The
biotic components is evident in the pond primary productivity through photosynthesis of
ecosystem, making itself self sufficient and self littoral and limnetic zone is more due to greater
regulating. penetration of light than the profundal zone.
144 Ecosystem

www.tntextbooks.in
7.2.11 Ecosystem services ( Benefits) Mangrove ecosystem services

Ecosystem services are defined as the benefits
• Offers habitat and
that people derive from nature. Robert act as nursery for
Constanza et al (1927) stated “Ecosystem aquatic plants and
services are the benefits provided to human, animals
through the transformation of resources (or
• Provides medicine,
Environmental assets including land, water,
fuel wood and
vegetation and atmosphere) into a flow of
timber.
essential goods and services”.
•
Act as bridge
Study on ecosystem services acts as an between sea and rivers by balancing
effective tool for gaining knowledge on sedimentation and soil erosion.
ecosystem benefits and their sustained use. • Help to reduce water force during cyclones,
Without such knowledge gain, the fate of any tsunamis and high tide periods.
ecosystem will be at stake and the benefits they
• Help in wind break, O2 production, carbon
provide to us in future will become bleak.
sequestration and prevents salt spray from
waves.
Robert Constanza and his
colleagues estimated the How do anthropogenic activities affect
value of global ecosystem ecosystem services?
services based on various Now, we all exploit the ecosystem more than
parameters. According to them in 1997, the that of our needs. The Millennium Ecosystem
average global value of ecosystems services Assessment (2005) found that “over the past 50
estimated was US $ 33 trillion a year. years, humans have changed the ecosystem more
The updated estimate for the total global rapidly and extensively than in any comparable
ecosystem services in 2011 is US $ 125 period of time in human history, largely to meet
trillion / year, indicating a four-fold increase rapidly growing demands for food, fresh water,
in ecosystem services from 1997 to 2011. medicine, timber, fiber and fuel.”
The varieties of benefits obtained from the ecosystem are generally categorized into the following
four types
Ecosystem services
Provisoning Cultural services Supporting services Regulating services

services • Spiritual and • Primary production • Invasion resistance
• Food, fiber religious values • Provision of habitat • Herbivory pollination
and fuel • Knowledge system • Nutrient cycling • Seed dispersal
• Genetic • Education and • Soil formation and • Climate regulation
resources inspiration retention • Pest regulation
• Bio-chemicals • Recreation and • Production of • Disease regulation
• Fresh water aesthetic values atmospherc oxygen • Erosion regulation
• Medicines • Ecotourism • Water cycling • Water purification
• Natural hazard protection
Figure 7.17: Types of Ecosystem services
Ecosystem 145

www.tntextbooks.in
Generally the following human activities Recycle the waste and reduce the amount
•
disturb or re-engineer an ecosystem every day. of waste you produce.
• Habitat destruction •
Reduce consumption of water and
• Deforestation and over grazing electricity.
• Erosion of soils •
Reduce or eliminate the use of house-hold
• Introduction of non-native species chemicals and pesticides.
• Over harvesting of plant material Maintain your cars and vehicles properly.
•
(In order to reduce carbon emission)
• Pollution of land, water and air
•
Run off pesticides, fertilizers and animal •
Create awareness and educate about
wastes ecosystem protection among your friends
and family members.
Ecosystem resilience
Ecosystem is damaged
by disturbances from
fire, flood, predation,
infection, drought, etc., removing a great
amount of biomasss. However, ecosystem
Go green
is endowed with the ability to resist the It refers to the
damage and recover quickly. This ability changing of one’s
of ecosystem is called ecosystem resilience lifestyle for the
or ecosystem robustness. safety and benefits of the environments
(Reduce, Reuse, Recycle)
How to protect the ecosystem? Way to go green and save green
It is a practice of protecting ecosystem at • Close the tap when not in use.
individual, organisational and governmental • Switch off the electrical gadgets
levels for the benefits of both nature and humans. when not in use.
Threats to ecosystems are many, like adverse • Never use plastics and replace them
human activities, global warming, pollution, etc. with biodegradable products
Hence, if we change our everyday life style, we • Always use ecofriendly technology
can help to protect the planet and its ecosystem. and products.
“USE ECOSYSTEM BUT DON’T
“If we fail to protect environment, we will LOSE ECOSYSTEM; MAKE IT
fail to save posterity”. SUSTAINABLE”
Therefore, we have to practice the following
in our day today life: 7.2.12 Ecosystem Management
• Buy and use only ecofriendly products and It is a process that integrates ecological, socio
recycle them. economic and institutional factors into a
Grow more trees
• comprehensive strategy in order to sustain
Choose
• sustained farm products and enhance the quality of the ecosystem to
(vegetables, fruits, greens, etc.) meet current and future needs.
Ecosystem management emphasis on
•
Reduce the use of natural resources.
human role in judicious use of ecosystem
146 Ecosystem

www.tntextbooks.in
and for sustained benefits through minimal Urban ecosystem restoration model
human impacts on ecosystems. Environmental
degradation and biodiversity loss will result Adayar Poonga is located in Chennai and
in depletion of natural resources, ultimately covers an area around a total of 358 acres of
affecting the existence of human Adayar creek and estuary, of which 58 acres
were taken up for eco restoration under the
auspices of Government of Tamil Nadu. It is
"By 2025, at least 3.5
billion people, nearly 50% maintained by Chennai Rivers Restoration
of the world’s population Trust (CRRT).This was a dumping site
are projected to face water previously.
scarcity." – IUCN. Presently it has 6 species of mangroves,
"Forests house approximately 50% of about 170 species of littoral and tropical
global bio-diversity and at least 300 million dry evergreen forests (TDF) which have
people are dependent on forest’s goods successfully established as a sustainable
and services to sustain their livelihood." – ecosystem. Restoration of plants species
IUCN has brought other associated fauna such as
butterflies, birds, reptiles, amphibians and
Strategy of ecosystem management other mammals of the ecosystem.
• I t is used to maintain Currently Adayar Poonga functions as an
biodiversity of ecosystems. environmental education Centre for school
• I t helps in indicating and college students and the public. The
the damaged ecosystem entire area stands as one of the best examples
(Some species indicate the for urban eco restoration in the state
health of the ecosystem: of Tamil Nadu.
such species are called a
flagship species).
• I t is used to recognize the inevitability of
ecosystem change and plan accordingly.
• I t is one of the tools used for achieving
sustainability of ecosystem through
sustainable development programme (or
projects).
• I t is also helpful in identifying ecosystems
which are in need of rehabilitation.
Adayar Poonga
• I t involves collaborative management with
7.3 Plant Succession
government agencies, local population,
communities and NGO’s. We very often see that forests and lands in our
areas are drastically affected by natural calamities
• I t is used to build the capacity of local (Flood, earthquake) and anthropogenic
institutions and community groups to assume activities (Fire, over grazing, cutting of trees).
responsibility for long term implementation Due to these reasons all plants of an area are
of ecosystem management activities even destroyed and the areas become nude. When we
after the completion of the project. observe this area, over a period of a time we can
Ecosystem 147

www.tntextbooks.in
see that it will be gradually covered by Secondary Succession

plant community again and become Intermediate
Pioneer Species Climax
fertile. Such successive replacement Species Community
of one type of plant community by
the other of the same area/ place is Grasses
Annual
Fire
known as plant succession. The first plants and
Perennials
Grasses, Shrubs Shrubs and trees
invaded plants in a barren area are 0 Year 1 - 2 Years 3 - 4 Years 5 - 150 Years 150 + Years
called pioneers. On the other hand,
Figure 7.18: Diagrammatic representation of
a series of transitional developments
secondary succession
of plant communities one after
another in a given area are called seral in a barren area is called pioneer species or
communities. At the end a final stage and a primary community or primary colonies.
final plant community gets established which Generally, Primary succession takes a very
are called as climax and climax community long time for the occurrence in any region.
respectively.
Example: Microbes, Lichen, Mosses.
7.3.1 Characteristics of ecological 2. Secondary succession - The development of
succession a plant community in an area where an already
• It is a systematic process which causes changes developed community has been destroyed by
in specific structure of plant community. some natural disturbance (Fire, flood, human
activity) is known as secondary succession.
• It is resultant of changes of abiotic and
Generally, This succession takes less time than
biotic factors.
the time taken for primary succession.
• It transforms unstable community into a
Primary succession Secondary succession
stable community.
1 Developing in an Developing in
• Gradual progression in species diversity, barren area disturbed area
total biomass, niche specialisation, and 2 Initiated due to a Starts due to external
humus content of soil takes place. biological or any factors only
other external factors
• It progresses from simple food chain to 3 No soil, while It starts where soil
complex food web. primary succession covers is already
starts present
• It modifies the lower and simple life form
4 Pioneer species Pioneer species
to the higher life forms. come from outside develop from existing
• It creates inter-dependence of plants and environment environment
animals. 5 It takes more time to It takes comparatively
complete less time to complete
7.3.2 Types of succession Table 1: Differences between primary and
The various types of succession have been secondary succession
classified in different ways on the basis of Example: The forest destroyed by fire and
different aspects. These are as follows: excessive lumbering may be re-occupied by
1. Primary succession - The development herbs over a period of times.
of plant community in a barren area where no 3. Allogenic succession
community existed before is called primary
Allogeneic succession occurs as a result of
succession. The plants which colonize first
148 Ecosystem

www.tntextbooks.in
Types of succession
Primary Secondary Autogenic Allogenic Autotrophic Heterotrophic

Succession Succession Succession Succession Succession Succession
Development Controlled
Development Controlled It occurs in the It occurs in the
of plant by biotic
of plant by abiotic medium that is medium that is
community on components of
community on components rich in inorganic rich in organic
barren area. ecosystem.
disturbed area. of ecosystem. substances . substances.
Figure 7.19: Types of succession
abiotic factors. The replacement of existing stage. It includes the following stages Fig 7.21.
community is caused by other external factors
(soil erosion, leaching, etc.,) and not by existing 1. Phytoplankton stage - It is the first stage
organisms. of succession consisting of the pioneer
community like blue green algae, green algae,
Example: In a forest ecosystem soil erosion diatoms, bacteria, etc., The colonization
and leaching alter the nutrient value of the soil of these organisms enrich the amount of
leading to the change of vegetation in that area. organic matter and nutrients of pond due to
7.3.3 Classification of plant succession their life activities and death. This favors the
development of the next seral stages.
Detailed study of Hydrosere and Lithosere are
discussed below: 2. Submerged plant stage - As the result of death
Plant succession and decomposition of planktons, silt brought
from land by rain water, lead to a loose mud
Hydrosere Mesosere Xerosere formation at the bottom of the pond. Hence,
(Succession (Succession (Succession
starts in the rooted submerged hydrophytes begin
starts in starts in
regions where to appear on the new substratum. Example:
regions regions where
water is Chara, Utricularia, Vallisneria and Hydrilla etc.
where moisture
plenty) The death and decay of these plants will build
Example: moisture is present
condition in minimal up the substratum of pond to become shallow.
Ponds, lakes,
stream , is amount with Therefore, this habitat now replaces another
swamps adequate) water group of plants which are of floating type.
Lithosere Halosere Psammosere 3. Submerged free floating stage - During

(Initiating on (Initiating in (Initiating on this stage, the depth of the pond will become
a barren rock) saline water) a sand) almost 2-5 feet. Hence, the rooted hydrophytic
plants and with floating large leaves start
Figure 7.20: Classification of plant succession
colonising the pond. Example: Rooted floating
Hydrosere plants like Nelumbo, Nymphaea and Trapa.
The succession in a freshwater ecosystem is Some free floating species like Azolla, Lemna,
also referred to as hydrosere. Succession in a Wolffia and Pistia are also present in this stage.
pond, begins with colonization of the pioneers By death and decomposition of these plants,
like phytoplankton and finally ends with the further the pond becomes more shallow.
formation of climax community like forest Due to this reason, floating plant species is
gradually replaced by another species which
Ecosystem 149

www.tntextbooks.in
makes new seral stage.
4. Reed-swamp stage - It is also called an

amphibious stage. During this stage, rooted
Forest stage
floating plants are replaced by plants which
can live successfully in aquatic as well as aerial
environment. Example: Typha, Phragmites,
Sagittaria and Scirpus etc. At the end of this
stage, water level is very much reduced, making
it unsuitable for the continuous growth of
amphibious plants.
Figure 7.21: Diagrammatic representation shows different stages of hydrosere.

Shrub stage
5. Marsh meadow stage - When the pond
becomes swallowed due to decreasing water
level, species of Cyperaceae and Poaceae such as
Carex, Juncus, Cyperus and Eleocharis colonise
the area. They form a mat-like vegetation with
Marsh meadow
the help of their much branched root system.

This leads to an absorption and loss of large
stage
quantity of water. At the end of this stage, the

soil becomes dry and the marshy vegetation
disappears gradually and leads to shurb stage.
6. Shrub stage - As the disappearance of marshy
Reed-swamp
vegetation continues, soil becomes dry. Hence,

stage
these areas are now invaded by terrestrial

plants like shrubs (Salix and Cornus) and trees
(Populus and Alnus). These plants absorb large
quantity of water and make the habitat dry.
Submerged plant Submerged free
Further, the accumulation of humus with a

floating stage
rich flora of microorganisms produce minerals

in the soil, ultimately favouring the arrival of
new tree species in the area.
7. Forest stage - It is the climax community of
hydrosere. A variety of trees invade the area
and develop any one of the diverse type of
vegetation. Example:Temperate mixed forest
stage
(Ulmus,Acer and Quercus), Tropical rain forest

(Artocarpus and Cinnamomum ) and Tropical
deciduous forest (Bamboo and Tectona).
In the 7 stages of hydrosere succession, stage1 is
Phytoplankton
occupied by pioneer community, while the stage

stage
7 is occupied by the climax community. The

stages 2 to 6 are occupied by seral communities.
150 Ecosystem

www.tntextbooks.in
7.3.4 Significance of Plant Succession energy in an ecosystem can be termed as energy

• Succession is a dynamic flow. It is explained through the food chain, food
process. Hence an web, ecological pyramids (pyramid of number,
ecologist can access and biomass and energy) and biogeochemical cycle.
study the seral stages of a Cycling of nutrients between abiotic and biotic
plant community found components is evident in the pond ecosystem,
in a particular area. making itself self sufficient and self regulating
• The knowledge of Ecosystem protected for the welfare of posterity
ecological succession helps to understand is called ecosystem management.
the controlled growth of one or more species Successive replacement of one type of plant
in a forest. community by the other of the same area/
• Utilizing the knowledge of succession, even place is known as plant succession. The first
dams can be protected by preventing siltation. invaded plants in a barren (nude) area are called
• It gives information about the techniques to pioneers (pioneers communities). On the other
be used during reforestation and afforestation. hand, a series of transitional developments
• It helps in the maintenance of pastures. of plant communities one after another in
• Plant succession helps to maintain species a given area are called seral communities.
diversity in an ecosystem. Succession is classified as primary succession,
• Patterns of diversity during succession secondary succession, allogeneic succession
are influenced by resource availability and and autotrophic succession. Plant succession
disturbance by various factors. is classified in to hydrosere (Initiating on a
• Primary succession involves the colonization water bodies) ,Mesosere and xerosere. Further
of habitat of an area devoid of life. xerosere is subdivided in to Lithosere ( Initiating
on a barren rock), Halosere and Pasmmosere.
• Secondary succession involves the
reestablishment of a plant community in Evaluation
disturbed area or habitat. I Choose the most suitable
• Forests and vegetation that we come across answer from the given
all over the world are the result of plant four alternatives and write
succession. the option code and the
corresponding answer.
Summary
1. Which of the following is
The interaction between biotic and abiotic not a abiotic component
components in an environment is called of the ecosystem?
ecosystem. Autotrophs and heterotrophs are a) Bacteria
the producers and consumers respectively. b) Humus
The function of ecosystem refers to creation of c) Organic compounds
energy, flow of energy and cycling of nutrients. d) Inorganic compounds
The amount of light available for photosynthesis
is called Photo synthetically Active Radiation . 2. Which of the following is / are not a natural
It is essential for increase in the productivity of ecosystem?
ecosystem. The rate of biomass production per a) Forest ecosystem b) Rice field
unit area /time is called productivity. It is classified c) Grassland ecosystem d) Desert ecosystem
as primary productivity, secondary productivity 3. Pond is a type of
and community productivity. The transfer of a) forest ecosystem
Ecosystem 151

www.tntextbooks.in
b) grassland ecosystem a) it does not maintain stability in nature

c) marine ecosystem b) it shows patterns of energy transfer
d) fresh water ecosystem c) it explains species interaction
4. Pond ecosystem is d) b and c
a) not self sufficient and self regulating 11. The following diagram represents
b) partially self sufficient and self regulating T4
c) self sufficient and not self regulating
d) self sufficient and self regulating T3
5. Profundal zone is predominated by

T2
heterotrophs in a pond ecosystem, because of
a) with effective light penetration
b) no effective light penetration T1
c) complete absence of light

d) a and b a)
pyramid of number in a grassland
6.
Solar energy used by green plants for ecosystem
photosynthesis is only b) pyramid of number in a pond ecosystem
c) pyramid of number in a forest ecosystem
a) 2 – 8% b) 2 – 10%
d) pyramid of biomass in a pond ecosystem
c) 3 – 10% d) 2 – 9%
12.
Which of the following is / are not the
7. Which of the following ecosystem has the
mechanism of decomposition
highest primary productivity?
a) Eluviation b) Catabolism
a) Pond ecosystem
c) Anabolism d) Fragmentation
b) Lake ecosystem
c) Grassland ecosystem 13.
Which of the following is not a
d) Forest ecosystem sedimentary cycle
8. Ecosystem consists of a) Nitrogen cycle b) Phosphorous cycle
c) Sulphur cycle d) Calcium cycle
a) decomposers b) producers
c) consumers d) all of the above 14. Which of the following are not regulating
services of ecosystem services
9. Which one is in descending order of a food
i) Genetic resources
chain
ii) Recreation and aesthetic values
a) Producers  Secondary consumers
iii) Invasion resistance
 Primary consumers  Tertiary
iv) Climatic regulation
consumers
a) i and iii b) ii and iv
b) Tertiary consumers  Primary
c) i and ii d) i and iv
consumers  Secondary consumers 
15. Productivity of profundal zone will be low.
Producers
Why?
c) Tertiary consumers  Secondary
consumers  Primary consumers  16. Discuss the gross primary productivity is
Producers more efficient than net primary productivity.
d) Tertiary consumers  Producers  17. Pyramid of energy is always upright. Give
Primary consumers  Secondary reasons
consumers 18.
What will happen if all producers are
10. Significance of food web is / are removed from ecosystem?
152 Ecosystem

www.tntextbooks.in
19. Construct the food chain with the following Benthic: Bottom zone of the pond
data.
Trophic: Refers to the position of organisms in
Hawk, plants, frog, snake, grasshopper. food chain
20. Name of the food chain which is generally
present in all type of ecosystem. Explain and Omnivores: Those eats both plants and animals
write their significance. Food chain: Refers movement of energy from
21. Shape of pyramid in a particular ecosystem producers up to top carnivores
is always different in shape. Explain with
Food web: Interlocking pattern of food chain
example.
22. Generally human activities are against to the Pyramid of number: Refers number of
ecosystem, where as you a student how will organisms in a successive trophic level
you help to protect ecosystem?
Pyramid of biomass: Refers to quantitative
23. Generally in summer the forest are affected relationship of the standing crops
by natural fire. Over a period of time it
recovers itself by the process of successions . Pyramid of energy: Refers transformation of
Find out the types of succession and explain. energy at successive trophic levels
24. Draw a pyramid from following details and Ten per cent law: refers only 10 per cent of
explain in brief. energy is stored in each successive trophic levels
Quantities of organisms are given-Hawks-50,
Bio geo chemical cycle: Exchange of nutrients
plants-1000.rabbit and mouse-250 +250,
between organisms and environments
pythons and lizard- 100 + 50 respectively.
25. Various stages of succession are given bellow. Carbon cycle: Circulation of carbon among
From that rearrange them accordingly. Find organisms and environments
out the type of succession and explain in
Guano: It is a accumulated excrement of sea
detail.
birds and bats.
Reed-swamp stage, phytoplankton stage,

shrub stage, submerged plant stage, forest Phosphorus cycle: Circulation of Phosphorus
stage, submerged free floating stage, marsh among organisms and environments
medow stage. Succession: Successive replacement of one type
Glossary of plant communities by other on barren or
disturbed area.
Ecosystem: Study of interaction between living
and non-living components Pioneers: Invaded plants on barren area
Standing quality: Total inorganic substances Primary succession: Plants colonising on

presents in any ecosystem at a given time and barren area
given area
Secondary succession: Plants colonising on
Standing crops: Amount of living material disturbed area.
present in a population at any time.
Climax communities: Final establishment of
Biomass: Can be measured as fresh weight or plant communities which are not replaced by
dry weight of organisms others.
Ecosystem 153

www.tntextbooks.in
ICT Corner
ECO SYSTEM
Let us know
about the
Ecosystem in
detail through
this activity.
Steps
• Type the URL or scan the QR code to open the activity page then Introduction page will
open.
• Click on the Learn icon in the introduction page to know in detail.
• Click on the Flashcards icon in the introduction page to know about the topics easily.
• Click on the Test icon to write a quiz test finally it displays the marks we scored.
URL: https://play.google.com/store/apps/details?id=com.ksolve.
ecologyfree
154 Ecosystem

www.tntextbooks.in
Unit IX - Plant Ecology

Chapter
8 Environmental Issues
Learning Objectives 8.8 Rain water harvesting

8.9 Environmental Impact Assessment
Learning objectives (EIA)
The learner will be able to, 8.10 Geographic Information System

Understand the importance of
growing more plants to mitigate the After understanding the structure and functions
environmental problems. of major ecosystems of the world, now student

Distinguish between the importance community should observe and understand
and conservation of endemic and environmental problems of their surroundings
endangered species. at local, national and international level.

Appreciate the use of technologies for Now we are going to understand some of the
agriculture and forestry. environmental issues such as

Participate in community activities to Over population
improve environmental conditions.
Health issues

Develop methods in conservation
Waste disposal
of water and plants for sustainable
development. All types of pollution

Get acquainted with satellite Green House gases
technology and utilising it in our daily Ozone depletion
life needs Water, energy, food scarcity
De-forestation
Chapter outline Climate change
Industrialisation,
8.1 Green house effect, urbanisation impacts
ozone depletion
8.2 Forestry Figure 8.1: Environmental issues
8.3 Deforestation Environmental issues are the problems and
8.4 Afforestation harmful effects created by human’s unmindful
8.5 Alien invasive activity and over utilisation of valuable resources
species obtained from the nature (environment). Student
8.6 Conservation should understand not only the environmental
issues we are facing now, but also find solutions
8.7 Carbon Capture and Storage (CCS)
to rectify or reduce these problems.
155
Environmental Issues

www.tntextbooks.in
Countries of the world agree that something needs in major ecosystems and climate patterns. For
to be done about these important environmental example, coral ecosystem is affected by increase
issues. Many global summits, conferences and in temperature, especially coral bleaching
conventions are regularly conducted by the United observed in Gulf of Mannar, Tamil Nadu.
Nations and many steps are taken to minimise Human activities lead to produce the green
human-induced issues by signing agreements house effect by
with around 150 countries. • Burning fossil fuels, which releases CO2 and
CH4
Activity
• Way of Agriculture and animal husbandry
Students may form ‘ECOGROUPS’ and practices
discuss eco-issues of their premises and find • Electrical gadgets like refrigerator and air
solutions to the existing problems like, litter conditioners release chloro fluoro carbons
disposal, water stagnation, health and hygiene, • The fertilizers used in Agriculture which
greening the campus and its maintenance. release N2O
• The emissions from automobiles.
Drastic increase in population resulted
The increase in mean global temperature (highest
in demand for more productivity of food
in 4000 years) due to increased concentration of
materials, fibres, fuels which led to many
green house gases is called global warming.
environmental issues in agriculture, land use
modifications resulting in loss of biodiversity, One of the reasons for this is over population
land degradation, reduction in fresh water which creates growing need for food, fibre and
availability and also resulting in man-made fuel and considered to be the major cause of
global warming by green house gases even global warming.
altering climatic conditions. Clouds and Dust particles
can also produce Green House
8.1 Green House effect and Global
effect. That is why clouds,
Warming
dusts and humid nights are
Green House Effect is a process by which warmer than clear dust free dry nights.
radiant heat from the sun is captured by gases
in the atmosphere 8.1.1. Effects of Global Warming
that increase the • Rise in global temperature which causes sea
temperature of the CH4
levels to rise as polar ice caps and glaciers
20%
earth ultimately. begin to melt causing submergence of many
CFC
The gases that CO2
14% coastal cities in many parts of the world.
60% O
capture heat are th
e rs
• There will be a drastic change in weather
6%
called Green patterns bringing more floods or droughts
House Gases which in some areas.
include carbon Figure 8.2: Relative
contribution of green •
Biological diversity may get modified,
dioxide (CO2),
house gases some species ranges get redefined. Tropics
methane (CH4),
and sub-tropics may face the problem of
Nitrous Oxide
decreased food production.
(N2O) and a variety of manufactured chemicals
like chlorofluorocarbon (CFC). Increase in
greenhouse gases lead to irreversible changes

www.tntextbooks.in
8.1.2. Sources of Green House Gases • Developing alternate renewable sources of

Emission (Natural and Anthropogenic) energy
CO2 (Carbon dioxide) • Minimising uses of nitrogeneous fertilizers,
and aerosols.
• Coal based power plants, by the burning of
fossil fuels for electricity generation. 8.1.4. Ozone depletion
•
Combustion of fuels in the engines of Ozone layer is a region of Earth’s stratosphere that
automobiles, commercial vehicles and air absorbs most of the Sun’s ultra violet radiation.
planes contribute the most of global warming. The ozone layer is also called as the ozone shield
• Agricultural practices like stubble burning and it acts as a protective shield, cutting the ultra-
result in emission of CO2. violet radiation emitted by the sun.
•
Natural from organic matter, volcanoes, Just above the atmosphere there are two
warm oceans and sediments. layers namely troposphere (the lower layer)
and stratosphere (the upper layer). The ozone
Methane
layer of the troposphere is called bad ozone
Methane is 20 times as effective as CO2 at and the ozone layer of stratosphere is known as
trapping heat in the atomosphere. Its sources good ozone because this layer acts as a shield
are attributed paddy cultivation, cattle rearing, for absorbing the UV radiations coming from
bacteria in water bodies, fossil fuel production, the sun which is harmful for living organisms
ocean, non-wetland soils and forest / wild fires.
N2O (Nitrous oxide)
Ozone is a colourless gas, reacts readily with
It is naturally produced in Oceans from biological air pollutants and cause rubber to crack, hurt
sources of soil and water due to microbial actions plant life, damages lung tissues. But ozone
and rainforests. Man-made sources include nylon absorbs harmful ultra violet β (uv-β) and UV –
and nitric acid production, use of fertilizers in α radiation from sunlight.
agriculture, manures cars with catalytic converter
What is Dobson Unit? DU is the unit of
and burning of organic matter.
measurement for total ozone. One DU (0.001
Global Warming Effects on Plants atm. cm) is the number of molecules of ozone
• Low agricultural productivity in tropics that would be required to create a layer of pure
• Frequent heat waves (Weeds, pests, fungi ozone 0.01 millimetre thick at a temperature of
need warmer temperature) 0° C and a pressure of 1 atmosphere (atm = the
• Increase of vectors and epidemics air pressure at the surface of earth). Total ozone
• Strong storms and intense flood damage layer over the earth surface is 0.3 centrimetres
• Water crisis and decreased irrigation (3 mm) thick and is written as 300 DU.
• Change in flowering seasons and pollinators The false colour
• Change in Species distributional ranges view of total ozone
• Species extinction - The purple and
blue colours are
8.1.3 Strategies to deal with Global
Warming where there is the
• Increasing the vegetation cover, grow more least ozone, and the
trees yellows and reds are
• Reducing the use of fossil fuels and green where there is more
Figure 8.3: The false
house gases ozone.
colour view of total ozone
157

www.tntextbooks.in
causing DNA damage. The thickness of the Clean Development Mechanism (CDM)
ozone column of air from the ground to the is defined in the Kyoto protocol (2007) which
top of the atmosphere is measured in terms of provides project based mechanisms with two
Dobson Units. objectives to prevent dangerous climate change
The ozone shield is being damaged by and to reduce green house gas emissions. CDM
chemicals released on the Earth’s surface projects helps the countries to reduce or limit
notably the chlorofluorocarbons widely used emission and stimulate sustainable development.
in refrigeration, aerosols, chemicals used as An example for CDM project activity, is
cleaners in many industries. The decline in the replacement of conventional electrification
thickness of the ozone layer over restricted area projects with solar panels or other energy
is called Ozone hole. efficient boilers. Such projects can earn Certified
Emission Reduction (CER) with credits / scores,
September 16 is WORLD OZONE DAY each equivalent to one tonne of CO2, which can
Ozone depletion in the stratosphere be counted towards meeting Kyoto targets.
results in more UV radiations especially UV B Plant indicators
radiations (shortwaves). UV B radiation destroys
The presence or absence of certain
biomolecules (skin ageing) and damages living
plants indicate the state of environment
tissues. UV – C is the most damaging type of
by their response. The plant species or
UV radiation, but it is completely filtered by the
plant community acts as a measure of
atmosphere (ozone layer). UV – a contribute 95%
environmental conditions, it is referred as
of UV radiation which causes tanning burning
biological indicators or phytoindicators or
of skin and enhancing skin cancer. Hence the
plant indicators.
uniform ozone layer is critical for the wellbeing
of life on earth. Examples
During 1970’s research findings indicated Plants Indicator for
1 Lichens, Ficus, Pinus, SO2 pollution
that man-made chlorofluorocarbons (CFC)
Rose
reduce and convert ozone molecules in the 2. Petunia, Nitrate
atmosphere. The threats associated with reduced Chrysanthemum
ozone pushed the issue to the forefront of global 3. Gladiolus Flouride
climate issues and gained promotion through pollution
organisation such as World Meterological 4. Robinia pseudoacacia Indicator of
Organisation and the United Nations. The (Black locust tree) heavy metal
contamination
Vienna Convention was agreed upon at the
Vienna conference of 1985 but entered into force
8.1.5 Effects of Ozone depletion
in 1988 provided the frameworks necessary to
create regulative measures in the form of the The main ozone depletion effects are:
Montreal protocol. The International treaty • Increases the incidence of cataract, throat
called the Montreal Protocol (1987) was held in and lung irritation and aggravation of
Canada on substances that deplete ozone layer asthma or emphysema, skin cancer and
and the main goal of it is gradually eliminating diminishing the functioning of immune
the production and consumption of ozone system in human beings.
depleting substances and to limit their damage • Juvenile mortality of animals.
on the Earth’s ozone layer. • Increased incidence of mutations.

www.tntextbooks.in
• In plants, photosynthetic chemicals will be • Multipurpose tree varieties like Acacia are
affected and therefore photosynthesis will used for wood pulp, tanning, paper and
be inhibited. Decreased photosynthesis will firewood industries.
result in increased atmospheric CO2 resulting •
Agro-forestry is recommended for the
in global warming and also shortage of food following purposes. It can be used as
leading to food crisis. Farm Forestry for the extension of forests,
• Increase in temperature changes the climate mixed forestry, shelter belts and linear strip
and rainfall pattern which may result in plantation.
flood / drought, sea water rise, imbalance in Rehabilitation of degraded forests and
ecosystems affecting flora and fauna. recreation forestry
The production of woody plants combined
8.2 Forestry
with pasture is referred to silvopasture system.
8.2.1 Agro forestry The trees and shrubs may be used primarily
Agroforestry is an integration of trees, crops to produce fodder for livestock or they may
and livestock on the same plot of land. The main be grown for timber, fuel wood and fruit or to
objective is on the interaction among them . improve the soil.
Example: intercropping of two or more crops This system is classified into following categories.
between different species of trees and shrubs, Protein Bank: In this various multipurpose
i.
which results in higher yielding and reducing the trees are planted in and around farm
operation costs. This intentional combination lands and range lands mainly for fodder
of agriculture and forestry has varied benefits production.
including increased bio-diversity and reduced Example: Acacia nilotica, Albizzia lebbek,
erosion. Azadirachta indica, Gliricidia sepium,
Some of the major species cultivated in Sesbania grandiflora.
commercial Agroforestry include Casuarina, Livefence of fodder trees and hedges:
ii.
Eucalyptus, Malai Vembu, Teak and Kadambu Various fodder trees and hedges are planted
trees which were among the 20 species as live fence to protect the property from
identified as commercial timber. They are of stray animals or other biotic influences.
great importance to wood-based industries.
Example: Gliricidia sepium, Sesbania
Benefits of agroforestry grandiflora, Erythrina spp., Acacia spp..
• It is an answer to the problem of soil and
water conservation and also to stabilise 8.2.2 Social forestry
the soil (salinity and water table) reduce It refers to the sustainable management of
landslide and water run-off problem. forests by local communities with a goal
• Nutrient cycling between species improves of climate carbon sequestration, change
and organic matter is maintained. mitigation, depollution, deforestation, forest
restoration and providing indirect employment
• Trees provide micro climate for crops and
opportunity for the youth. Social forestry refers
maintain O2 – CO2 balanced, atmospheric
to the management of forests and afforestation
temperature and relative humidity.
on barren lands with the purpose of helping the
•
Suitable for dry land where rainfall is
environmental, social and rural development
minimum and hence it is a good system for
and benefits. Forestry programme is done
alternate land use pattern.
for the benefit of people and participation of
159

www.tntextbooks.in
the people. Trees grown outside forests by cause of deforestation.

government and public organisation reduce the • Logging for timber
pressure on forests. •
Developmental activities like road
In order to encourage tree cultivation outside construction, electric tower lines and dams.
forests, Tree cultivation in Private Lands was •
Over population, Industrialisation,
implemented in the state from 2007-08 to 2011- urbanisation and increased global needs.
12. It was implemented by carrying out block
Effects of deforestation
planting and inter-crop planting with profitable
tree species like Teak, Casuarina, Ailanthus, •
Burning of forest wood release stored
Silver Oak, etc. in the farming lands and by a carbon, a negative impact just opposite of
free supply of profitable tree species for planting carbon sequestration.
in the bunds. The Tank foreshore plantations • Trees and plants bind the soil particles. The
have been a major source of firewood in Tamil removal of forest cover increases soil erosion
Nadu. The 32 Forestry extension centres and decreases soil fertility. Deforestation in
provide technical support for tree growing in dry areas leads to the formation of deserts.
rural areas in Tamil Nadu. These centres provide • The amount of runoff water increases soil
quality tree seedlings like thorn / thornless erosion and also creates flash flooding, thus
bamboo, casuarinas, teak, neem, Melia dubia, reducing moisture and humidity.
grafted tamarind and nelli, etc. in private lands • The alteration of local precipitation patterns
and creating awareness among students by leading to drought conditions in many
training / camps. regions. It triggers adverse climatic conditions
and alters water cycle in ecosystem.
8.2.3. Major activities of forestry
extension centres • It decreases the bio-diversity significantly as
• Training on tree growing methods their habitats are disturbed and disruption
of natural cycles.
•
Publicity and propaganda regarding tree
growing • Loss of livelihood for forest dwellers and
rural people.
• Formation of demonstration plots
• Increased global warming and account for
• Raising and supply of seedlings on subsidy
one-third of total CO2 emission.
• Awareness creation among school children
• Loss of life support resources, fuel, medicinal
and youth about the importance of forests
herbs and wild edible fruits.
through training and camps.
8.4 Afforestation
8.3 Deforestation
Afforestation is planting of trees where there was
Deforestation is one of the major contributors
no previous tree coverage and the conversion
to enhance green house effect and global
of non-forested lands into forests by planting
warming. The conversion of forested area into
suitable trees to retrieve the vegetation. Example:
a non-forested area is known as deforestation.
Slopes of dams afforested to reduce water run-
Forests provide us many benefits including
off, erosion and siltation. It can also provide
goods such as timber, paper, medicine and
a range of environmental services including
industrial products. The causes are
carbon sequestration, water retention.
• The conversion of forests into agricultural
plantation and livestock ranching is a major

www.tntextbooks.in
The Man who Single Handedly Created a Achievements

Dense Forest • Degraded forests were restored
Jadav "Molai" Payeng (born 1963) is an •
Community assets like overhead tanks
environmental activist has single-handedly bore-wells, hand pumps, community halls,
planted a forest in the middle of a barren libraries, etc were established
wasteland. This Forest Man of India has • Environmental and ecological stability was
transformed the world’s largest river island, maintained.
Majuli, located on one of India’s major rivers, • Conserved bio-diversity, wildlife and genetic
the Brahmaputra, into a dense forest, home to resources.
rhinos, deers, elephants, tigers and birds. And •
Involvement of community especially
today his forest is larger than Central Park. women in forest management.
Former vice-chancellor of Jawahar Lal
Nehru University, Sudhir Kumar Sopory 8.5 Alien invasive species
named Jadav Payeng as Forest Man of Invasion of alien or introduced species disrupts
India, in the month of October 2013. He was ecosystem processes, threaten biodiversity,
honoured at the Indian Institute of Forest reduce native herbs, thus reducing the ecosystem
Management during their annual event services (benefits). During eradication of
‘Coalescence’. In 2015, he was honoured these species, the chemicals used increases
with Padma Shri, the fourth highest civilian greenhouse gases. Slowly they alter ecosystem,
award in India. He received honorary micro climate and nature of soil and make it
doctorate degree from Assam Agricultural unsuitable for native species and create human
University and Kaziranga University for his health problems like allergy, thus resulting in
contributions. local environmental degradation and loss of
important local species.
Afforestation Objectives
According to World Conservation Union
• To increase forest cover, planting more trees,
invasive alien species are the second most
increases O2 production and air quality.
significant threat to bio-diversity after habitat loss.
•
Rehabilitation of degraded forests to
What is invasive species?
increase carbon fixation and reducing CO2
from atmosphere. A non-native species to the ecosystem or country
under consideration that spreads naturally,
• Raising bamboo plantations.
interferes with the biology and existence of
• Mixed plantations of minor forest produce
native species, poses a serious threat to the
and medicinal plants.
ecosystem and causes economic loss.
• Regeneration of indigenous herbs / shrubs.
It is established that a number of invasive
Awareness
• creation, monitoring and species are accidental introduction through
evaluation. ports via air or sea. Some research organisations
• To increase the level and availability of water import germplasm of wild varieties through
table or ground water and also to reduce which also it gets introduced. Alien species with
nitrogen leaching in soil and nitrogen edible fruits are usually spread by birds.
contamination of drinking water, thus Invasive species are fast growing and are
making it pure not polluted with nitrogen. more adapted. They alter the soil system by
• Nature aided artificial regeneration. changing litter quality thereby affecting the
161

www.tntextbooks.in
soil community, soil fauna and the ecosystem the waterways hampering agriculture, fisheries,
processes. recreation and hydropower.
It has a negative impact on decomposition Prosopis juliflora
in the soils by causing stress to the neighbouring Prosopis juliflora is an invasive species native
native species. Some of the alien species which to Mexico and South America. It was first
cause environmental issues are discussed below introduced in
Eichhornia crassipes Gujarat to counter
It is an invasive desertification and
weed native to later on in Andhra
South America. Pradesh, Tamil
It was introduced Nadu as a source
as aquatic of firewood. It
is an aggressive Figure 8.5:
ornamental
Figure 8.4: coloniser and as a Prosopis juliflora
plant, which
grows faster Eichhornia crassipes consequence the
throughout the habitats are rapidly covered by this species. Its
year. Its widespread growth is a major cause invasion reduced the cover of native medicinal
of biodiversity loss worldwide. It affects the herbaceous species. It is used to arrest wind
growth of phytoplanktons and finally changing erosion and stabilize sand dunes on coastal and
the aquatic ecosystem. desert areas. It can absorb hazardous chemicals
It also decreases the oxygen content of the from soil and it is the main source of charcoal.
waterbodies which leads to eutrophication. It 8.6 Conservation
poses a threat to human health because it creates a
India due to its topography, geology and
breeding habitat for disease causing mosquitoes
climate patterns has diverse life forms. Now
(particularly Anopheles) and snails with its
this huge diversity is under threat due to many
free floating dense roots and semi submerged
environmental issues for this conservation
leaves. It also blocks sunlight entering deep and
becomes an important tool by which we can
Bio-diversity Conservation
In-situ Ex-situ
Protected area Sacred plants Seed banks, Pollen Botanical gardens

network home gardens banks, Field gene, Arboreta, Zoological
Cryopreservation parks, Aquaria
Community Government
Protected Protected
Sacred groves
Biosphere Wildlife
Sacred lakes National parks
Reserves Sanctuaries
Terrestial Marine
Figure 8.6: Flow chart on biodiversity conservation

www.tntextbooks.in
Conservation movement In-situ conservation
A community level participation can help It means conservation and management of

in preservation and conservation of our genetic resources in their natural habitats. Here
environment. Our environment is a common the plant or animal species are protected within
treasure for all the living organisms on earth. the existing habitat. Forest trees, medicinal and
Every individual should be aware of this and aromatic plants under threat are conserved
participate actively in the programs meant for by this method. This is carried out by the
the conservation of the local environment. community or by the State conservation which
Indian history has witnessed many people include wildlife, National park and Biosphere
movements for the protection of environment. reserve. The ecologically unique and biodiversity
rich regions are legally protected as wildlife
Chipko Movement sanctuaries, National parks and Biosphere
The tribal women of Himalayas protested reserves. Megamalai, Sathyamangalam wildlife,
against the exploitation of forests in 1972. Later Guindy and Periyar National park, and Western
on it transformed into Chipko Movement by ghats, Nilgiris, Agasthyamalai and Gulf of
Sundarlal Bahuguna in Mandal village of Mannar are the biosphere reserves of Tamil
Chamoli district in 1974. People protested Nadu.
by hugging trees together which were felled
Sacred groves
by a sports goods company. Main features of
Chipko movement were, These are the patches or grove of cultivated trees
which are community protected and are based
• This movement remained non political
on strong religious belief systems which usually
• It was a voluntary movement based on
have a significant religious connotation for
Gandhian thought.
protecting community. Each grove is an abode
• It was concerned with the ecological balance of a deity mostly village God Or Goddesses
of nature like Aiyanar or Amman. 448 grooves were
• Main aim of Chipko movement was to give a documented throughout Tamil Nadu, of which
slogan of five F’s – Food, Fodder, Fuel, Fibre 6 groves (Banagudi shola, Thirukurungudi and
and Fertilizer, to make the communities self Udaiyankudikadu, Sittannnavasal, Puthupet
sufficient in all their basic needs. and Devadanam) were taken up for detailed
Appiko Movement floristic and faunistic studies. These groves
The famous Chipko Andolen of Uttarakhand provide a number of ecosystem services to
in the Himalayas inspired the villagers of Uttar the neighbourhood like protecting watershed,
Karnataka to launch a similar movement to save fodder, medicinal plants and micro climate
their forests. This movement started in Gubbi control.
Gadde a small village near Sirsi in Karnataka Ex-situ conservation
by Panduranga Hegde. This movement started It is a method of conservation where species are
to protest against felling of trees, monoculture, protected outside their natural environment.
forest policy and deforestation. This includes establishment of botanical gardens,
reduce many species getting lost from our native zoological parks, conservation strategies such
land. By employing conservation management as gene, pollen, seed, in-vitro conservation,
strategies like germplasm conservation, in situ, cryo preservation, seedling, tissue culture and
ex-situ, in-vitro methods, the endemic as well DNA banks. These facilities not only provide
as threatened species can be protected housing and care for endangered species, but
163

www.tntextbooks.in
also have educational and recreational values and human intereferences.. Serious efforts need to
for the society be undertaken for their conservation, otherwise
these species may become globally extinct.
8.6.1 Endemic Centres and Endemic
Plants
Endemic species are plants and animals that
exist only in one geographic region. Species can
be endemic to large or small areas of the earth.
Some are endemic to a particular continent, a b
some to a part of a continent and others to a
Figure 8.7: Endemic Plants
single island.
a. Bentinckia condapanna b. Baccaurea courtallensis
Any species found restricted to a specified
geographical area is referred to as ENDEMIC.. 8.7 Carbon Capture and Storage (CCS)
It may be due to various reasons such as
Carbon capture and storage is a technology of
isolation, interspecific interactions, seeds
capturing carbondioxide and injects it deep into
dispersal problems, site specificity and many
the underground rocks to a depth of 1 km or more
other environmental and ecological problems.
and it is an approach to mitigate global warming
There are 3 Megacentres of endemism and 27
by capturing CO2 from large point sources such
microendemic centres in India. Approximately
one third of Indian flora have been identified as as industries and power plants and subsequently
endemic and found restricted and distributed in storing it instead of releasing it into the
three major phytogeographical regions of india, atmosphere. Various safe sites have been selected
that is Indian Himalayas, Peninsular India and for permanent storage in various deep geological
Andaman nicobar islands. Peninsular India, formations, liquid storage in the Ocean and solid
especially Western Ghats has high concentration storage by reduction of CO2 with metal oxide to
of endemic plants. Hardwickia binata and produce stable carbonates. It is also known as
Bentinckia condapanna are good examples for Geological sequestration which involves injecting
endemic plants. A large percentage of Endemic CO2 directly into the underground geological
species are herbs and belong to families such as formations (such as declining oil fields, gas fields
Poaceae. Apiaceae, Asteraceae and Orchidaceae. saline aquifers and unmineable coal have been
suggested as storage sites).
Endemic plants Habit Name of endemic centre
Baccaurea Tree Southern Western Carbon Sequestration
courtallensis Ghats Carbon sequestration is the process of capturing
Agasthiyamalaia Tree Peninsular india
and storing CO2 which reduces the amount of
pauciflora
CO2 in the atmosphere with a goal of reducing
Hardwickia Tree Peninsular and
binata northern India
global climate change.
Bentinckia Tree Western ghats of Tamil Carbon sequestration occurs naturally by plants
condappana Nadu and kerala and in ocean. Terrestrial sequestration is typically
Nepenthes Liana Khasi hills, Meghalaya accomplished through forest and soil conservation
khasiyana practices that enhance the storage carbon.
Table 1: Endemic plants As an example microalgae such as species
Majority of endemic species are threatened of Chlorella, Scenedesmus, Chroococcus and
due to their narrow specific habitat, reduced seed Chlamydomonas are used globally for CO2
production, low dispersal rate, less viable nature sequestration. Trees like Eugenia caryophyllata,

www.tntextbooks.in
Tecoma stans, Cinnamomum verum have farming. (vii) reducing use of Laptops (when
high capacity and noted to sequester carbon. used for 8 hours, it releases nearly 2 kg. of CO2
Macroalgae and marine grasses and mangroves annually) (viii) Line drying clothes. (Example:
are also have ability to mitigate carbon-di-oxide. If you buy imported fruit like kiwi, indirectly
Carbon Foot Print (CFP) it increases CFP. How? The fruit has travelled
a long distance in shipping or airliner thus
Every human activity leaves a mark just like
emitting tons of CO2)
our footprint. This Carbon foot print is the
total amount of green house gases produced by Biochar
human activities such as agriculture, industries, Biochar is another long term method to store
deforestation, waste disposal, buring fossil carbon. To increase plants ability to store more
fuels directly or indirectly. It can be measured carbon, plants are partly burnt such as crop
for an individual, family, organisation like waste, waste woods to become carbon rich
industries, state level or national level. It is slow decomposing substances of material called
usually estimated and expressed in equivalent Biochar. It is a kind of charcoal used as a soil
tons of CO2 per year. The burning of fossil amendment. Biochar is a stable solid, rich in
fuels releases CO2 and other green house gases. carbon and can endure in soil for thousands of
In turn these emissions trap solar energy and years. Like most charcoal, biochar is made from
thus increase the global temperature resulting biomass via pyrolysis. (Heating biomas in low
in ice melting, submerging of low lying areas oxygen environment) which arrests wood from
and inbalance in nature like cyclones, tsunamis complete burning. Biochar thus has the potential
and extreme weather conditions. To reduce to help mitigate climate change via carbon
the carbon foot print we can
follow some practices like
(i) Eating indigenous fruits Lentils Protein good choice EAT SMART
of fibre & nutrient Your food choices affect the climate
and products (ii) Reducing
use of electronic devices (iii) Tomatos Veggies, fruits low in
fat and colorie high in
0 1 2 3 4 5 6 7
Reduce travelling (iv) Avoid nutrient
buying fast and preserved,

processed, packed foods. (v) Beans
Broccoli
Plant a garden (vi) Reducing Yoghurt Organic, high
Nuts
consumption of meat and protein, good fat,
Peanut more nutritions
butter
sea food. Poultry requires Rice
conventional foods
little space, nutrients and less Potatoes
pollution compared cattle

Egg
Fish Organic rich
Carbon Sink Chicken omega
Any system having the
capacity to accumulate Solman
fish, Pork Processed food.
more atmospheric carbon Cheese
during a given time Highest carbon foot print.
Beef
interval than releasing CO2. & Lamb CARBON FOOTPRINT
Example: forest, soil, ocean Processed food. car miles driven per 4oz(118.29 ml). consumed
Different foods have a different impacts.Here’s how the green
are natural sinks. Landfills house gas emissions (GHGs) of twenty common foods compare.
are artificial sinks. Figure 8.8: Carbon foot print
165

www.tntextbooks.in
sequestration. Independently, biochar when Rainwater harvesting is the accumulation and

added to soil can increase soil fertility of acidic storage of rain water for reuse in-site rather than
soils, increase agricultural productivity, and allowing it to run off. Rainwater can be collected
provide protection against some foliar and soil from rivers, roof tops and the water collected
borne diseases. It is a good method of preventing is directed to a deep pit. The water percolates
waste woods and logs from getting decayed and and gets stored in the pit. RWH is a sustainable
instead we can convert them into biochar thus water management practice implemented not
converting them to carbon storage material. only in urban area but also in agricultural fields,
which is an important economical cost effective
8.8 Rain water harvesting – RWH method for the future.
(Solution to water crisis – A
ecological problem) 8.8.1 Environmental benefits of Rain
Rain water canal
Water Harvesting:
• Promotes adequacy of underground water
and water conservation.
• Mitigates the effect of drought.
Drain pipe • Reduces soil erosion as surface run-off is
Sand filter reduced.
• Reduces flood hazards.
Water tank Improves groundwater quality and water
•
Over flow
pipe to
table / decreases salinity.
well
Rainwater harvesting • Avoid land wastage for storage purpose and
Well in individual house no population displacement is involved.
• Stores water underground as an eco-friendly
Figure 8.9: Pictures of Rain Water measure and us a part of sustainable water
Harvesting Structures in Ooraniers
storage strategy for local communities.
Water storage tank
The water is then supplied to 8.8.2 Importance of Lakes
flats, which can be used for
domestic purposes Water bodies like lakes, ponds not only provide
us a number of environmental benefits but
they strengthen our economy as well as our
quality of life like health. Lakes as a storage of
Collection tank rain water provide drinking water, improves
A fitted sensor
then sends
ground water level and preserve the fresh water
the water to bio-diversity and habitat of the area where it
the tank
occurs.
In terms of services lakes offer sustainable
solutions to key issues of water management
Suction tank and climatic influences and benefits like
A filter placed in the
tank clears the Rainwater inlet nutrient retention, influencing local rainfall,
water of impurities The rainwater that collects on removal of pollutants, phosphorous and
the terrace makes its way
down a pipe nitrogen and carbon sequestration.
Figure 8.10: Rain Water Harvesting
Structures in Water Supply sources

www.tntextbooks.in
8.9 Environmental Impact 8.9.1 Biodiversity Impact Assessment

Assessment (EIA) (BIA)
Environmental Impact Assessment is an Biodiversity Impact Assessment can be
environmental management tool. It helps to defined as a decision supporting tool to help
regulate and recommend optimal use of natural biodiversity inclusive of development, planning
resources with minimum impact on ecosystem and implementation. It aims at ensuring
and biotic communities. It is used to predict the development proposals which integrate bio-
environmental consequences of future proposed diversity considerations. They are legally
developmental projects (example: river projects, compliant and include mechanisms for the
dams, highway projects) taking into account conservation of bio-diversity resources and
inter-related socio-economic, cultural and provide fair and equitable sharing of the benefits
human-health impacts. It reduces environmental arising from the use of bio-diversity.
stress thus helping to shape the projects that Bio-diversity impacts can be assessed by
may suit local environment by ensuring optimal • Change in land use and cover
utilization of natural resources and disposal of
• Fragmentation and isolation
wastes to avoid environmental degradation.
• Extraction
The benefits of EIA to society
• External inputs such as emissions, effluents
• A healthier environment
and chemicals
• Maintenance of biodiversity
• Decreased resource usage • Introduction of invasive, alien or genetically
• Reduction in gas emission and modified species
environment damage • Impact on endemic and threatened flora and
fauna.
Biomonitoring
The act of observing and assessing the current 8.10 Geographic Information System
state and ongoing changes in ecosystem, GIS is a computer system for capturing, storing,
biodiversity components, landscape including checking and displaying data related to positions
natural habitats, populations and species. on Earth’s surface. Also to manipulate, analyse,
An agricultural drone is an unmanned aerial manage and present spacial or geographic data.
vehicle applied to farming in order to help
GPS is a satellite navigation system used to
increased crop production and monitor crop
determine the ground position of an object. It is
growth. Agricultural drones let farmers see
a constellation of approximately 30 well spaced
their fields from the sky. This bird’s eye-view
satellites that orbit the earth and make it possible
can reveal many issues such as irrigation
for the people with ground receivers to pinpoint
problems, soil variation and pest and fungal
their geographic location. Some applications in
infestations. It is also used for cost effective safe
which GPS is currently being used for around
method of spraying pesticides and fertilizers,
the world include Mining, Aviation, Surveying
which proves very easy and non-harmful.
Agricultural and Marine ecosystem.
Importance of GIS
• Environmental impact
assessment
• Disaster management
Figure 8.11: Agricultural drone • Zoning of landslide
hazard
167

www.tntextbooks.in
• Determination of land cover and land use Summary

• Estimation of flood damage Green house effect leads to climate change which
• Management of natural resources results in global warming. Deforestation causes
• Soil mapping soil erosion, whereas Afforestation helps to
• Wetland mapping restore vegetation and increases ground water
• Irrigation management and identification of table. Regeneration of trees by Agroforestry is
volcanic hazard possible with the involvement of community
• Vegetation studies and mapping of and government. Help to conserve the flora and
threatened and endemic species. fauna in their natural habitat and man-made
Remote Sensing is the process of detecting and environments like zoological parks and national
monitoring the physical characteristics of an area parks. Mitigation of carbon in the atmosphere
by measuring its reflected and emitted radiation done in the form of sequestration. Rain water
at a distance from the targeted area. It is an tool harvesting is done for improving the ground
used in conservation practices by giving exact water table. Importance and location of lakes in
picture and data on identification of even a single Tamil Nadu which aids water supply to the city
tree to large area of vegetation and wild life for is a measure of conservation of drinking water.
Assessment of Environment and Biodiversity
classification of land use patterns and studies,
helps to study risk analysis and disaster
identification of biodiversity rich or less areas for
management. Forest cover is monitored through
futuristic works on conservation and maintenance
Remote sensing and GIS.
of various species including commercial crop,
medicinal plants and threatened plants. Evaluation
Specific uses 1. Which of the following
• Helps predicting favourable climate, for the would most likely help to
study of spreading of disease and controlling it. slow down the greenhouse
• Mapping of forest fire and species effect.
distribution. a) Converting tropical
• Tracking the patterns of urban area forests into grazing land for cattle.
development and the changes in Farmland b) Ensuring that all excess paper packaging
or forests over several years is buried to ashes.
• Mapping ocean bottom and its resources c) Redesigning landfill dumps to allow
Applications of Satellites methane to be collected.
d) Promoting the use of private rather than
Name of the Year of
Application public transport.
Satellites Launch
SCATSAT – I Sep. 2016 Weather 2. With respect to Eichhornia
forecasting, Statement A: It drains off oxygen from water
cyclone prediction
and is seen growing in standing water.
and tracking
services in India Statement B: It is an indigenous species of
INSAT 3DR Sep. 2016 Disaster our country.
management a) Statement A is correct and Statement B is
CARTOSAT – 2 Jan. 2018 Earth observation wrong.
GSAT – 6A March Communication b) Both Statements A and B are correct.
2018
c) Statement A is correct and Statement B is
CARTOSAT – 2 Jan. 2018 To watch border
(100th Satellite) surveillance
wrong.
d) Both statements A and B are wrong.

www.tntextbooks.in
3. Find the wrongly matched pair. 9. The unit for measuring ozone thickness
a) Endemism - Species confined to a a) Joule b) Kilos
region and not found c) Dobson d) Watt
anywhere else. 10.
People’s movement for the protection of
b) Hotspots - Western ghats environment in Sirsi of Karnataka is
c) Ex-situ a) Chipko movement
Conservation - Zoological parks b) Amirtha Devi Bishwas movement
d) Sacred groves - Saintri hills of Rajasthan c) Appiko movement
e) Alien sp. d) None of the above
Of India - Water hyacinth 11. The plants which are grown in silivpasture
4. Depletion of which gas in the atmosphere system are
can lead to an increased incidence of skin a) Sesbania and Acacia
cancer? b) Solenum and Crotalaria
c) Clitoria and Begonia
a) Ammonia b) Methane
d) Teak and sandal
c) Nitrous oxide d) Ozone
12. What is ozone hole?
5. One green house gas contributes 14% of total
13. Give four examples of plants cultivated in
global warming and another contributes 6%.
commercial agroforestry.
These are respectively identified as
a) N20 and CO2 b) CFCs and N20 14. Expand CCS.
c) CH4 and CO2 d) CH4 and CFCS 15.
How do forests help in maintaining the
6. One of the chief reasons among the following climate?
for the depletion in the number of species 16.
How do sacred groves help in the
making endangered is conservation of biodiversity?
a) over hunting and poaching
17. Which one gas is most abundant out of the
b) green house effect
four commonest greenhouse gases? Discuss
c) competition and predation
the effect of this gas on the growth of plants?
d) habitat destruction
18. Suggest a solution to water crisis and explain
7. Deforestation means
its advantages.
a) growing plants and trees in an area where
there is no forest 19. Explain afforestation with case studies.
b) growing plants and trees in an area where 20. What are the effects of deforestation and
the forest is removed benefits of agroforesty?
c) growing plants and trees in a pond
d) removal of plants and trees Glossary
8. Deforestation does not lead to Algae Blooms: Sudden sprout of algae growth,
a) Quick nutrient cycling which can affect the water quality adversely and
b) soil erosion indicate potentially hazardous changes in local
c) alternation of local weather conditions water chemistry.
d) Destruction of natural habitat weather Atmosphere: A major regional community of
conditions plants and animals with similar life forms and
environmental conditions.
169

www.tntextbooks.in
Biodegradable waste: Organic waste, typically Radioactive: A materials is said to be radioactive

coming from a plant or animal sources, which if it emits radiation.
other living organisms can break done.
Recycle:To break waste items done into their
Biosphere: The portion of earth and its raw materials, which are then used to remake
atmosphere that can support life. the original item or to make new items.
Oil spill: The harmful release of oil into the Sustainable development: Development using
environment, usually through water, which is hand of energy sources in a way that meets the
very difficult to clean up and often kills, birds, needs of people today without reducing the
fish and other wildlife. ability in future generation to meet their own
needs.
Radiation: A form of energy that is transmitted
in waves, rays or particles from a natural source
such as the sun and the ground or an artificial
source such as an X-ray machine.
ICT Corner
Let us know about the Environmental

issues using the EARTH NOW app
through this activity.
Steps
• Type the URL or scan the QR code to open the activity page.
• Click on the satellite it displays the shape and activities of the satellite.
• Click on the Vital Signs to see the global Climate data including surface air
temperature, Carbondioxide, Ozone, etc.,
URL:
https://play.google.com/store/apps/details?id=gov.nasa.jpl.earthnow.activity

www.tntextbooks.in
Unit X: Economic Botany

Chapter
9 Plant Breeding
Economic botany is the study of the

Learning Objectives relationship between people and economically
important plants. It explores the ways by
The learner will be able to which humans use plants for food, medicines
and other uses. Economic botany intersects

Appreciate the relationship between many fields including established disciplines
humans and plants. such as agronomy, anthropology, archaeology,

Recognise the origin of agriculture. chemistry, trade and commerce.

Perceive the importance of organic 9.1 R
elationship between humans
agriculture. and plants
From the very early times, human beings have

Understand the different conventional
co-existed with plants which played a vital
methods of plant breeding.
role in their survival. Through a long process
of trial and error, our ancestors have selected
hundreds of wild plants from the various
Chapter outline parts of the world for their specific use. The
knowledge of the plants and its applications
have led to the development of the humans and
9.1 Relationship their civilization in many ways.
between human
and plants 9.2 Domestication of plants
Domestication is the process of bringing a
9.2 Domestication of plant species under the control of humans and
plants gradually changing it through careful selection,
genetic alteration and handling so that it is more
9.3 Origin of agriculture
useful to people. The domesticated species are
9.4 History of agriculture renewable sources that have provided food and
other benefits to human.
9.5 Organic agriculture The possible changes in the plant species due
to domestication are listed below;
9.6 Plant breeding • Adaptation to a greater diversity of
environments and a wider
9.7 Conventional plant breeding
geographical range.
methods
• Simultaneous /uniform flowering
9.8 Modern plant breeding Techniques and fruiting.
• Lack of shattering or scattering of seeds.
Plant Breeding 171

www.tntextbooks.in
• Increased size of fruits and seeds.

• Change from a perennial to annual habit.
Indian Plant Breeders
• Change in breeding system.
a. Dr. M. S. Swaminathan – He is a
• Increased yield. pioneer mutation breeder.
• Increased resistance for disease and pest. b. Sir. T.S. Venkataraman – An eminent
• Developing seedless parthenocarpic sugarcane breeder.
fruit. c. Dr. B.P. Pal – Famous wheat breeder,
• Enhancing colour, appearance, developed superior disease resistant
palatability and nutritional composition. varieties of wheat.
d. Dr. K. Ramiah – Eminent rice breeder,
9.3 Origin of Agriculture
developed several high yielding
Archeological evidence for earliest record
varieties of rice.
of agriculture is found in the fertile crescent
e. N.G.P. Rao – An eminent sorghum
region in and around Tigris and Euphrates river
breeder, developed world’s first hybrid
valleys, approximately about 12,000 years ago.
of Sorghum (CSH-1).
The earlier Greek and Roman naturalists
f. C.T. Patel – Who developed world’s
like Theophrastus, Dioscorides, Pliny the elder
first cotton hybrid.
and Galen laid down the scientific foundation
g. Choudhary Ram Dhan – Wheat
in understanding origin and domestication of
breeder, who is famous for C-591
cultivated plants.
variety of wheat, which made Punjab
9.4 Organic Agriculture the wheat granary of India.
Organic farming is an alternative agricultural
system which originated early in the twentieth efficient and cost effective than chemical
century in reaction to rapidly changing farming fertilizers.
practices. It is a production system that sustains S.N Groups Examples
the health of the soils, ecosystems and people. It A N2 fixing Biofertilize
relies on ecological processes, biodiversity and
1. Free-living Azotobacter, Clostridium,
cycles adapted to local conditions rather than Anabaena, Nostoc,
the use of inputs with adverse effects. Symbiotic Rhizobium, Anabaena azollae
9.5.1. Biofertilizers
3. Associative Symbiotic Azospirillum
Biofertilizers are defined as preparations
P Solubilizing Biofertilizer
containing living cells or latent cells of B
efficient strains of microorganisms that 1. Bacteria Bacillus subtilis,

Pseudomonas striata
help crop plants uptake of nutrients by
their interactions in the rhizosphere when 2. Fungi Penicillium, Aspergillus.
applied through seed or soil. Biofertilizers C P Mobilizing Biofertilizers
could be also called as microbial cultures,
1. Arbuscular Mycorrhiza Glomus, Scutellospora.
bioinoculants, bacterial inoculants or
2. Ectomycorrhiza Amanita.
bacterial fertilizers.
They are efficient in fixing nitrogen, D Biofertilizer for Micro nutrients
solubilising phosphate and decomposing 1. Silicate and Bacillus.

Zinc solubilizers
cellulose. They are designed to improve
the soil fertility, plant growth, and also the E Plant Growth Promoting Rhizobacteria
number and biological activity of beneficial 2. Pseudomonas Pseudomonas fluorescence

microorganisms in the soil. They are eco-
friendly organic agro inputs and are more Figure 9.3: Classification of Biofertilizers
172 Plant Breeding

www.tntextbooks.in
Rhizobium phycomycetous fungi and angiosperm roots.

Bio-fertilisers containing rhizobium bacteria They have the ability to dissolve the phosphates
are called rhizobium bio-fertilizer culture. found in abundance in the soil.
Symbiotic bacteria that reside inside the root No colonization AM-colonization
nodules convert the atmospheric nitrogen
into a bio available form to the plants. This Increased
resistance
nitrogen fixing bacterium when applied to the to foliar
pathogens
soil undergoes multiplication and fixes the
atmospheric nitrogen in the soil. Rhizobium is
best suited for the paddy fields which increase Increased
drought
the yield by 15 – 40%. and salt
(b) (a) tolerance
Nutrient transfer
via AMF
PO43-
Nutrient transfer PO43-

Zn2+
via root hairs
H2O Local
2+
resistance
Zn NH4+ H2 O NH4+
to root
pathogens
PO43- Phosphate Increased resistance
depletion zone to heavy metal toxicity
Figure 9.4 (a) : Root nodules occur on root
(b) C.S. of Root nodule Figure 9.6 Benefits of AM colonisation
Azolla Apart from increasing the availability of
Azolla is a free-floating water fern that fixes phosphorus, AM provides necessary strength to
the atmospheric nitrogen in association with resist disease, germs and unfavourable weather
nitrogen fixing blue green alga Anabaena azolla. conditions. It also assures water availability.
It is used as a bio-fertilizer for wetland rice Seaweed Liquid Fertilizer
cultivation and is known to contribute 40 – 60 Seaweed liquid fertilizer (SLF) contains
kg/ha/crop. The agronomic potential of Azolla cytokinin, gibberellins and auxin apart from
is quite significant particularly for increasing the
macro and micro nutrients. Most seaweed based
yield of rice crop, as it quickly decompose in soil.
fertilizers are made from kelp(brown algae)
(a) which grows to length of 150 metres. seaweed
Liquid fertilizer is
not only organic
but also eco-
(b) friendly. The
alginates in the
seaweed that
Figure 9.5: (a) Azolla in paddy field react with metals
Figure 9.7 : Seaweed – Kelp
in the soil and
(b) Azolla
form long, cross-linked polymers in the soil.
Arbuscular mycorrhizae These polymers improve the crumbing in the
Arbuscular mycorrhizae (AM) is formed by soil, swell up when they get wet and retain
the symbiotic association between certain moisture for a long time. They are especially
Plant Breeding 173

www.tntextbooks.in
useful in organic gardening which provides

carbohydrates for plants. Seaweed has more
than 70 minerals, vitamins and enzymes. It
promotes vigorous growth. Improves resistance
of plants to frost and disease. Seeds soaked in
(a) (b)
seaweed extract germinate much rapidly and
develop a better root system.
Bio-Pesticides
Bio-pesticides are biological agents used for the
control of plant pests. They are in high use due
to their non-toxic, cheaper and eco-friendly
(c)
characteristics as compared to chemical or
Figure 9.9 : (a) Beauveria Fungi
synthetic pesticides. Bio-pesticides have become (b) Beauveria sps infected insect on green plant
an integral component of pest management in (c)Entomopathogenic fungi on insets
terms of the environmental and health issues
main objectives of the green manuring is to
attributed to the use of chemicals in agriculture.
increase the content of nitrogen in the soil. Also
Trichoderma species are free-living fungi it helps in improving the structure and physical
that are common in soil and root ecosystem. properties of the soil. The most important green
They have been recognized as bio-control agent manure crops are Crotalaria juncea, Tephrosia
for (1) the control of plant disease (2) ability purpurea, Indigofera tinctoria
to enhance root growth development (3) crop The green manuring can be practised
productivity (4) resistance to abiotic stress and as Green in-situ manuring or Green leaf
(5) uptake and use of nutrients. manuring. Green in-situ manuring refers to
the growing of green manuring crops in the
TRICHODERMA VIRIDE
A Potential bio-control agent for border rows or as intercrops along with the
soil borne diseases
main crops. Example: Sun hemp, Cowpea,
Green gram etc. whereas green leaf manuring
is the application of green leaves and twigs of
trees, shrubs, plants growing in wastelands
and field bunds. The important plant species
useful for green leaf manure are Cassia fistula,
Figure 9.8: Figure 9.8: Sesbania grandiflora, Azadirachta indica,
(a) Trichoderma fungi (b) Biopesticide Delonix regia, Pongamia pinnata etc.,
Beauveria species is an entomo-pathogenic
fungus that grows naturally in soils throughout 9.6 P
lant Breeding
the world. It acts as a parasite on various Plant breeding is the science of improvement
arthropod species causing white muscardine of crop varieties with higher yield, better
disease without affecting the plant health and quality, resistance to diseases and shorter
growth. It also controls damping off of tomato durations which are suitable to particular
caused by Rhizoctonia solani. environment. In other words, it is a purposeful
manipulation of plant species in order to
Green Manuring create desired genotype and phenotype for
Green manuring is defined as the growing the benefit of humans. In early days, plant
of green manure crops and use of these crops breeding activities were based mainly on
directly in the field by ploughing. One of the skills and ability of person involved. But as
174 Plant Breeding

www.tntextbooks.in
the principles of genetics and cytogenetics 9.7.1. Plant Introduction

have elucidated breeding methods such as Plant introduction may be defined as the
selection, introduction, hybridization, ploidy, introduction of genotypes from a place where it is
mutation, tissue culture and biotechnology normally grown to a new place or environment.
techniques were designed to develop improved Rice variety of IR8 introduced from Philippines
crop varieties. and Wheat varieties of Sonora 63, Sonora 64
from Mexico.
9.6.1. Objectives of Plant Breeding
• o increase yield, vigour and fertility of
T The newly introduced plant has to adapt
the crop itself to the new environment. This adjustment
or adaptation of the introduced plant in the
• To increase tolerance to environmental
changed environment is called acclimatization.
condition, salinity, temperature
All the introductions must be free from presence
and drought.
of weeds, insects and disease causing organisms.
• To prevent the premature falling of buds, This has to be carefully examined by the process
fruits etc. called quarantine, a strict isolation imposed to
• To improve synchronous maturity. prevent the spread of disease.
• To develop resistance to Introduction may be classified as Primary
pathogens and pests. introduction and Secondary introduction
• To develop (1) Primary introduction - When the
photosensitive and introduced variety is well adapted to the new
thermos-sensitive environment without any alternation to the
varieties. original genotype.
9.6.2. Steps in Plant Breeding (2) Secondary introduction - When the
The main steps in plant breeding are given below introduced variety is subjected to selection to
isolate a superior variety and hybridized with a
Creation of
Domestication Genetic Mutation local variety to transfer one or a few characters
Plant Variation to them. The botanical gardens in different
introduction Polyploidy parts of the world also played a significant role
Selection
Tissue in plant introduction. Example : Tea varieties
Hybridization Evaluation and culture collected from China and North East India
Release as a initially grown in Botanical Garden of Kolkata
Germplasm variety Genetic
collection from which appropriate clones have selected
Engineering
Seed multiplication and introduced to different parts of India.
and distribution
Figure 9.11 : Steps in Plant Breeding National Bureau of plant
Genetic Resources (NBPGR)
9.7 C
onventional Plant Breeding
The Bureau is responsible
Methods for introduction and maintenance of
Conventional plant breeding methods resulting germ plasm of various agricultural and
in hybrid varieties had a tremendous impact on horticultural station in our country. It is
agricultural productivity over the last decades. also responsible for maintenance of plant
It develops new plant varieties by the process materials of botanical and medicinal
of selection and seeks to achieve expression of interest. It is located at Rangpuri, New Delhi
genetic material which is already present within and has four regional plant quarantine
the species. In this chapter we will discuss stations at Amristsar, Kolkata, Mumbai
about some of the conventional methods of and Chennai at Meenambakkam
plant breeding.
Plant Breeding 175

www.tntextbooks.in
9.7.2. Selection of plants obtained as a result of repeated

Selection is the choice of certain individuals self-pollination from a single homozygous
from a mixed population for a one or more individual. Hence, a variety formed by this
desirable traits. Selection is the oldest and method shows more homozygosity with
basic method of plant breeding. There are two respect to all genes. The disadvantage of
main types of Selection. this type is that the new genotypes are never
created and they are less adaptable and less
i. Natural Selection: This is a rule in nature
stable to the environmental fluctuations.
and results in evolution reflected in the
Darwinian principle “survival of the fittest”. c. Clonal Selection: In asexually propagated
It takes longer time in bringing about crop, progenies derived from a plant
desired variation. resemble in genetic constitution with the
parent plant as they are mitotically divided.
ii. Artificial Selection: It is a human involved
Based on their phenotypic appearance,
process in having better crop from a mixed
clonal selection is employed to select
population where the individuals differ in
improved variety from a mixed population
character. The following are the three main
(clones). The selected plants are multiplied
types of artificial selection.
through vegetative propagation to give rise
a. Mass Selection: In mass selection a large to a clone. The genotype of a clone remains
number of plants of similar phenotype or unchanged for a long period of time.
morphological characters are selected and
their seeds are mixed together to constitute 1st Few to several hundred
a new variety. The population obtained Year superior plants selected.
from the selected plants would be more Mixture of clones
uniform than the original population and

(i) Clones from the selected
are not individually tested. After repeated 2nd plants grown seprately.
Clones from
selection for about five to six years, selected Year
Selected plants
(ii) Desirable clones selected.
seeds are multiplied and distributed to
the farmers. The only disadvantage of
(i) Preliminary yield trail
mass selection is that it is difficult to with standard checks.
distinguish the hereditary variation from 3rd (ii) Selection for quality,
environmental variation. Year
Preliminary
disease resistance etc,
(iii) Few outstanding clones
Yield trail
selected.
Mass Selection vs. Pure LineSelection
Line mixture (i) Multilocation yield trails

4th-6th with standard checks.
Mass Selection Pure Line Selection
Year (ii) Best clone identified for
Multilocation release as a new variety
Yield trail
Bulk of phenotypically Single plant offspring

(i) Multilocation yield trails
similar plants
5 th with standard checks.
L1 L2 L3........ LN
Year (ii) Best clone identified for
Seed release as a new variety
Cultivar register and Register and market multiplication
marketing the best pure lines
Heterogenous cultivars Homogenous cultivars Figure 9.13 Clonal Selection

9.7.3. Hybridization
Figure 9.12 : Mass selection vs Pureline selection
Hybridization is the method of producing new
b. Pureline selection: Johannsen in 1903 crop varieties in which two or more plants of
coined the word pureline. It is a collection unlike genetically constitution is all crossed
176 Plant Breeding

www.tntextbooks.in
together that result in a progeny called hybrid. ii. Intervarietal hybridization - The cross
Hybridization offers improvement in crop and is between the plants belonging to two
the only effective means of combining together different varieties of the same species and is
the desirable characters of two or more varieties also known as intraspecific hybridization.
or species. The first natural hybridization was This technique has been the basis of
observed by Cotton Mather in maize. improving self-pollinated as well as cross
pollinated crops
Steps in Hybridization
iii. Interspecific hybridization - The cross
Steps involved in hybridization are as follows. between the plants belonging to different
1. Selection of Parents: Male and female plants species belonging to the same genus is
of the desired characters are selected. Both also called intragenic hybridization. It
should be tested for their homozygosity. is commonly used for transferring the
2. Emasculation: It is a process of removal of genes of disease, insect, pest and drought
anthers to prevent self pollination before resistance from one species to another.
dehiscence of anther. Example: Gossypium hirsutum x
3. Bagging: The stigma of the flower is Gossypium arboreum – Deviraj.
protected against any undesirable pollen (a) (b)
grains, by covering it with a bag .
Figure 9.15 Flower -

(a) G. hirsutum (b) G. arboreum
iv. Intergeneric hybridization – The crosses
are made between the plants belonging to
two different genera. The disadvantages
are hybrid sterility, time consuming
and expensive procedure. Example:
Raphanobrassica, Triticale. (Refer chapter 4
for detailed illustration)
Figure 9.14 a & b: Emasculation
and Bagging (Wheat) 9.7.4. Heterosis
Heterosis (hetero- different; sis - condition)
4. Crossing: Transfer of pollen grains from
G.H. Shull was the first scientist to use the
selected male flower to the stigma of the
term heterosis in 1912. The superiority of
female emasculated flower.
the F1 hybrid in performance over its parents
5. Harvesting seeds and raising plants: The is called heterosis or hybrid vigour. Vigour
pollination leads to fertilization and finally refers to increase in growth, yield, greater
seed formation takes place. The seeds are adaptability of resistance to diseases, pest
grown into new generation which are called and drought. Vegetative propagation is the
hybrids. best suited measure for maintaining hybrid
Types of Hybridization vigour, since the desired characters are not
According to the relationship between lost and can persist over a period of time.
plants, the hybridization is divided into. Many breeders believe that the magnitude of
heterosis is directly related to the degree of
i. Intravarietal hybridization - The cross
genetic diversity between the two parents.
between the plants of same variety. Such
Depending on the nature, origin, adaptability
crosses are useful only in self-pollinated crops.
Plant Breeding 177

www.tntextbooks.in
and reproducing ability heterosis can be

classified as: Gamma Garden or Atomic
Garden: Is a form of mutation
i. Euheterosis- This is the true heterosis which
breeding where plants are
is inherited and is further classified as:
exposed to radioactive sources
a. Mutational Euheterosis - Simplest
typically cobalt-60 or caesium-137 in order to
type of euheterosis and results from the
generate desirable mutation in crop plants. The first
sheltering or eliminating of the deleterious,
Gamma garden in India is Bose Research Institute
unfavourable often lethal, recessive,
at Calcutta in 1959 and the second is IARI in 1960
mutant genes by their adaptively superior
which produced large variation in short type.
dominant alleles in cross pollinated crops.
b. Balanced Euheterosis – Well balanced
exhibits increased hybrid vigour, increased
gene combination which is more adaptive to
heterozygosity, increase tolerance to both biotic
environmental conditions and agricultural
and abiotic stresses, buffering of deleterious
usefulness.
mutations. In addition, polyploidy often results
ii.
Pseudoheterosis – Also termed as
in reduced fertility due to meiotic error allowing
luxuriance. Progeny possess superiority
the production of seedless varieties.
over parents in vegetative growth but not
in yield and adaptation, usually sterile or When chromosome number is doubled by
poorly fertile. itself in the same plant, is called autopolyploidy.
Example: A triploid condition in sugarbeets,
9.7.5. Mutation Breeding apples and pear has resulted in the increase
Muller and Stadler (1927- 1928) coined the in vigour and fruit size, large root size, large
term mutation breeding. It represents a new leaves, flower, more seeds and sugar content
method of conventional breeding procedures in them. It also resulted in seedless tomato,
as they have the advantage of improving the apple, watermelon and orange. Polyploidy can
defect without losing agronomic and quality be induced by the use of colchicine to double
character in agriculture and crop improvement. the chromosome number. Allopolyploids are
Mutation means the sudden heritable produced by multiplication of chromosome
changes in the genotype or phenotype of an sets that are initially derived from two different
organism. Gene mutations are of considerable species. Example: Triticale (Triticum durum
importance in plant breeding as they provide x secale cereale) Raphanobrassica (Brassica
essential inputs for evolution as well as for oleraceae x Raphanus sativus).
re-combination and selection. It is the only
method for improving seedless crops. 9.7.7. Green Revolution
Radiation such as UV short wave, X-ray, Green revolution the term was coined by William
Alpha (α), Beta (β), Gamma waves and many S.Gaud in (1968). It is defined as the cumulative
chemicals such as cesium, EMS (ethyl methane result of a series of research, development,
sulfonate), nitromethylurea induce mutation innovation and technology transfer initiatives.
to develop new varieties of crops. Example: Agricultural production (especially wheat and
Triple gene dwarf wheat with increase in rice) manifolds worldwide particularly in the
yield and height. Atomita 2 - rice with salinity developing countries between the 1940’s and
tolerance and pest resistance. the late 1960’s.
9.7.6. Polyploid Breeding The Green revolution or third Agricultural
Majority of flowering plants are diploid (2n). Revolution is the intensive plan of 1960’s to
The plants which possess more than two sets of increase crop yield in developing countries
chromosome are called polyploids. Polyploidy by introducing the high yielding, resistant
is a major force in the evolution of both varieties, increased irrigation facilities, fertilizer
wild and cultivated plants. Polyploidy often application and better agricultural management.
178 Plant Breeding

www.tntextbooks.in
In 1963 semi-dwarf wheat of Mexico

was introduced from which India got five Norman E. Borlaug: The plant pathologist
prolonged strategies for breeding a wide range plant breeder devoted his life at the International
of high varieties like Sonora 64, Sonalika and Maize and Wheat improvement centre at
Kalyansona possessing a broad spectrum of Sonord in Mexico. He developed a new high
resistance to major biotic and abiotic condition. yielding, rust resistant, non-lodging dwarf
Same as wheat M.S.Swaminathan produced the wheat varieties like Norin-10, Sonora-64, Lerma
first semi-dwarf fertiliser responsive hybrid rojo-64, etc. which are now being cultivated in
variety of rice TNI (Taichung Native-1) in 1956 many countries. This formed
from Taiwan. The derivatives were introduced in the base for ‘green revolution’.
1966. Later better yielding semi dwarf varieties He was awarded a Nobel prize
of rice Jaya and Ratna developed in India. for Peace in 1970.
Dr. M. S. Swaminathan: He
NORIN 10 – The cultivars is a pioneer mutation breeder.
found that Norin 10 He has produced Sharbati Sonora, is the amber
dwarfing genes have high
grain coloured variety of wheat by mutation,
photosynthetic rate per unit
which is responsible for green revolution in India.
leaf area and increase respiratory activity.
Dr. Swaminathan is called
Gonjiro Inazuka selected the semi-dwarf
“Father of green revolution
wheat variety that became Norin 10. He
in India”.
would have never thought that the semi
dwarf genes would not only revolutionize Nel Jayaraman: Mr.
the world of wheat but also helped to save Jayaraman, hails from
more than one billion lives from hunger Adirangam village in Tiruvarur district. He
and starvation. was a disciple of Dr.Nammalvar and state co-
ordinator of ‘Save our rice campaign, Tamil
Plant Breeding for Developing Nadu. He strived hard for conservation of
Resistance to diseases traditional rice varieties. He had trained a team
Some crop varieties bred by hybridization of farmers and regularly update them on the
and selection, for disease resistance to fungi, current issues that affect them.
bacteria and viral diseases are released (Table 9.1). In 2005, he organized a first ever
Crop Variety
Resistance to traditional paddy seed
diseases festival in his farm as an
Wheat Himgiri Leaf and Stripe individual. The seed festival
rust, hill bunt in May 2016 at Adhirangam
was 10th in a row and
Brassica Pusa swarnim White rust
in which 156 different
(Kara rai)
traditional varieties were distributed to more
Cauliflower Pusa Shubhra, Black rot and
than 7000 farmers across Tamil Nadu. He was
Pusa snowball curl blight
invited by the Philippines Government to
K-1 black rot
give a talk at the International Rice Research
Cowpea Pusa Komal Bacterial blight Institute (IRRI) on his work and mission. In
Chilli Pusa Chilly mosaic 2011, he received the State Award for best
Sadabahar virus, Tobacco organic farmer for his contribution to organic
mosaic virus farming, and in the year 2015, he received the
and Leaf curl. National Award for best Genome Savior.
Table 9.1: Disease resistance varieties
Plant Breeding 179

www.tntextbooks.in
Resistance to yellow mosaic virus in bhindi traits in plant breeding. These techniques often
(Abelmoschus escullentus) was transferred from involve genome editing, to modify DNA at
a wild species and resulted in a new variety of specific locations within the plants to produce
A. Escullentus called Parbharni kranti. new traits in crop plants. The various methods
Plant Breeding for Developing of achieving these changes in traits include the
Resistance to Insect Pests following.
Insect resistance in • Cutting and modifying the genome
host crop plants may be during the repair process by tools like CRISPR
due to morphological, /Cas.
biochemical or physiological • Genome editing to introduce changes in
characteristics. Hairy leaves few base pairs using a technique called
in several plants are associated Oligonucleotide-directed mutagenesis
with resistance to insect pests. (ODM).
Example: resistance to jassids in cotton and • Transferring a gene from an identical or
cereal leaf beetle in wheat. In wheat, solid stems closely related species (cisgenesis)
lead to non-preference by the stem sawfly and • Organising processes that alter gene
smooth leaves and nectar-less cotton varieties activity without altering the DNA itself
do not attract bollworms. High aspartic acid, (epigenetic methods).
low nitrogen and sugar content in maize leads Summary
to resistance to maize stem borers.
Economic Botany deals with the
Crop Variety Insect pests relationship between people and economically
Brassica Pusa Gaurav Aphids important plants to fulfill the three basic
(rapeseed needs of life such as food, clothing and
mustard) shelter. Domestication, a term often used for
Flat been Pusa Sem 2 Jassids, aphids a more intricate process, involves the genetic
Pusa Sem 3 and fruit alteration of plants which did not appear at
borer once, but rather over a substantial period of
Okra Pusa Sawani Shoot and time, perhaps hundreds of years for some
(Bhindi) Pusa A-4 Fruit borer species. In the history of agriculture Vavilov
has given the eight main centres of origin of
Table 9.2 Pest resistance varieties plants were now divided into 12 centres of
9.8 M
odern Plant Breeding origin. In Organic agriculture biofertilizers
In the milestones of plant breeding methods are microbial inoculants which all ecofriendly,
Genetic Engineering, Plant tissue culture, more effective even though cost effective than
Protoplasmic fusion or somatic hybridisation, chemical fertilizers. Rhizobium, Azolla, VAM
Molecular marking and DNA finger printing are and sea weeds are used as fertilizers which
some of the modern plant breeding tools used increase the crop yield many fold.
to improve the crop varieties. We have already Plant breeding is a purposeful manipulation
discussed about the various techniques and of plant species in order to create desirable
application of the above mentioned concepts in genotype and phenotype for the benefit of
Unit VIII. mankind. Plant introduction, selection,
New Plant Engineering Techniques / New hybridization, heterosis, mutation breeding,
Breeding Techniques (NBT) polyploidy breeding and green revolution are
the different methods of conventional breeding.
NBT are a collection of methods that could
increase and accelerate the development of new
180 Plant Breeding

www.tntextbooks.in
Evaluation a) clone b) haploid

c) autopolyploid d) genome
1. Assertion: Genetic
variation provides the 8. Importing better varieties and plants from
raw material for selection outside and acclimatising them to local
environment is called
Reason: Genetic
a) cloning b) heterosis
variations are differences
c) selection d) introduction
in genotypes of the individuals.
a) Assertion is right and reason is wrong. 9. Dwarfing gene of wheat is
b) Assertion is wrong and reason is right. a) pal 1 b) Atomita 1
c) Both reason and assertion is right. c) Norin 10 d) pelita 2
d) Both reason and assertion is wrong. 10. Crosses between the plants of the same
2. While studying the history of variety are called
domestication of various cultivated plants a) interspecific b) inter varietal
_______ were recognized earlier c) intra varietal d) inter generic
a) Centres of origin
11. Progeny obtained as a result of repeat self
b) Centres of domestication
pollination a cross pollinated crop to called
c) Centres of hybrid
a) pure line b) pedigree line
d) Centres of variation
c) inbreed line d) heterosis
3. Pick out the odd pair.
12. Jaya and Ratna are the semi dwarf varieties of
a) Mass selection - Morphological
a) wheat b) rice
characters
c) cowpea d) mustard
b) Purline selection - Repeated self
pollination 13. Which one of the following are the species that
c) Clonal selection - Sexually propagated are crossed to give sugarcane varieties with
d) Natural selection - Involves nature high sugar, high yield, thick stems and ability
to grow in the sugarcane belt of North India?
4. Match Column I with Column II
a) Saccharum robustum and Saccharum officinarum
Column I Column II
i) William S. Gaud I) Heterosis b) Saccharum barberi and Saccharum officinarum
ii) Shull II) Mutation breeding c) Saccharum sinense and Saccharum officinarum
iii) Cotton Mather III) Green revolution d) Saccharum barberi and Saccharum robustum
iv) Muller and Stadler IV) Natural 14. Match column I (crop) with column II
hybridization (Corresponding disease resistant variety)
a) i – I, ii – II, iii – III, iv – IV and select the correct option from the
b) i – III, ii – I, iii – IV, iv – II given codes.
c) i – IV, ii – II, iii – I, iv – IV Column I Column II
d) i – II, ii – IV, iii – III, iv – I I) Cowpea i) Himgiri
5. The quickest method of plant breeding is II) Wheat ii) Pusa komal
a) Introduction b) Selection III) Chilli iii) Pusa Sadabahar
c) Hybridization d) Mutation breeding IV) Brassica iv) Pusa Swarnim
6. Desired improved variety of economically I II III IV
useful crops are raised by a) iv iii ii i
a) Natural Selection b) hybridization b) ii i iii iv
c) mutation d) biofertilisers c) ii iv i iii
d) i iii iv ii
7. Plants having similar genotypes produced
by plant breeding are called
Plant Breeding 181

www.tntextbooks.in
15. A wheat variety, Atlas 66 which has been 20. How are microbial innoculants used to
used as a donor for improving cultivated increase the soil fertility?
wheat, which is rich in 21. What are the different types of
a) iron b) carbohydrates hybridization?
c) proteins d) vitamins 22. Explain the best suited type followed by
16. Which one of the following crop varieties plant breeders at present?
correct matches with its resistance to a disease? 23. Write a note on heterosis.
Variety Resistance to disease 24. List out the new breeding techniques involved
a) Pusa Komal Bacterial blight in developing new traits in plant breeding.
b) Pusa Sadabahar White rust Glossary
c) Pusa Shubhra Chilli mosaic virus
d) Brassica Pusa swarnim
Acclimatization : The adaptation of an individual
to a changed climate or the adjustment of a
17. Which of the following is incorrectly paired? species or a population to a changed environment
a) Wheat - Himgiri over a number of generations.
b) Milch breed - Sahiwal
Agronomy : Science of farming
c) Rice - Ratna
d) Pusa Komal - Brassica Germplasm Collection : The entire collection
18. Match list I with list II (of plants / seeds) having all the diverse
alleles for all genes in a given crop is called
List I List II germplasm collection.
Biofertilizer Organisms
i) Free living N2 a) Aspergillus Non recurrent parent : The parent of a hybrid
ii) Symbiotic N2 b) Amanita that is not again used as a parent in backcrossing
iii) P Solubilizing c) Anabaena azollae
Quarantine : Strict isolation imposed to prevent
iv) P Mobilizing d) Azotobactor
the spread of disease
a. ic, iia, iiib, ivd b. id, iic, iiia, ivb.
c. ia, iic, iiib, ivd c. ib, iia, iiid, ivc. Strain : A group of similar individuals from a
19. Differentiate primary introduction from common origin.
secondary introduction.
APPENDIX
Vavilov’s Centre of Crop Origin Crops domesticated

1 China Foxtail millet, soybean, bamboo, onion, crucifers.
2 India Rice, sugarcane, mango, orange, eggplant, sesame.
2a South East Asia Rice, banana, coconut, clove , hemp.
3 Central East Wheat, pea, hemp, cotton etc.
4 The Near East Wheat, rye, many subtropical and tropical fruits.
5 Mediterranean Olive, vegetables, oil yielding plants, wheats
6 Ethiopia (Abyssinian) Wheat, barley, sesame, castor, coffee.
7 Mesoamerica (South Mexican & Central Maize, bean,
American Centre) sweet potato, papaya, guava, tobacco.
8 South America Tomato, pine-apple
8a The Chiloe Centre Potato
8b The Brazilian –Paraguayan Centre Groundnut, cashew nut, pine apple, peppers, rubber.
182 Plant Breeding

www.tntextbooks.in
MILESTONES IN PLANT BREEDING

Plant breeding based on Hybrid breeding
Cross breeding Crossing two genetically GMO
Development of improved varieties different individuals to develop Introducing foreign genes Targeted
by combining good characteristics better performing hybrid into the DNA of a plant Breeding
f
from ttwo parents
t
Crop Understanding Using modern tools such
Domestication the structure of DNA Insect - resistant as genome editing for more
Farmers select the More vigorous James watson and Francis Crick cotton targeted breeding
best wild species to hybrid corn identify the double helix of DNA
create crops
Waxy corn
10,000 BC 1865 1926 1940 1953 1994 2000 now future
Domestication Barely resistants

Blast-resistant
of wheat to yellow dwarf virus
rice
Plant breeding Based on Marker-assisted Selection
Mendel's laws Mutagenesis Genetic information Locating desirable traits in a plant
Gregor Mendel describes the Developing new genetic Development of improved varieties for efficient selection and breeding
inheritance of traits from one diversity by exposing crop by working directly with DNA
generation to the next. His laws plants to chemical
become the core of classical genetics agents or radiation
For 10,000 years, farmers and For 150 years, plant scientists and Today, farmers feed at least 10 times By 2050, we will need 50% more
breeders have been developing breeders have improved plant more people using almost same food to feed the rapid growing
and improving crops breeding on a scientific basis amount of lands as 100 years ago population
Figure 9.10 : Milestones in Plant Breeding
Biofortification – breeding crops with higher levels of vitamins and minerals or higher protein
and healthier fats – is the most practical means to improve public health.
Breeding for improved nutritional quality is undertaken with the objectives of improving
• Protein content and quality
• Oil content and quality
• Vitamin content and
• Micronutrient and mineral content
In 2000, maize hybrids that had twice the amount of amino acids, lysine and tryptophan, compared
to existing maize hybrids were developed. Wheat variety, Atlas 66 having a high protein content,
has been used a donor for improving cultivated wheat. It has been possible to develop an iron
fortified rice variety containing over five times as much iron as in commonly consumed varieties.
The Indian Agricultural Research Institute, New Delhi has also released several vegetable crops
that are rich in vitamins and minerals, example: vitamin A enriched carrots, spinach, pumpkin;
vitamin C enriched bitter gourd, bathua, mustard, tomato; iron and calcium enriched spinach and
protein enriched beans – broad, lablab, French garden peas.
Sugar cane: Saccharum bareri was originally grown in North India, but had poor sugar content and
yield. Tropical canes grown in South India Saccharum officinarum had thicker stems and higher sugar
content but did not grow well in North India. These two species were successfully crossed to get sugar
cane varieties combining the desirable qualities of high yield, thick stems, high sugar and ability to grow
in the sugarcane areas of North India.
Plant Breeding 183

www.tntextbooks.in
New generation plant breeding

TRADITIONAL
Crops with improved characteristics produced by cross

METHOD
Gene has 50-50 chance of being passed to offspring.

breeding plants with desired gene Desired gene will take multiple generations to spread
Combines genes from different species Chromosome

Bacteria
Bacterial
chromosome Gene
MODERN METHOD
Plant cell
1. Plasmid: 3. Vector: Restriction
Circular
enzyme cleaves plasmid.
DNA molecule is 2. DNA containing gene for
Second enzyme –
removed desired trait is removed
from cell. This from chromosome. Restriction DNA ligase – pastes gene
acts as vector to enzyme cuts gene into DNA molecule, making 4. Vector inserts gene into
carry gene from DNA recombinant vector chromosomes of plant cells
NEW BREEDING
CRISPR/Cas9*: Precise gene-editing cuts

Plant with desired gene has gene pasted
TECHNIQUES
DNA at specified sequence and enables

into all its chromosomes. Gene is transmitted
introduction of replacement sequence
to nearly all offspring
*Clustered Regularly Interspaced Short Palindromic Repeats.
Cas9 is a cleaving protein.
Figure 9.16 Sequential development of plant breeding techniques
ICT Corner
Plant Breeding
Let us know about the details of
Medicinal Plants in detail.
Steps
• Type the URL or scan the QR code to open the activity page then Introduction page will open.
• Click on ‘Plants’ it will display list of Medicinal Plants.
• Click on each plants individually on the next screen it displays the description, harvesting and
properties of the plants.
• Click the option on the top left side of the front page to see the preparation of oils, Powder etc.,

URL:
https://play.google.com/store/apps/details?id=com.dssoft.plantasmedicinales
184 Plant Breeding

www.tntextbooks.in
Unit X: Economic Botany

Chapter
10 Economically
Useful Plants and
Entrepreneurial Botany
Learning Objectives The land and water of the earth sustain a

vast assemblage of plants upon which all
The learner will be able to other living forms are directly or indirectly
Acquire knowledge about origin, area dependent. Pre-historic humans lived on
of cultivation and uses of various food berries, tubers, herbage, and the wild game
yielding plants. which they collected and hunted that occupied
whole of their time. Domestication of plants
Describe the different spices and
and animals has led to the production of
condiments and their uses.
surplus food which formed the basis for
Elicit the uses of fibre, timbers, paper and civilizations. Early civilization in different
dye yielding plants. parts of the world has domesticated different
Acquire knowledge about the active species of plants for various purposes. Based
principles, chemical composition and on their utility, the economically useful plants
medicinal uses of plants. are classified into food plants, fodder plants,
fibre plants, timber plants, medicinal plants,
Gains knowledge of organic farming- bio
and plants used in paper industries, dyes and
fertilisers and bio pest repellants.
cosmetics. Selected examples of economically
important plants for each category are
discussed in this chapter.
Chapter outline
10.1 Food Plants 10.1 Food plants

Currently about 10,000 food plants are being
10.2 Spices and Condiments
used of which only around 1,500 species were
10.3 Fibre brought under cultivation. However, food
10.4 Timber base of majority of the population depends
10.5 Latex
only on three grass species namely rice, wheat
and maize.
10.6 Pulp wood
10.1.1 Cereals
10.7 Dye
The word cereal is derived from Ceres, which
10.8 Cosmetics according to the Roman mythology denotes
10.9 Traditional system of medicines “Goddess of agriculture”. All cereals are members
of grass family (Poaceae) that are grown for their
10.10 Medicinal plants
edible starchy seeds. The prominence of cereals
10.11 Entrepreneurial Botany as food plants is due to the following attributes:
185 Economically useful plants and Entrepreneurial Botany
TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_200-238 CH 10.indd 185 3/14/2020 12:17:29 PM

www.tntextbooks.in
i. Greater adaptability and successful

colonisation on every type of habitat.
ii. The relative ease of cultivation
iii.
Tillering property that produce more
branches which results in higher yield per Rice Wheat
unit area. Figure 10.1: Major Cereals
iv. Compact and dry grains that they can be
easily handled, transported and stored Wheat
without undergoing spoilage. Botanical name : Triticum aestivum
v. High caloric value that provides energy. Origin and Area of cultivation
The nutrients provided by cereals include Earliest evidence for wheat cultivation
carbohydrates, proteins, fibres and a wide comes from Fertile Crescent region. The
range of vitamins and minerals. Cereals can common cultivated wheat, Triticum aestivum
be classified into two different types based is cultivated for about 7,500 years. Wheat is
on their size namely Major Cereals and mostly cultivated in the North Indian states
Minor Cereals. such as Uttar Pradesh, Punjab, Haryana,
Rajasthan, Madhya Pradesh and Bihar.
Major Cereals
Uses
Rice / Paddy
Wheat is the staple food in Northern India.
Botanical name : Oryza sativa Wheat flour is suitable to make bread and other
Paddy is a semi-aquatic crop and is grown in bakery products. Processed wheat flour, that
standing water. It is an important food crop has little fibre, is called Maida which is used
of the world, occupying the second position extensively in making parota, naan and bakery
in terms of area under cultivation and products. Malted wheat is a major raw material
production, next to wheat. Rice is the chief for producing alcoholic beverages and nutritive
source of carbohydrate. drinks.
Origin and Area of cultivation
South East Asia is considered as the center PSEUDO-CEREAL
of origin of rice. Earliest evidences of rice The term pseudo-cereal is
cultivation have been found in China, India used to describe foods that
and Thailand. It is mainly cultivated in Delta are prepared and eaten
and irrigated regions of Tamil Nadu. as a whole grain,
Uses but are botanical
Rice is the easily digestible calorie rich outliers from
grasses. Example:
cereal food which is used as a staple food
quinoa. It is
in Southern and North East India. Various
actually a seed from
rice products such as Flaked rice (Aval), Pseudo cereal - the Chenopodium
Puffed rice / parched rice (Pori) are used as Chenopodium quinoa
quinoa plant
breakfast cereal or as snack food in different belongs to the family Amaranthaceae. It is
parts of India. a gluten-free, whole-grain carbohydrate, as
Rice bran oil obtained from the rice bran is well as a whole protein (meaning it contains
used in culinary and industrial purposes. all nine essential amino acids) and have been
Husks are used as fuel, and in the manufacture eaten for 6,000 years in Andes hill region.
of packing material and fertilizer.
Economically useful plants and Entrepreneurial Botany 186

www.tntextbooks.in
Uses 10.1.3 Minor Millets

Most of the corn produced is used as Foxtail Millet
fodder than food. Corn syrup is used in
Botanical name : Setaria italica
the manufacture of infant foods. Corn is a
This is one of the oldest millet used
raw material in the industrial production of
traditionally in India. Which is domesticated
alcohol and alcoholic beverages.
first in China about 6000 years. Rich in protein,
10.1.2 Millets (Siru Thaniyangal) carbohydrate, vitamin B and C, Potassium and
The term millet is applied to a variety of very Calcium.
small seeds originally cultivated by ancient Uses
people in Africa and Asia. They are gluten free It supports in strengthening of heart and
and have less glycemic index. improves eye sight. Thinai porridge is given to
lactating mother.
Kodo Millet
Botanical name : Paspalum scrobiculatum
Finger Millet Sorghum Kodo millet is originated from West Africa,
Figure 10.2: Millets which is rich in fibre, protein and minerals.
Uses
Finger Millet – Ragi
Kodo millet is ground into flour and used
Botanical name : Eleusine coracana
to make pudding. Good diuretic and cures
Finger millet is the crop of early introduction from constipation. Helps to reduce obesity, blood
East Africa into India. Ragi is rich in calcium. sugar and blood pressure.
Uses
It is used as a staple food in many southern
10.1.4 Pulses
The word Pulse is derived from the Latin
hilly regions of India. Ragi grains are made
words ‘puls’ or ‘pultis’ meaning “thick soup”.
into porridge and gruel. Ragi malt is the
Pulses are the edible seeds that are harvested
popular nutrient drink. It is used as a source
from the fruits of Fabaceae. They provide vital
of fermented beverages.
source of plant-based protein, vitamins and
Sorghum minerals for people around the globe.
Botanical name : Sorghum vulgare
Black gram
Sorghum is native to Africa. It is one of the major
Botanical name : Vigna mungo
millets in the world and is rich in calcium and iron.
Uses Black gram is native to India. Earliest
It is fed to poultry, birds, pigs and cattle and a archeobotanical evidences record the presence
source of fermented alcoholic beverage. of black gram about 3,500
years ago. It is cultivated as
a rain fed crop in drier parts
of India. India contributes to
80% of the global production
of black gram. Important states
growing black gram in India are
Foxtail Millet Kodo Millet Uttar Pradesh, Chattisgarh and
Figure 10.3: Minor Millets Karnataka.

www.tntextbooks.in
Black gram Sprouted green gram Red gram

Figure 10.4: Pulses
Uses 10.1.5 Vegetables

Black gram is eaten whole or split, boiled or While walking through a market filled with fresh
roasted or ground into flour. Black gram batter vegetables like stacks of lady’s finger, mountains
is a major ingredients for the preparation of of potatoes, pyramids of brinjal, tomatoes,
popular Southern Indian breakfast dishes. cucurbits, we learn to choose the vegetables that
Split pulse is used in seasoning Indian curries. is fresh, tender, ripe and those suit the family
taste through experience and cultural practices.
Red gram / Pigeon pea
Why do we need to eat vegetables and what do
Botanical name : Cajanus cajan they provide us?
Origin and Area of cultivation: It is the only Vegetables are the important part of
pulse native to Southern India. It is mainly grown healthy eating and provide many nutrients,
in the states of Maharashtra, Andhra Pradesh, including potassium, fiber, folic acid and
Madhya Pradesh, Karnataka and Gujarat. vitamins A, E and C. The nutrients in vegetables
Uses are vital for maintenance of our health.
Red gram is a major ingredient of sambar, a Lady’s finger / Okra
characteristic dish of Southern India. Roasted
Botanical name : Abelmoschus esculentus
seeds are consumed either salted or unsalted
Family: Malvaceae
as a popular snack. Young pods are cooked and
consumed.
Lady’s finger is a native of the Tropical Africa.
Green gram Assam, Maharashtra and Gujarat are the
Botanical name : Vigna radiata important states where Lady’s finger is grown in
Origin and Area of cultivation abundance. Coimbatore, Dharmapuri and Vellore
Green gram is a native of India and the earliest are the major cultivating regions of Tamil Nadu.
archaeological evidences are found in the state
Uses
of Maharashtra. It is cultivated in the states of
The fresh and green tender fruits are used
Madhya Pradesh, Karnataka and Tamil Nadu.
as a vegetable. Often they are sliced and
Uses dehydrated to conserve them for later use. It
It can be used as roasted cooked and sprouted has most important nutrients.
pulse. Green gram is one of the ingredients of
10.1.6 Fruits
pongal, a popular breakfast dish in Tamil Nadu.
Edible fruits are fleshy structures with a pleasant
Fried dehulled and broken or whole green gram
aroma and flavours. Fruits are sources of many
is used as popular snack. The flour is traditionally
nutrients including potassium, dietary fiber,
used as a cosmetic, especially for the skin.
folic acid and vitamins.Depending on the
climatic region in which fruit crops grow, they

www.tntextbooks.in
can be classified into temperate(apple, pear, Uses

plum) and tropical fruits (mango, jack, banana). Cashews are
In this chapter we will study an example of commonly used
tropical fruit. for garnishing
Mango (National fruit of India) sweets or curries, or Cashew
Botanical name : Mangifera indica ground into a paste Figure 10.6: Nuts
Family: Anacardiaceae that forms a base of
sauces for curries or some sweets. Roasted and
Origin and Area of
raw kernels are used as snacks.
cultivation
The mango is the native 10.1.8 Sugars
to Southern Asia, We experienced sweetness while eating the
especially Burma and stems of sugarcane, roots of sugar beet, fruits
Eastern India. It is the of apple and while drinking palmyra sap. This
National fruit of India. Figure 10.5: Mango is due to the different proportions of sugars
Major mango producing found in it. Sugar is the generic name for
States are Andhra Pradesh, Bihar, Gujarat and sweet tasting soluble carbohydrate, which are
Karnataka. Salem, Krishnagiri, Dharmapuri are used in foods and beverages. Sugars found in
the major mango producing districts of Tamil sugarcane and palmyra make them ideal for
Nadu. Some of the major cultivars of mango in efficient extraction to make commercial sugar.
India are Alphonsa, Banganapalli, neelam and
Sugarcane
malgova.
Botanical name : Saccharum officinarum
Uses Family : Poaceae
Mango is the major table fruit of India, which Origin and Area of cultivation
is rich in beta carotenes. It is utilized in many The cultivated Saccharum officinarum
ways, as dessert, canned, dried and preserves has evolved by repeated back crossing of
in Indian cuisine. Sour, unripe mangoes are S.officinarum of New Guinea with wild
used in chutneys, pickles, side dishes, or may S.spontaneum of India to improve the quality.
be eaten raw with salt and chili. Mango pulp is All districts except Kanyakumari and Nilgiris
made into jelly. Aerated and non-aerated fruit of Tamil Nadu cultivate Sugarcane.
juice is a popular soft drink.
Uses
10.1.7 Nuts Sugar cane is the raw material for extracting
Nuts are simple dry fruits composed of a hard white sugar. Sugarcane supports large number
shell and an edible kernel. They are packed of industries like sugar mills producing refined
with a good source of healthy fats, fibre,
sugars, distilleries producing liquor grade
protein, vitamins, minerals and antioxidants.
Cashew nut
Botanical name : Anacardium occidentale
Family: Anacardiaceae
Cashew has originated in Brazil and made its way
to India in the 16th century through Portuguese Palmyra tree and
Palm Jaggery
sailors. Cashew is grown in Kerala, Karnataka, Sugarcane products
Goa, Maharashtra, Tamil Nadu, and Orissa. Figure 10.7: Sugars

www.tntextbooks.in
ethanol and millions of jaggery manufacturing and India via Philippines. In India Gujarat,
units. Fresh sugarcane juice is a refreshing Andhra Pradesh and Rajasthan are top
drink. Molasses is the raw material for the producers.
production of ethyl alcohol. Uses
Palmyra (State tree of Tamil Nadu) Nuts contain about 45% oil. The kernels
Botanical name : Borassus flabellifer are also rich sources of phosphorous and
Family: Arecaceae vitamins, particularly thiamine, riboflavin
and niacin. It is premium cooking oil because
it does not smoke. Lower grade oil is used in
Palmyra is native to tropical regions of Africa,
manufacture of soaps and lubricants.
Asia and New Guinea. Palmyra grows all over
Tamil Nadu, especially in coastal districts. Sesame / Gingelly
Uses Botanical name : Sesamum indicum
Exudate from inflorescence axis is collected for Family : Pedaliaceae
preparing palm sugar. Inflorescence is tapped for its Origin and Area of cultivation: Sesamum
sap which is used as health drink. Sap is processed indicum has originated from Africa.. Sesame
to get palm jaggery or fermented to give toddy. is cultivated as a dry land crop. West Bengal
Endosperm is used as a refreshing summer and Madhya Pradesh are the top producers
food. Germinated seeds have an elongated embryo in India during 2017-18. It is considered as a
surrounded by fleshy scale leaf which is edible. healthy oil in Southern Indian culture.
Uses
10.1.9 Oil Seeds
Why fried foods are tastier than boiled foods? Sesame oil is used for mostly culinary purposes
in India. Lower grades are used in manufacture
There are two kinds of oils namely, essential
of soaps, in paint industries, as a lubricant and as
oils and vegetable oils or fatty oils. The
an illuminant. In India, the oil is the basis of most
essential oils or volatile oils which possess
of the scented oils used in perfumes. Sesame seed
aroma evaporate or volatilize in contact
with air. Any organ of a plant may be the snacks are popular throughout India.
source of essential oil. For example, flowers
of Jasmine, fruits of orange and roots of
ginger. The vegetable oils or non-volatile
oils or fixed oils that do not evaporate.
Whole seeds or endosperm form the sources
of vegetable oils. Groundnut Sesame
Figure 10.8: Oil Seeds
Let us know about few oil seeds
Groundnut / Peanut 10.1.10 Beverages
Botanical name : Arachis hypogaea How about a cup of coffee or tea? We always
entertain our guests with this offer.
Family : Fabaceae
All non-alcoholic beverages contain alkaloids
Origin and Area of
that stimulate central nervous system and also
Cultivation: Groundnut is
possess mild diuretic properties.
native of Brazil. Portuguese
Coffee
introduced groundnut into
Botanical name : Coffea arabica
Africa. The Spanish took
Family : Rubiaceae
it to the South East Asia

www.tntextbooks.in
Why does a student Spices are accessory foods mainly used

or a driver prefer for flavouring during food preparation to
tea or coffee during improve their palatability. Spices are aromatic
night work? plant products and are characterized by sweet
Origin and Area or bitter taste. Spices are added in minimal
Coffee
of cultivation: quantities during the cooking process. For
Figure 10.9: Beverages
Coffea arabica is example black pepper.
the prime source Condiments, on the other hand, are
of commercial coffee which is native to the flavouring substances having a sharp taste and
tropical Ethiopia An Indian Muslim saint, are usually added to food after cooking. For
Baba Budan introduced coffee from Yemen
example, curry leaves.
to Mysore.Karnataka is the largest coffee
producing state in India followed by Tamil The following spices and condiment are
Nadu and Kerala. Tamil Nadu is the largest discussed in detail.
consumer of coffee in India. Spices
Uses
Cardamom
Drinking coffee in moderation provides the Botanical name : Elettaria cardamomum
following health benefits:
Family : Zingiberaceae
Caffeine enhances release of acetylcholine
Origin and Area of cultivation: It is
in brain, which in turn enhances efficiency. It can
indigenous to Southern India and Sri Lanka.
lower the incidence of fatty liver diseases, cirrhosis
Cardamom is called as “Queen of Spices”. In
and cancer. It may reduce the risk of type 2 diabetes.
India it is one of the main cash crops cultivated
in the Western Ghats, and North Eastern India
10.2 Spices and Condiments
“Aroma attracts everyone” Uses
History: The seeds have a pleasing aroma and a

characteristic warm, slightly pungent taste. It
Spices were used extensively throughout the
is used for flavouring confectionaries, bakery
world for several thousands of years. Records
products and beverages. The seeds are used
of use of garlic and onion dates back 2500 years.
in the preparation of curry powder, pickles
Majority of the spices are native to and cakes. Medicinally, it is employed as a
Mediterranean region, India and South East stimulant and carminative. It is also chewed
Asian countries. Spices, especially pepper as a mouth freshener.
triggered the search for sea route to India
Black Pepper
and paved way for the exploratory voyages by
Spanish and Portuguese. Botanical name : Piper nigrum
Family : Piperaceae
Cardamom Black Pepper Turmeric Chillies

Figure 10.10: Spices

www.tntextbooks.in
Origin and Area of cultivation: It is indigenous arteries, which leads to heart attack.
to Western Ghats of India. Pepper is one of Chillies / Red Pepper
the most important Indian spices referred
Botanical name : Capsicum annuum,
to as the “King of Spices” and also termed as
C. frutescens.
“Black Gold of India”. Kerala, Karnataka and
Family : Solanaceae
Tamil Nadu are the top producers in India.
Origin and Area of cultivation: Capsicum
The characteristic pungency of the pepper
is native to South America and is popularly
is due to the presence of alkaloid Piperine.
known as chillies or red pepper in English.
There are two types of pepper available in the
India is leading producer and exporter.
market namely black and white pepper.
C. annuum and C. frutescens are important
Uses
cultivated species of chillies.
It is used for flavouring in the preparation of
Uses
sauces, soups, curry powder and pickles. It is
The fruits of C.annuum are less pungent than the
used in medicine as an aromatic stimulant for
fruits of C.frutescens. C.annum includes large,
enhancing salivary and gastric secretions and
sweet bell peppers. Long fruit cultivars of this
also as a stomachic. Pepper also enhances the
species are commercially known as ‘Cayenne
bio-absorption of medicines.
pepper’ which are crushed, powdered and used
Turmeric as condiment. Chillies are used in manufacture
Botanical name : Curcuma longa of sauces, curry powders and preparation of
Family : Zingiberaceae pickles. Capsaicin is an active component of
Origin and Area of cultivation: It is chillies. It has pain relieving properties and
indigenous to Southern Asia India is the used in pain relieving balms. Chillies are a
largest producer, consumer and exporter of good source of Vitamin C, A and E.
turmeric. Erode in Tamil Nadu is the World’s Capsaicin is responsible
largest wholesale turmeric market. for the pungency or spicy
Uses taste of chillies. Pungency
Turmeric is one of the most important and of Chillies is measured
ancient Indian spices and used traditionally over in Scoville Heat Units
thousands of years for culinary, cosmetic, dyeing (SHU). World’s hottest chilli, Carolina reaper
pepper measures 2,200,000 SHU. Naga viper
and for medicinal purposes. It is an important
chilli is the hottest in India that measures
constituent of curry powders. Turmeric is used
1,349,000 SHU. Commonly used cayenne
as a colouring agent in pharmacy, confectionery
pepper measures 30,000 to 50,000 SHU.
and food industry. Rice coloured with turmeric
(yellow) is considered sacred and auspicious Condiment
which is used in ceremonies. It is also used for
Tamarind
dyeing leather, fibre, paper and toys.
Botanical name:
Curcumin extracted from turmeric is Tamarindus indica
responsible for the yellow colour. Curcumin is
Family : Fabaceae-
a very good anti-oxidant which may help fight
Caesalpinioideae
various kinds of cancer. It has anti-inflammatory,
anti-diabetic, anti-bacterial, anti-fungal and anti- Origin and Area of Figure 10.11 : Tamarind
viral activities. It stops platelets from clotting in cultivation: Tamarind
is native of tropical African region and was

www.tntextbooks.in
introduced into India several thousand years from the two cultivated species (1) Corchorus
before. It is cultivated in India, Myanmar, south capsularis and (2) C.olitorius is of African
asian countries and several African and Central origin whereas C. capsularis, is believed to be
American countries. Tamarind has long been Indo-Burmese origin. It is an important
used in Africa and in Southern Asia. The name cultivated commercial crop in Gangetic plains
tamarindus is of Arabian origin, which means of India and Bangladesh.
“dates of India”. (tamar – dates; Indus – India). Uses
Uses It is one of the largest exported fibre material of
It is used in flavouring sauces in the United States India. The jute industry occupies an important
and Mexico. In India, the fruit pulp is major place in the national economy of India. Jute is
ingredients for many culinary preparations. used for ‘safe’ packaging in view of being natural,
Sweet tamarinds are sold as table fruits in India renewable, bio-degradable and eco-friendly
imported from Thailand and Malaysia. product. It is used in bagging and wrapping
textile. About 75% of the jute produced is used
10.3 Fibres for manufacturing sacks and bags. It is also used
Botanically a fiber is a long narrow and thick- in manufacture of blankets, rags, curtains etc. It
walled cell. is also being used as a textile fibre in recent years.
Cotton
Botanical name : Gossypium spp.
Family : Malvaceae
Cotton is the world’s most important non-
food commercial crop.
Origin and Area of cultivation: It is
Cotton plant Jute products
one of the oldest cultivated crops of the
world. It has been cultivated for about Figure 10.12: Fibres
8000 years both in new world and in old 10.4 Timber
world. Commercial cotton comes from four The basic need of shelter is obtained from the
cotton species: two from the new world and timber trees.
two from the old world. (1) G. hirsutum
Teak
(2) G.barbadense are the New world species
Botanical name : Tectona grandis
and (3) G. arboretum (4) G. herbaceum
are the old world species. In India cotton Family: Lamiaceae
is cultivated in Gujarat, Maharashtra, Origin and Area of
Andhra Pradesh and Tamil Nadu. cultivation: This is
Uses native to South east
Asia. It is observed
It is mainly used in the manufacturing of
wild in Assam. But
various textile, hosiery products, toys and is
cultivated in Bengal,
also used in hospitals. Teak wood carving
Assam, Kerala,
Jute Tamil Nadu and Figure 10.13: Timber
Botanical name : Corchorus spp. North-West India.
Family : Malvaceae Uses
Origin and Area of cultivation: Jute is derived It is one of best timbers of the world.

www.tntextbooks.in
The heartwood is golden yellow to golden

brown when freshly sawn, turning darker Rubber – Vulcanization
when exposed to light. Known for its Charles Goodyear
durability as it is immune to the attack of invented vulcanization in
termites and fungi. 1839. He found that the
defects in rubber articles could be overcome
The wood does not split or crack and is
by heating rubber with sulphur under
a carpenter friendly wood. It was the chief pressure at 1500 C. The process was called
railway carriage and wagon wood in India. vulcanization. The name was given from the
Ship building and bridge-building depends on Roman God of Fire, Vulcan. Because of this,
teakwood. It is also used in making boats, toys, solid rubber tyres were used for first time in
plywood, door frames and doors. 1867. That is why we smoothly travel on road.
10.5 Latex
Rubber 10.6 Pulp Wood
The term paper is
Botanical name : Hevea brasiliensis
derived from the
Family : word ‘papyrus’
Euphorbiaceae a plant (Cyperus
Origin and Area papyrus) that was Figure 10.15 : Wood pulp
of cultivation: used by Egyptians
It is a native to make paper-like materials. Paper production
of Brazil and is a Chinese invention. The Chinese discovered
was introduced the paper that was prepared from the inner bark
Figure 10.14: Rubber Tree
outside its of paper mulberry in 105 A.D. For a long time,
native range during the colonial period and the art of paper making remained a monopoly
has become an important cash crop. Asia of the Chinese until Arabs learned the technique
contributed 90% of the world production. and improved it around 750 A.D. Invention of
Kerala is the largest producer in India followed printing increased the demand for paper.
by Tamil Nadu. Manufacture of Wood pulp: Wood
Uses is converted into pulp by mechanical,
Tyre and other automobile parts manufacturing and chemical processes. Wood of Melia
industries consume 70% of the rubber azadirachta, Neolamarkia chinensis, Casuarina
production. Rubber is used in manufacturing spp, Eucalyptus spp are used for making
footwear, wire and cable insulations, rain- paper pulp.
coats, household and hospital goods, shock
Purified dissolving pulp is
absorbers, belts, sports goods, erasers,
used as a basic material in
adhesives, and rubber-bands Hard rubber is
the manufacture of rayon
used in the electrical and radio engineering
or artificial silk, fabrics,
industries Concentrated latex is used for transparent films (cellophane, cellulose
making gloves, balloons and acetate films), plastics. The viscose process of
condoms. Foamed latex is making rayon is the most common process.
used in the manufacture of
cushions, pillows and life-
belts.

www.tntextbooks.in
10.7 Dyes people have realized the hazards of chemical-

The ability to perceive colour is a wonderful based cosmetics and are turning back to
aspect of human eyes and dyes add colour to natural products. In this chapter one of the
the goods we use. They have been in use since major plants namely Aloe which is used in the
the ancient times. cosmetic industries is discussed.
The earliest authentic records of dyeing Aloe
were found in the tomb painting of ancient Botanical name : Aloe vera
Egypt. Colourings on mummy cements Family: Asphodelaceae (formerly Liliaceae)
(wrapping) included saffron and indigo. They
Origin and Area of cultivation: It is a native
can also be seen in rock paintings in India.
of Sudan. It is cultivated on a large scale in
Henna Rajasthan, Gujarat,
Botanical name : Lawsonia inermis Maharashtra, Andhra
Family : Lythraceae Pradesh and Tamil
Origin and Area of cultivation: It is indigenous Nadu.
to North Africa and South-west Asia. It is Uses Figure 10.17: Aloe vera
grown mostly throughout India, especially in ‘Aloin’ (a mixture
Gujarat, Madya Pradesh and Rajasthan. of glucosides) and its gel are used as skin
Uses tonic. It has a cooling effect and moisturizing
An orange dye ‘Henna’ is obtained from the characteristics and hence used in preparation
leaves and young shoots of Lawsonia inermis. The of creams, lotions, shampoos, shaving creams,
principal colouring matter of leaves ‘lacosone” after shave lotions and allied products. It
is harmless and causes no irritation to the skin. is used in gerontological applications for
This dye has long been used to dye skin, hair and rejuvenation of aging skin. Products prepared
finger nails. It is used for colouring leather, for from aloe leaves have multiple properties such
the tails of horses and in hair-dyes. as emollient, antibacterial, antioxidant,
antifungal and antiseptic. Aloe vera gel is used
in skin care cosmetics.
10.8.1 Perfumes
The word perfume is derived from the Latin
word Per (through) and fumus (to smoke),
meaning through smoke. It refers to the
Henna dye age-old tradition of burning scented woods
Figure 10.16: Naturals Dyes at religious ceremonies.In early days, when
people were less conscious of personal
10.8 Cosmetics hygiene, essential oils not only masked
Traditionally in Southern India, people have offensive odours, but also may have acted as
been using turmeric, green gram powder, antiseptics. Perfumes are added to baths and
henna, sigaikai and usilai for their skin and used for anointing the body.
hair care. These were mostly home prepared Perfumes are manufactured from essential
products that are used for grooming. Today, oil which are volatile and aromatic. Essential
cosmetics have a high commercial value oils are found at different parts of the plant
and have become chemical based industrial such as leaves, (curry leaf, mint), flowers (rose,
products. Providing personal care services jasmine), fruits (citrus, straw berry) and wood
has become a major industry. In recent years, (sandal, eucalyptus).

www.tntextbooks.in
Jasmine blends well with other perfumes.

Madurai Malli It is much used in modern perfumery and
‘Madurai Malli’ is the pride cosmetics and has become popular in air
of Madurai has a distinct freshners, anti-perspirants, talcum powders,
reputation universally shampoos and deodorants.
because of its uniqueness and has been
given the Geographical Indications (GI) 10.9 Traditional Systems
mark by the Geographical indication of Medicines
Registry of India. Madurai malli has India has a rich medicinal heritage. A number
thick petals with long stalk equal to that of Traditional Systems of Medicine (TSM)
of petals and the distinct fragrance is are practiced in India some of which come
due to the presence of chemicals such as from outside India. TSM in India can be
jasmine and alpha terpineol. This makes broadly classified into institutionalized
it easy to distinguish Madurai Malli from or documented and non-institutionalized
other places. This is the second GI tag for or oral traditions. Institutionalized Indian
Jasmine after ‘Mysore Malli’. systems include Siddha and Ayurveda which
are practiced for about two thousand years.
Jasmine These systems have prescribed texts in which
Botanical name : Jasminum grandiflorum the symptoms, disease diagnosis, drugs to cure,
Family: Oleaceae preparation of drugs, dosage and diet regimes,
daily and seasonal regimens. Non- institutional
Jasmine, as a systems, whereas, do not have such records
floral perfume, and or practiced by rural and tribal peoples
ranks next to across India. The knowledge is mostly held in
the rose oil. oral form. The TSM focus on healthy lifestyle
Major species and healthy diet for maintaining good health
cultivated on the and disease reversal.
commercial scale Figure 10.18: Jasmine Siddha system of medicine
is Jasminum
Siddha is the most popular, widely practiced
grandiflorum, a native of the north-western
and culturally accepted system in Tamil
Himalayas. In Tamil Nadu, the major jasmine Nadu. It is based on the texts written by 18
cultivation centres are Madurai and Thovalai Siddhars. There are different opinions on the
of Kanyakumari District. The essential oil is constitution of 18 Siddhars. The Siddhars are
present in the epidermal cells of the inner and not only from Tamil Nadu, but have also come
outer surfaces of both the sepals and petals. from other countries. The entire knowledge is
One ton of Jasmine blossom yields about 2.5 documented in the form of poems in Tamil.
to 3 kg of essential oil, comprising 0.25 to 3% Siddha is principally based on the Pancabūta
of the weight of the fresh flower. philosophy. According to this system three
Uses humors namely Vātam, Pittam and Kapam
that are responsible for the health of human
Jasmine flowers have been used since ancient beings and any disturbance in the equilibrium
times in India for worship, ceremonial purposes, of these humors result in ill health. The drug
incense and fumigants, as well as for making sources of Siddha include plants, animal parts,
perfumed hair oils, cosmetics and soaps. marine products and minerals. This system
Jasmine oil is an essential oil that is valued for specializes in using minerals for preparing
its soothing, relaxing, antidepressant qualities. drugs with the long shelf-life. This system
uses about 800 herbs as source of drugs. Great

www.tntextbooks.in
stress is laid on disease prevention, health plants to the farmers.

promotion, rejuvenation and cure. Medicinal plants play a significant role in
Ayurveda system of medicine providing primary health care services to rural
Ayurveda supposed to have originated from and tribal people. They serve as therapeutic
Brahma. The core knowledge is documented agents as well as important raw materials for
by Charaka, Sushruta and Vagbhata in the manufacture of traditional and modern
compendiums written by them. This system medicines. Medicinally useful molecules
is also based on three humor principles obtained from plants that are marketed as drugs
namely, Vatha, Pitha and Kapha which would are called Biomedicines. Medicinal plants which
exist in equilibrium for a healthy living. This are marketed as powders or in other modified
system Uses more of herbs and few animal forms are known as Botanical medicines.
parts as drug sources. Plant sources include Keezhanelli
a good proportion of Himalayan plants. The Botanical name : Phyllanthus amarus
Ayurvedic Pharmacopoeia of India lists Family : Euphorbiaceae (Now in Phyllanthaceae)
about 500 plants used as source of drugs.
Origin and Area of cultivation: The plant is
Folk system of medicine a native of Tropical American region and is
Folk systems survive as an oral tradition among naturalised in India and other tropical countries.
innumerable rural and tribal communities It is not cultivated and is collected from moist
of India. A consolidated study to document places in plains. Phyllanthus maderspatensis
the plants used by ethnic communities was is also commonly sold in the medicinal plant
launched by the Ministry of Environment and markets collected from non-forest are as
Forests, Government of India in the form of keezhanelli.
All India Coordinated Research Project on Active principle: Phyllanthin is the major
Ethnobiology. As a result about 8000 plant chemical component.
species have been documented which are Medicinal importance
used for medicinal purposes. The efforts to
Phyllanthus is a well-known hepato-protective
document in several under-explored and
plant generally used in Tamil Nadu for the
unexplored pockets of India still continue.
treatment of Jaundice. Research carried out
Major tribal communities in Tamil Nadu who
by Dr. S P Thyagarajan and his team from
are known for their medicinal knowledge
University of Madras has scientifically proved
include Irulas, Malayalis, Kurumbas,
that the extract of P. amarus is effective against
Paliyans and Kaanis. Some of the important
hepatitis B virus.
medicinal plants are discussed below.
Nilavembu
10.10 Medicinal Plants Botanical name : Andrographis paniculata
India is a treasure house of medicinal plants.
They are linked to local heritage as well as to Family : Acanthaceae
global-trade. All institutional systems in India Andrographis paniculata, known as the
primarily use medicinal plants as drug sources. King of Bitters is traditionally used in Indian
At present, 90% collection of medicinal plants systems of medicines.
is from the non-cultivated sources. Growing Active principle: Andrographolides.
demand for herbal products has led to quantum
Medicinal importance:
jump in volume of plant materials traded
within and across the countries. Increasing Andrographis is a potent hepatoprotective
demand exerts a heavy strain on the existing and is widely used to treat liver disorders.
resources. Now efforts are being made to Concoction of Andrographis paniculata and
introduce cultivation techniques of medicinal eight other herbs (Nilavembu Kudineer) is

www.tntextbooks.in
Opium is derived from the exudates of

fruits of poppy plants. It was traditionally
used to induce sleep and for relieving pain.
Opium yields Morphine, a strong analgesic
which is used in surgery. However, opium is
an addiction forming drug.
Phyllanthus amarus Andrographis paniculata
Cannabis / Marijuana
Figure 10.19: Medicinal Plants
Botanical name : Cannabis sativa
effectively used to treat malaria and dengue.
Family: Cannabiaceae
Psychoactive Drugs Origin and Area of Cultivation: Marijuana
In the above chapter you have learnt about is native to China. States such as Gujarat,
plants that are used medicinally to treat Himachal Pradesh, Uttarkand, Uttarpradesh
various diseases. Phytochemicals / drugs and Madhaya Pradesh have legally permitted
from some of the plants alter an individual’s to cultivate industrial hemp/Marijuana
perceptions of mind by producing The active principle in Marijuana
hallucination are known as psychoactive is trans-tetrahydrocanabinal (THC). It
drugs. These drugs are used in all ancient possess a number of medicinal properties.
culture especially by Shamans and by It is an effective pain reliever and reduces
traditional healers. Here we focus on two hypertension. THC is used in treating
such plants namely Poppy and Marijuana. Glaucoma a condition in which pressure
Opium poppy develops in the eyes. THC is also used in
Botanical name : Papaver somniferum reducing nausea of cancer patients undergoing
Family: Papaveraceae radiation and chemotherapy. THC provides
relief to bronchial disorders, especially asthma
Origin and Area of cultivation:
as it dilates bronchial vessels. Because of these
Opium poppy is native to South Eastern
medicinal properties, cultivation of cannabis
Europe and Western Asia. Madhya Pradesh,
is legalized in some countries. However,
Rajasthan and Uttar Pradesh are the licenced
prolonged use causes addiction and has an
states to cultivate opium poppy.
effect on individual’s health and society.
Table 1: Other commo Medicinal plants

S. Common Botanical Plant part
Tamil Name Family Medicinal Uses
No Name Name used
1 Holy basil துளசி Ocimum Lamiaceae Leaves and The leaves are stimulant, antiseptic, anti-
sanctum Roots hypertensive and anti-bacterial and expectorant
used in bronchitis. Decoction of roots is given as
a diaphoretic in malarial fevel.
2 Indian நெல்லி Phyllanthus Phyllanthaceae Fruit It is a potent rejuvenator and immune
gooseberry emblica modulator. It has a anti-ageing properties. It
helps to promote longevity, enhance digestion,
treat constipation and reduce fever and cough.
3 Indian குப்பைமேனி Acalypha indica Euphorbiaceae Leaves Used to cure skin diseases caused by
Acalypha ringworms. Powdered leaves are used to cure
bedsores and infected wounds.
4 Vilvam வில்வம் Aegle marmelos Rutaceae Fruit The unripe fruit is used to treat problems of
stomach indigestion. It kills intestinal parasites.
5 Veldt grape பிரண்டை Cissus Vitaceae Stem and Paste obtained from the powdered stem and root of
quadrangularis root this plant is used in bone fractures. Whole plant is
useful to treat asthma and stomach troubles.

www.tntextbooks.in
Hence most of the countries have banned its Organic farming is an alternative agricultural
cultivation and use. system in which plants/crops are cultivated
Narcotics Control Bureau in natural ways by using biological inputs to
(NCB) maintain soil fertility and ecological balance
Drugs come in various forms thereby minimizing pollution and wastage.
and can be taken in numerous ways. Some Indians were organic farmers by default until
are legal and others are not. Drug abuse and the green revolution came into practice.
misuse can cause numerous health problems Use of biofertilizers is one of the important
and in serious cases death can occur. components of integrated organic farm
The Narcotics Control Bureau management, as they are cost effective
(NCB) is the nodal drug law and renewable source of plant nutrients
enforcement and intelligence to supplement the chemical fertilizers for
agency of India and is responsible sustainable agriculture. Several microorganisms
for fighting drug trafficking and and their association with crop plants are being
the abuse of illegal substances.
exploited in the production of biofertilizers.
10.11 Entrepreneurial Botany Organic farming is thus considered as the
Entrepreneurial Botany is the study of movement directed towards the philosophy of
how new businesses are created using plant Back to Nature.
resources as well as the actual process of
I. Organic Pesticide
starting a new business. An entrepreneur is
someone who has an idea and who works to Pest like aphids, spider and mites can cause
create a product or service that people will serious damage to flowers, fruits, and vegetables.
buy, by building an organization to support the These creatures attack the garden in swarms, and
sales. Entrepreneurship is now a popular topic drain the life of the crop and often invite disease
for higher secondary students, with a focus on in the process. Many chemical pesticides prove
developing ideas to create new ventures among unsafe for human and the environment. It turns
the young people. fruits and vegetables unsafe for consumption.
Thankfully, there are many homemade, organic
Vast opportunities are there for the students of
options to turn to war against pests.
Botany. In the present scenario students should
acquire ability to merge skills and knowledge II. Bio-pest repellent
in a meaningful way. Converting botanical Botanical pest repellent and insecticide made
knowledge into a business idea that can be with the dried leaves of Azadirachta indica
put into practice for earning a livelihood is the Preparation of Bio-pest repellent
much-needed training for the students. • Pluck leaves from the neem tree and chop
Few examples for activities of the leaves finely.
entrepreneurship are Mushroom cultivation, e chopped up leaves were put in a 50-liter
• Th
Single cell protein (SCP) production, Seaweed container and fill to half with water; put the
liquid fertilizer, Organic farming, Terrarium, lid on and leave it for 3 days to brew.
Bonsai and Cultivation of medicinal and
sing another container, strain the mixture
• U
aromatic plants
which has brewed for 3 days to remove the
This part of the chapter is dealt about organic leaves, through fine mesh sieve. The filtrate
farming in brief. can be sprayed on the plants to repel pests.
10.11.1 Organic farming • To make sure that the pest repellent sticks to

www.tntextbooks.in
Preparation of Organic Pesticide
Mix 120g of hot Blend the Add the vegetable Pour the solution into a glass
chillies with 110 vegetables together paste to 500 ml of container and leave it undisturbed
g of garlic or manually or using warm water. Give the for 24 hours. If possible, keep the
onion. Chop them an electric grinder ingredients a stir to container in a sunny location. If
thoroughly. until it forms a thoroughly mix them not, at least keep the mixture in a
thick paste. together. warm place.
1 2 3 4
Strain the mixture. Pour the Pour the pesticide into a squirt Spray your plants with the
solution through a strainer, bottle. Make sure that the spray pesticide. Treat the infected
remove the vegetables and collect bottle has first been cleaned plants every 4 to 5 days with the
the vegetable-infused water and with warm water and soap solution. After 3 or 4 treatments,
pour into another container. This to get rid it of any potential the pest will be eliminated. If the
filtrate is the pesticide. Either contaminants. Use a funnel area is thoroughly covered with
to transfer the liquid into the
discard the vegetables or use it as the solution, this pesticide should
squirt bottle and replace the
a compost. keep bugs away for the rest of the
nozzle.
5 6 season. 7
Avoid spraying the plants during the sunny times of the day since it could burn plants. Many
other plants possess insect repellent or insecticidal properties. Combinations of these plants can
be fermented and used as biopesticide.
Figure 10.20: Preparation of organic pesticide
the plants, add 100 ml of the economically useful plants are classified
cooking oil and the same into food plants, fibre plants, timber plants,
amount of soap water. medicinal plants, and plants used in paper
(The role of the soap water industries, dyes and cosmetics.
is to break down the oil, However, food base of majority of the
and the role of the oil is to population depends on very few Cereals,
make it stick to the leaves). Millets, Pulses, Vegetables, Fruits, Nuts, Sugars,
e stewed leaves from the mixture can be
• Th Oil seeds, Beverages, Spices and Condiments.
used in the compost heap or around the base Oils can be classified into two types
of the plants. namely, essential oils and vegetable oils. Fatty
Summary acids in oil may be saturated or unsaturated.
Early civilization in different parts of the world The oil yielding plants are groundnut and
has domesticated different species of plants sesame. The oils are used in cooking, making
for various purposes. Based on their utility, soaps and other purposes. Beverages contain
alkaloids that stimulate central nervous

www.tntextbooks.in
system. Spices were used throughout the b) Assertion is wrong, Reason is correct
world for several years. Cardamom is ‘Queen c) Both are correct and reason is the correct
of Spices’ used for flavouring confectionaries explanation for assertion.
and beverages. Black pepper is King of Spices. d) Both are correct and reason is not the
correct explanation for assertion.
Botanically a fibre is a long, narrow, thick
walled cell. Cotton and Jute are fibre yielding 3. Groundnut is native of _____________
plants. Teak is wood used for making furniture. a) Philippines b) India
Rubber is produced from the latex of Hevea c) North America d) Brazil
brasiliensis. Paper production is a Chinese 4. Statement A: Coffee contains caffeine
invention. Dyes have been used since ancient Statement B: Drinking coffee enhances cancer
times. The orange dye henna is from the leaves of
a) A is correct, B is wrong
Lawsonia. Perfumes are volatile and aromatic in b) A and B – Both are correct
nature, manufactured from essential oils which c) A is wrong, B is correct
are found at different parts of the plant. Medicinal d) A and B – Both are wrong
plants serve as therapeutic agents. Medicinally 5. Tectona grandis is coming under family
useful molecules obtained from these plants
a) Lamiaceae b) Fabaceae
are marketed as drugs are called Biomedicines.
c) Dipterocaipaceae e) Ebenaceae
Whereas phytochemicals from some of the
6. Tamarindus indica is indigenous to
plants which alter an individual’s perceptions of
mind by producing hallucination are known as a) Tropical African region
b) South India, Sri Lanka
psychoactive drugs.
c) South America, Greece
Entrepreneurial Botany is the study of d) India alone
how new businesses are created using plant 7. New world species of cotton
resources as well as the actual process of a) Gossipium arboretum
starting a new business. b) G.herbaceum
c) Both a and b
Evaluation d) G.barbadense
1. Consider the following statements and 8. Assertion: Turmeric fights various kinds
choose the right option. of cancer
i) Cereals are members of grass family. Reason: Curcumin is an anti-oxidant
ii) Most of the food grains come from present in turmeric
monocotyledon. a) Assertion is correct, Reason is wrong
a) (i) is correct and (ii) is wrong b) Assertion is wrong, Reason is correct
b) Both (i) and (ii) are correct c) Both are correct
c) (i) is wrong and (ii) is correct d) Both are wrong
d) Both (i) and (ii) are wrong 9. Find out the correctly matched pair.
2. Assertion: Vegetables are a) Rubber Shorea robusta
important part of healthy b) Dye Lawsonia inermis
eating. c) Timber Cyperus papyrus
Reason: Vegetables are d) Pulp Hevea brasiliensis
succulent structures 10. Observe the following statements and pick
of plants with pleasant out the right option from the following:
aroma and flavours. Statement I – Perfumes are manufactured
a) Assertion is correct, Reason is wrong from essential oils.
Statement II – Essential oils are formed at

www.tntextbooks.in
different parts of the plants. 24. What are millets? What are its types? Give
a) Statement I is correct example for each type.
b) Statement II is correct 25. If a person drinks a cup of coffee daily it
c) Both statements are correct will help him for his health. Is this correct?
d) Both statements are wrong If it is correct, list out the benefits.
11. Observe the following statements and pick 26. Enumerate the uses of turmeric.
out the right option from the following: 27. What is TSM? How does it classified and
Statement I: The drug sources of Siddha what does it focuses on?
include plants, animal parts, ores and 28. Write the uses of nuts you have studied.
minerals. 29. Give an account on the role of Jasminum
Statement II: Minerals are used for in perfuming.
preparing drugs with long shelf-life. 30. Give an account of active principle and
a) Statement I is correct medicinal values of any two plants you
b) Statement II is correct have studied.
c) Both statements are correct 31. Write the economic importance of rice.
d) Both statements are wrong 32. Which TSM is widely practiced and
12. The active principle trans-tetra hydro culturally accepted in Tamil Nadu? - explain.
canabial is present in 33. What are psychoactive drugs? Add a note
a) Opium b) Curcuma Marijuana and Opium
c) Marijuana d) Andrographis 34. What are the King and Queen of spices?
13. Which one of the following matches is Explain about them and their uses.
correct? 35. How will you prepare an organic pesticide
a) Palmyra - Native of Brazil for your home garden with the vegetables
b) Saccharun - Abundant in Kanyakumari available from your kitchen?
c) Steveocide - Natural sweetener
d) Palmyra sap - Fermented to give ethanol Glossary
14.
The only cereal that has originated and Alzheimer’s disease: A type of dementia that
domesticated from the New world. causes problems with memory, thinking and
a) Oryza sativa b)Triticum asetumn behavior
c) Triticum duram d) Zea mays Antiperspirant: Products whose primary
15. Write the cosmetic uses of Aloe. function is to inhibit perspiration / sweat
16. What is pseudo cereal? Give an example. Anti-inflammatory: the property of a substance
17. Discuss which wood is better for making or treatment that reduces swelling.
furniture.
Antioxidant: A substance that scavenges free
18. A person got irritation while applying
radicals.
chemical dye. What would be your
suggestion for alternative? Carminative: A drug causing expulsion of gas
19. Name the humors that are responsible for from the stomach or bowel.
the health of human beings. Cirrhosis: A chronic liver disease typically
20. Give definitions for organic farming? caused by alcoholism or hepatitis.
21. Which is called as the “King of Bitters”? Confectionary: a place where confections/
Mention their medicinal importance. sweets are kept or made
22. Differentiate bio-medicines and botanical
Cosmetics: substances or products used foe
medicines.
personal grooming.
23. Write the origin and area of cultivation of
green gram and red gram. Diuretic: Substance that promote urine

www.tntextbooks.in
production or nutrients
Ethnobiology: Ethnobiology is the study of Odour: Smell (pleasant or unpleasant).
relationships between peoples and plants. Perfumery: The art or process of making
Fixative: A substance used to reduce the perfume
evaporation rate and improve stability when Pharmacopoeia: Is a book containing directions
added to more volatile components. for the identification of compound medicines,
Lubricant: Oily substance reduces friction. and published by the authority of a government
Malnutrition: Deficiencies, excesses or or a medical or pharmaceutical society.
imbalances in a person’s intake of energy and / Seasoning: The processing of food with spices
and condiments to enhance the flavour.
ICT Corner
Economically Useful Plants
Steps
Let
• Type the URL or scan the QR code to open the
us know activity page then Introduction page will open.
about the • Select Package of Practices to know the various
agriculture in methods of agricultural crops breeding system.
detail through • Click on Chat with expert helps the farmers
this activity to clarify their doubts.
• Click on Videos to know about the agricultural methods visually
through videos.

URL: https://play.google.com/store/apps/details?id=com.criyagen
Steps
Let • Type the URL or scan the QR code to open the
us know activity page then Introduction page will open.
about the • Click on Agriculture it will display the approaches to
Agri book cultivate the planted paddy, cotton and sugarcane.
in detail •
Click on Horticulture it will display the
through approaches to cultivate the agricultural crops
this like tea, coffee.
activity. • Click on Organic Farming it will explain the Traditional method of farming
and Traditional Fertilizers.
• Click on Forestry it will explain the gardening methods about plants.

URL: * Pictures are indicative only
https://play.google.com/store/apps/details?id=com.agribook.venkatmc.agri

www.tntextbooks.in
Leland H. Hartwell, Leroy Hood, (2011),

9.
References Genetics, 4th Edition, New York: McGraw Hill
Companies.
UNIT VI – Reproduction in Plants
10. Linda E Graham, James M. Graham, Lee
1.
Gangulee,H.C., and Datta,C., 1972 College W. Wilcox (2006), Plant Biology, 2nd Edition,
Botany,-Volume 1 New Central Book Pearson Education, Inc.
Agency,Calcutta-9. 11. Monroe W. Strickberger, Genetics – London:
Bhojwani,S.S and Bhatnagar, S.P. 1997. The
2. Pearson Education, Inc.
Embryology of Angiosperms. VIKAS Publishing 12. Peter J. Russell (2003), Essential Genetics,
Housing Pvt Limited, New Delhi. Pearson Education, Benjamin Cummings, San
3.
R ao,K.N and Krishnamurthy, K.V. 1976 Francisco.
Angiosperms ,Publisher S.Viswanathan, 13. Randhawa S.S (2010), A Text Book of Genetics,
Chennai. 3rd Edition, S.Vikas and company.
4. Maheswari, P. 1950. An introduction to the 14. Rober J. Brooker (2015), Genetics, 4th Edition ,
embryology of angiosperms Tata Mcgraw Hill London: McGraw Hill.
Publishing Co Ltd. New Delhi.
5. Pat Willmer, 2011. Pollination and Floral UNIT VIII - Biotechnology
Ecology, Princeton University Press. USA
Alan
1. Seragg (2010). Environmental
6. Embryology of Flowering Plants Terminology Biotechnology. Second Edition. Oxford
and Concepts. 2009 Vol. 3:Reproductive Systems University Press, Oxford, New York.
(Edited by T.B.Batygina) Science Publishers
Bernard R. Glick; Jack J. Pasternak, Cheryl
2.
Enfield (NH) USA.
L. Patten (2010). Molecular Biotechnology:
Principles and Applications of Recombinant
UNIT VII – Genetics DNA. ASM Press, USA.
Anthony J.F. Griffiths, Susan R. Wessler,
1. Bhojwani, S. S. and Razdan, M. K. (2004).
3.
Richard C. Lewontin, Sean B. Carroll (2004) Plant Tissue Culture: Theory and Practice.
Introduction to Genetics Analysis 8th Edition, Elsevier Science.
USA: W.H. Freeman & Co. Ltd. Bhojwani, S. S. and Razdan, M. K. (1996).
4.
Benjamin A. Pierce (2010), Genetics: A
2. Plant Tissue Culture Theory and Practice. A
conceptual approach, 3rd Edition, New York Revised Edition, Elsevier, Amsterdam.
Carl P. Swanson, Timothy Merz, William J.
3. Bimal, C., Bhattacharyya and Rintu Banerjee
5.
Yound, Cytogenetics, (1965) Eastern Economy (2010). Environmental Biotechnology. Oxford
Edition. University Press, Oxford, New York.
Carl-Erik Tornqvist, William G Hopkins,
4. Brown, T. A. (2007). Gene Cloning and DNA
6.
(2006), Plant Genetics, New York: Chelsa House Analysis - An Introduction. 6th ed., Wiley-
publications. Blackwell, UK.
Clegg C J, (2014) Biology, London: Hooder
5. Chen, Z. and Evans, D. A. (1990). General
7.
Education techniques of tissue cultures in perennial crops.
In: Z. Chen et al. (ed.). Handbook of Plant Cell
Daniel L, Hartl, David Freifelder, Leon A.
6.
Culture. Vol. 6. Perennial Crop. McGraw-Hill
Snyder, Jones (2009), Basic Genetics, Bartlett
Publishing Company, New York.
publishers, USA
Dixon, R. A. and Gonzales, R. A. (2004). Plant
8.
James D.Watson, Tania A. Baker, Stephen
7.
Cell Culture. IRL Press.
P.Bell, Alexander Gann, Michael Levine,
Richard Losick, (2013) Molecular Biology of the Dubey, R. C. (2009). A Textbook of Biotechnology.
9.
Gene –London: Pearson Education S. Chand & Co. Ltd., New Delhi.
Krishnan.V, N. Senthil, Kalaiselvi Senthil
8. 10. Glick, B. R. and Pasternak, J. J. (2002).
(2015), Principles of Genetics, 2nd Edition. Molecular Biotechnology: Principles and

www.tntextbooks.in
Applications of Recombinant DNA. Panima 11. Peter Stiling, (2012), Ecology Global Insighto
Publishers Co., USA. and Investigations, New Delhi:.Tata McGrawhill,
11. Gupta, P. K. (2010). Elements of Biotechnology. 12. Sharma P.D., (2018), 13th Edition, Ecology and
Rastogi & Co., Meerut. Environment, Meerut : Rastogi Publication.
12. Kalyankumar De (2007). An Introduction to 13. Shukla and Handel.C, (2016), Plant Ecology, S.
Plant Tissue Culture Techniques, New Central Chand & Company Ltd., New Delhi.
Book Agency, Kolkata. 14. Singh. H.R., (2009), Environmental Biology,
13. Morgan, Thomas Hunt (1901). Regeneration. New Delhi: S. Chand and Company Limited.
New York: Macmillan. 15. Sir Harry G. Champion, Seth S.K., (2005),
14. Ramawat, K. G. (2000). Plant Biotechnology. S. The forest types of India, Natraj Publication,
Chand & Co. Ltd., New Delhi. Dehradun.
15. Razdan, M. K. (2004). Introduction to Plant 16. Thomas M. Smith, Robert Leo Smith, (2015),
Tissue Culture. Second Edition. Oxford & IBH Elements of Ecology, England: Pearson Education
Publishing Co. Pvt. Ltd., New Delhi. Ltd.,
26. Smita Rastogi and Neelam Pathak (2010). 17. Verma. V, (2011), Plant Ecology, New Delhi:
Genetic Engineering. Oxford University Press, Anu Books Pvt. Ltd.,
New Delhi.
UNIT IX Plant Ecology UNIT X – Economic Botany
Chapman J.L. and Reiss M.J., (1995),

1. Gopalan C, Rama Sastri B.V, and
1.
Ecology – Principles and Applications, NewYork:
Balasubramanian S.C., (1989) Nutritive value
Cambridge University Press,
of Indian Foods – Revised and updated by
Dash M.C., (2011), 3rd Edition, Fundamental of
2. Narasinga RaoB.S., Deosthale Y.G.,. and Pant
Ecology, Tata McGrawhill, New Delhi.
K.C., Hyderabad; National Institute of Nutrition,
Eugene P. Odum, Ecology, 2nd Edition, New
3. ICMR.
Delhi:Oxford & IBH Publishing Co. Pvt. Ltd.,
Kochhar, S.L. (2016) Economic Botany in
2.
Kochar P.L., (1995), Plant Ecology, Agra: Ratch
4.
the Tropics, (Fifth Edition), Delhi:Cambridge
Prakashon Mandir,
University Press
Madhab Chandra Dash, Sathya Prakash,
5.
3. Simpson, B.B., Ogozaly, M.C., (2001)
(2011), Fundamentals of Ecology, New Delhi:
Tata McGrawhill,. Economic Botany (3rd Edition)Newyork:
McGraw- Hill.
6. Mannel C. Molles Jr., (2010), Ecology – Concepts
and Applications, New Delhi: Tata McGrawhill, Marriyaom H. Reshid, (2017), The Flavour of
4.
Michael Cain, William D. Bowman, Sally D.
7. Spices – Journeys, Recipes and Stores, Hochette
Hacker, (2008), Ecology, V Publisher: Sinauer India.
Associates, Inc Gerrald E. Wickens, (2001) Economic Botany
5.
Misra K.C., (1998), Manual of Plant Ecology,
8. Principles and Practices, Netherlands: Springer.
Oxford & IBH Publishing Co. Pvt. Ltd., New Rajkumar Joshi, (2013) Aromatic and Vital Oil
6.
Delhi. Plants. New Delhi:Agrotech Press,
Mohan P. Arora, (2016), Ecology, Mumbai:
9. Mukund Joshi, (2015), Text Book of Field Crops,
7.
Himalaya Publishers Delhi: PHI Learning Private Limited.
10. Peter J. Russel, Stephan L. Wolla, Paul
Rajesh Kumar Dubey, (2016) Green Growth,
8.
E. Hertz, Cacie Starr, Haventy McMillan,
Eco-Livelihood & Sustainability New Delhi:
(2008), Ecology, New Delhi: Cengage Learing
Ocean Books Private Limited.
India Pvt. Ltd.,
205

www.tntextbooks.in
Frame shift
English – Tamil Terminology கட்ட நகர்வு சடுதி மாற்றம்
mutation
Unit VI – Reproduction in plants Gene interaction மரபணு இடைச்செயல்

Gene mapping மரபணு வரைபடம்
Apomixis கருவுறா இனப்பெருக்கம்
Genome மரபணுத்தொகையம்
Apospory கருவுறா வித்து
Archesporium முன்வித்து திசு Genotype மரபணுவகையம்
Cleistogamous மூடிய பூ Haploidy ஒருமடியம் (பன்மம்)

flower Heredity பாரம்பரியம்
Cryopreservation குளிர்பாதுகாப்பு
Heterozygous மாறுபட்டபண்பிணைவு
Embryo sac கருப்பை
Homologous ஒத்த அமைவிட
Floral primordium மலர் த�ோற்றுவி
chromosome குர�ோம�ோச�ோம்
Funiculus சூல் காம்பு
Incomplete முழுமைபெறா
Microsporogenesis நுண் வித்துருவாக்கம் dominance ஓங்குத்தன்மை
Polyembryony பல்கருநிலை
Incomplete linkage முழுமையற்ற பிணைப்பு
Scion ஒட்டுத் தண்டு
Independent
Stock வேர்கட்டை சாராஒதுங்கு விதி
assortment
Internal
Unit VII - Genetics அக மெத்திலாக்கம்
methylation
Inversion தலைகீழ் திருப்பம்
Allele அல்லீல்
Jumping genes தாவும் மரபணுக்கள்
Allopolyploidy அயல்பன்மடியம்
Linkage group பிணைப்புத் த�ொகுதி
Alternative splicing மாற்று இயைத்தல்
Locus நிலையிடம்
Autopolyploidy தன்பன்மடியம்
Map unit வரைபட அலகு
Backcross பிற்கலப்பு
தவறாக
Blending
கலப்பு பாரம்பரியம் Mis-sense mutation வெளிப்பாட்டடையும்
inheritance
சடுதிமாற்றம்
கிளைவழி
Branch migration Monohybrid ஒரு பண்புக்கலப்புயிரி
இடம்பெயர்தல்
Codominance இணைஓங்குத்தன்மை Multiple alleles பல்கூட்டு அல்லீல்கள்
Complete linkage முழுமையான பிணைப்பு Mutagen சடுதிமாற்றக் காரணி
Complementation Mutation சடுதிமாற்றம்

நிரப்பு ச�ோதனை
test வெளிப்பாடடையாத
Non-sense mutation
Coupling இணைப்பு சடுதி மாற்றம்
Crossing over குறுக்கேற்றம் Palindrome முன்பின்ஒத்தவரிசை
DNA metabolism DNA வளர்சிதை மாற்றம் Phenotype புறத்தோற்றவகையம்
Dominance ஓங்குத்தன்மை Purity of gametes இனச்செல்கலப்பற்றது
Duplication இரட்டிப்பாதல் Recessive ஒடுங்குத்தன்மை
F1 generation (first Repulsion விலகல்
முதல் மகவுச்சந்ததி
filial generation)
206

www.tntextbooks.in
Restriction enzymes தடைக்கட்டு ந�ொதிகள் Dedifferentiation வேறுபாடு இழத்தல்

Saltation திடீர் மாற்றம் Differentiation வேறபாடுறுதல்
Segregation தனித்தொதுங்குதல் DNA Bank DNA வங்கி

Downstream கீழ்காற் பதப்படுத்தம்
Sequence த�ொடர்வரிசை
Process
Sex linkage பால் பிணைப்பு Embryogenesis கரு உருவாக்கம்
Silent mutation அமைதி சடுதிமாற்றம் Embryoids சிறுகருக்கள்
Split genes பிளவுறு மரபணு Explant பிரிகூறு
Synaptonemal இணைப்பிணைப்புக் Fermentation ந�ொதித்தல்
complex கூட்டமைப்பு Gel Electrophoresis இழும மின்னாற் பிரித்தல்
Synopsis இணைச் சேர்தல் Gene மரபணு
Tassel seed கதிர் குஞ்சவிதை Gene Bank மரபணு வங்கி
Test cross ச�ோதனைக்கலப்பு Gene Gun மரபணு துப்பாக்கி
நான்மய நிலை Gene Manipulation மரபணு கையாளும்

Tetrad stage
Technique த�ொழில்நுட்பம்
Three point test முப்புள்ளி ச�ோதனைக்
Genetically மரபணு மாற்றப்பட்ட
cross கலப்பு
modified plants தாவரங்கள்
Translocation இடம்பெயர்தல்
Genome மரபணு த�ொகையம்
Green Fluorescence பசுமை ஒளிர் புரதம்
UNIT VIII - Biotechnology Protein
Hardening வன்மையாக்குதல்
Artificial seeds செயற்கை விதைகள் Human Genome மனித மரபணு த�ொகைய
Aseptic condition நுண்ணுயிர் அற்ற நிலை Sequence த�ொடர் வரிசை
Autoradiography கதிரியக்க படமெடுப்பு Inoculation உள்நுழைத்தல்
Insert செருகி
Biochip உயிரி சில்லு invitro culture ஆய்வுகூட ச�ோதனை
Biomass உயிரி கூளம் வளர்ப்பு
Biopharming உயிரி மருந்தாக்கம் Isolation தனிமைபடுத்துதல்
Biopiracy உயிரிப�ொருள் க�ொள்ளை Laminar air flow சீரடுக்கு காற்று பாய்வு
Bioreactor / உயிரி வினைகலன் / chamber அறை
Fermentor ந�ொதிகலன் Liquid medium/ திரவ ஊடகம் / திரவ
Biosynthesis உயிரி உற்பத்தி liquid culture வளர்ப்பு
Buffer தாங்கல் கரைசல் Marker அடையாளக்குறி
Carriers கடத்தி Microinjection நுண்செலுத்துதல்
Cloned Plants நகல�ொத்த தாவரங்கள் Micropropagation நுண்பெருக்கம்
Cloning நகல்பெருக்கம் Mycoremediation பூஞ்சை சீரமைப்பாக்கம்
Cloning Site நகலாக்க களம் Nutritional medium ஊட்ட ஊடகம்
Cryoconservation உறைகுளிர் வெப்பநிலை Organogenesis உறுப்புகளாக்கம்
பேணல் Palindrome முன்பின் ஒத்த வரிசை
Cybrids கலப்பின பிளாஸ்மிட்கள் Sequence
Phytoremediation தாவர சீரமைப்பாக்கம்
207

www.tntextbooks.in
Pollen Bank மகரந்த வங்கி Carbon foot print கார்பன் தடம்

Probe துருவி Carbon கார்பன் ஒதுக்கமடைதல்
Recombinant DNA மறுகூட்டிணைவு DNA sequestration
Recombinant மறுகூட்டிணைவு Carbon sink கார்பன் ேதக்கி
Redifferentiation மறுவேறுபாடுறுதல் Co-evolution கூட்டுப் பரிணாமம்
Regeneration மீள் உருவாக்கம்
Decomposers சிதைப்பவைகள்
Replica Blotting நகல் முலாம்
Technique த�ொழில்நுட்பம் Ecological சூழ்நிலைப்படிகள்
hierarchy
Restriction Enzyme தடை கட்டு ந�ொதி
Ecotone இடைச்சூழலமைப்பு
Somatic Embryoids உடல் கருவுருக்கள்
Sterile condition நுண்ணுயிர் நீக்கிய நிலை Ecotope சூழல் நில அமைவு
Sterilization நுண்ணுயிர் நீக்கம் Frugivores பழ உண்ணிகள்
Tissue culture திசு வளர்ப்பு Gnano கடல் அருகு வாழ்
Totipotency முழு ஆக்குத்திறன் பறவைகளின் எச்சம்
பெற்றவை Habitat புவி வாழிடம்
Transfection த�ொற்றுதல்
Humus மட்கு
Transposon இடமாற்றிக் கூறுகள்
Latitude விரிவகலம்
Upstream Process மேல்காற் பதப்படுத்தம்
Mimicry பாவனை செயல்கள்
Vector தாங்கி கடத்தி
Virus free plants வைரஸ் அற்றத் Niche செயல் வாழிடம்
தாவரங்கள் Ozone depletion ஓச�ோன் குறைதல்
Walking Genes நடக்கும் மரபணுக்கள் Photosyntheicaly ஒளிச்சேர்க்கை சார்
active radioactive செயலூக்கக் கதிர்வீச்சு
UNIT IX – Plant Ecology Plant Ecology தாவர சூழ்நிலையியல்
Predation க�ொன்றுண்ணும்
Agroforestry வாழ்க்கை முறை
வேளாண்காடுகள்
Alien Invasive Sacred groves க�ோயில் காடுகள்
அயல் ஊடுருவும்
species சிற்றினங்கள் Seedball விதைப்பந்து
Allelopathic வேதியத்தடைப் Social forestry சமூகக்காடுகள்
chemicals ப�ொருட்கள் Soil profile மண்ணின்
Altitude குத்துயரம் நெடுக்குவெட்டு விவரம்
Autecology சுய சூழ்நிலையில் Standing crops நிலைப்பயிர்
Benthic ஆழ்மிகு மண்டலம் Standing quality நிலைத்தரம்
Benthos ஆழ் உயிரிகள் Succession வழிமுறை வளர்ச்சி
Biochar உயிரித்தொகுப்பு Synecology கூட்டுச் சூழ்நிலையில்
Biome உயிர்மம் Topographic factors நிலப்பரப்பு
Biotope உயிரி நில அமைவு வடிவமைப்பு காரணிகள்
Trophic level ஊட்டஞ்சார் மட்டம்
208

www.tntextbooks.in
UNIT X - Economic Botany Competitive

Examination Questions
புதிய தட்பவெப்ப
Acclimatization UNIT VI – Reproduction in plants
நிலைக்கு பழகுதல்
Archeological 1. Which of the following plant reproduces by
த�ொல்லியல் பதிவுகள்
records leaf (DPMT 2003)
உயிரிமூலக்கூறு a) Agave b) Bryophyllum
Bio medicine
மருந்து c) Gladiolus d) Potato
Biofertilizers உயிரி உரம் 2. Advantage of cleistogamy (NEET 2013)
Culinary சமையல் a) Higher genetic variability
b) More vigorous offspring
Decoction வடிநீர்
c) No dependence on pollinators
வளர்ப்புச் சூழலுக்கு d) Vivipary
Domestification
உட்படுத்துதல்
3. An example for edible underground stem is
Emasculation மகரந்தத்தாள் நீக்கம் (NEET 2014)
Entrepreneur தொழில் முனைவோர் a) Carrot b) Groundnut
c) Sweet potato d) Potato
Essential oil நறுமண எண்ணெய்
4. Pollen tablets are available in the market for
Gluten பசையம்
(NEET 2014)
Green manuring தழை உரம் a) invitro fertilization
b) Breeding programmes
Kelp பழுப்பு பாசி
c) supplementing food
Organic agriculture இயற்கை வேளாண்மை d) ex situ conservation
Plant pathology தாவர ந�ோயியல் 5. Geitonogamy involves (NEET 2014)
Pseudo cereal ப�ொய் தானியம் a) Fertilization of a flower by pollen from
another flower of a same plant
Pungent நெடி (அல்லது) காரம்
b) Fertilization of a flower by pollen of the
Resin பிசின் same flower
Sapwood மென்கட்டை c) Fertilization of a flower by pollen from
a flower of another plant in a same
நிறைவுற்ற க�ொழுப்பு population
Saturated fatty acids
அமிலம்
d) Fertilization of a flower by the pollen
Stimulant தூண்டி from a flower of another plant belongs to
distant population.
Tillering புல் கிளைத்தல்
6. Which one of the following generates new
Unsaturated fatty நிறைவுறா க�ொழுப்பு
அமிலம்
genetic combinations leading to variations?
acids
(NEET 2016)
Vigour வீரியம் a) vegetative reproduction
எளிதில் ஆவியாகும் b) parthenogenesis
Volatile oil
எண்ணெய் c) Sexual reproduction
d) Nucellar polyembryony
209

www.tntextbooks.in
7.
Functional megaspore in angiosperm Function of filiform apparatus is to
13)
develops into an (NEET 2017) (AIPMT 2014)
a) endosperm b) Embryo sac a) recognize the suitable pollen at stigma
c) embryo d) ovule b) stimulate division of generative cell
c) produce nectar
Which of the statement is not true.
8.
d) guide the entry of pollen tube
(NEET 2016)
a) Pollen grain of many species cause severe The coconut water from tender coconut
14)
allergies represents (NEET 2016)
b) Stored pollen in liquid nitrogen can be a) endocarp
used in crop breeding programmes b) fleshy mesocarp
c) Tapetum helps in the dehiscence of c) free nuclear proembryo
anther d) free nuclear endosperm
d) Exine of pollen grains is made up of
15) Pollination in water hyacinth and water lily
sporopollenin
is brought about by the agency of
9)
When a diploid female plant is crossed (NEET 2016)
with a tetraploid male, the ploidy of a) insects or wind b) birds
endosperm cells in the resulting seed is c) bats d) water
(AIPMT 2004)
a) pentaploidy b) diploidy 16) Perisperm differs from endosperm in
c) triploidy d) tetraploidy (NEET 2013)
a) being haploid tissue
10)
Which one of the following pairs of b) having no reserve food
plant structures has haploid number of c) being a diploid tissue
chromosomes? (AIPMT 2008) d)
its formation by fusion of secondary
a) Egg nucleus and secondary nucleus nucleus with several sperms
b) Megaspore mother cell and antipodal cells
c) Egg cell and and antipodal cells 17) Male gametes in angiosperms are formed
d) Nucellus and antipodal cells by the division of (AIPMT 2007)
a) microspore mother cell b) microspore
The arrangement of nuclei in a normal
11) c) generative cell d) vegetative cell
embryo sac in the dicot plant is
(AIPMT 2006) 18) In a type of apomixes known as adventive
a) 2 + 4 + 2 b) 3 + 2 + 3 polyembryony,embryo develop directly
c) 2 + 3 + 3 d) 3 + 3 + 2 from the (AIPMT 2005)
a) synergids or antipodals in an embryo sac
12) Wind pollinated flowers are b) nucellus or integuments
(AIPMT PRE 2010) c) zygote
a) Small, producing nectar and dry pollen d) accessory embryo sac in the ovule
b) small, brightly colored, producing large
number of pollen grains 19) In a cereal grain the single cotyledon of the
c) small, producing large number of embryo is represented by (AIPMT 2006)
pollen grains a) coleorhizae b) scutellum
d)
large, producing abundant nectar and c) prophyll d) coleoptiles
pollen
210

www.tntextbooks.in
20) An ovule which becomes curved so that the 5. A Pleiotropic gene
nucellus and embryo sac lie at right angles (AIPMT 2015 – Re-exam)
to the funicle is (AIPMT 2004) a) Controls multiple traits in an individual
a) camylotropous b) anatropous b) Is expressed only in primitive plants
c) orthotropous d) hemianatropous c) Is a gene evolved during Pliocene
d) Controls a trait only in combination with
21) Endosperm is formed during the double
another L gene
fertilization by (AIPMT 2000)
a) two polar nuclei and one male gamete 6. A true breeding plant is
b) one polar nuclei and one male gamete (NEET Phase II 2016)
c) ovum and male gametes a) Near homozygous and produces
d) two polar nuclei and two male gametes offspring of its own kind
UNIT VII – Genetics b) Always homozygous recessive in its
genetic construction
1.
Genes for cytoplasmic male sterility c) One that is able to breed on its own
in plants are generally located in d) Produced due to cross pollination among
(AIPMT 2005) unrelated plants
a) Mitrochondrial genome b) Cytosol
7. Mendel obtained wrinkled seeds in pea due
c) Chloroplast genome d) Nuclear genome
to the deposition of sugars instead of starch.
2. In which mode of inheritance do you expect It was due to which enzyme?
more maternal influence among the off (AIPMT 2001)
spring (AIPMT 2006) a) Amylase b) Invertase c) Diastase
a) Autosomal b) Cytoplasmic d) Absence of starch branching enzyme
c) Y-linked d) X-linked
8. Ratio of complementary gene is
3.
Which one of the following cannot be
explained on the basis of Mendel’s Law of (AIPMT 2001)
Dominance? (AIPMT 2010) a) 9:3:4 b) 12:3:1 c) 9:3:3:4 d) 9:7
a) Factors occur in pairs
9. If there are 999 bases in an RNA that codes
b) The discrete unit controlling a particular
for a protein with 333 amino acid and the
character is called a factor
base at position 901 is deleted such that the
c) Out of one pair of factors one is dominant
length of the RNA becomes 998 bases, how
and the other is recessive
many codons will be altered?
d) Alleles does not show any blending and
(NEET 2017)
both the characters recover as such in
F2 generation a) 1 b) 11 c) 33 d) 333
4. F2 generation in a Mendelian cross shows 10.

If a homozygous red flowered plant is
that both genotypic and phenotypic ratios crossed with a homozygous white flowered
are same as 1:2:1. It represents a case of plant, then the off-springs will be
(AIPMT 2012) (AIIMS 1999, 2002, 2007)
a) Monohybrid crosses with incomplete a) Half-white flowered b) Half-red flowered
dominance c) All white flowered d) All red flowered
b) Co-dominance c) Dihybrid cross
11. The ratio in a dihyrbid test cross between
d) Monohybrid cross with complete
two individuals is given by (AIIMS 2001)
dominance
211

www.tntextbooks.in
a) 2:1 b) 1:2:1 c) 3:1 d) 1:1:1:1 17. The year 1900 AD is highly significant for
geneticists due to (JIPMER 2013)
12. Pure line breed refers to
a) Discovery of genes
(AIIMS 2002, AIIMS 2007) b) Principle of linkage
a) Heterozygosity only c) Chromosomal theory of heredity
b) Heterozygosity and linkage d) Rediscovery of Mendelism
c) Homozygosity only
d) Homozygosity and self assortment 18. The phenotypic ratio of trihybrid cross in F2
generation is (JIPMER 2016)
13. How many different types of gametes can a) 27:9:9:9:3:3:3:1 b) 9:3:3:1
be formed by F1 progeny, resulting from the c) 1:4:6:4:1 d) 27:9:3:3:9:1:2:1
following cross AABBCC x aabbcc
In a mutational event when adenine is
19.
(AIIMS 2004)
replaced by guanine, it is the case of
a) 3 b) 8 c) 27 d) 64 (AIPMT 2004)
Which of the following conditions
14. a) Frameshift mutatin b) Transcription
represents a case of co-dominant genes? c) Transition d) Transversion
(AIIMS 2009) 20. Mutations can be induced with
a) A gene expresses itself, suppressing the (AIPMT 2011)
phenotypic effect of its alleles a) Gamma radiations b) Infrared radiations
b) Genes that are similar in phenotypic c) IAA d) Ethylene
effect when present separately, but when 21. The mechanism that causes a gene to move
together interact to produce a different from one linkage group to another is called
trait
(AIPMT 2015, NEET (Phase – II) 2016)
c) Alleles both of which interact to produce
a) Translocation b) Crossing over
a trait which may or may not resemble
c) Inversion d) Duplication
either of the parental type
d) Alleles, each of which produces an A point mutation comprising the
22.
independent effect in a heterozygous substitution of a purine by pyrimidine is
condition. called (AIIMS 2002)
a) Transition b) Translocation
15. If ‘A’ represents the dominant gene and ‘a’
c) Deletion d) Transversion
represents its recessive allele, which of the
following would be most likely result in 23. Frameshift mutation occurs when
the first generation off spring when Aa is (AIPMT 2008)
crossed with aa? (AIIMS 2016) a) Base is substituted
a) All will exhibit dominant phenotype b) base is deleted or added
b) All will exhibit recessive phenotype c) Anticodons are absent
c) Dominant and recessive phenotypes d) None of these
will be 50% each The distance between two genes in a
24.
d) Dominant phenotype will be 75% chromosome is measured in cross-over
16. In Pisum Sativum, there are 14 chromosomes. units which represent (AIIMS 2008)
How many types of homologous pairs can a) Ratio of crossing over between them
be prepared? (JIPMER 2010) b) Percentage of crossing over between them
a) 14 b) 7 c) 214 d) 210 c) Number of crossing over between them
d) None of these
212

www.tntextbooks.in
25.
When a cluster of genes show linkage 31. Which of the following statement is not true
behaviour they (AIPMT 2003) of two genes that show 50% recombination
a) do not show a chromosome map frequency? (NEET 2013)
b) show recombination during meiosis a) The genes may be on different
c) do not show independent assortment chromosomes
d) induce cell division b) The genes are tightly linked
c) The genes show independent assortment
26. Genetic map is one that (AIPMT 2003)
d) If the genes are present on the same
a) Establish sites of the genes on a
chromosome, they undergo more than
chromosome
one crossover in every meiosis.
b) Establishes the various stages in gene
evolution 32. Haploids are more suitable for mutation
c) Shows the stages during the cell division studies than the diploids. This is because
d) Shows the distribution of various species (AIPMT 2008)
in a region a) All mutations, whether dominant or
27. After a mutation at a genetic locus of the recessive are expressed in haploids
character of an organism changes due to the b) Haploids are reproductively more stable
change in (AIPMT 2004) than diploids
a) DNA replication c)
Mutagens penetrate in haploids more
b) Protein synthesis pattern effectively than diploids
c) RNA transcription pattern d) Haploids are more abundant in nature
d) Protein structure than diploids
28. In a hexaploidy wheat, the haploid (n) and 33.
Crossing over that results in genetic
basic (x) numbers of chromosomes are recombination in higher organisms occurs
(AIPMT 2007) between (AIPMT 2004)
a) n =21 and x =7 b) n =7 and x =21 a) Non-sister chromatids of a bivalent
c) n =21 and x =21 d) n =21 and x =14 b) Two daughter nuclei
c) Two different bivalents
29. Point mutation involves (AIPMT 2009)
d) Sister chromatids of bivalents
a) Deletion b) Insertion
c) Change in single base pair
d) duplication UNIT VIII – Biotechnology
30.
Which one of the following is a wrong
statement regarding mutations? 1. What is the criterion for DNA fragments
movement on agarose gel during gel
(AIPMT 2012)
electrophoresis? (NEET 2017)
a) UV and Gamma rays are mutagens
a) The smaller the fragment size, the
b) Change in a single base pair of DNA
farther it moves.
does not cause mutation
b) Positively charged fragments move to
c) Deletion and insertion of base pairs cause
farther end.
frame shift mutations.
c) Negatively charged fragments do not
d) Cancer cells commonly show
move.
chromosomal aberrations.
d) The larger the fragment size, the farther
it moves.
213

www.tntextbooks.in
2. Stirred-tank bioreactors have been designed 8. During the process of isolation of DNA,
for (NEET – II 2016) chilled ethanol is added to
a) Purification of product. (Karnataka NEET 2013)
b) Addition of preservatives to the product a) Precipitate DNA
c) Availability of oxygen throughout the b) Break open the cell to release DNA
process c) Facilitate action of restriction enzymes
d) Ensuring anaerobic conditions in the d) Remove proteins such as histones.
culture vessel.
9. For transformation, micro-particles coated
3. Which of the following is not a component with DNA to be bombarded with gene gun
of downstream processing? (NEET-II 2016) are made up of (AIPMT 2012)
a) Separation b) Purification a) Silver or platinum b) Platinum or zinc
c) Preservation d) Expression c) Silicon or platinum d) Gold or tungsten.
4. Which of the following is not a feature of 10. Biolistics (gene-gun) is suitable for
the plasmids? (NEET-I 2016) (AIPMT Mains 2012)
a) Transferable b) Single-stranded a) disarming pathogen vectors
c) Independent replication b) transformation of plant cells
d) Circular structure c) constructing recombinant DNA by
joining with vectors
5. Which of the following is not required for
d) DNA fingerprinting.
nay of the techniques of DNA fingerprinting
available at present? (NEET-I 2016) 11. Genetic engineering is possible because
a) Restriction enzymes (CBSE 1998)
b) DNA-DNA hybridization a) phenomenon of transduction in bacteria
c) Polymerase chain reaction understood
d) Zinc finger analysis b) we can see DNA by electron microscope
c) we can cut DNA at specific sites by
6.
Which vector can clone only a small
endonuclease like DNAase I
fragment of DNA? (AIPMT 2014)
d) restriction endonuclease purified from
a) Bacterial artificial chromosome
bacteria can be used invitro
b) Yeast artificial chromosome
c) Plasmid d) Cosmid 12. Genetic Engineering is (BHU 2003)
a) Making artificial genes
7.
The colonies of recombinant bacteria
b) Hybridisation of DNA of one organism
appear white in contrast to blue colonies
to that of the others
of non-recombinant bacteria because of
c) Production of alcohol by using
(NEET 2013)
microorganisms
a) Insertional inactivation of alpha
d) Making artificial limbs, diagnostic
galactosidase in recombinant bacteria.
instruments such as ECG, EFG, etc.
b) Inactivation of glycosidase enzyme in
recombinant bacteria. 13. Ligase is used for (AMU 2006)
c) Non-recombinant bacteria containing a) Joining of two DNA fragments
beta galactosidase. b) Separating DNA
d) Insertional inactivation of alpha c) DNA polymerase reaction
galactosidase in non-recombinant bacteria. d) All of these
214

www.tntextbooks.in
14. In genetic engineering, gene of interest is a>b and d>c, was subjected to agarose
transferred to the host cell through a vector. gel electrophoresis. The position of these
Consider the following four agents (1-4) fragmets from cathode to anode sides of the
in this regard and select the correct option gel would be (DPMT 2010)
about which one or more of these can be a) b,a,c,d b) a,b,c,d
used as vectors c) c,b,a,d d) b,a,d,c
1. A bacterium 2. Plasmid 19. An analysis of chromosomal DNA using
3. Plasmodium 4. Bacteriophage the southern hybridisation technique does
(AIPMT Main 2010) not use (AIPMT 2014)
a) 1 and 4 only b) 2 and 4 only a) Electrophoresis
c) 1 only d) 1 and 3 only
b) Blotting
15. Given below is a sample of a portion of c) Autoradiography
DNA strand giving the base sequence on d) PCR
the opposite strands. What is so special
The colonies of recombinant bacteria
20.
shown in it? (AIPMT 2014)
appear white in contrast to blue colonies of
5’---GAATTC---3’ 3’---CTTAAG---5’
non- recombinant bacteria because of
a) Palindromic sequence of base pairs (NEET 2013)
b) Replication completed a) Non-recombinant bacteria containing
c) Deletion mutation beta galactosidase
d) Start codon at the 5’end b) Insertional inactivation of a-galactosidase
16. There is a restriction endonuclease called in non-recombinant bacteria
EcoRI. What does “co” part in it stand for ? c) Insertional inactivation of
(AIPMT 2011) b-galactosidase in recombinant
a) Coelom b) Colon bacteria
c) Coli d) Coenzyme d) Inactivation of glycosidase enzyme in
recombinant bacteria
17.
The figure below is the diagrammatic
representation of the vector pBR322. Which 21. Which one of the following palindromic
one of the given options correctly identifies base sequence in DNA can be easily cut
its certain components? (AIPMT 2012) at about the middle by some particular
restriction enzyme? (AIPMT 2010)
a) 5’CGTTCG3’ 3’ATCGTA 5’
b) 5’ GATATG 3’ 3’ CTACTA 5’
c) 5’ GAATTC 3’ 3’ CTTAAG 5’
d) 5’ CACGTA 3’ 3’ CTCAGT 5’
22.
Silencing of mRNA has been used in
producing transgenic plants resistant to
a) Ori-original restriction enzyme (AIPMT, 2011)
b) rop-reduced osmotic pressure a) Boll worms b) Nematodes
c) Hind III, EcoRI – selectable markers c) White rusts d) Bacterial blights
d) ampR, tetR – antibiotic resistance genes 23. Some of the characteristics of Bt cotton are
18.
A mixture containing DNA fragments (AIPMT,2010)
a,b,c,d with molecular weights of a+b=c, a) Long fibre and resistant to aphids
215

www.tntextbooks.in
b) Medium yield, long fibre and resistant to a) Theodore Schwann

beetle pests b) A.V. Leeuwenhoek
c)
High yield and production of toxic c) F.C. Steward
protein crystals which kill dipteran pests d) Robert Hooke
d) High yield and resistant to boll worms 30.
Tissue culture technique can produce
24. An improved variety of transgenic basmati infinite number of new plants from a small
rice (AIPMT,2010) parental tissue. The economic importance
a) Does not require chemical fertilisers and of the technique is raising. (Karnataka
growth hormones NEET 2013)
b) Gives high yield and is rich in a) genetically uniform population
vitamin A identical to the original parent.
c) Is completely resistant to all insect pests b) homozygous diploid plants
and diseases of paddy c) new species
d) Gives high yield but no characteristic d) variants through picking up somaclonal
aroma variations
25) Consumption of which one of the following 31.
Which of the following statements is
foods prevent the kind of blindness not true about somatic embryogenesis?
associated with vitamin A deficiency? (Karnataka NEET 2013).
(AIPMT 2012) a. The pattern of development of a somatic
a) Flavr Savr b) Canola embryo is comparable to that of a zygotic
c) Golden rice d) Bt brinjal embryo.
26. A protoplast is a cell (NEET 2016) b) Somatic embryos can develop from
a) undergoing division microspores.
c) Somatic embryo is induced usually by an
b)without cell wall
auxin such as 2, 4-D.
c) without plasma membrane
d) A somatic embryo develops from a
d) without nucleus.
somatic cell.
27. A technique of micropropagation is (NEET
32. Which one of the following is a case of
2015)
wrong matching? (AIPMT 2012)
a) Protoplast fusion
a) Somatic - Fusion of
b) embryo rescue
two diverse hybridization cells
c) somatic hybridization
b) Vector DNA - Site for tRNA
d) somatic embryogenesis
synthesis
28. To obtain virus-free healthy plants from a c) Micropropagation - in vitro
diseased one by tissue culture technique, production of plants in large numbers
which part/parts of the diseased plant will d) Callus - U n o r g a n i s e d
be taken? (AIPMT 2014) mass of cells produced in tissue culture.
a) Apical meristem only
33. Polyethylene glycol method is used for
b) Palisade parenchyma
(AIPMT 2010)
c) Both apical and axillary meristems
a) biodiesel production
d) Epidermis only.
b) seedless fruit production
29. Cellular totipotency was demonstrated by
c) energy production from sewage
(AIPMT 1991)
d) gene transfer without a vector.
216

www.tntextbooks.in
34. Somaclones are obtained by (AIPMT 2009) a) Aerenchyma - Opuntia

a) Plant breeding b) Age pyramid - Biome
b) Irradiation c) Parthenium - Threat to
c) genetic engineering
hysterophorus biodiversity
d) tissue culture. d) Stratification - Population
35. The technique of obtaining large number of
5. An association of individuals of different
plantlets by tissue culture method is called
a) Plantlet culture ( AIPMT 2005) species living in the same habitat and
b) Organ culture having functional interactions is
c) Micropropagation (Re-AIPMT 2015)
d) Macropropagation a) Population b) Ecological niche
36. Coconut milk is used in tissue culture in c) Biotic community d) Ecosystem
which present ( AIPMT 2000) 6. Roots play in significant role in absorption
a) cytokinin b) auxin
of water in (Re-AIPMT 2015)
c) gibberellins d) ethylene. a) Wheat b) Sunflower
37.
Haploid plants can be obtained by c) Pistia d) Pea
culturing. ( AIPMT 1994)
7. If we uncover half of the forest covering the
a) pollen grains b) root tips
earth, what crisis will be produced at most
c) young leaves d) endosperm.
and the first? (AIPMT 1996)
UNIT IX - Plant Ecology a. Some species will be extinct
b. Population and ecological imbalance will
Plants which produce characteristic
1. rise up
pneumatophores and show vivipary belong c. Energy crisis will occur
to (NEET 2017) d. Rest half forests will maintain this
a) Halophytes b) psammophytes imbalance.
c) hydrophytes d) mesophytes
8. Most animals are tree dwellers in a
2. Mycorrhizae are the example of (AIPMT 2015)
(NEET I 2017) a) Tropical rain forest
a) amensalism b) antibiosis b)Coniferous forest
c) mutualism d) fungistatis c) Thorn woodland
3. If ‘+’ sign is assigned to beneficial interaction, d) Temperate deciduous fo
‘-’ sign to detrimental and ‘0’ sign to neutral Cuscuta is an example of
9.
interaction, then the population interaction (AIPMT Mains 2012)
represented by ‘+’ ‘-’ refers to (NEET 2016) a) Ectoparasitism b) Brood parasitism
a) mutualism b) amensalism c) Predation d) Endoparasitism
c) commensalism d) parasitism
10.
Large woody vines are more commonly
Which of the following is correctly
4. found in (AIPMT Prelims 2011)
matched? (NEET Phase 2 – 2016) a) Alphine forests b) Temperate forests
c) Mangroves d) Tropical rain forests
217

www.tntextbooks.in
11. Niche overlap indicates 16. Secondary succession takes place on / in

(AIPMT Prelims 2006) (NEET 2015 cancelled)
a) Active co-operation between two species a) newly created pond b) newly cooled lava
c) bare rock d) degraded forest
b) Two different parasites on the same host
c) Sharing of one or more resources 17. In an ecosystem the rate of production of
between the two species organic matter during photosynthesis is
termed as (NEET 2015 cancelled)
d) Mutualism between two species
a) Secondary productivity
12.
Which one of the following pairs is b) net productivity
mismatched? (AIPMT Prelims 2005) c) Net primary productivity
a) Savanna – Acacia trees d) gross primary productivity
b) Prairie – Epiphytes 18. Natural reservoir of phosphorous is
c) Tundra – Permafrost (NEET 2013)
d) Coniferous forest – Evergreen trees a) rock b) fossils
c) sea water d) animal bones
13.
Which ecosystem has the maximum
biomass? (NEET 2017) 19. Secondary productivity is rate of formation
of new organic matter by (NEET 2013)
a) Grassland ecosystem
a) consumers b) decomposers
b) Pond ecosystem
c) producers d) parasites
c) Lake ecosystem
d) Forest ecosystem 20. Which one of the following processes during
decomposition is correctly described?
14. Which of the following would appear as the
(NEET 2013)
pioneer organisms on bare rocks?
a) Catabolism – Last step in the decomposition
(NEET 2016) under fully anaerobic condition
a) Mosses b) Green algae b) Leaching – Water soluble inorganic nutrient
c) Lichens d) Liverworts rise to the top layers of soil
15. In which of the following both pairs have c) Fragmentation – Carried out by organisms
correct combination? (NEET 2015) such as earthworms.
Gaseous nutrient Nitrogen and d) Humification – Leads to the accumulative
cycle Sulphur of a dark coloured substance humus which
a)
Sedimentary Carbon and undergoes microbial action in a very fast
nutrient cycle Phosphorous rate.
Gaseous nutrient Sulphur and
cycle Phosphorous 21.
Which one of the following is not a
b)
Sedimentary Carbon and functional unit of an ecosystem?
nutrient cycle Nitrogen (AIPMT 2012)
Gaseous Carbon and
a) Energy flow b) decomposition
nutrient cycle Nitrogen
c) c) Productivity d) stratification
Sedimentary Sulphur and
nutrient cycle Phosphorous 22. The upright pyramid of number is absent in
Gaseous nutrient Carbon and
(AIPMT 2012)
cycle Sulphur
d) a) Pond b) forest
Sedimentary Nitrogen and
nutrient cycle Phosphorous c) lake d) grassland
218

www.tntextbooks.in
23. The rate of formation of new organic matter 29.Match the following and select the correct
by rabbit in a grassland is called option (AIPMT 2014)
(Mains 2012) Column I Column II
a) net productivity (I) Earthworm (i) pioneer species
b) secondary productivity (II) Succession (ii) Detritivore
c) net primary productivity (III) Ecosystem service (iii) Natality
d) gross primary productivity (IV) Population growth (iv) Pollination
24. The second stage of hydrosere is occupied I II III IV
by plants like (Mains 2012) a) i ii iii iv
a) Azolla b) Typha b) iv i iii ii
c) Salix d) Vallisneria c) iii ii iv i
d) ii i iv iii
25. Which one of the following is a characteristic
feature of cropland ecosystem? 30.
Given below is a simplified model of
(NEET 2016) phosphorous cycling in a terrestrial
a) Ecological succession ecosystem with four blanks (A – D. Identify
b) Absence of soil organisms the blanks. (AIPMT 2014)
c) Least genetic diversity
Consumers C
d) Absence of weeds
26.
Most animals that live in deep oceanic
waters are (Re-AIPMT 2015) D
A
a) Detritivores
b) Primary consumers
c) Secondary consumers Uptake
Soil Solution
d) Tertiary consumers Run off
27. During ecological succession
(Re-AIPMT 2015) B
a) The changes lead to a community that is
in near equilibrium with the environment
A B C D
and is called pioneer community.
Rock
b) The gradual and predictable change in a) Detritus Litter fall Producers
minerals
species composition occurs in a given Rock
area. b) Litter fall Producers Detritus
minerals
c) The establishment of a new biotic community Rock
c) Detritus Producers Litter fall
is very fast in its primary phase. minerals
d) The number and types of animals remain Rock
d) Producers Litter fall Detritus
constant. minerals
28. The mass of living material at a trophic level 31. If 20 J of energy is trapped at producer level,
at a particular time is called (AIPMT 2015) then how much energy will be available to
a) Standing crop peacock as food in the following chain?
b) Gross primary productivity (AIPMT 2014)
c) Standing state Plant → Mice → Snake → Peacock
d) Net primary productivity a) 0.02 J b) 0.002 J
c) 0.2 J d) 0.0002 J
219

www.tntextbooks.in
32.
Given below is an imaginary pyramid 36. Of the total incident solar radiation the
of numbers. What could be one of the proportion of PAR is (AIPMT Prelims 2011)
possibilities about certain organisms at a) More than 80% b) About 70%
some of the different levels ? c) About 60% d) Less than 50%
(AIPMT Prelims 2012)
The breakdown of detritus into smaller
37.
TC 10 particles by earthworm is a process called
SC 50 (AIPMT Mains 2011)
a) Mineralisation b) Catabolism
PC 500 c) Humification d) Fragmentation
PP 1 38.
The biomass available for consumption
by the herbivores and the decomposers is
a) Level one PP is ‘pipal trees’ and the level
called (AIPMT Prelims 2010)
SC is ‘sheep’.
a) Gross primary productivity
b) Level PC is ‘rats’ and level SC is ‘cats’
c) Level PC is ‘insects’ and level SC is b) Net primary productivity
‘small insectivorous birds’ c) Secondary productivity
d) Level PP is ‘phytoplanktons’ in sea and d) Standing crop
‘whale’ on top level TC 39. The correct sequence of plants in a hydrosere
33. Which one of the following statements for is (AIPMT Prelims 2009)
pyramid of energy is incorrect, whereas the a) Volvox → Hydrilla → Pistia → Scirpus
remaining three are correct? (AIPMT → Lantana → Oak
Prelims 2011) b) Pistia→Volvox→Scirpus→Hydrilla→Oak
a) It is upright in shape
→ Lantana
b) Its base is broad
c) Oak→Lantana→Volvox→Hydrilla→Pistia
c) It shows energy content of different
→Scirpus
trophic level organisms
d) Oak→Lantana→Scirpus→Pistia→Hydrilla
d) It is inverted in shape
→Volvox
34. Which one of the following animals may
40. About 70% of the total global carbon is
occupy more than one trophic levels in the
found in (AIPMT Prelims 2008)
same ecosystem at the same time?
(AIPMT Mains 2011) a) Forests b) Grasslands
a) Goat b) Frog c) Agro ecosystems d) Oceans
c) Sparrow d) Lion Consider the following
41. statements
35. Both hydrarch and xerarch successions lead concerning food chains
to (AIPMT Mains 2011) Removal of 80% tigers from an area
i)
a) Highly dry conditions resulted in greatly increased growth of
b) Excessive wet conditions vegetation.
c) Medium water conditions Removal of most of the carnivores
ii)
d) Xeric conditions resulted in an increased population of
deers.
iii) The length of food chains is generally
limited to 3 – 4 trophic levels due to
220

www.tntextbooks.in
energy loss. 47. The ozone of atmosphere in which the ozone

iv) The length of food chains may vary from layer is present is called
2 to 8 trophic levels. (AIPMT 2014)
Which two of the above statements are a. ionosphere b. mesosphere
correct? (AIPMT Prelims 2008) c. stratosphere d. troposphere
a) i and ii b) ii and iii 48.
Which one of the following is a wrong
c) iii and iv d) i and iv statement? (AIPMT 2012)
a. Most of the forests have been lost in
42. Which one of the following is not used for
tropical areas.
construction of ecological pyramids?
b. Ozone in upper part of atmosphere is
(AIPMT Prelims 2006) harmful to animals.
a) Dry weight c. Greenhouse effect is a natural
2) Number of individuals phenomenon.
c) Rate of energy flow d.Eutrophication is a natural phenomenon
4) Fresh weight in freshwater bodies.
43. The UN Conference of Parties on climate 49. Good ozone is found in the (Mains 2011)
change in the year 2012 was held at (NEET a. mesosphere b.troposphere
2015) c. stratosphere d. ionosphere
a. Lima b. Warsaw 50.
Chipko movement was launched for the
c. Durban d. Doha. protection of (AIPMT 2009)
44. Which of the following are most suitable a. forests b. livestock
indicators of SO2 pollution in the c.wetlands d.grasslands
environment? ( NEET 2015) 51. Identify the correctly matched pair.
a. Algae b. Fungi (AIPMT 2005)
c. Lichens d. Conifers a. Basal convention -Biodiversity
45. Which of the following is not one of the conservation
prime health risks associated with greater b.Kyoto protocol -Climatic change
UV radiations through the atmosphere due c. Montreal protocol -Global warming
to depletion of stratospheric ozone? (NEET d. Ramsar convention -Ground water
2015) pollution
a. Damage to eyes
52.
Common indicator organism of water
b. Increased liver cancer
pollution is (AIPMT 2004)
c. Increased skin cancer d.
a. Lemna pancicostata
d. Reduced Immune system
b. Eichhornia crassipes
46. A location with luxuriant growth of lichens c. Escherichia coli
on the trees indicates that the d. Entamoeba histolytica
(AIPMT 2014)
53. Which country has the greatest contribution
a. trees are very healthy for the hole formation in ozone layer?
b. trees are heavily infested (AIPMT 1996)
c. location is highly polluted a. Russia b. Japan
d. location is not polluted. c. USA d Germany
221

www.tntextbooks.in
UNIT X - Economic Botany diverse alleles for all genes in a given crop is
called (NEET 2013)
1. The name of Dr. Norman Borlaug is a) cross hybridization among the selected
associated with (JIPMER 2007) parents
a) Green revolution b) evaluation is selection of parents
b) Yellow revolution c) germplasm collection
c) White revolution d) selection of superior recombinants
d) Blue revolution 16. An example for semi dwarf variety of wheat
2. Which of the following is generally used for is (HPPMT 2012)
induced mutageneis in crop plants a) IR 8 b) Sonalika
(JIPMER 2007) c) Triticum d) Saccharum
a) Alpha b) X-ray 17.

Himgiri developed by hybridization is
c) UV ray d) Gamma ray selection for disease resistance against rust
3. A man-made allopolyploid cereal crop is pathogen is a variety of (AIPMT 2011)
(OJEE 2010) a) Chilli b) Maize
a) Hordeum vulgare b) Triticale c) Sugarcane d) Wheat
c) Raphanus brassica d) Zee mays Breeding of crops with high levels of
18.
4.
Objective of plant breeding is minerals, vitamins and proteins is called
(MP PMT 2001) (CBSE AIPMT 2010)
a) better yield a) somatic hybridization
b) better quality b) biofortification
c) disease / stress resistance c) bio magnification
d) All of the above d) micro propagation
5. Selection is a method of (MP Pmet 2001) The reason for vegetatively reproducing
19.
a) cytology b) plant phycology crop plants to suit for maintaining hybrid
c) plant breeding d) genetics vigour is that (AIPMT 1998)
6. Green revolution in India occurred during a) they are more resistant to disease
( AIPMT 2012) b) once a desired hybrid produced, no
a) 1960’s b) 1970’s chances of losing it
c) 1980’s d) 1950’s c) they can be easily propagated
d) they have a longer life span.
7.
Jaya and ratna developed for green
revolution in India are the varieties of Wonder wheat is a new wheat variety
20.
(AIPMT 2011) developed by (AIIMS 2009)
a) maize b) rice a) Mexico’s International Wheat and
c) sugarcane d) wheat. Maize improvement centre
b) Indian National Botanical Research
9. First man-made cereal triticale is Institute
(HPMT 2008) c) Australian crop Improvement centre
a) Octaploid b) hexaploid d) African Crop Improvement centre
c) Both a & b d) diploid
11. In plant breeding programmes, the entire
collection (of plants / seeds) having all the
222

www.tntextbooks.in
HIGHER SECONDARY - SECOND YEAR

BIOLOGY: BOTANY PRACTICALS
INTRODUCTION
Laboratory is a place where ideas and concepts can be tested through experiments. Laboratory
investigations in biology increase the reasoning abilities, brings scientific attitude in a learner and also
helps in acquisition of skills of scientific processes. Hence, a biology student too, is obliged to attend
practical in laboratory with utmost sincerity, honesty and inquisitiveness. The practical work includes
 Study of permanent slides  Section, cutting and mounting

 Microscopic preparation of slides  Analysing the problem and solving it
 Study of preserved and fresh specimens  Physiological experiments, etc.
GENERAL INSTRUCTIONS
In order to perform experiments successfully, a learner needs to go to the Biology Laboratory well
prepared. This includes the following.
1. Laboratory record book
2. Dissection box
3. Laboratory manual
4. A laboratory coat or apron
5. A hand towel
6. Drawing pencil (HB) and pencil eraser to record various experiments and to draw diagrams
7. Any item more as per the instructions of the teacher
While in the laboratory, a student should be very careful and methodical. One should listen carefully
to the instructions given by the teacher / instructor before performing an experiment. Maintain a
complete silence and working atmosphere in the laboratory. Record keeping is most important in
practical. Diagrams should be correctly drawn and well labelled. Always get the signature of the
teacher in the practical note book on each day after the practical class.
However, it is important that every student of Botany / Biology may pay proper attention to the
practical work and should try to acquire basic laboratory skills and develop a keen sense of observation
and acquire a sound training in the reporting of the work done.
If the material suggested for a particular experiment is not available, a suitable alternate material
may be used.
223
TN_GOVT_XII_BIOLOGY_BOTANY_PRACTICAL_MANUAL_PAGES_239-258.indd 223 3/14/2020 12:12:57 PM

www.tntextbooks.in
BIOLOGY BOTANY PRACTICALS

MODEL QUESTION
Identify the given slide ‘A’ and give any two reasons. Draw a neat labelled
I.
diagram.
Identify the given specimen / model / photograph ‘B” and give any two
II.
reasons.
Analyse the given ecological / genetic problem ‘C’. Solve it by giving
III.
appropriate reasons.
Write the aim, procedure, observation and inference of the given
IV.
experiment ‘D’.
Identify the economically important plant product ‘E’. Mention its Botanical
V.
name, useful part and their uses.
MARKS ALLOTMENT-PRACTICAL EXAMINATION

Identification – ½ , Reason (any two) – ½ , Diagram – ½ ,
I. A 2
Labelling – ½
II. B Identification – ½ , Reason (any two) – ½ 1
Identification – ½ , Solve/ Construct– ½,
III. C 1½
Reason/ Observation and Inference/ Answer – ½
IV. D Aim – ½ , Procedure – ½ , Table (Observation and Inference) – ½ 1½
V. E Identification and Botanical name – ½ , Useful part – ½, use – ½. 1½
Total 7 ½ marks
Record 1 ½ marks
Skill 1 marks
Maximum marks 10 marks
224

www.tntextbooks.in
QUESTION No- I (A) - Preparation and Demonstration of Slides
Note: Teacher has to prepare a temporary slide using fresh specimen for demonstration. (During
examination permanent slides can be used if temporary slide preparation is not possible).
Exercise 1 T.S. of Mature anther
Exercise 2 L.S. of an Angiospermic ovule
Exercise 3 T.S. of Nerium leaf
QUESTION No- II (B) - Fresh or preserved specimens and Models / Photographs / Charts
Exercise 4 Adaptations of flowers for pollination by different agents – Wind, Insects.
Exercise 5 Structure of Dicotyledonous seed – Gram (Cicer).
Exercise 6 Picture of a vector (pBR 322)
Exercise 7 Plant tissue culture – Callus with plantlets
Exercise 8 Types of ecological pyramids – Number, Biomass, Energy
QUESTION No- III (C) - Problems – Genetics and Ecology
Exercise 9 To verify Mendel’s Monohybrid cross
Exercise 10 Analysis of seed sample to study Mendelian Dihybrid Ratio
Exercise 11 Flow of energy and Ten percent law
Determination of population density and percentage frequency of different plant species of

Exercise 12
given area by Quadrat method
Exercise 13 Chromosomal aberration – Deletion, Duplication, Inversion
Exercise 14 Genetic / Linkage maps
QUESTION No- IV (D) - Experiments
Exercise 15 Study of pollen germination on a slide
Exercise 16 Study of pH of different types of soils
Exercise 17 Isolation of DNA from plant material
QUESTION No- V (E) -Economic importance of plants
Economically important plant products and their uses:Sesame / Gingelly oil, Rubber, Aval
Exercise 18
(Flaked rice), Rose water, Henna powder,Aloe gel
225

www.tntextbooks.in
BIOLOGY BOTANY PRACTICALS
I - Preparation and Demonstration of Slides

Note: Teacher has to prepare a temporary slide using fresh specimen for demonstration.
(During examination permanent slides can be used if temporary slide preparation is not
possible)
Exercise 1: T.S of Anther
Aim: To study and identify the given slide – T.S of Anther

Principle: Androecium is made up of stamens. Each stamen possesses an anther and a filament.
Anther bears pollen grains which represent the male gametophyte.
Requirements: Anther of Datura metel, glycerine, safranin, slide, cover slip, blade, brush,
needle to prepare temporary slides, permanent slide of T.S. of mature anther and compound
microscope.
Collect buds and opened flowers of Datura metel. Dissect the stamens, separate the
anthers and take thin sections and observe the structure under the microscope.
Record the various stages of anther from your observation.
Diagnostic Features
Connective
• A mature anther is bilobed (dithecous) and the two
Epidermis
lobes are joined by a connective.
Endothecium
• Each anther lobe has two pollen chambers in which Middle layer
pollen grains are produced. Pollen grain
• A microsporangium or pollen sac is surrounded by Stomium
four wall layers. They are epidermis , endothecium,

middle layers and tapetum.
• Centre of the microsporangium (pollen sac) is filled
with haploid pollen grains. Figure 1: Pollen grain stage of anther
Exercise 2: L.S of an Angiospermic ovule.
Aim: To study and identify the L.S. of an Angiospermic Ovule.
Principle: In female reproductive part of a flower, the basal swollen part is ovary. The ovules are
present inside the ovary, later they develops to seed.
Requirement: Permanent slide of L.S. of Ovule, microscope
226

www.tntextbooks.in
Diagnostic Features
Chalazal end
• Ovule or megasporangium is protected by
one / two coverings called integuments.
Integument
• The stalk of the ovule is called funicle.
• The point of attachment of funicle to the
body of the ovule is known as hilum.
Nucellus
• The body of the ovule is made up of a
central mass of parenchymatous tissue
called nucellus.
Embryo sac
• The integuments form a pore called Hilum
micropyle and the region opposite to the
micropyle is called as chalaza.
Micropyle
• The nucellus has a large, oval, sac like
structure towards the micropylar end Funicle
called embryo sac.
• A mature ovule, has 8 nuclei in its embryo Vascular supply
sac. Figure 2: L.S of ovule
Exercise 3: T.S. of Nerium Leaf

Aim: To observe and understand the xerophytic adaptations found in Nerium leaves for living
in dry or xeric habitat.
Principle: The plants which are living in dry or xeric condition are known as Xerophytes.
Requirements: Nerium leaf, few pieces of carrot / pith / styrofoam, blade, brush, needle,
compound microscope, glycerine, coverslip, wash glass, microslide, saffranin solution, petri
dish, etc.
Start cutting transverse sections of

Thick cuticle
Nerium leaf placing it in between a piece Multi-layered epidermis
of carrot. Select the thinnest section of
the material with the help of a delicate brush. Palisade parenchyma
Take a clean watch glass with water, transfer
thin sections of the material. Put a few drops Spongy parenchyma
Stomata
of safranin stain in the watch glass with water. Guard cells
Leave it for 3-5 minutes. Drain off stain and wash Pit (Cavity)
with water if necessary. Put the thinnest section Trichomes (Hairs)
in the centre of the slide. Put a drop of glycerine
Lower epidermis
over the material. Cover it with a coverslip with
Cuticle
the help of needle. Observe it under a compound
microscope. Figure 3: T.S. of Nerium leaf
227

www.tntextbooks.in
Diagnostic Features
• Presence of multilayered epidermis with thick cuticle.
• Sunken stomata are present only in the lower epidermis.
• Mesophyll is well differentiated into palisade and spongy parenchyma.
• Mechanical tissues are well developed.
II - Fresh or preserved specimens and Models / Photographs / Charts
Exercise 4: Adaptations of flowers for pollination by different agents.
Aim: To study the adaptations in flowers for pollination by different agents (wind and insects)
Principle: The process of transfer of pollen grains from the anther to stigma of a flower is called
pollination.
Requirements: Fresh flowers of maize or any other cereal / gram, any insect pollination flowers
like Salvia, Calotropis, Ocimum and Asteraceae flowers.
Place the given flower on a slide and observe it with the help of hand lens. Note down the
adaptations of the flowers meant for pollination by the external agents.
5 A. Wind Pollinated Flowers - Anemophily Male inflorescence (Tassel)
Diagnostic Features Female inflorescence(Cob)
• The flowers are small, inconspicuous, colourless, odourless

and nectarless. Silk
• Anthers and stigmas are commonly exerted.

• Pollen grains are light, small, powdery and produced in
large numbers.
• The stigmas are large, sometimes feathery and branched
adapted to catch the pollens. Figure 4a: Maize
5 B. Insect Pollinated Flowers - Entemophily
Diagnostic Features
• The flowers are showy,
brightly coloured and scented.
Disc
• The flowers produce nectar or edible Retinaculum
Pollinium
pollen.
• Anthers and stigmas are commonly
inserted.
• Stigmas are usually unbranched and flat or lobed. Figure 4b: Calotropis
228

www.tntextbooks.in
Exercise 5: Dicot seed
Aim: To study and identify the Dicot seed

Principle: The fertilized ovule is called seed and possesses an embryo, endosperm and a
protective coat. Seeds may be endospermous or non endospermous.
Requirements: Chick pea, bowl, water
Soak the seeds of chick pea or gram in water for 2 – 3 hours. Drain the water and place the
seeds in a moist cotton cloth for 2 – 3 days. Observe for germination. Select some sprouted
seeds, observe under a dissection microscope and record the parts.
Diagnostic Features Testa

Radicle
• Seeds of gram have two cotyledons and an embryonal

axis. Testa
• Each seed is covered by two seed coats (a) Testa –
Seed entire
outer coat and (b) Tegmen – inner coat.
Cotyledon
• The embryonal axis consists of radicle and plumule. Plumule
• The portion of the embryonal axis above the level of

cotyledons is called epicotyl. It terminates into the Testa
plumule. Radicle
• The portion of the embryonal axis below the level of Seed cut opened
cotyledons is called hypocotyl. It terminates into the a) Dicot seed (Cicer arientinum)
Figure 5: Dicot seed – Gram (Cicer)
radicle or root tip.
Exercise 6: E.coli cloning vector (pBR 322) Fruit (Caryopsis) entire
Aim: To study and identify the features of cloning vector – pBR 322
Principle: Vectors are used as carriers to deliver the desired foreign DNA into a host cell.
Endosperm
Requirements: Models/ Photographs / Pictures of E.coli Cloning vector pBR 322.
Scutellum
Coleoptile
Diagnostic Features (FR5, +LQG,,,
Shoot apex
• pBR 322 plasmid is a reconstructed plasmid containing 4361 base Radicle %DP+,
pairs and most widely used as cloning vector. DPSRoot
5 cap
WHW5
Coleorhiza
L.s. of fruit
• In pBR, p denotes plasmid and B and R respectively the notes S%5
of scientists Boliver and Rodriguez who developed the plasmid.b) Monocot seed (Oryza sativa)
RUL URS
The number 322 is the number of plasmids developed from theirFigure 2.25 Structure of seed
laboratory. 3YX,,
• It contains two different antibiotic resistance genes and recognition Figure 6: E-coli cloning
site for several restriction enzymes (Hind III, Eco R I, Bam H I, Sal vector (pBR 322)
I, Pvu II, Pst I, Cla I), Ori and antibiotic resistance genes (ampR and
tetR). Rop codes for the proteins involved in the replication of the plasmid.
229

www.tntextbooks.in
Exercise 7: Plant tissue culture – Callus with plantlets
Aim: To study and identify the Callus with plantlets.

Principle: Growing the plant cells, tissues and organs in an artificial, synthetic medium
under controlled conditions is called plant tissue culture. The technique of cloning plant
is easier than animals because plant cells are simple in structure and most plant cells
shows totipotency (i.e) ability to regenerate from cells.
Requirements: Model / Photograph / Picture of callus with plantlets.
Diagnostic Features
• The callus is an unorganized mass of undifferentiated

tissue.
• The mechanism of callus formation is that auxin
induce cell elongation and cytokinin induces cell
Callus culture
division as a result of which masses of cells are Further culturing
formed. regenerated new plantlet
• Roots and shoots are differentiated from the callus. Figure 7: Callus with plantlets
Exercise 8: Types of ecological pyramid
Aim: To study and identify the different types of ecological pyramids

Principle: The relationship between different trophic levels in an ecosystem when
shown diagrammatically appear as ‘ecological pyramids’. In these ecological pyramids,
the successive tiers represent successive trophic levels towards the apex. The base of the
pyramid is of producers, the next one above it is of herbivores and the top tiers are of
carnivores. The top most or apex represents the tertiary or top level consumers.
Requirements: Models / Photographs / Pictures of different types of ecological pyramid.
8 A. Pyramid of numbers
Diagnostic Features T4
• The number of organism that are present in successive T

trophic levels of an ecosystem is shown in the pyramid of
3
numbers of a grassland ecosystem. T 2
• There is a gradual decrease in the number of organisms in T 1
each trophic level from producers to primary consumers,

then to secondary consumer, and finally to tertiary Figure 8 a: Pyramid of numbers in
consumers. grassland ecosystem
• Therefore, pyramid of number in grassland ecosystem is always upright.
230

www.tntextbooks.in
8 B. Pyramid of biomass T3
Diagnostic Features T2
• Pyramid of biomass represents the total biomass or standing crop

(dry weight) of organisms in each trophic level at a particular time.
• In aquatic ecosystem, the bottom of the pyramid is occupied by T1
the producers, which comprises very small organisms (algae and

phytoplanktons) possessing the least biomass and so the value Figure 8 b: Pyramid
gradually increases towards the tip of the pyramid. of biomass in aquatic
• Therefore, here the pyramid of biomass is always inverted in shape. ecosystem
T1 - Producers | T2 - Herbivores | T3 - Secondary consumers |
8 C. Pyramid of energy
Diagnostic Features Tertiary
consumers
0.1 Joule
• Pyramid of energy represents the number of joules 1 Joule
transferred from one trophic level to next. Secondary consumers
10 Joules
• The bottom of the pyramid of energy is occupied by the
producers. There is a gradual decrease in energy transfer Sunlight Primary consumers
at successive trophic levels from producers to the upper

1000 Joules
100 Joules
Producers
levels.
Figure 8 c: Pyramid of Energy
• Therefore pyramid of energy is always upright.
III - Solving the Problems

Exercise 9: To verify Mendel’s Monohybrid cross
NOTE: Student have to work in pairs to perform this experiment and record the data in the
observation and record note book with the help of the teacher.
Need not consider this Monohybrid cross experiment for Board Practical Examination.
Aim:
To verify Mendel’s Monohybrid cross.
Principle:
When two purelines with contrasting traits of a particular character (phenotype) are crossed to produce
the next generation (F1 generation), all the members of the progeny are of only one phenotype, i.e.
of one of the two parents. The phenotype that appears is called dominant and the one that does not
appear is called recessive. When the F1 plants are selfed, the progeny i.e. the F2 generation, is in the
ratio of 3 dominant : 1 recessive (¾ : ¼ of 75% : 25%). This reappearance of the recessive phenotype in
F2 generation, verifies Mendel’s Monohybrid cross.
Requirements:
64 yellow and 64 green plastic beads, all of exactly same shape and size (when beads are not available,
pea seeds may be painted and used). Plastic beakers, petri dish and a napkin / hand towel.
231

www.tntextbooks.in
Procedure
Make the student to work in pairs to perform the Parents Pure Yellow x Pure Green
YY yy
experiment. Follow the steps in given sequence.
1. Put 64 yellow beads in one beaker and 64 green Gametes Y Y y y
beads in the other to represent male and female
gametes respectively. Let the yellow bead be F1 generation Yy Hybrid Yellow seeds
indicated by ‘Y’ and the green bead by ‘y’

Selfing of F1 plants Yy x Yy
2. Take a bead from each container and place them
together (it represents fertilization) on the hand Gametes Y y Y y
towel spread before you on the table.
Just like the previous step, continue to pick
3. F2 generation YY Yy yY yy
beads and arrange them in pairs. Thus 64
Pure Hybrid Pure
pairs of beads are obtained representing the 64 Yellow 25% Yellow 50% Green 25%
heterozygous F1 progeny.
4. Put 32 F1 progeny in one petridish and the Figure 9 : Monohybrid cross
remaining 32 in another petridish (representing the F1 males and females).
5. To obtain the F2 generation, the student should withdraw one bead from one beaker labelled male
and one from the other beaker labelled female keeping his / her eyes closed (to ensure randomness)
and put them together on the hand towel spread over the table. Continue this process till all the
beads are paired. Thus 64 offsprings of F2 progeny are obtained.
6. Note the genotype (YY or Yy or yy) of each pair and their possible phenotype.
7. Pool all the data and calculate the genotypic and phenotypic ratios.
Observation:
Record the result in the following table:
Total Number of Genotypes
Generation Phenotype(s)
individuals YY Yy yy
F1
Total
F2
Total
Phenotypic ratio : in F1
in F2
Genotypic ratio : in F1
in F2
Inference:
The results are so because when the F1 individuals are crossed together to raise the F2 generation, each
F1 individual produces two types of gametes: 50% having dominant allele and the remaining 50%
having recessive allele. These gametes undergo random fusion during fertilization to produce the F2
generation. According to simple probability of mixing of opposite sex gametes, offsprings of three
genotypes are likely to appear as follows:
Among these, proportion of dominant phenotype would be YY + Yy = yellow and recessive phenotype
yy = green, which occur in 3 : 1 or 75% : 25% ratio.
232

www.tntextbooks.in
This ratio of 3 :1 in the F2 suggests that the hybrids or heterozygotes of F1 generation have two
contrasting factors or alleles of dominant and recessive type. These factors, though remain together
for a long time, do not contaminate or mix with each other. They separate or segregate at the time of
gamete formation so that a gamete carries only one factor, either dominat or recessive.
Precautions:
1. Take a sufficiently large number of seeds for analysis to minimise the error.
2. Observe the contrasting form of trait carefully.
Exercise 10: Analysis of seed sample to study Mendelian dihybrid ratio
Aim: P Generation Parent 1 Parent 2
To analyse seed sample of pea for Mendelian dihybrid Round yellow cotyledon X Wrinkled green cotyledon
ratio of 9 : 3 : 3 : 1.
RR YY rr yy
Principle:
F1 generation R r Yy
In a dihyrbid cross, the segregation of one gene pair
All round-yellow cotyledons
is independent of the segregation of the other pair.
It means that when the factors (genes) for different F1 Generation Round yellow cotyledon X Round yellow cotyledon
(selfed) R r Yy R r Yy
characters inherited from parents do not remain
linked in the offsprings, but their distribution in the RY Ry rY ry
gametes and in the progeny of subsequent generations R Y RR YY RR Yy Rr YY Rr Yy
is independent of each other. F2 Generation R y RR Yy RR yy Rr Yy Rr yy
rY Rr YY Rr Yy rr YY rr Yy
Requirement: r y Rr Yy Rr yy rr Yy rr yy
Plastic beakers, Pea seed samples or plastic beads, tray, Phenotypic Ratio 9:3:3:1
petri dishes, notebook, pencil / pen. Figure 10 : Dihybrid cross
Teachers should select the Pea seed or plastic beads which represents the four types of traits such
as yellow round, yellow wrinkled, green round and green wrinkled in the ratio of 9:3:3:1
Procedure:
1. Take a lot of about 160 Pea seeds or plastic beads in a tray.
2. Separate out yellow round, yellow wrinkled, green round and green wrinkled and put them in
separate petridishes.
3. Note down the number of seeds in each plate and find out their approximate ratio.
Observation:
Present your finding in the form of a table.
Total Number of No. of yellow No. of yellow No. of green No. of green Approximate
seeds observed round seeds wrinkled seeds round seeds wrinkled seeds ratio
160 90 30 30 10 9 : 3:3:1
Inference:
The ratio of yellow round : yellow wrinkled : Green round : green wrinkled is approximately 9 : 3 : 3 : 1
which is exactly the same as obtained by Mendel for a dihybrid cross. This indicates that the contrasting
genes for seed colour and seed shape show an independent assortment in the population of pea seeds.
233

www.tntextbooks.in
Exercise 11: Flow of energy and Ten percent law
Aim:
To understand the unidirectional flow of energy 270 Joules
in an ecosystem and transfer of energy follows the

Tertiary Energy lost
consumers
30 Joules
10% law. 300 Joules
2700 Joules
Energy lost
Principle: Secondary consumers
The student studies about flow of energy and that 3000 Joules
27000 Joules
only about 10% of energy is made available to the

Energy lost
next trophic level. Large amount of energy about

Sunlight Primary consumers
270000 Joules
90% is lost at each trophic level in a food chain.

Energy lost
300000 30000 Joules
Joules
Producers
Requirements:
Problems to be given to students based on different Figure 11: Ten percent law
examples with alternating food chain and amount of energy.
The teacher must train the student by giving them various kinds of food chain with different
values.
Problem
Analyse the food chain given below and find out the amount of energy received by the organism in
third trophic level.
Sun
Grass receives 30,000. J of energy from sun

Grass Rabbit Snake Eagle
Given: The amount of energy in the producers, i.e. grass = 30,000 J.
Solution:
Grass Rabbit Snake Eagle
T1 T2 T3 T4
Producer Primary Consumer Secondary Consumer Tertiary Consumer
T1 – Grass (Producer) = 30,000 J of energy

T2 – Rabbit (Primary Consumer) = ?
T3 – Snake (Secondary Consumer) = ?
According to the ten percent law, during the transfer of energy, only about 10% of the energy flows
from each trophic level to the next lower trophic level. So 10% of energy from T1 gets transferred to T2
10
So T2 - Rabbit (primary consumer) receives 30000 X = 3000 J
100
Similarly, 10% of energy from T2 gets transferred to T3
So T3 – Snake (Secondary consumer) receives 10
3000 X = 300 J
100
Answer:
1. The third tropic level T3 – (Snake) receives 300 J of energy.
234

www.tntextbooks.in
Exercise 12: Determination of Population density and Percentage frequency by Quadrat

method.
NOTE: Teachers can take the students to open space and teach them how to construct plot/
quadrats and to record the number of individuals of each plant species occurring in the quadrat.
The percentage frequency should be calculated and entered in the practical observation and
record note book. Examiner need not consider this experiment for Board Practical Examinations.
Aim:
To study population density and percentage frequency of different plant species of a given area by
quadrat method.
Principle:
The number of individuals in a population never remains constant. It may increase or decrease due
to many factors like birth rate, death rate, migration, etc. The number of individuals of a species
presents per unit area or space of a given time is called population density. The population density
and percentage frequency of different plant species can be determined by laying quadrats / segments
of suitable size and recording of the number of individuals of each species occurring in the quadrat.
Requirements:
Metre scale, string or cord, hammer, nails, paper, pencil, etc.
Procedure:
1. In the selected site of study, hammer the nails firmly in the soil without damaging the vegetation.
2. Fix four nails to make a square plot.
3. Tie each end of the nails using a thread, to make 1 m X 1 m plot.
4. If the number of plants in the plot is large, the plot can be divided into quadrats.
5. Count the number of individuals of a species “A” present in the first quadrat and record the data
in the table.
6. Similarly count the individuals of the species “A” in other quadrats respectively and record the data
in the table.
7. Count the number of individuals of a species “B” present in the all quadrats and record the data
in the table.
8. Repeat the same procedure for other species and record the data in the table.
Nail
Species No. 1 Species No. 3
Species No. 2 Species No. 4

Quadrat I Quadrat II Species No. 5
1m
String
Quadrat III Quadrat IV

Nail
1m Plants outside the quadrat
A plot Figure 12: Occurrance of plant species in a quadrat

235

www.tntextbooks.in
Total number of individuals in all the quadrats studied

Population Density =
Total number of quadrats studied
Total number of quadrats in which species occurred

Percentage frequency = X 100
Total number of quadrats studied
Observation and Inference:
Different plant species, their population density and percentage frequency occurring in a given area.
No. of individuals
Total number of Total number of Total Population Frequency
Plant species
per quadrat
individuals in quadrats in which Number of
S. No.
Density percentage
all the quadrats each species quadrats
I II III IV (N/B) (A/B) x 100
studied (N) occurred (A) studied (B)
1
2
3
4
5
Precautions:
1. The measurement of quadrat should be accurate.
2. The string or cord used should not be very thick.
Exercise 13: Chromosomal aberrations – Deletion, Duplication and Inversion

Problem:
Given below is the representation of a kind of chromosomal aberration such as deletion, duplication
and inversion. Identify and give reasons for identification. Also mentions its significance.
Aim:
To understand the abnormality in the chromosomal structure in an organism.
Principle:
To study about the chromosomal aberration which can occur due to ionizing radiations or chemicals.
On the basis of breaks and reunions in the chromosomal segment different types of aberrations can
be recognized.
Requirements:
Copper wire, Alphabets marked ( A to H ) yellow colour beads denotes gene, and red colour bead
without alphabet denote centromere. Using this materials make different kinds of chromosomal
segments with specific gene sequence, that can be given to the students and asked to analyse the
aberration involved in it.
Procedure:
1. Make a normal chromosome model using copper wire and yellow beads and place it on the table.
In the model chromosome with gene sequence A to H, along with centromere ( red bead).
2. For Deletion - Give yellow colour beads without one or more marked alphabets A to H (The lack
236

www.tntextbooks.in
of any one or more beads denotes deletion type of chromosomal aberration).

3. For Duplication – Give yellow colour beads with addition of one or more marked alphabets A to
H (The repetition of one or more beads denotes duplication type of chromosomal aberration).
4. For Inversion – Give yellow colour beads which marked alphabets from A to H as in normal
chromosome. (There is no addition or deletion of beads (A to H) given, so the students can
construct the inverted segment of the chromosome using the given beads).
Based on the type of beads given the student has to identify and
construct the relevant chromosomal aberration. A
B A
13 A. Chromosomal Aberration – Deletion C
B
B
Deletion of Deletion of
segment C segment
Reasons: D A D C
D
1.
The deletion of the chromosomal segement A and D. E E
E
(Refer figure 13a) F
F
F
G G
2. When there is a loss of a segment of the genetic material in a H G
H
H
I I
chromosome it is called deletion. I
Terminal Normal Intercalary
Significance: deletion Chromosome deletion
Most of the deletions lead to death of an organism. Figure: 13 a: Deletion
Duplications
13 B. Chromosomal Aberration - Duplication A A A A
B B B B
Reasons: C C C C
1. When a segment of a chromosome is present more than once in a chromosome, D
E
B
C
C
B
D
then it is called duplication (Tandem duplication) F

G
D D F
G
E E
2. The order of the genes in a chromosome is A, B, C, D, E, F, G, H and I. Due H
I F F
B
C
to aberration, the genes B and C are duplicated and the sequence of genes
G G
H H H
I I
becomes A, B, C, B, C, D, E, F, G, H and I. (Refer figure 13b)
I
Normal Tandem Reverse Displaced

chromosome tandem tandem
Significance:
Figure 13 b:
Some duplications are useful in the evolution of the organism. Duplication
13 C. Chromosomal Aberration - Inversion

A A A A
Problem: B D D B B
C C
Given below is the representation of a kind of chromosomal C C C
F
F
B B D
D
aberration. Identify it giving reasons for your identification. E E
E
E
E
Also mentions its significance. F F F
D
D
G G G
G
Identification: H H H H
I I I
I
The given genetic problem is identified as inversion type of a) Paracentric inversion b) Pericentric inversion
(does not include centromere) (includes centromere)
chromosomal aberration.
Figure: 13 c: Inversion
Reasons:
1. When the order of genes in a chromosomal segment is reversed due to rotation by an angle of 180°,
it is called inversion.
2. The order of genes in a chromosome is A, B, C, D, E, F, G, H and I. Due to aberration, the sequence
of genes become A, D, C, B, E, F, G, H and I (Refer figure 13c)
237

www.tntextbooks.in
Significance:
Sometimes inversion is responsible for evolution of the organism.
NOTE: Likewise the teacher can give different types of chromosomal aberrations with various
gene sequence to students for practise. The external examiner can also use the same technique
by giving different gene sequence.
Exercise 14: Genetic / linkage maps

Aim:
To understand the frequency of recombination between the gene pairs on the same chromosome.
Principle:
To analyse the relative distance between the various genes and map their position in the chromosome,
which is called genetic or linkage maps.
Requirements:
Different kinds of linkage / genetic maps can be constructed by giving the students the relative distance
between the linked genes of a chromosome. A diagrammatic representation can be drawn showing
the location and arrangement of genes and their relative distance between them.
Solve the Problem
Problem: There are three linked genes A, B and C in a chromosome. Percentage of crossing over
(recombination frequency) between A and B is 20, B and C is 28 and A and C is 8. What is the
sequence of genes on the linkage map?
Given: Percentage of crossing over between the 3 linked genes A – B = 20%, B – C = 28% and A – C = 8%.
Solution
28%
B A C
20% 8%
Figure 14: Linkage Map
Reasons:
1. The frequency of crossing over is directly proportional to the relative distance of the genes on the
chromosomes.
2. More crossing over = More distance between two genes and
Less crossing over = Less distance between the two genes.
In the above problem, the sequence of the genes on the linkage map is B, A, C
NOTE: Teachers can give different crossing over percentage between its linked genes in a
chromosome and make the students construct the linkage maps. The external examiner can
also do the same for the Board Practical Examinations.
238

www.tntextbooks.in
IV - Experiments
Exercise 15: Study of Pollen germination on a slide
NOTE: Pollen germination can be studied by dusting some pollens from common flowers like
Crotalaria, Hibiscus, Pisum, etc. on a glass slide containing a drop of 10% sugar solution or
tender coconut water or any nutrient medium.
Observe the slide after about 10 – 15 minutes under the low power of compound microscope.
You will be able to observe the pollen tubes coming out of the pollen grains.
Aim: To study the pollen germination on a slide. (a)

Vegetative cell
Requirements: Fresh seasonal flowers, cavity slide, cover slip, compound Generative cell
microscope, sucrose, boric acid, distilled water, beakers, etc. (b)
Procedure: Generative nucleus
1. Prepare a nutrient solution by dissolving 1 gm. of sucrose / 1 gm. of boric Pollen tube
Tube nucleus
acid in 100 ml. of distilled water. (c)

2. Take a clean cavity slide and put a few drops of nutrient solution in the
cavity of the slide.
3. Dust a few pollen grains from the stamen of a mature flower on it. Male gametes
4. View the slide in the microscope after 5 minutes and then observe it
Tube nucleus
regularly for about half an hour.
Figure 15: Pollen
Observation: In nutrient medium, the pollen grains germinate. The tube cell germination
enlarges and comes out of the pollen grain through one of the germ pores to
form a pollen tube. The tube nucleus descends to the tip of the pollen tube. The
generative cell also passes into it. It soon divides into two male gametes.
Inference: Different stages of germinating pollens are observed. Some pollens are in their initial
stage of germination while others have quite long pollen tube containing tube nucleus and two
male gametes.
Precautions: 1. Flowers should be freshly plucked. 2. Use clean cavity slide to observe the pollen
grains. 3. The slides should not be disturbed, otherwise position of pollen grains will get changed.
Exercise 16: Study of pH of different types of soil

Some nutrients become toxic in higher concentration. Therefore pH of the soil is an important
chemical property of the soil. Plants thrive well in neutral or slightly acidic soils. The pH of the
soil determines the types of soil organisms and also controls the solubility of different nutrients.
The pH of soil ranges from 0 - 14.
a. pH level 7 - Neutral soil
b. pH level below 7 - Acidic soil
c. pH level above 7 -Alkaline soil
d. Optimum pH for plant growth ranges from 5.5 to 7.
Most plants thrive best in neutral pH. Slight acidity favours tree growth and forms forests.
Slight alkalinity is favourable for grasses and legume crops.
239

www.tntextbooks.in
Aim:
To study pH of different types of soil.
Requirements:
Soil samples (from two different sites such as crop soil, garden
soil, roadside soil, pond soil, river bank soil), test tubes, funnel,
filter papers, pH papers of different range, distilled water, beaker.
Procedure: Figure 16: Study of pH of
Dissolve one tablespoon or 1 gram of soil from each soil sample different types of soil
in 100 ml of distilled water in separate beakers. Stir the solutions
well and keep aside for half an hour to settle down the suspended
particles. Filter off each solution separately in different test tubes. Dip a small piece of broad range
pH paper on each of the solution. Match the colour of the pH paper with the colour scale given on the
pH paper booklet. This gives an approximate pH.
Observation:
Record the pH of different soil samples in the observation table.
S. No. Soil sample pH Value
1
2
3
Inference:
Thus the pH value of different soil samples required for plant growth can be determined.
Precautions:
1. Wash the glassware thoroughly and get it dried before the experiment.
2. Dry the pH papers before comparing the colour with the colour scale.
3. Match the colour carefully and determine pH accurately.
Exercise 17: Isolation of DNA from plant materials
DNA is one of the nucleic acids found in living systems. DNA acts as the genetic material in
most of the organisms.
Principle: Recombinant DNA technology has allowed breeders to introduce foreign DNA
in other organisms including bacteria, yeast, plants and animals. Such organisms are called
Genetically Modified Organisms (GMOs). Thus rDNA technology involves isolation of DNA
from a variety of sources and formation of new combination of DNA.
Aim: To isolate DNA from available plant materials such as spinach leaves, fresh green pea seeds,
green papaya, etc.
Requirements: Plant materials, mortar and pestle, beakers, test tubes, ethanol, etc.
Procedure: Take a small amount of plant material and grind it in a mortar with a little amount of
water and sodium chloride. Make it into a solution and filter it. To this filterate, add liquid soap
solution or any detergent solution and mix it with a glass rod. Then tilt the test tube and add
240

www.tntextbooks.in
chilled ethanol and leave it aside in the stand. After half-an-hour

we can observe the precipitated DNA as fine threads. DNA that
separates can be removed by spooling
Observation: DNA appears as white precipitate of very fine
threads on the spool.
Inference: Thus DNA can be isolated from the plant cell nucleus
by this technique.
Figure 22: Isolation of DNA
Precautions:
1. All the glasswares must be thoroughly cleaned and dried.
2. The chemicals used for the experiments must be of standard quality.
3. If ordinary ethanol is used, the time duration for obtaining precipitated DNA may extend further.
V - Economic Importance of Plants

Exercise 18: Economically important plant products
S. Identification Botanical Useful

Uses
no (Product name) Name parts
1. Sesame/ Sesamum Seeds 1. Sesame oil is mostly used for culinary purposes.
Gingelly oil indicum 2. Lower grades are used in manufacture of soaps, in paint
industries, as a lubricant and as an illuminant.
2. Rubber Hevea Latex 1. Rubber is used in the manufacture of footwear, wire and cable
brasiliensis insulations, rain coat, sports goods, erasers, adhesives, rubber
bands, household and hospital goods and shock absorbers.
2. Concentrated latex is used for making gloves and balloons.
3. Foamed latex is used in the manufacture of cushions, pillows
and life-belts.
3. Flaked Rice Oryza Seeds 1. Flaked rice (aval) is used as breakfast cereal or as snacks.
(Aval) sativa
4. Henna Powder Lawsonia Leaves 1. An orange dye “henna” obtained from leaves and young shoots
inermis is used to dye skin, hair and fingernails.
2. It is also used for colouring leather, tails of horses and hair.
5. Aloe Gel Aloe vera Leaves 1. Aloe gel is used as skin tonic.
2. Because of its cooling effect and moisturizing characteristics,
it is used in the preparation of creams, lotions, shampoos,
shaving creams and allied products.
3. It is used in gerontological applications for rejuvenation of
ageing skin.
241

www.tntextbooks.in
Biology: Botany - Class XII

List of Authors and Reviewers
Reviewers Authors
Dr. K. V. Krishnamurthy, P. Saravanakumaran, PG Assistant in Botany,
Professor and Head (Retd.) GHSS, Koduvalarpatti, Theni.
Bharathidasan University, Trichy
P. Anandhimala, PG Assistant in Botany,
Dr. S. Palaniappan, GGHSSS, Pochampalli, Krishnagiri.
Principal (Retd.),
Govt. Arts College for Men (A), Nandanam, Chennai M.V. Vasudevan, PG Assistant in Botany,
Adhiyaman GBHSS, Dharmapuri
J. Mani, PG Assistant in Botany,
Domain Experts GHSS, R. Gobinathampatti, Dharmapuri.
Dr. M.N. Abubacker, Associate Professor & Head, G. Muthu, PG Assistant in Botany,
PG and Research Department of Biotechnology, GHSS (ADW), Achampatti, Madurai.
National College (A), Tiruchy
G. Sathiyamoorthy, PG Assistant in Botany,
Dr. S.S. Rathinakumar, Principal (Retd.), GHSS, Jayapuram, Tirupattur, Vellore.
Sri Subramania Swamy Government Arts College , Thiruthani
T. Ramesh, PG Assistant in Botany,
Dr. D. Narashiman, Professor and Head (Retd.) GBHSS, Vettavalam, Thiruvannamalai
Plant Biology & Biotechnology, MCC College
Tambaram, Kancheepuram S. Malar Vizhi, PG Assistant in Botany,
GHSS, Chenbagaramanputhoor, Kanyakumari.
Dr. K.P. Girivasan, Associate Professor of Botany,
Govt. Arts & Science College, Nandanam, Chennai G. Bagyalakshmi, PG Assistant in Botany,
GGHSS, Jalagandapuram, Salem.
Dr. C.V. Chitti Babu, Associate Professor of Botany,
Presidency College, Chennai C. Kishore Kumar, PG Assistant in Botany,
GHSS, Thattaparai, Vellore.
Dr. Renu Edwin, Associate Professor of Botany,
Presidency College, Chennai Sathyawathi Sridhar, PG Assistant in Botany,
Sri Sankara Senior Secondary School, Adyar, Chennai.
M. Lakshmi, PG Assistant in Botany,
Academic Coordinators Sri Sankara Senior Secondary School, Adyar, Chennai.
K. Manjula, M. Chamundeswari, PG Assistant in Botany,
Lecturer in Botany, DIET, Triplicane, Chennai. Prince MHSS, Nanganallur, Kancheepuram.
J.Radhamani, D. Padma, PG Assistant in Botany,
Lecturer in Botany, DIET, Kaliyampoondi, Kancheepuram Prince MHSS, Madipakkam, Chennai.
(Author, Practicals)
V. Kokiladevi,
PGT Botany, GHSS, Sunnambukulan, Thiruvallur.
Content Readers
Art and Design Team

Dr. T.S. Subha, Associate Professor in Botany,
Bharathi Womens College, Chennai.
Dr. P.T. Devarajan, Associate Professor in Botany,
Illustration Presidency College, Chennai
A. Jeyaseelan, Art Teacher
GBHSS, Uthangarai, Krishnagiri. Dr. N. Pazhanisami, Associate Professor in Botany,
Govt. Arts College, Nandanam, Chennai
S. Gopu
Gopu Rasuvel Dr. G. Rajalakshmi, Associate Professor in Botany,
Santhana Krishnan Bharathi Womens College, Chennai.
Dr. R. Kavitha, Associate Professor in Botany,
Layout Bharathi Womens College, Chennai
Santhiyavu Stephen S
Balaji
Prasanth C OR Code Management Team
Pakkiri
R. Jaganathan, SGT,
PUMS - Ganesapuram, Polur, Thiruvannamalai.
In-House J.F. Paul Edwin Roy, B.T.Assistant,
QC - Arun Kamaraj Palanisamy PUMS -Rakkipatty, Salem.
- Rajesh Thangappan S. Albert Valavan Babu, B.T.Assistant
G.H.S, Perumal Kovil, Paramakudi, Ramanathapuram
Wrapper Design
Kathir Aarumugam
Co-ordination
Ramesh Munisamy
Typist
S. Chitra, SCERT, Chennai
This book has been printed on 80 G.S.M.
Elegant Maplitho paper.
Printed by offset at:
242

12th Bio Botany EM WWW - Tntextbooks.in

Uploaded by

Document Information

Original Title

Copyright

Available Formats

Share this document

Share or Embed Document

Sharing Options

Did you find this document useful?

Is this content inappropriate?

Copyright:

Available Formats

12th Bio Botany EM WWW - Tntextbooks.in

Uploaded by

Copyright:

Available Formats

www.tntextbooks.

GOVERNMENT OF TAMIL NADU

HIGHER SECONDARY SECOND YEAR

Untouchability is Inhuman and a Crime

Department of School Education

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 1 3/14/2020 12:34:30 PM

Government of Tamil Nadu

NOT FOR SALE

State Council of Educational

Printing & Publishing

Tamil NaduTextbook and Educational

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 2 3/14/2020 12:34:30 PM

UNIT VI: Reproduction in Plants

E-book Assessment DIGI links

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 3 3/14/2020 12:34:30 PM

Career corner List of professions related to the subject

Learning objectives are brief statements that describe what

Chapter Outline Illustrate the complete overview of chapter

Amazing facts, Rhetorical questions to lead students

Activity Directions are provided to students to conduct activities

Infographics Visual representation of the lesson to enrich learning .

To motivate the students to further explore the content

ICT To enhance digital Science skills among students

Conceptual diagram that depicts relationships between

Glossary Explanation of scientific terms

Tamil terminology for Botanical terms given for easy

References List of related books for further details of the topic

Web links List of digital resources

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 4 3/14/2020 12:34:30 PM

List of Medical Courses

2 B. D. S. (Bachelor of Dental Surgery) – 4

6 B.Sc Nursing – 4 years

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 5 3/14/2020 12:34:31 PM

Agricultural Courses Botany Career Opportunities and

TN_GOVT_BIOLOGY_BOTANY_XII_Page I-VIII Front.indd 6 3/14/2020 12:34:31 PM

UNIT VI: Reproduction in Plants

1 Asexual and Sexual

One of the essential features of all living things

Asexual and Sexual Reproduction in Plants 1

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 1 3/14/2020 10:29:58 AM

of living things and the different types of

2 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 2 3/14/2020 10:29:59 AM

(a) Reproduction by roots – Murraya

Bud from eye

Fleshy scale leaf (j) Sucker

i) Tunicated – Allium cepa

(k) Axillary bulbils

ii) Naked – Lilium

Figure 1.1 a-k: Natural methods of vegetative reproduction in plants.

Asexual and Sexual Reproduction in Plants 3

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 3 3/14/2020 10:30:01 AM

Disadvantage of natural vegetative ii. Approach grafting: In this method both

4 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 4 3/14/2020 10:30:01 AM

Asexual and Sexual Reproduction in Plants 5

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 5 3/14/2020 10:30:01 AM

6 Asexual and Sexual Reproduction in Plants

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 6 3/14/2020 10:30:01 AM

Figure 1.4 Stages in the Figure

Asexual and Sexual Reproduction in Plants 7

TN_GOVT_BIOLOGY-BOTANY_XII_PAGES_001-032 CH 01.indd 7 3/14/2020 10:30:02 AM

saprophytes, cleistogamous flowers and extreme • The pollenkitt material is contributed by

1.4.2 Female reproductive part - Chalazal end

Evaluation 6. First cell of male gametophyte in